research article detection of food spoilage and pathogenic...

Research ArticleDetection of Food Spoilage and PathogenicBacteria Based on Ligation Detection Reaction Coupled toFlow-Through Hybridization on Membranes

K Boumlhme1 P Cremonesi2 M Severgnini3 Tomaacutes G Villa1 I C Fernaacutendez-No1

J Barros-Velaacutezquez1 B Castiglioni2 and P Calo-Mata1

1 Department of Analytical Chemistry Nutrition and Food Science School of Veterinary Sciences University of Santiago de Compostela27002 Lugo Spain

2 Institute of Agricultural Biology and Biotechnology National Research Council 26500 Lodi Italy3 Institute of Biomedical Technologies Italian National Research Council 20090 Segrate Italy

Correspondence should be addressed to P Calo-Mata pcalomatagmailcom

Received 28 January 2014 Accepted 14 March 2014 Published 10 April 2014

Academic Editor Stefano DrsquoAmelio

Copyright copy 2014 K Bohme et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Traditional culturing methods are still commonly applied for bacterial identification in the food control sector despite being timeand labor intensive Microarray technologies represent an interesting alternative However they require higher costs and technicalexpertisemaking them still inappropriate formicrobial routine analysisThe present study describes the development of an efficientmethod for bacterial identification based on flow-through reverse dot-blot (FT-RDB) hybridization on membranes coupled to thehigh specific ligation detection reaction (LDR) First the methodology was optimized by testing different types of ligase enzymeslabeling and membranes Furthermore specific oligonucleotide probes were designed based on the 16S rRNA gene using thebioinformatic tool Oligonucleotide Retrieving for Molecular Applications (ORMA) Four probes were selected and synthesizedbeing specific for Aeromonas spp Pseudomonas spp Shewanella spp andMorganella morganii respectively For the validation ofthe probes 16 reference strains from type culture collections were tested by LDR and FT-RDB hybridization using universal arraysspotted onto membranes In conclusion the described methodology could be applied for the rapid accurate and cost-effectiveidentification of bacterial species exhibiting special relevance in food safety and quality

1 Introduction

Microbial spoilage of food is an area of global concerncausing serious foodborne intoxications and resulting inhigh economic losses for the food producing sector Themicrobiological safety of food has become an increasedimportance for the consumers as well as for the foodproducing industry and regulations that require monitor-ing and the enforcement of control systems have beenestablished Research in the food safety and quality fieldhas been continuously focused on the search for sensitiveaccurate rapid and cost-effective methods to determinepotential microbial risks Conventional cultivation methodsand phenotypical tests are still commonly applied in thefood microbiological field but are time consuming and labor

intensive Over the past years the tools for moleculardiagnosis have greatly improved and immunoassays massspectrometry and PCR-based technologies have been intro-duced for microbial identification Microarrays are powerfulsensitive and specific high-throughput technologies thatallow an accurate identification based on single target detec-tion and can determine subtle differences in the bacterialgenomes Gene arrays can hybridize multiple DNA targetssimultaneously and thus have enormous potential for thedetection and identification of bacterial species [1] Thanksto the increase in the complete microbial genome sequencesDNA microarrays are becoming a common tool in manyareas of microbial research [2] For bacterial identificationthe so-called oligonucleotide arrays are used consisting ofshort oligonucleotide probes specific for the corresponding

Hindawi Publishing CorporationBioMed Research InternationalVolume 2014 Article ID 156323 11 pageshttpdxdoiorg1011552014156323

2 BioMed Research International

target sequence In the last decade oligonucleotide arrayshave been successfully applied for the detection of bacterialpathogens in the clinical as well as in the food sector [3ndash7] However besides numerous advantages such as beinginformative and highly repeatable and the potential forminiaturization and ease of automation most describedmicroarraymethods require elevated costs for equipment anda more qualified personal circumstances that limit its broadapplication for routine analyses in common food controllaboratories In this sense reverse dot-blot (RDB) hybridiza-tion using membrane-based macroarrays represents a cost-effective alternative that needs less specialized equipmentand can be used in any well set up molecular biologylaboratory [8] Moreover a hybridization system in whichwith the help of negative pressure DNA samples activelyflow through membranes and the immobilized probes havebeen developed This flow-through hybridization system isthe most efficient method for molecular hybridization andhas the advantages of being very fast semiautomated cleanversatile and less expensive than traditional hybridizationIn addition the diffusivity and local reaction concentrationof DNA are increased due to three-dimensional volumesleading to a higher sensitivity [9]

