renin-angiotensin-aldosterone...

Renin-Angiotensin-Aldosterone System

TASK-3 Channel Deletion in Mice Recapitulates Low-ReninEssential Hypertension

Nick A. Guagliardo, Junlan Yao, Changlong Hu, Elaine M. Schertz, David A. Tyson, Robert M. Carey,Douglas A. Bayliss, Paula Q. Barrett

Abstract—Idiopathic primary hyperaldosteronism (IHA) and low-renin essential hypertension (LREH) are common formsof hypertension, characterized by an elevated aldosterone-renin ratio and hypersensitivity to angiotensin II. They aresuggested to be 2 states within a disease spectrum that progresses from LREH to IHA as the control of aldosteroneproduction by the renin-angiotensin system is weakened. The mechanism(s) that drives this progression remainsunknown. Deletion of Twik-related acid-sensitive K channels (TASK) subunits, TASK-1 and TASK-3, in mice(T1T3KO) produces a model of human IHA. Here, we determine the effect of deleting only TASK-3 (T3KO) on thecontrol of aldosterone production and blood pressure. We find that T3KO mice recapitulate key characteristics of humanLREH, salt-sensitive hypertension, mild overproduction of aldosterone, decreased plasma-renin concentration withelevated aldosterone:renin ratio, hypersensitivity to endogenous and exogenous angiotensin II, and failure to suppressaldosterone production with dietary sodium loading. The relative differences in levels of aldosterone output andaldosterone:renin ratio and in autonomy of aldosterone production between T1T3KO and T3KO mice are reminiscentof differences in human hypertensive patients with LREH and IHA. Our studies establish a model of LREH andsuggest that loss of TASK channel activity may be one mechanism that advances the syndrome of low reninhypertension. (Hypertension. 2012;59:999-1005.) Online Data Supplement

Key Words: TASK channels aldosterone hyperaldosteronism low renin essential hypertension

Aldosterone plays an important role in the regulation ofblood pressure (BP). When overtly dysregulated it

causes primary aldosteronism (PA), a syndrome characterizedby hypertension, high plasma aldosterone concentration, de-creased plasma renin activity and varying degrees of hypo-kalemia, and metabolic alkalosis. In PA, aldosterone over-production is relatively independent of the renin-angiotensinsystem (RAS) and, thus, not suppressed by sodium loading.PA is the result of both known (aldosterone-producingadenomas and glucocorticoid-remediable hyperaldosteron-ism) and unknown causes (idiopathic hyperaldosteronism[IHA] with bilateral adrenal hyperplasia).1 A closely relatedform of hypertension, low renin essential hypertension(LREH), is a more subtle form of aldosterone dysregulationin which plasma aldosterone concentrations may be normal ornear normal but are inappropriately high for the level ofplasma renin. LREH accounts for a notable 25% to 30% ofpatients with essential hypertension.2,3 Using the aldosteron-e:renin ratio (ARR) as an indicator of the pathophysiology ofhypertension,4,5 it has been suggested that LREH and IHA

may not be separate disease processes but rather stages of adisease continuum that progresses from normotension toLREH to IHA as the control of aldosterone productionweakens and production becomes relatively autonomous.6–8

Indeed, among normotensive individuals, a high-normalplasma aldosterone concentration and ARR is predictive offuture progression to hypertension.9,10 The mechanisms thatdrive this progression remain ill-defined.8

Recent studies have highlighted the importance of K

channel activity in the control of aldosterone production.11

Sustained production of aldosterone from adrenal zona glo-merulosa (ZG) cells requires extracellular Ca2 entry viavoltage-gated Ca2 channels that are activated by membranedepolarization.12,13 By their hyperpolarizing activities, K

channels restrain the production of aldosterone. Indeed,mutations in the human KCNJ5 gene that reduce ion selec-tivity and impair the ability of the inwardly rectifying K

channel to maintain negative membrane voltages provide amolecular basis for the excessive overproduction of aldoste-rone in a subset of patients with tumorigenic PA.11 Mice have

Received December 12, 2011; first decision January 18, 2012; revision accepted March 14, 2012.From the Departments of Pharmacology (N.A.G., C.H., E.M.S., D.A.T., D.A.B., P.Q.B.), and Medicine (R.M.C.), University of Virginia, School of

Medicine, Charlottesville, VA; School of Life Sciences (C.H.), State Key Laboratory of Medical Neurobiology and Institutes of Brain Science, FudanUniversity, Shanghai, China.

N.A.G. and J.Y. contributed equally to this work.The online-only Data Supplement is available with this article at http://hyper.ahajournals.org/lookup/suppl/doi:10.1161/HYPERTENSIONAHA.

111.189662/-/DC1.Correspondence to Paula Q. Barrett, Department of Pharmacology, University of Virginia, School of Medicine, Charlottesville, VA 22908. E-mail

[email protected]© 2012 American Heart Association, Inc.

Hypertension is available at http://hyper.ahajournals.org DOI: 10.1161/HYPERTENSIONAHA.111.189662

999

by guest on June 1, 2018http://hyper.ahajournals.org/

Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from

http://hyper.ahajournals.org/lookup/suppl/doi:10.1161/HYPERTENSIONAHA.111.189662/-/DC1



http://hyper.ahajournals.org/












also supported the importance of K channel activity in thecontrol of aldosterone production.14–16 For example, deletionof 2 mouse genes that encode 2-pore domain Twik-relatedacid-sensitive K channels (TASK) channel subunits yieldshyperaldosteronism. Ablation of Kcnk3 (TASK-1) causes anadrenal zonation defect and a novel form of glucocorticoid-remediable hyperaldosteronism,16 whereas deletion of bothKcnK3 and Kcnk9 (TASK-3) produces a syndrome thatclosely resembles human IHA,15 hypertension, increasedurinary excretion of aldosterone, decreased levels of plasmarenin, exaggerated ARR, and failure to suppress aldosteroneproduction with Na loading or to normalize production withangiotensin II (Ang II) type 1 receptor blockade. BothTASK-1 and TASK-3 subunits are prominently expressed inadrenal ZG cells.15,17 By forming homodimeric or heterodi-meric “leak” K channels,18 these subunits provide a back-ground hyperpolarizing conductance that contributes to set-ting the negative membrane potential of ZG cells.12,17,19 ZGcells lacking both TASK-1 and TASK-3 are depolarized (by20 mV), which permits autonomous overproduction ofaldosterone characteristic of the IHA phenotype.15 Here, weshow that deletion of only TASK-3 recapitulates key featuresof the milder LREH syndrome,8,20–23 salt-sensitive hyperten-sion, mild overproduction of aldosterone, decreased levels ofplasma renin, greater sensitivity to Ang II, and maintainedresistance to Na suppression. We conclude that the progres-sive loss of TASK channel activity maybe a mechanism thatadvances the syndrome of low-renin hypertension.

MethodsMiceTASK knockout (KO) mice were generated as described previ-ously24 (please see the online-only Data Supplement). Male micewere used to remove the potential confounds of hormonal surgesassociated with the estrus cycle. All of the experiments were carriedout in accordance with the National Institutes of Health Guide for theCare and Use of Laboratory Animals and approved by the Universityof Virginia Animal Care and Use Committee.