Although the basic principle of the hybridization tech-nique is the discrimination between a perfect match andone single mismatch this specificity is difficult to reachwith classical oligoprobe arrays and cross-reactions can leadto false positive results [10] This is of special relevance tothe food control sector since bacterial species present infood products can differ significantly in their pathogenicand spoilage nature and it is necessary to detect specificallythose that represent a high microbial risk With the ligasedetection reaction (LDR) sequences can be differentiated byjust one polymorphism and closely related bacterial specieswith high sequence similarity can be discriminated Themicroarray technology based on LDR coupled to a universaloligonucleotide array has been described elsewhere [11] andrequires the design of two oligonucleotide probes specificfor each target sequence The discriminating probe carriesa label at the 51015840 end and the discriminating base at the31015840 end The common probe contains a unique sequenceat the 31015840 end that is addressed to a certain location on auniversal array (zipcode) In the ligase reaction both probesare joined only in the case that a complementary template ispresent and this template sequence exhibits a perfectmatch inthe discriminating position The described methodology hasbeen successfully applied for the detection and identificationof pathogenic bacterial species in milk [11]

Based on these previous works [11] the present workfocused on the design of specific LDR-probes for the detec-tion of food spoilage bacterial species Accordingly 16S rRNAgene sequences of the most relevant foodborne pathogenicand spoilage bacterial species were considered and singlenucleotide polymorphisms for the discrimination at thespecies level were determined with the bioinformatics toolORMA [12]

The objective of this study was the development of a fastand cost-effective flow-through hybridization technologybased on the high specific LDR approach coupled to universal

macroarrays on membranes The proposed methodologycombines the efficiency and specificity of the microarraytechnique with the rapidity and convenience of flow-throughhybridization being of special interest for microbial identi-fication in the food safety and quality field The applicationof this sensitive method would result in the rapid and earlydetection of food spoilage bacteria and thus contribute to theaccurate analysis and control of microbial risks

2 Materials and Methods

21 Design of Specific Oligonucleotide Probes For the probedesign up to fifty 16S rRNA gene sequences of bacterialspecies exhibiting pathogenic or spoilage activity were down-loaded from public databases (NCBI RDP) and aligned withthe bioinformatics program ClustalX 21 [13] Consensussequences were determined for every species andor genuswith the program GenDoc 27 [14] considering polymor-phisms with a percentage higher than 30 Based on theconsensus sequences of every species andor genus candidateprobes were designed with the bioinformatics tool Oligonu-cleotide Retrieving for Molecular Applications (ORMA) [12]All potential candidate probes were tested in silico againstreference databases (RDP NCBI) for their specificity At theend four probes were selected to carry out the studies ofthe present work being specific for the genera AeromonasPseudomonas Shewanella and for the species Morganellamorganii respectively The sequences of the specific probepairs and the corresponding zipcode positions are listed inTable 1 The DNA sequences of the zipcodes were randomlyselected as previously described [15]

22 Bacterial Strains and Culture Media For the validationof the synthesized probes 16 reference strains were tested(Table 2) Bacterial reference strains were obtained from theSpanish Type Culture Collection (CECT) The strains werereactivated in brain-heart infusion (BHI) broth (BectonDickinson and Company Le Pont de Claix France) andincubated for 24 h at 30∘C Afterwards bacterial cultureswere grown on plate count agar (PCA) (Oxoid HampshireEngland) at 30∘C and single colonies were isolated For DNAextraction a single colony was incubated in BHI for 24 h at30∘C

23 DNA Extraction and PCR Amplification Total genomicDNA was extracted by means of the DNeasy tissue minikit(Qiagen Valencia CA USA) and the 16S rRNA gene wasamplified as described elsewhere [11] using the universalprimer pair 20F1500R [16] The PCR products were purifiedby using aWizard SV gel and PCRClean-Up System purifica-tion kit (Promega Italia Milan Italy) and quantified by elec-trophoresis in agarose gel with the quantitative LowRanger100 bp DNA Ladder (Norgen Biotek CorpThorold OntarioCanada)

24 Ligase Detection Reaction (LDR) Selected probes wereordered for synthesis (Thermo Fisher Scientific GmbH UlmGermany) Each probe pair consisted of a common probe

BioMed Research International 3

Table 1 Nucleotide sequences of the selected unique probes and complementary zipcodes

Probe name1 Probe sequence2 czipcode sequence3 PosHybrid control gttaccgctggtgctgccgccggta 66Synth template agccgcgaacaccacgatcgaccggcgcgcgcagctgcagcttgctcatgDS synth template catgagcaagctgcagctgcgcgcgCP synth template ccggtcgatcgtggtgttcgcggctgtggtgtgccagccgtcggtgccat 63DSMorganella ggcgtaaagcgcacgcaggcggttgattgCPMorganella agtcagatgtgaaatccccgggcttaacccgggatgtcagtgacgcgctcagcgttg 29DS Shewanella gatgtctactcggagtttggtgtcttgaacactgggcCP Shewanella tctcaagctaacgcattaagtagaccgcctggggagccgtacccttccgctggagatttac 23DS Aeromonas gccccgggctcaacctgggaattgcatttaaaactgtCP Aeromonas ccagctagagtcttgtagaggggggtagaattccagtgtgcgcccgagatcggtatccccg 17DS Pseudomonas cccttgtccttagttaccagcacgtiatggtgggcCP Pseudomonas actctaaggagactgccggtgacaaaccggaggggattgcaccgtcagcaccaccgag 141DS discriminating probe CP common probe 2discriminating positions are indicated as bold 3complemantary zipcode sequences are underlined

Table 2 Reference strains used for probe validation

StrainAeromonas caviae ATCC 15468Aeromonas hydrophila ATCC 7966Aeromonas veronii ATCC 35624Bacillus cereus ATCC 14893a

Morganella morganii BM-65Morganella morganii ATCC 8076Pseudomonas fluorescens ATCC 13525Pseudomonas fluorescens ATCC 17397Pseudomonas fragi ATCC 4973Pseudomonas putida ATCC 12633Pseudomonas putida ATCC 17453Pseudomonas syringae ATCC 19310Shewanella algae ATCC 51192Shewanella baltica CECT 323Shewanella putrefaciens ATCC 8071Staphylococcus aureus ATCC 9144aaStrains applied as negative controls

with a phosphate modification at the 51015840 end and a uniquesequence (complementary zipcode) at the 31015840 end and adiscriminating probewith the specific nucleotide at the 31015840 endand a label for detection at the 51015840 end Three different labelswere tested Cy3 Cy5 and biotin

The lyophilized probes were resuspended in waterobtaining a concentration of 100120583MAfterwards a probemixwas prepared containing 1 120583M of every oligonucleotide ofeach probe pair A probe pair complementary to a syntheticDNA template was also added as a ligation control to theprobe mix (see Table 1) The total volume of LDR was 20120583Land it included 1X ligase buffer 4U ligase 005 120583M of each

probe 05 120583M synthetic DNA template and 5ndash50 fmol of thePCR products Three ligase enzymes were tested pfu DNAligase (Stratagene La Jolla CA USA) ampligase (EpicentreMadison WI USA) and taq ligase (New England BiolabsBeverly MA USA)

25 Denaturation of LDR Products LDR hybridization mix-tures of a total volume of 65 120583L were prepared contain-ing 20120583L of the LDR products 01 120583M labeled czipcode66 (complementary to zipcode 66 see Table 1) 01mgmLsalmon sperm and Solution A (2X SSC01 SDS) Beforehybridization to the universal arrays or membranes wasperformed these mixtures were denatured at 95∘C for 2minand chilled on ice

26 Membrane Preparation and Subsequent Immobilizationof Oligonucleotides The amino-modified zipcode oligonu-cleotides (100120583M Thermo Fisher Scientific GmbH) werediluted with 05M sodium bicarbonate buffer (pH 84) todifferent concentrations (1120583M 01 120583M and 001120583M) andwere dotted at different volumes (1 120583L 05120583L 03120583L 02 120583Land 01 120583L) at the given positions on the membranes

One membrane contained nine subarrays allowing thehybridization of nine samples simultaneously Two differ-ent types of membranes were tested and required differ-ent preparation procedures Nylon Biodyne C membranes(Negatively-Charged Nylon 66 pore size 045120583m Pall Co)were rinsed briefly with 01M HCl and then incubated infreshly prepared 16 EDC (N-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride Sigma-Aldrich) for 15minAfter drying at air and dotting the oligonucleotides anyremaining active groups were quenchedwith 01MNaOH for10min Finally membranes were rinsed thrice with deionizedwater and air-dried for storage or immediately used forhybridization