Metabolic Cage Experiments

Salt DietsMetabolic cage experiments and blood analysis were conducted asdescribed previously15,25 using 1 of 4 experimental protocols (pleasesee Figure S1 and expanded Methods section in the online-only DataSupplement for details). Diets contained normal Na (NS; 0.3%Na, 0.8% K), low Na (LS; 0.05% Na, 0.8% K), high Na

(HS; 4.0% Na, 0.8% K), or high K (4.0% K, 0.3% Na).

Ang II DeliveryAfter NS urine collection (days 4–7), ALZET osmotic minipumps(Durect Corporation, Cupertino, CA) containing Ang II (0.040/0.4/0.800/1.200/ or 4.000 g of Ang II per kg/min) or 0.9% salinevehicle were implanted SC. Mice were allowed 1 day of surgicalrecovery before collection of 24-hour urine samples (days 10–13;please see the online-only Data Supplement).

Telemetric BPBP was recorded from conscious, freely behaving mice. Pressuretransmitters (Data Sciences International telemetry system; DSI, StPaul, MN) were threaded through the left carotid artery and im-planted in the aortic arch (please see the online-only Data Supple-ment). After 7 days of surgical recovery, BP and heart rate wererecorded (NS, days 8–11) before challenge with HS (days 12–18) or

with candesartan (10 mg/kg per day) delivered in the drinking water(days 12–15).

ZG Isolation, RT-PCR, and Western Blot AnalysisThe ZG layer was isolated from mouse adrenal glands using lasercapture microdissection (Leica Microsystems, Inc). RNA was iso-lated for quantitative RT-PCR analysis of TASK-1, Kcnj5, Ang IItype 1A receptor, Ang II type 1B receptor, and Cyp112 expression.For Western blot analysis of CYP112 protein, adrenal lysates froma single mouse (2 adrenals) were combined and equivalent totalprotein diluted with SDS sample buffer, resolved by 10% SDS-PAGE, and analyzed by immunoblot using anti-Cyp112 antibody(please see the online-only Data Supplement).

ElectrophysiologyThinly sectioned adrenal sections (80 m) were prepared from 35- to55-day–old mice, and ZG cells were identified by their location insubcapsular cell rosettes.15 Electrophysiological recordings wereobtained at room temperature using patch electrodes (3–5 ), anAxopatch 200B amplifier, and a pCLAMP 10.3 (Molecular De-vices). Baseline membrane voltages were recorded in current clampfrom ZG cells after 2 to 4 minutes of perfusion with standard externalsolution (please see the online-only Data Supplement).

Data AnalysisFor each experimental protocol, T1T3KO or T3KO mice were run inparallel with wild-type (WT) mice to control for potential environ-mental differences among cohorts. Individual animals were run ononly 1 experimental protocol, and data were collapsed by genotypeacross cohorts. Mean urine aldosterone/creatinine and plasma reninconcentration were log transformed because of unequal variancesand analyzed using a 2-way ANOVA. Plasma K and Cyp112were compared using a 2-way ANOVA. BP and heart rate wereanalyzed using a 1-way (NS) or repeated-measures 2-way ANOVA(before and after candesartan, HS). If the overall ANOVA reporteda statistical significance (P0.05), group means were comparedusing a Bonferroni post hoc test and significance determined ifP0.05. Dose-response curves for Ang II sensitivity were generatedand analyzed with Origin Pro software. An independent t testcompared TASK-1 and Kcnj5 mRNA expression and membranepotential, with significance at P0.05.

ResultsT3KO Mice Display Mild HyperaldosteronismIn previous work, we found that TASK-1/:TASK-3/

double KO mice on a mixed genetic background (SV129/C57BL/6) produced more aldosterone than age-matched con-trol littermates despite lower levels of plasma renin concen-tration (PRC).15 Here, we measured urinary aldosteroneexcretion (24-hour, normalized to creatinine) and PRC inTASK-1/:TASK-3/ mice on a congenic C57BL/6 back-ground (T1T3KO) to determine whether the reported pheno-typic difference between genotypes was attributable to dele-tion of the TASK genetic loci. Consistent with our previousobservations, T1T3KO mice on an NS-diet displayed overthyperaldosteronism, producing 4-fold more aldosteronethan C57BL/6 WT mice (P0.001) despite plasma reninlevels that were only 20% of that of WT mice (P0.001;Figure 1A, left). This dysregulation resulted in an ARR thatwas 30-fold greater than WT, consistent with the previ-ously characterized mouse IHA phenotype (Figure 1B,left). Thus, the PA phenotype is associated with thedeletion of TASK-1 and TASK-3 and is not dependent ona particular genetic background.

1000 Hypertension May 2012


Dow

nloaded from


The expression of both TASK-1 and TASK-3 subunits inZG cells allows the potential for homodimeric and heterodi-meric TASK channel conformations.18 To determine whetherTASK-3 deletion is sufficient to recapitulate the IHA pheno-type of double KO mice, we studied congenic T3KO mice inparallel. Urinary aldosterone excretion in T3KO mice waselevated modestly but significantly (37%; P0.017) abovethat of WT mice (Figure 1A, top right) and was accompaniedby reduced levels (P0.001) of plasma renin (Figure 1A,bottom right). These opposing changes in aldosterone outputand renin status in T3KO mice produced an elevated ARRthat was 2.6-fold greater than that of WT mice but was,nonetheless, an order of magnitude less than that of T1T3KOmice (Figure 1B, right). These comparative differences in thelevel of aldosterone output and ARR are reminiscent ofobservations in human hypertensive patients with LREH andIHA.5,8 To determine whether these mice were hypertensive,we placed pressure transmitters in the aortic arch to determineBP in conscious freely behaving mice by telemetry. We foundthat both T1T3KO and T3KO mice have significantly higher24-hour ambulatory systolic (SBP; P0.001) and diastolic(DBP; P0.01) BPs than WT mice (Figure 1C). Thus, weconclude that both T1T3KO and T3KO mice are hyperten-sive, the former because of IHA and the latter because oflow-renin primary hypertension.

T3KO Mice Display Hyperaldosteronism That IsResistant to Salt SuppressionAng II and extracellular K are the 2 major regulators ofaldosterone production in vivo.15,22,26,27 Consistent with thestimulation of the RAS, limiting dietary Na (LS) increasedurinary aldosterone excretion above that produced on an NSdiet in both WT and T3KO mice (P0.011). Nevertheless,urinary aldosterone excretion in T3KO mice remained 1.6-fold that of WT (Figure 2A). T3KO mice also displayed an

augmented response to dietary K feeding (high K) that was1.7-fold that of WT. However, the dysregulation of aldosteroneproduction in T3KO mice was most striking in mice fed an HSdiet, when the activity of RAS is decreased. Unlike WT mice,T3KO mice failed to suppress aldosterone output with HS butmaintained excretion at NS feeding levels. This resistance to HSinhibition was shared by T1T3KO mice (data not shown). Thus,HS challenge revealed a component of aldosterone output inT3KO mice that is independent of the RAS.