The Protran BA 85 nitrocellulose membranes (pore size045 120583m Sigma-Aldrich) were used without any pretreat-ment After dotting the oligonucleotides membranes wereexposed to UV-light (254 nm) for 30 sec to cross-link theoligonucleotides

27 Flow-Through Hybridization on Membranes Flow-through hybridization was performed on an HybriMaxdevice (Patent no US6020187 Hybribio Limited HongKong China) [17] that works on the basis of the particularprinciple of flow-through hybridization caused by a negativepressure under the airproof hybridization membraneproduced by pumping The steps were as follows (1)prehybridization of the membrane with 05mL Solution A(2) dilution of the denatured LDR products with 450 120583LSolution A and hybridization to the membrane at 50∘C for15min and (3) washing the membrane twice with 05mLSolution A to eliminate the unhybridized PCR products

Whenworkingwith biotin-labeled probes color develop-ment was carried out as follows (4) washing the membranetwice with 05mL 01M sodium citrate (5) incubation with05mL streptavidin-horseradish peroxidase (HRP) at 37∘Cfor 5min (6) washing the membrane twice with 05mLSolution A to eliminate the uncombined peroxidase (7)washing the membrane twice with 05mL 01M citric acidbuffer (pH 5) and (8) color development with 05mL 3355-tetramethylbenzidine (TMB) chromogen

The membranes were imaged and analyzed with theChemiDoc MP imaging system (BioRad)

28 Validation of Probes by Hybridization to an UniversalArray (UA) onGlass Slides At the same time the probes werevalidated by hybridization of the LDR reaction products to auniversal microarray on glass slides following the method-ology described elsewhere [11] One slide contained eightsubarrays separated by press-to-seal silicone isolators (10 times9mm Schleicher and Schuell BioScience Dassel Germany)allowing the hybridization of eight samples simultaneouslyBriefly the denatured LDR products were applied to the slideand hybridization was carried out in a dark chamber at 65∘Cfor 1 h 30min After hybridization the slides were washed at65∘C for 15min in Solution A Finally the slide was driedby spinning at 80timesg for 3min The fluorescent signals wereacquired at a 5120583m resolution by using a ScanArray Lite laserscanning system (Perkin Elmer Life and Analytical SciencesBostonMA)with a green laser for Cy3 dye (120582

119890119909 543 nm 120582

119890119898

570 nm) All images were analyzed visually and statisticallydetermining average values and standard deviations of thefluorescence intensity

3 Results

31 Probe Validation by Hybridization to Universal Arrayson Glass Slides For the probe design we consideredDNA sequences of the most important food spoilage andpathogenic bacterial species using the 16S rRNA gene as tar-get Consensus sequences were determined for every speciesandor genus of interest and discriminating nucleotides were

determined with the computer software ORMA The list ofspecific fragments of 25ndash60 bp was reviewed and the poten-tial candidate probes were tested in silico against referencedatabases (RDPNCBI) with the aim to verify their specificityFour of the designed probes were selected for the presentstudies for being specific for the bacterial speciesMmorganiiand for Aeromonas Pseudomonas and Shewanella generawhich are of special interest in seafood spoilage

Before applying the synthesized probes in the flow-through hybridization approach they were tested in vitroby hybridization to universal arrays (UA) on glass slides asdescribed elsewhere [11] The designed probes were specificfor the corresponding species andor genus and sensitivefor concentrations between 5 and 50 fmol of sample DNAFurthermore the amplified 16S rDNAs of two additionalreference strains (Bacillus cereus ATCC 14893 and Staphylo-coccus aureusATCC9144)were analyzed as negative controlsresulting in no fluorescence signal against any of the testedprobes

32 Optimization of the Flow-Through HybridizationApproach Coupled to LDR The principle of the flow-through hybridization approach is based on themethodologyof reverse dot blot (RDB) hybridization in that the targetingmolecules flow through the immobilized probes withinthe membrane fibers This reduces the time needed forhybridization from hours to minutes and also simplifiesthe washing steps since any unbound molecule is removedeasily by passing through the membrane

In the present study we applied for the first time the LDR-based methodology to a flow-through hybridization strategyFirst with the aim of optimizing the protocol a number ofhybridizations were carried out under different conditionsonly with the positive controls for hybridization (66) andligation (63) The hybridization control is a labeled syntheticoligonucleotide that contains a DNA sequence that is com-plementary to the zipcode 66 spotted onto the membrane apositive signal at this position indicates that the hybridizationprocess is successfulThe ligation control includes a syntheticoligonucleotide and a probe pair that is complementary tothe DNA sequence of the synthetic template This probealso contains a DNA sequence that is complementary to thezipcode 63 spotted onto the membrane a positive signal atthis position indicates that the ligation reaction takes place asexpectedThe scheme of the spotted zipcode oligonucleotidesis shown in Figure 1

In these preliminary experiments different labelingagents were tested (Figures 2(a)ndash2(c)) and different concen-trations of the zipcode oligonucleotides were spotted onto themembranes ((i)ndash(iii) in Figure 2) to compare the intensities ofthe dots obtained after hybridization of the positive controlsGood results were obtained spotting the oligonucleotides atconcentrations of 1120583M and 01 120583M ((i) and (ii) in Figure 2)whereas the concentrations of 001 120583M gave dots with unac-ceptable levels of intensity The best results were obtainedwith biotin labeling (Figure 2(a)) with good intensities forboth hybridization and ligation controls In the case of Cy3-labeling no positive signal was detected for the ligation


66

03 120583L

66

02 120583L

63

02 120583L

66

02 120583L

63

02 120583L

66

02 120583L

63

02 120583L

66

03 120583L66

03 120583L

63

03 120583L63

03 120583L63

03 120583L

Figure 1 Scheme of spotted zipcode-oligonucleotides on mem-branes for the optimization experiments 66Hybridization control63ligation control

controls in any experiment (Figure 2(b)) This was due to ahigh fluorescence background all over the membrane thatcomplicated the visibility of the spots With Cy5-labelinglittle fluorescence backgroundwas obtained but although thedots of the ligation controls could be clearly detected theintensity was lower than that obtained with biotin labeling(Figure 2(c))

In addition different volumes of the spotted zipcodeswere tested Well-defined dots were obtained with volumeshigher than 01 120583L smaller volumes resulting to be lessreproducible due to difficulties in pipetting Neverthelesssmaller volumes and smaller dots could be obtained withadequate pipettes and tips and a macroarray with up to 50spots could be designed

Biodyne C nylon membranes have been described to bethe most adequate ones for hybridization purposes sinceoligonucleotides are covalently bound onto the membranesby interaction between the negatively charged carboxylgroups of the membrane and the positively charged amino-groups of DNA However since nylonmembranes are knownto exhibit a higher fluorescence background compared tonitrocellulose membranes the latter were also tested Inthe case of nitrocellulose membranes DNA oligonucleotideswere directly spotted onto the membranes and cross-linkedby UV-light Unfortunately the results were less satisfactoryand the nitrocellulose membranes showed even a higherfluorescence background (Figure 3) Likewise a high colorbackground was observed for the biotin labeling The higherbackground for all the three labeling reagents was mainlydue to the difficulties in the washing processes since thenitrocellulosemembranes are less permeable In addition thespots obtained on nitrocellulose membranes were not as welldefined as on nylon membranes

In a further experiment three different ligase enzymeswere tested pfu DNA ligase taq DNA ligase and ampli-gase The best results were obtained with taq DNA ligaseexhibiting dots with higher intensities for the ligation con-trols Figure 4 shows the hybridization results on BiodyneC membranes and biotin labeling after carrying out theligation reaction employing the three different enzymesSimilar results were obtained for the fluorescence label Cy5

33 Application of the Designed LDR Probes to the Flow-Through Hybridization Methodology As a conclusion of theoptimization experiments the following application of thedesigned probes to the flow-through hybridization approachwas carried out with taq DNA ligase in the ligation reactionand with biotin labeling for hybridization on Biodyne Cmembranes The zipcode oligonucleotides were spotted at aconcentration of 01120583M and a volume of 02120583L The schemeof the spotted macroarray is shown in Figure 5

The methodology was validated with the strains listed inTable 2 With the flow-through hybridization approach bac-terial DNA of the corresponding reference strains was suc-cessfully detected at concentrations of 10 fmol Furthermorethe specificity of the designed probes was also confirmedwith this technique resulting in positive signals at the corre-sponding positions on the macroarray membrane (Figure 6)and no signal of the negative controls (B cereus ATCC 14893and S aureus ATCC 9144) (data not shown) In additionthe methodology was also successfully applied for mixturesof amplified DNA from reference strains corresponding todifferent species (Figures 6(e) and 6(f))