T3KO mice maintained a low renin status on all of the Na

diets compared with WT mice (P0.002; Figure 2B). How-ever, high K feeding reduced renin concentration levels ofWT mice to that of T3KO mice, implying a direct role forTASK-3 in the regulation of renin secretion. Nevertheless,treatment with candesartan, an insurmountable Ang II type 1receptor blocker that removes Ang II type 1 receptor–activated feedback inhibition of renin secretion, restoredplasma levels of renin in T3KO mice to values that wereindistinguishable from those of WT mice (P0.63; Figure 2Binset). Thus, we conclude that the low renin status of T3KOmice on all Na diets is not likely the result of reduced reninstores or impaired vesicular secretion but rather an enhancedsensitivity of JG cells to Ang II inhibition, a consequence ofTASK-3 subunit deletion.

Conventional Determinants of AutonomousAldosterone Production Are Not Changed inT3KO MiceThe deletion of both TASK-1 and TASK-3 results in a20-mV membrane depolarization of ZG cells and providesa cellular explanation for the overt autonomous overproduc-tion of aldosterone in the T1T3KO mouse strain.15 By usingcurrent clamp recordings, we found that baseline membranepotential in ZG cells from T3K0 mice was not different fromWT mice (P0.868), remaining at the hyperpolarized level

50

40

30

20

10

0

UA

ldo/

Cre

at(n

g/m

g)

12

10

8

6

4

2

0

PRC

(mgA

l/ml/h

r)

160

140

120

100

80

60

2

1

0

2

1

0

BP

(mm

Hg)

160

140

120

100

80

60

WT T1T3KO WT T3KO

WT T1T3KO WT T3KO

* *

**

* *

*

**

*

10 100 1000 10 100 1000

T1T3KO

WT

T3KO

WT

WTT1T3KO

WTT3KO

Systolic Diastolic Systolic Diastolic

Log Ratio (UAldo/Renin)

Blood Pressure

A B

C

Figure 1. Effect of Twik-related acid-sensitive K channels (TASK) 3 deletion on urinary aldosterone, plasma renin concentration (PRC),and blood pressure in congenic mice. A, top, 24-hour urinary aldosterone excretion normalized to creatinine (ng/mg, UAldo/creatinine)in T1T3KO (, left; n12), T3KO (, right; n31) and wild-type (WT) mice (, n38) on normal Na (NS) diet (0.32% Na, 0.8% K; 7days on diet). A, bottom, PRC (mg of angiotensin [Ang] I per mL/h) of same WT and knockout (KO) mice. B, Ratio of UAldo to PRCcalculated per mouse and averaged per genotype. C, 24-hour systolic blood pressures (SBPs) and diastolic blood pressures (DBPs) ofconscious mice, T1T3KO (n5), T3KO (n11), and WT (n11) using radiotelemetry. Values represent meanSEM; *vs WT mice (P0.05).

Guagliardo et al TASK-3 Deletion and Low Renin Hypertension 1001


Dow

nloaded from


characteristic of these cells (Figure 3A). Moreover, T3KOmice displayed a mild but significant hypokalemia (P0.001;Figure 3B) that would be predicted to further hyperpolarizethe ZG cell in vivo. Neither the mRNA expression ofTASK-1 subunits (P0.505; Figure 3C) nor that of the Kcnj5inwardly rectifying K channel (P0.240; Figure 3D) wasupregulated to compensate for the loss of the TASK-3expression. Therefore, we conclude that a difference inbaseline ZG membrane potential cannot account for the mildoverproduction of aldosterone observed in T3KO mice.

Aldosterone synthase (Cyp112) expression is restricted tothe ZG of the adrenal gland28 and is the terminal cytochromeP450 enzyme catalyzing the 3-step conversion of 11-deoxycorticosterone to aldosterone. The mRNA for Cyp112is present at low levels in normal adrenals and is increased inaldosterone-secreting tumors.29 We found that the level of thetranscript for Cyp112 was increased in T3KO mice fed anNS or HS diet (P0.04; Figure 3E). However, this increase intranscript level was not accompanied by an increase inCyp112 protein expression (Figure 3F); a similar dissocia-tion of protein and mRNA levels was observed in micegenetically engineered to produce a more stable Cyp112transcript.30 Thus, we conclude that previously identifiedcauses for autonomous overproduction of aldosterone in

humans and in mice, membrane depolarization and enhancedsteroidogenic capacity, do not underlie the hyperaldosteron-ism of T3KO mice.

Altered Adrenal Responsiveness to Ang II andAutonomous Production in T3KO MiceIncreased responsiveness to Ang II is well documented inLREH.21–23 We used osmotic minipumps to deliver Ang II(0.04–4.0.0 g/kg per minute) interstitially and measuredurinary aldosterone excretion in mice maintained on an NSdiet. We found that aldosterone output was dose-dependentlyincreased by Ang II in mice of both genotypes (Figure 4A)and was consistently greater in T3KO than in WT mice (atbaseline: WT mean, 8.3 ng of aldosterone per milligram ofcreatinine; T3KO mean, 10.5 ng of aldosterone per milligramof creatinine); therefore, we calculated the fold increase frombaseline for each animal. As shown in Figure 4A, the EC50

for stimulation by Ang II in T3KO mice was left shifted fromthat of WT mice (WT, 2122235 ng/kg per minute; T3KO,982112 ng/kg per minute; n4–7 animals per dose;P0.038). Thus, T3KO mice displayed a hypersensitivity toAng II. To isolate the Ang II–sensitive component of aldo-sterone output and to corroborate and extend these findingsacross the diets, we measured urinary aldosterone excretionbefore and after candesartan was delivered in the drinkingwater (10 mg/kg per day). As expected during dietary Na

restriction, stimulation of the RAS markedly increased theAng II–evoked component of aldosterone output in mice ofboth genotypes (P0.001; Figure 4B, left), but, in T3KOmice, this component was nearly twice that seen in WT mice(P0.001). In fact, there was a significant effect of genotypeacross diets; aldosterone production in T3KO mice wasapproximately double that of WT mice (P0.001). Thus, weconclude that, as in humans with LREH,21,23 T3KO mice areuncommonly sensitive to the aldosterone-stimulating actionof exogenous or endogenous Ang II.

Lack of aldosterone suppression after salt loading is usedas a screening test for PA and is a hallmark of autonomousaldosterone production that is independent of the RAS.3 Arelative resistance to salt suppression has also been noted insome patients with LREH20,21 underscoring a possible con-tinuum between the 2 disease states.7,8 We used aldosteroneoutput in the presence of candesartan, as a measure of an AngII–independent component of aldosterone production. Wefound that candesartan normalized urinary aldosterone excre-tion between T3KO and WT mice on LS and NS diets,whereas there was an Ang II–independent component ofaldosterone output on HS (P0.001; Figure 4B, right). Theseresults differ from those seen with T1T3KO mice in which,relative to WT mice, an enhanced Ang II–independentcomponent of aldosterone output was evident on all of the saltdiets.15 Thus, we observe that T1T3KO and T3KO micediffer in the degree to which the RAS axis is imbalanced andaldosterone output is autonomous.