4 Discussion

Microarray-based methods represent state-of-the-art tech-nologies for a high-throughput molecular analysis allowinghigh sensitivity accuracy and specificity DNA microarraysbecame a common tool in many areas of microbial researchincluding detection and identification of bacterial speciesdue to the high potential to discriminate subtle differencesin the genome the possibility to analyze multiple targetssimultaneously and the ability to detect noncultivable bac-teria In addition a microarray experiment has the facilityto be miniaturized and automated [1 2 18] Thanks tothe increase in the complete microbial genome sequencingand the advances in bioinformatics and biomolecular tech-nologies DNA microarrays are promising analytical toolsthat are expected to replace time-consuming and laboriousconventional techniques for bacterial identification in nearfuture However the impact on the food microbial sector hasbeen less intensive and for food control purposes traditionalculturing methods are still commonly applied due to the ele-vated costs and technical expertise required by microarray-based assays

One of the challenges and greatest costs in the pro-cess of designing a microarray is the identification testingand validation of discriminatory gene regions [8] Mostdesigned oligonucleotide microarrays for bacterial identi-fication are based on probes with the 16S rRNA gene astarget sequence Ribosomal genes represent ideal molecu-lar markers for microbial identification by oligonucleotidearrays first because they contain conserved as well asvariable regions and second due to the huge amount ofsequence data available in public databases that facilitatethe design of specific probes Microarrays based on the 16SrRNA gene have been successfully applied for the detectionof foodborne pathogens isolated from different food samples[3 4] and coastal waters [5] In another study bacterial food


(a) (b) (c)

(i)

(ii)

(iii)

Figure 2 Biodyne C membrane-macroarray images obtained for optimization experiments with different labeling (a) biotin (b) Cy3 and(c) Cy5 and zipcode-oligonucleotides spotted at different concentrations (i) 1120583M (ii) 01 120583M and (iii) 001120583M

(a) (b) (c)

Figure 3 Nitrocellulose membrane-macroarray images obtained for optimization experiments with different labeling (a) biotin (b) Cy3and (c) Cy5


(a) (b) (c)

Figure 4 Biodyne Cmembrane-macroarray images obtained for optimization experiments with biotin labeling and different ligase enzymes(a) pfu DNA ligase (b) taq DNA ligase and (c) ampligase

C 63 66

o 14 17

23 29 14

17 23 29

66 63 C

Figure 5 Scheme of spotted zipcode-oligonucleotides on mem-branes 119862Color control 66hybridization control 63ligation Control14Pseudomonas spp 17Aeromonas spp 23Shewanella spp and29Morganella morganii

pathogens such as Bacillus spp Escherichia coli Salmonellaspp Staphylococcus spp and Vibrio spp were detected by a16S rRNA based oligonucleotide array [19] However in thisstudy the discrimination was achieved at the genus level butnot at the species level

The limitations of the 16S rRNA gene as a target are dueto the high similarity of these gene sequences in many bac-terial species Nevertheless discrimination of closely relatedbacterial species is often required as well in clinical diseasesas in the food safety sector due to the varying pathogenicand spoilage character of genetically closely related species Inthis sense the 16S-23S rRNA intergenic spacer region (ISR)exhibits higher sequence variability allowing the design ofspecific probes for the successful identification of bacterialfoodborne pathogens [20ndash23] In other studies aimed atthe detection of foodborne pathogens the designed probesreferred to specific genes such as virulence or toxin codinggenes This approach led to the unequivocal identificationof a number of important foodborne pathogens such asCampylobacter jejuni E coli Salmonella typhimurium Lis-teria monocytogenes and Yersinia enterocolitica [24 25]However the high specificity of this approach contrasts withthe challenges of the need for multiplex amplifications beforehybridization

The methodology applied in the present study was basedon a different microarray technology that combines the highspecific ligase detection reaction (LDR) and the multiplehigh-throughput DNA analysis of a microarray platformThe LDR approach has the ability to differentiate two DNAsequences by a single nucleotide polymorphism and requiresthe design of two oligonucleotide probes specific for eachtarget sequence In the ligase reaction both probes arehybridized to a present template and ligated only in the caseof a perfect match in the discriminating position [26] Afurther advantage of the LDR is that the ligation is carriedout in liquidmedium allowing amuch better interaction andhybridization of two complementary DNA strands that resultin an increased sensitivity Afterwards the ligation productsthese including the joined and labeled probes hybridizeto a certain location on a universal microarray Since theligated probes are short oligonucleotides the hybridizationprocess is facilitated considerably as compared to wholegenes In addition the sequence fragments that hybridizeto the array namely the zipcodes are located at the end ofthe probes again facilitating the contact to the immobilizedDNA sequences Such zipcodes are synthetic sequencesthat are unique and different from any existing sequencethus avoiding cross-hybridizations The number of zipcodesequences is unlimited and further probes can be designed atany time assigning them to a ldquofreerdquo or new zipcode sequencethat is spotted onto the universal microarray Accordinglythe microarray platform can be enlarged easily for furtherspecies or genes and thus be applied to a wide range ofmicrobial samples This is of special interest for bacterialidentification in the food sector due to the fact that theuniversal microarray can be applied to any foodstuff justadapting the mix of probes used for the ligation reaction byadding the probes that correspond to the target microbialspecies