Ang II–Dependent and Salt-Sensitive Hypertensionin T3KO MiceRelative aldosterone excess, as indicated by an elevatedARR, is the strongest predictor of DBP and the second-most

70

60

50

40

30

20

10

0

UA

ldo/

Cre

at (n

g/m

g)

HK LS NS HS

*

+Candesartan

Salt Diet

*

* *

* *

** *

HK LS NS HS

PRC

(mgA

l/ml/h

r)

3

2

1

0

15

10

5

0NS HS

LS NS HS

10

5

0

A

B WTT3KO

Figure 2. Effect of diet on urinary aldosterone (UAldo) and plasmarenin concentration (PRC). A, 24-hour UAldo/creatinine (ng/mg) ofwild-type WT (Œ) and T3KO mice () on each of 4 salt diets: highK (HK; n11 per group), low Na (LS; n20–25), normal Na

(NS; n31–38), high Na (HS; n25–32). A, inset, Expanded scaleto show increase in UAldo/creatinine in T3KO vs WT mice on NSor high Na (HS) diet. B, PRC (mg of angiotensin [Ang] I per mL/h)of WT and T3KO mice on salt diets. B, inset, PRC after candesar-tan treatment (10 mg/kg per day) on LS, NS, or HS for WT andT3KO mice (LS, n20–25; NS, n11; HS, n11). Values representmeanSEM; *vs WT mice (P0.05).



Dow

nloaded from


important predictor of SBP.5 We used candesartan to normal-ized both aldosterone output and plasma renin concentrationbetween genotypes on an NS diet to determine whether thehypertension of T3KO mice could be corrected. In T3KOmice maintained on an NS diet, 24-hour ambulatory DBP andSBP were elevated, 13 mm Hg (P0.01) and 17 mm Hg(P0.001), respectively. Candesartan decreased DBP andSBP in mice of both genotypes but normalized only DBP(Figure 5A). By contrast, SBP of T3KO mice, althoughcorrected to normotensive values, remained elevated 17 mmHg above that of WT mice (P0.001) indicating that, inT3KO mice, factors other than the RAS control SBP.

Salt-sensitive hypertension is a frequent observation inLREH and a hallmark of volume-dependent hypertension.2

We found that normotensive WT mice were able to adjust toa salt load maintaining normal DBP and SBP during HSchallenge (Figure 5B). In T3KO mice, DBP also remainedstable during Na loading, whereas SBP rose by 9 mm Hg(P0.001). This suggests that autonomy of aldosteroneproduction imparts salt sensitivity that weakens the control ofSBP while DBP remains under RAS control.

DiscussionOur studies show that the genetic deletion of TASK-3subunits produces a phenotype that duplicates key features ofhuman LREH. First, as in LREH, levels of aldosterone outputin T3KO mice are mildly elevated but inappropriate for thelow levels of plasma renin, resulting in an ARR that is greaterthan twice that of normotensive WT mice.2,3 Second, on LSand NS, aldosterone production remains under the control ofRAS with a demonstrated hypersensitivity to both endoge-

nous and exogenous Ang II. An enhanced responsiveness tothe steroidogenic actions of Ang II is a well-describedcharacteristic of LREH.20–22 Third, on HS, RAS control isweakened, revealing a component of aldosterone output thatis relatively autonomous, consistent with the relative resis-tance to salt suppression observed in some patients withLREH.20 Finally, SBP is salt sensitive in T3KO mice,mimicking yet another established feature of LREH.2

Our mouse model of LREH displays enhanced responsive-ness to the actions of Ang II. Candesartan normalizedaldosterone production (LS and NS), restored suppressedlevels of plasma renin (LS, NS, and HS), and corrected theelevation in DBP (NS and HS) between genotypes. Thissubtle but uniform abnormality in the RAS was unexpected.The adrenal hypersensitivity to Ang II is likely not the resultof an increase in Ang II type 1 receptor expression, becausemessage levels for Ang II type 1A receptor and Ang II type1B receptor in ZG microdissected from T3KO mice and WTadrenals were equivalent (Figure S2), conclusions that aresupported by observations in the Lyon hypertensive rat whereneither changes in the affinity nor regulation of Ang IIreceptor subtypes in the ZG accounted for enhanced adrenalsensitivity to Ang II.31 The adrenal hypersensitivity to Ang IIis also not likely the result of an increase in sympatheticnervous system activity (eg, driving adrenal hyperplasiaand/or potentiating aldosterone release), because heart ratesin T3KO mice were reduced significantly from those of WTmice (Figure S3). In addition, we found no evidence of ZGhyperplasia. Our data also show that neither an increase in thesynthetic capacity of the ZG cell to produce aldosterone, as

5.5

5.0

4.5

4.0

3.5

3.0HK LS NS HS

Salt Diet

*

Plas

ma

[K] (

mm

ol/L

)

WTT3KO

NS HS

Cyp

11β2

mR

NA

per A

ctin

0.25

0.20

0.15

0.10

0.05

0.00

Salt Diet

WTT3KO

-100 -80 -60 -40 -20 0Baseline Vm (mV)

T3KO

WT

T3KO

WT

T3KO

WT

T3KO

WT

TASK-1 mRNA per Actin

TASK-3 mRNA per Actin

Kcnj5 mRNA per Actin

0.0 0.5 1.0 1.5

0.0 0.05 0.10 0.15 0.20

0.0 0.02 0.04 0.06 0.08

NS

HS

LS

WT T3KO

WT T3KO

WT T3KO

1 2 3 1 2 3

1 2 3 4 5 1 2 3 4 5

1 2 3 4 1 2 3 4

Cyp11β2

A

B

C

D

E F*

*

Figure 3. Membrane potential, K chan-nels and Cyp112 expression in theadrenal zona glomerulosa cells (ZGs).T3KO hyperaldosteronism is notexplained by differences in ZG baselineVm, plasma K, or Twik-related acid-sensitive K channels (TASK) 1 expres-sion. A, Baseline membrane potential(Vm) (mV) of ZG cells in adrenal sectionsfrom wild-type (WT; , n16) and T3KOmice (, n17) determined in currentclamp. B, Plasma K (mmol/L) in WT (Œ)and T3KO mice () on salt diets (highK [HK], n11, normal Na [NS], lowNa [LS], high Na [HS], n21–26).*Indicates main effect of genotype(P0.001). C and D, Expression ofmRNA (C, TASK-1 and TASK-3) and (D)Kcnj5 in ZG layer isolated by lasermicrodissection, from WT (n6) andT3KO (n6) adrenal slices, measured byRT-PCR and expressed as fold-initialmRNA (2dCt) relative to actin mRNA. E,mRNA expression of Cyp112 in ZGlayer, NS (n6, *P0.001) or HS (n4,*P0.038). F, Western blot analysis oflysates (20 g of total protein) preparedfrom mouse adrenals (2 adrenals perlane): NS (n3), HS (n5), LS (n4),detected with aldosterone synthase(Cyp112) antibody. Values representmeanSEM, *vs WT mice (P0.05).



Dow

nloaded from


measured by protein levels of Cyp112, nor a significantreduction in baseline membrane potential can explain en-hanced responsiveness to Ang II. In this respect, our datasuggest that either TASK-3 channels are not important insetting the baseline membrane potential of ZG cells (indisagreement with previous observations17) or that compen-satory expression of other unidentified conductance(s) main-tains membrane potential in TASK-3–deficient ZG cells.

At present, the precise cellular mechanism that underliesenhanced responsiveness to Ang II remains unanswered.Nevertheless, our mouse models of LREH and IHA suggestan evolution of aldosterone dysregulation, from normal toexaggerated to autonomous, that depends on the absence of

TASK-3 (LREH) or both TASK-1 and TASK-3 (IHA). In thisrespect, it is noteworthy that extracellular K acts bothalone26 and in concert with Ang II27 to regulate aldosteroneproduction. K elevation depolarizes ZG cells, permitting theopening of voltage-dependent Ca2 channels and the conse-quent increase in extracellular Ca2 entry, a step that iscritical for sustaining steroidogenesis.32,33 Thus, one couldposit that, in LREH, a small change in K conductance thatdoes not appreciably affect baseline membrane potential may,nevertheless, render the ZG cell more susceptible to depolar-izing influences (eg, by Ang II) and, thus, exaggerate re-sponses to submaximal concentrations of aldosterone secre-tagogues. On the other hand, a larger change in K

conductance, as demonstrated in our mouse model of IHA,depolarizes the ZG cell and, thus, imparts autonomy to theproduction of aldosterone. We propose, therefore, that thesemouse models of LREH and IHA stand as proof of principlethat progressive loss of K channel activity can be a mechanismto advance the syndrome of low-renin hypertension.

PerspectivesIHA and LREH present with a high frequency in hyperten-sion, promoting the development of cardiovascular and renaldisease. Here, we demonstrate that disruption of the TASK-3or TASK-3/TASK-1 genes results in phenotypic characteris-tics of LREH and IHA in C57BL/6 mice, low-renin hyper-tension with high ARR, hypersensitivity to Ang II, andautonomous aldosterone production. These mouse modelsprovide the opportunity to identify the cellular basis for thesephenotypic characteristics and suggest that variants in humanTASK channel genes may contribute to the development ofLREH and IHA. The development of pharmacological agents

16

12

8

4

0

LS NS HS

Die

t - (D

iet+

C)

Ual

do/C

reat

(ng/

mg)

WTT3KO

Fold

∆ A

ldos

tero

ne

Log(AngII Infusion) (mg/kg/min)1.5 2.0 2.5 3.0 3.5 4.0

A

B

*

LS NS HS

Ual

do/C

reat

(ng/

mg)

30

20

10

0

30

20

10

0

Salt Diet+ candesartan

Ang II-dependent Ang II-dependent8

6

4

2

8

6

4

2

NS HS NS HS+ cand

**

Figure 4. Changes in aldosterone production evoked by angio-tensin ll (Ang ll) and candesartan. A, Fold increase in 24-hoururinary aldosterone (UAldo)/creatinine in wild-type WT (Œ) andT3KO mice () induced by exogenous Ang II delivery (SCosmotic minipumps: 0 [saline vehicle], 0.04, 0.40, 0.80, 1.20, or4.00 g/kg per minute; n4–7 per dose). Changes in aldoste-rone production evoked by vehicle did not differ from thatevoked by 0.04 g of Ang II per kg/min (data not included in thegraph). *Significant difference in dose-response curves betweengenotypes (P0.038); EC50 in T3KO mice was half that of WTmice. B, Comparison of Ang II–dependent (left) and indepen-dent (right) aldosterone production in WT and T3KO mice onNa diets (see Figure 2 for numbers). B, top left, the Ang II–de-pendent response defined as difference between the UAldo/cre-atinine before and during candesartan (C) administration (10mg/kg per day). *Main effect of genotype (P0.002). B, topright, UAldo/creatinine with candesartan defined as Ang II–inde-pendent aldosterone production. B, top insets, expanded scaleto highlight differences between genotypes. Values representmeanSEM, *vs WT mice (P0.05).

NS NS+C

WTT3KO

∆ B

P (m

mH

g)(H

S-N

S)

A B*140

120

100

80

60

Salt Diet

*

BP

(mm

Hg)

SystolicDiastolic

10

5

0

-5DBP SBP

Blood Pressure

Figure 5. The effects of angiotensin II (Ang II) type 1 receptorblockade and high Na diet on ambulatory blood pressure. A,24-hour systolic blood pressure (SBP; solid lines) and diastolicblood pressure (DBP; dashed lines) of wild-type (WT; Œ) andT3KO () on normal Na (NS; n11) and NS with candesartanin drinking water (n5–6). Candesartan (10 mg/kg per day) nor-malized DBP between WT and T3KO mice, whereas SBPremained significantly elevated (*P0.001). B, Increase in24-hour SBPs and DBPs induced by high Na (HS; HSNS;n4–6 per condition). SBP and DBP in WT mice failed torespond to HS challenge (n6), whereas T3KO mice showedincrease in SBP (*P0.001; n4), but not DBP (P0.077; n4).Dashed line represents no change with Na loading. Values rep-resent meanSEM, *vs WT mice (P0.05).



Dow

nloaded from


that increase TASK channel activity may be of therapeuticbenefit in the treatment of these hypertensive disorders.

AcknowledgmentsWe are grateful to Dr Robert Chevalier and Bobbi Thornhill for sharingtheir expertise and the use of radiotelemetry blood pressure setup. Wealso thank Dr Gomez-Sanchez for the generous gift of his aldosteronesynthase antibody, and AstraZeneca for kindly supplying us withcandesartan cilexetil.

Sources of FundingThis work was supported by National Institutes of Health grants toP.Q.B. (HL-089717, HL-036977) and grants to D.A.B. (NS-33583).

DisclosuresNone.

References1. Funder JW, Carey RM, Fardella C, Gomez-Sanchez CE, Mantero F,

Stowasser M, Young WF Jr, Montori VM. Case detection, diagnosis, andtreatment of patients with primary aldosteronism: an Endocrine Societyclinical practice guideline. J Clin Endocrinol Metab. 2008;93:3266–3281.

2. Gordon RD, Laragh JH, Funder JW. Low renin hypertensive states:perspectives, unsolved problems, future research. Trends EndocrinolMetab. 2005;16:108–113.

3. Mulatero P, Verhovez A, Morello F, Veglio F. Diagnosis and treatment oflow-renin hypertension. Clin Endocrinol (Oxf). 2007;67:324–334.

4. Stowasser M, Gordon RD. The aldosterone-renin ratio and primary aldo-steronism. Mayo Clin Proc. 2002;77:202–203.

5. Tomaschitz A, Maerz W, Pilz S, Ritz E, Scharnagl H, Renner W, BoehmBO, Fahrleitner-Pammer A, Weihrauch G, Dobnig H. Aldosterone/reninratio determines peripheral and central blood pressure values over a broadrange. J Am Coll Cardiol. 2010;55:2171–2180.

6. Padfield PL, Brown JJ, Lever AF, Schalekamp MA, Beevers DG, DaviesDL, Robertson JI, Tree M. Is low-renin hypertension a stage in the devel-opment of essential hypertension or a diagnostic entity? Lancet. 1975;1:548–550.

7. Kater CE, Biglieri EG. The syndromes of low-renin hypertension: “sep-arating the wheat from the chaff.” Arq Bras Endocrinol Metabol. 2004;48:674–681.

8. Lim PO, Struthers AD, MacDonald TM. The neurohormonal naturalhistory of essential hypertension: towards primary or tertiary aldoste-ronism? J Hypertens. 2002;20:11–15.