The application of LDR coupled to a universal array(UA-LDR) for microbial identification has been described byvarious authors [27ndash29] especially for clinical diagnosticsCremonesi et al [11] successfully applied the methodology to


(a) (b) (c) (d) (e) (f)

Figure 6 Biodyne Cmembrane-macroarray images obtained when testing the strains (a) Aeromonas hydrophilaATCC 7966 (b)Morganellamorganii ATCC 8076 (c) Pseudomonas fluorescens ATCC 13525 (d) Shewanella putrefaciens ATCC 8071 (e) a mix of A hydrophila ATCC7966 and P fluorescens ATCC 13525 and (f) a mix of all the four strains corresponding to the different species

detect and identify bacterial species causing mastitis in dairyruminants also including species that are of great interest asresponsible of foodborne disease and food spoilage

The present study was based on one hand on the resultsobtained by these authors and on the other hand on thedesign of further probes using the same bioinformatics toolORMA Difficulties were observed for some genera espe-cially inside the Enterobacteriaceae family for which speciesdifferentiation was not possible due to the high sequencesimilarity of the 16S rRNA gene and the great variety ofclosely related bacterial species that are potentially present infood products Finally four probes were selected and resultedto be specific for the genera Aeromonas Pseudomonas andShewanella as well as for the speciesMmorganii The probeswere successfully tested in vitro with the UA-LDR approachdescribed by Cremonesi et al [11] being specific and sensitiveto concentrations of 5 fmol This is the first time that LDRprobes have been designed for these relevant foodbornebacterial species and genera

As mentioned before the UA-based approach can beeasily enlarged by further probes corresponding to otherbacterial species with food spoilage character thus repre-senting an efficient microarray platform with high potentialfor the accurate bacterial species identification in the foodcontrol sector where a great variety of bacterial species canbe present in one food product and need to be detected atlow concentrations

However besides the fast technology development inthe microarray field the transition to potential commercialapplications is very slow [8] The main drawback of themicroarray technology is the necessary large initial invest-ment for sophisticated and expensive instruments needed formicroarray printing and laser scanning In addition hightechnical expertise is required thus limiting their applica-tions to well-trained and well-equipped laboratories [9 30]

In this sense although the throughput of macroarrays ismoderate as compared to microarrays the former representa cost-effective rapid accurate and efficient alternative thatdo not require specialized equipment and can be used in anywell set-upmolecular laboratory but still retain the sensitivity

and specificity of the microarray technology Such oligonu-cleotidemacroarrays are based on the reverse dot-blot (RDB)hybridization technique in which specific oligonucleotideprobes are immobilized to membranes and afterwards thelabeled target DNA is hybridized to the membranes [31 32]

The application of a flow-through (FT) device forhybridization represents an improvement of the RDB tech-nique The FT-RDB approach has been described by variousauthors for specific oligonucleotide detection and resultedto be the most efficient method for molecular hybridiza-tion combining two advanced techniques flow-throughhybridization and simultaneous multiple detection on amacroarray membrane An active flow directs the sampleDNA towards immobilized probes within the membranefibers increasing the diffusivity and local reaction concentra-tion of DNA and allowing the close contact of DNA probeswith the immobilized DNA inside the membrane poresConventional dot-blot hybridizations need to be incubatedfor several hours in plastic bags or glass tubes and requirelarge volumes to cover the wholemembrane which decreasesthe concentration of DNA available for binding to the probesalso decreasing active interactions between complementarystrands considerably [33] The FT-RDB hybridization inven-tion demonstrated to be an efficient approach for genotypingbeingmore efficient faster (lt15min) and less expensive thangene chips thus having high potential for the use inmicrobialidentification