9. Vasan RS, Evans JC, Larson MG, Wilson PW, Meigs JB, Rifai N,Benjamin EJ, Levy D. Serum aldosterone and the incidence of hyper-tension in nonhypertensive persons. N Engl J Med. 2004;351:33–41.

10. Meneton P, Galan P, Bertrais S, Heudes D, Hercberg S, Menard J. Highplasma aldosterone and low renin predict blood pressure increase andhypertension in middle-aged Caucasian populations. J Hum Hypertens.2008;22:550–558.

11. Choi M, Scholl UI, Yue P, Bjorklund P, Zhao B, Nelson-Williams C, JiW, Cho Y, Patel A, Men CJ, Lolis E, Wisgerhof MV, Geller DS, ManeS, Hellman P, Westin G, Akerstrom G, Wang W, Carling T, Lifton RP.K channel mutations in adrenal aldosterone-producing adenomas andhereditary hypertension. Science. 2011;331:768–772.

12. Lotshaw DP. Role of membrane depolarization and t-type ca2 channelsin angiotensin II and k stimulated aldosterone secretion. Mol CellEndocrinol. 2001;175:157–171.

13. Quinn SJ, Cornwall MC, Williams GH. Electrical properties of isolated ratadrenal glomerulosa and fasciculata cells. Endocrinology. 1987;120:903–914.

14. Arrighi I, Bloch-Faure M, Grahammer F, Bleich M, Warth R, Mengual R,Drici MD, Barhanin J, Meneton P. Altered potassium balance and aldo-sterone secretion in a mouse model of human congenital long qtsyndrome. Proc Natl Acad Sci U S A. 2001;98:8792–8797.

15. Davies LA, Hu C, Guagliardo NA, Sen N, Chen X, Talley EM, Carey RM,Bayliss DA, Barrett PQ. Task channel deletion in mice causes primaryhyperaldosteronism. Proc Natl Acad Sci USA. 2008;105:2203–2208.

16. Heitzmann D, Derand R, Jungbauer S, Bandulik S, Sterner C, Schweda F,El Wakil A, Lalli E, Guy N, Mengual R, Reichold M, Tegtmeier I,Bendahhou S, Gomez-Sanchez CE, Aller MI, Wisden W, Weber A,Lesage F, Warth R, Barhanin J. Invalidation of TASK1 potassiumchannels disrupts adrenal gland zonation and mineralocorticoid homeo-stasis. EMBO J. 2008;27:179–187.

17. Czirjak G, Enyedi P. TASK-3 dominates the background potassium con-ductance in rat adrenal glomerulosa cells. Mol Endocrinol. 2002;16:621–629.

18. Czirjak G, Enyedi P. Formation of functional heterodimers betweenthe TASK-1 and TASK-3 two-pore domain potassium channelsubunits. J Biol Chem. 2002;277:5426–5432.

19. Lotshaw DP. Effects of k channel blockers on k channels, membranepotential, and aldosterone secretion in rat adrenal zona glomerulosa cells.Endocrinology. 1997;138:4167–4175.

20. Collins RD, Weinberger MH, Dowdy AJ, Nokes GW, Gonzales CM,Luetscher JA. Abnormally sustained aldosterone secretion during saltloading in patients with various forms of benign hypertension; relation toplasma renin activity. J Clin Invest. 1970;49:1415–1426.

21. Marks AD, Marks DB, Kanefsky TM, Adlin VE, Channick BJ. Enhancedadrenal responsiveness to angiotensin II in patients with low reninessential hypertension. J Clin Endocrinol Metab. 1979;48:266–270.

22. Wisgerhof M, Brown RD. Increased adrenal sensitivity to angiotensin IIin low-renin essential hypertension. J Clin Invest. 1978;61:1456–1462.

23. Griffing GT, Wilson TE, Melby JC. Alterations in aldosterone secretionand metabolism in low renin hypertension. J Clin Endocrinol Metab.1990;71:1454–1460.

24. Lazarenko RM, Willcox SC, Shu S, Berg AP, Jevtovic-Todorovic V,Talley EM, Chen X, Bayliss DA. Motoneuronal task channels contributeto immobilizing effects of inhalational general anesthetics. J Neurosci.2010;30:7691–7704.

25. Guagliardo NA, Yao J, Bayliss DA, Barrett PQ. Task channels are notrequired to mount an aldosterone secretory response to metabolic acidosisin mice. Mol Cell Endocrinol. 2011;336:47–52.

26. Dluhy RG, Axelrod L, Underwood RH, Williams GH. Studies of thecontrol of plasma aldosterone concentration in normal man: II–effect ofdietary potassium and acute potassium infusion. J Clin Invest. 1972;51:1950–1957.

27. Pratt JH. Role of angiotensin II in potassium-mediated stimulation ofaldosterone secretion in the dog. J Clin Invest. 1982;70:667–672.

28. Wotus C, Levay-Young BK, Rogers LM, Gomez-Sanchez CE, EngelandWC. Development of adrenal zonation in fetal rats defined by expressionof aldosterone synthase and 11-hydroxylase. Endocrinology. 1998;139:4397–4403.

29. Boulkroun S, Samson-Couterie B, Dzib JF, Lefebvre H, Louiset E, AmarL, Plouin PF, Lalli E, Jeunemaitre X, Benecke A, Meatchi T, ZennaroMC. Adrenal cortex remodeling and functional zona glomerulosa hyper-plasia in primary aldosteronism. Hypertension. 2010;56:885–892.

30. Makhanova N, Hagaman J, Kim HS, Smithies O. Salt-sensitive bloodpressure in mice with increased expression of aldosterone synthase.Hypertension. 2008;51:134–140.

31. Aguilar F, Lo M, Claustrat B, Saez JM, Sassard J, Li JY. Hypersensitivityof the adrenal cortex to trophic and secretory effects of angiotensin II inLyon genetically-hypertensive rats. Hypertension. 2004;43:87–93.

32. Aguilera G, Catt KJ. Participation of voltage-dependent calcium channelsin the regulation of adrenal glomerulosa function by angiotensin II andpotassium. Endocrinology. 1986;118:112–118.

33. Barrett PQ, Bollag WB, Isales CM, McCarthy RT, Rasmussen H. Role ofcalcium in angiotensin II-mediated aldosterone secretion. Endocr Rev.1989;10:496–518.



Dow

nloaded from


Carey, Douglas A. Bayliss and Paula Q. BarrettNick A. Guagliardo, Junlan Yao, Changlong Hu, Elaine M. Schertz, David A. Tyson, Robert M.

TASK-3 Channel Deletion in Mice Recapitulates Low-Renin Essential Hypertension

Print ISSN: 0194-911X. Online ISSN: 1524-4563 Copyright © 2012 American Heart Association, Inc. All rights reserved.

is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Hypertension doi: 10.1161/HYPERTENSIONAHA.111.189662

2012;59:999-1005; originally published online April 9, 2012;Hypertension.

http://hyper.ahajournals.org/content/59/5/999World Wide Web at:

The online version of this article, along with updated information and services, is located on the

/content/59/6/e59.full.pdfAn erratum has been published regarding this article. Please see the attached page for:

http://hyper.ahajournals.org/content/suppl/2012/04/09/HYPERTENSIONAHA.111.189662.DC1Data Supplement (unedited) at:

http://hyper.ahajournals.org//subscriptions/

is online at: Hypertension Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer this process is available in the

click Request Permissions in the middle column of the Web page under Services. Further information aboutOffice. Once the online version of the published article for which permission is being requested is located,

can be obtained via RightsLink, a service of the Copyright Clearance Center, not the EditorialHypertensionin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:


Dow

nloaded from

http://hyper.ahajournals.org/content/59/5/999

http://hyper.ahajournals.org/content/suppl/2012/04/09/HYPERTENSIONAHA.111.189662.DC1

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://hyper.ahajournals.org//subscriptions/


Correction

In the Hypertension article by Guagliardo et al (Guagliardo NA, Yao J, Hu C, Schertz EM, TysonDA, Carey RM, Bayliss DA, Barrett PQ. TASK-3 Channel Deletion in Mice RecapitulatesLow-Renin Essential Hypertension. Hypertension. 2012;59:999–1005), corrections have beenmade.

In Figure 4, two corrections have been made. In the top panel (A), the x-axis label has beencorrected to read ng/kg/min” instead of “mg/kg/min.” In the bottom panel (B), for the graph onthe right, the title has been corrected to read “Ang II-independent” instead of “Ang II-dependent.”

The authors regret these errors.

These corrections have been made to the current online version of the article, which is availableat http://hyper.ahajournals.org/content/59/5/999.full.

(Hypertension. 2012;59:e59.)© 2012 American Heart Association, Inc.

Hypertension is available at http://hyper.ahajournals.org DOI: 10.1161/HYP.0b013e31825b884a

16

12

8

4

0

LS NS HS

Die

t - (D

iet+

C)

Ual

do/C

reat

(ng/

mg)

WTT3KO

Fold

∆ A

ldos

tero

ne

Log(AngII Infusion) (ng/kg/min)1.5 2.0 2.5 3.0 3.5 4.0

A

B

*

LS NS HS

Ual

do/C

reat

(ng/

mg)

30

20

10

0

30

20

10

0

Salt Diet+ candesartan

Ang II-dependent Ang II-independent8

6

4

2

8

6

4

2

NS HS NS HS+ cand

**

e59

ONLINE SUPPLEMENT

TASK-3 CHANNEL DELETION IN MICE RECAPITUATES LOW RENIN

ESSENTIAL HYPERTENSION

Nick A Guagliardo, PhD1; Junlan Yao, PhD1; Changlong Hu, MD; Elaine M

Schertz; David A Tyson; Robert M Carey, MD; Douglas A Bayliss,PhD; Paula Q

Barrett, PhD.

Department of Pharmacology (N.A.G., C.H., E.M.S., D.A.T., D.A.B., P.Q.B), and

Medicine (R.M.C.) University of Virginia, School of Medicine, Charlottesville, VA

22908, and School of Life Sciences, State Key Laboratory of Medical

Neurobiology and Institutes of Brain Science (C.H.), Fudan University, Shanghai,

China.

1 These authors contributed equally to this work

Corresponding author:

Paula Q. Barrett, Department of Pharmacology, University of Virginia School of

Medicine, 1640 Jefferson Park Ave, Charlottesville VA, 22908.

Tel. 434-924-5454

Fax. 434-982-3878

Email: [email protected]

Expanded Methods

Mice Mice were housed in a temperature and humidity controlled vivarium on a 12:12 light:dark cycle with free access to diet and drinking water. All diets used throughout these experiments were developed by and purchased from Harlan Teklad Laboratories (Madison, WI). To generate T3KO mice, separate mouse lines with “floxed” TASK-1 and TASK-3 alleles were backcrossed to a C57Bl/6J background using “speed congenics” and bred with Cre-deleter mice (also on a C57Bl/6J) to generate TASK-1 KO and TASK-3 KO mice on a congenic background. These 2 mice strains were then crossed to generate TASK-1/3 double KO mice. Metabolic Cage Experiments Mice used in metabolic cages studies were male and between 60 and 100 days old at the start of the experiment. Each mouse participated in only one experimental protocol. A schematic of the experimental protocols used and number of WT and T3KO mice per experimental protocol is presented in Figure S1. T1T3KO mice (n=12) were studied using protocol 1. Salt diets Mice were habituated to metabolic cages prior to experiments, then placed on one of 4 experimental protocols (Figure S1). For the initial studies of aldosterone production (Protocol 1), mice received normal sodium (NS, 0.3% Na+), low sodium (LS, 0.05% Na+) and high sodium (HS, 4.0% Na+) diets for one week, with a week of recovery (NS) between dietary testing. In addition, after LS, mice were given LS + candesartan (Astra Zeneca, 10 mg/kg/day, in drinking water) for 4 days. Fluid consumption was monitored previous to candesartan delivery to ensure accurate dosing. To further compare the effect of candesartan on aldosterone production between genotypes, mice were tested on one of 2 additional protocols; Protocol 2: one week of NS followed by NS + candesartan, or Protocol 3: HS followed by HS + candesartan. Mice studied under Protocol 4 received high potassium, normal sodium diet (HK, 4%K+, 0.3%Na+) for 7 days. The mean aldosterone/creatinine of the last 4 days on each diet and the last 3 days of diet + candesartan treatment was calculated for each mouse and used to generate group means. Angiotensin II Delivery (Protocol 5) To obtain the correct dose, mice were weighed on the day before surgery to calculate the concentration of Ang II per osmotic minipump for each mouse. Pumps were filled and placed in 37 ºC isotonic saline overnight to promote prompt delivery after implantation. On the day of surgery, mice were anesthetized with ketamine/dexmedetomidine (50-70 mg/kg/0.25-0.5 mg/kg IP, reversal agent antipamezole, 1mg/kg IP) and osmotic minipumps were implanted

subcutaneously. Mice were allowed one day of recovery in a home cage before returning to metabolic cages. Urine Analysis 24-hr. urine samples from mice housed in metabolic cages were analyzed for aldosterone and creatinine. Urinary aldosterone concentration was determined using an aldosterone I125 radioimmunoassay (RIA, Diagnostic Products Corporation, Los Angeles, CA). Samples were standardized to urinary creatinine concentration as measured by Jaffe’ colorimetric detection with a Creatinine Assay Kit (Cayman Chemical Company, Ann Arbor, MI). Blood Analysis For blood sample collection, mice were transported to the laboratory from the vivarium in the morning and allowed to habituate to the laboratory setting for ~5 hours before blood was sampled. Tail vein sampling was performed using a 50 um, non-heparin capillary tube containing 1uL of 0.125M EDTA; blood was separated by centrifugation and stored at -20 ºC until analysis for plasma renin. Plasma renin concentration was measured using an RIA (Diasorin, Stillwater, MN). In addition, after each diet, mice were anesthetized with ketamine/dexmedetomidine (50-70 mg/kg/0.25-0.5 mg/kg IP, reversal agent antipamezole, 1mg/kg IP) and blood was sampled from the retro-orbital sinus using heparinized capillary tubes for analysis with an iStat hand held analyzer (EC8+ cartridge, Heska, Fort Collins, CO). Blood Pressure Blood pressure was monitored in conscious, freely moving mice using a radio-telemetry device consisting of a pressure-sensing catheter and telemetric transmitter (implant TA11PA-C10, Data Science International, St. Paul, MN). Mice were anesthetized with a combination of ketamine (50-70 mg/kg) and dexmedetomidine (0.25-0.5 mg/kg IP) and kept on a water-circulating heating pad. The left carotid artery was exposed with blunt dissection and occluded just caudal to the carotid bifurcation. The pressure-sensing catheter was inserted into the carotid and advanced until the tip was just inside the aortic arch. The catheter was ligated in place with silk suture and the arterial entry site was closed with tissue glue. Through the same incision site a subcutaneous pocket was formed on the right flank of the mouse and the transmitter/battery was placed within the pocket. The skin was closed with polypropylene sutures and the mouse was revived with the reversal agent antipamezole (1 mg/kg, i.p ). After surgery, mice were given the analgesic ketoprofen for two days (sc, 4mg/kg bw per day). Mice were individually housed in home cages positioned on the radio-telemetric receivers and given 7 days to recover before data collection. Twenty second pressure wave forms were collected and stored every 10 minutes using Dataquest A.R.T software (Data Sciences International, St. Paul, MN) and mean arterial pressure derived. Baseline data was collected for 4 days after recovery, followed by 4 days of candesartan (10mg/kg/day, in drinking water) or the last 4 days of HS diet. Mice whose transmitters failed were excluded from analysis.

Electrophysiology Adrenal slices were prepared from adrenal glands freshly harvested from anesthetized mice (ketamine, 15mg, i.p.) and kept in ice-cold low-Ca2

bicarbonate buffered saline (BBS; mM: 10 glucose, 140 NaCl, 2 KCl, 5 MgCl2, 0.1 CaCl2, 26 NaHCO3 bubbled with 95% O2/5% CO2). The surrounding fat tissue from each adrenal was carefully removed under a dissecting microscope, embedded in low melting temperature agar (2.5% in BBS), and sectioned (80µm) using a DSK supermicroslicer (Ted Pella, Inc). The slices were incubated at 35 ºC in BBS for 30 minutes, then kept at room temperature for the remainder of the experiment. Adrenal slices were submerged in a recording chamber, secured with a slice anchor, and visualized using an Examiner A1 microscope (Zeiss) with 40x objective. Cells located near the surface of the slice just beneath the capsule were targeted for recording, based on anatomic location and characteristic shape. Electrophysiology recordings were obtained at room temperature using patch electrodes (2-5 MΩ) and an Axopatch 200B amplifier (Molecular Devices, Inc). Data acquisition was performed using pCLAMP 10.3 (Molecular Devices). Slices were perfused with an external solution that contained (mM): 140 NaCl, 3 KCl, 10 HEPES, 2 MgCl2 2 CaCl2, 10 glucose, pH 7.3. The pipette (intracellular) solution contained (mM): 135 KMeSO3, 4 NaCl, 10 HEPES, 1 MgCl2, 0.5 EGTA, 3 Mg-ATP, 0.3 Tris-GTP, pH 7.2. Voltage traces were acquired at 2.5 kHz filtered at 1 kHz with Axopatch 200B integrated low pass Bessel filter. Baseline membrane voltages were recorded from ZG cells for 2-4 minutes after stabilization of the recording. ZG isolation and RT-PCR Adrenal glands were dissected from terminally anesthetized mice (ketamine, 15mg, i.p.), flash-frozen, sectioned on a cryostat at 8 µm, and mounted onto specialized microscope slides containing a polyethylene napthalate window. A laser capture system (AS/LMD, Leica Microsystems, Inc.) was used to visualize and carefully sample ZG tissue for subsequent qRT-PCR analysis. RNA was isolated with the PicoPure RNA isolation kit (Arcturus) and cDNA was generated with iScript reverse transcription kit (Biorad) and qRT-PCR performed in quadruplicate using an iCycler, with iQ SYBR Green SuperMix reagents (BioRad). In preliminary experiments, a dilution series of cDNA was used with each primer set to establish conditions (primer concentration, annealing temperature) to yield >90% efficiency; in addition, the PCR product was run on an agarose gel and sequenced to confirm its identity. Melt curve analysis and no-template controls were included with each run. qRT-PCR data was analyzed using a delta-Ct normalization procedure against expression of Actin and values compared between T3KO and WT mice.

Primers used:

TASK-1 f TGCTGCGCCTCAAGCCGCACAAG

TASK-1 r GAACACCTTGCCTCCGTCCGTGC

Cyp11β2 f ATTCTATGTTCAAGTCCACCTCAC

Cyp11β2 r TCCGCCACAATGCCACTG

Kcnj5 f CAAGCAGCTATGGCCGGTGA

Kcnj5 r ATGTAGCGCTGGCGTGGCTT

Actin f ATGCTCCCCGGGCTGTAT

Actin r CATAGGAGTCCTTCTGACCCATTC

AT1a f TcaCCAGATCAAGT GCATTTTGA

AT1a r AGAGTTAAGGGCCATTT TGCTTT

AT1b f ACTGGCAGAAATACCATGTCTTCA

AT1b r CCGACTAATTATGTTCATGTGGAAA

Cyp11β2 Protein Expression Both adrenals from each mouse (~100 days old) were dissected, trimmed of fat, immediately frozen and stored at -80 until time of analysis. Adrenals were disrupted in 100µl RIPA buffer (PBS, 0.1% SDS, 1% NP40, deoxycholate 0.5%, protease inhibitor cocktail from sigma 1:100), homogenized with an insulin syringe (25 passes), and centrifuged (10,000g) for 10min at 4C. The supernatant was used as lysate. After protein analysis , 20µg total protein per sample was separated on 10% SDS-polyacrylamide, and transfered to PVDF membrane. Membranes were preblocked with 5% milk/TBST prior to antibody exposure. The Cyp11β2 antibody, a gift from Dr. Gomes-Sanchez, was used at 1:1000 in TBST with 5% milk, 0.1% BSA and 0.1 NaN3.

!"!#$%&

' (

) )*+

,) ,)*+

' #

) ,$

'

)

) -) -)) -)*+ ) ,)

'

( (. #/ ( 0

)) )*)

) " $1-)-2" $1,),3" $1,$ ",3$14 1 1516 1 ))7 188999.9(9":"

("(&

"&

#;"(&

"&

"&

' /

Figure S1. Schematic diagram of metabolic cage protocol and dietary manipulations.

Figure S2. AT1AR and AT1BR mRNA expression in ZG of mice. ZG was isolated using lasercapture microdissection. AT1AR and AT1BR mRNA expression was measured using qRT-PCR and quantified relative to Actin mRNA. Both AT1AR (A) and AT1BR (B) mRNA levels were similar between WT mice and T3KO on both NS (n=6 per group) and HS (n=4 per group) diets

Figure S3. Heart rate (HR, beats per minute) during day (sleeping) and night (active) phases on NS. During sleep HR between genotypes was equivalent but differed during active phase. *P=0.004; n=11 per genotype. Values represent mean ± S.E.M of 4 day accumulated measurements.

renin-angiotensin-aldosterone...

Documents