The flow-through hybridization device HybriMax usedin the present study has been patented by Tam [17] Besidesthe advantages of flow-through hybridization mentionedabove with this device the hybridization process can besemiautomated this being cleaner and less expensive thantraditional hybridization protocols [17] More recently theHybriMax and FT-RDB hybridization process on nylonmembranes were successfully applied to the genotyping ofhepatitis B virus [34 35] The application of HybriMax tohuman papillomavirus (HPV) genotyping was also reported[36]

The aim of the present study was the use of the FT-RDBhybridization approach for the fast and efficient identification


of food pathogens and spoilage bacteria In another workthe combination of FT and RDB has been applied to thedetection of ten intestinal foodborne pathogens (Salmonellaspp Brucella spp E coli O157H7 Clostridium botulinumB cereus Clostridium perfringens Vibrio parahaemolyticusShigella spp Y enterocolitica Vibrio cholerae L monocyto-genes and S aureus) [9] In such study the bacterial 16S and23S genes were simultaneously amplified directly from 540fecal samples and the results were compared to traditionalculturemethodsOur study considered three probes designedby these authors In this sense the probe for Lmonocytogenesexhibited cross-hybridization with B cereus and Bacillusthuringiensis strains while the probe for S aureus cross-hybridizedwith Lmonocytogenes strains Likewise the probefor B cereus could not distinguish between B cereus and Bthuringiensis due to the high sequence similarity of the 16Sand 23S rRNA genes of these two species

In another study RDB hybridization on nylon mem-branes was successfully applied for the detection of 14foodborne pathogens using specific probes for the 23S rRNAgene as target sequences for the species E coli C jejuniShigella dysenteriae V cholerae V parahaemolyticus Proteusvulgaris B cereus L monocytogenes C botulinum and Saureus [37] However these authors also reported problemsof unspecificity during the hybridization process Althoughthe 23S rRNA gene exhibited more sequence variability thanthe 16S rRNA gene the differentiation of closely relatedspecies is not easy These authors described the difficultiesin the design of specific probes for the species C perfringensand Streptococcus pyogenes based on the 23S rRNA geneFurthermore the DNA isolated of the species Salmonellaenterica and Y enterocolitica gave cross-reactions with E coliin their study [37]

In a recent study 11 foodborne pathogens were detectedwith biotinylated species-specific primers and hybridizationof the amplification products to specific probes on a thin-film biosensor [30] The assay proved to be extremely robustsensitive specific and economical obtaining reliable PCRfragment identification within 30min However the speci-ficity of the sensor requires the amplification with species-specific primers this involving multiplex PCR reactionwhich limits the throughput and number of target species

The assays described in the present work have beencarried out taking into account the principles of FT-RDBhybridization described by Xing et al [9] but resolvingthe above-mentioned problems by combining the approachwith the high specific LDR probes As a result the Hybri-Max device was successfully applied for the detection andidentification of bacterial reference strains by hybridizingthe joined probes to immobilized DNA fragments on mem-branes after carrying out PCR amplification and ligationreaction The protocol has been optimized to improve thesensitivity of the method In RDB hybridization experimentsthe results are normally visualized by biotin labeling andan enzyme-induced color development reaction To avoidseveral washing and incubation steps that are required forthis procedure experiments have also been carried outwith fluorescence labeling However instead of an expectedhigher sensitivity the detected spots were less intense with

fluorescence labeling making biotin labeling and subsequentcolor development reaction the method of choice for the FT-RDB hybridization assay

5 Conclusion

The FT-RDB hybridization methodology described in thiswork is fast and efficient and can be easily implementedin standard microbiological laboratories due to the easeof use and reduced costs as compared to the expensiveinstrumentation material and technical expertise requiredfor microarray platforms The assay can be applied for foodcontrol purposes obtaining a rapid accurate and specificidentification of bacterial species with importance in thespoilage and safety of any food product In the PCR stepbacterial DNA could be amplified directly from a foodmatrixwithout previous isolation and purification steps Thanksto the combination of specific LDR-probes and the flow-through hybridization process results were obtained in a fewhours Food microbial risk can be efficiently achieved withthe FT-RDB approach evaluated in this work this resultingin a better quality control of foodstuffs and the prevention offoodborne disease

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This work was funded by the Project 10PXIB261045PR fromXunta de Galicia and by the Projects AGL2010-19646 fromthe SpanishMinistry of Science and TechnologyThe predoc-toral research stay of K Bohme in Italy was funded by a FEMSResearch Fellowship

References

[1] J Zhou ldquoMicroarrays for bacterial detection and microbialcommunity analysisrdquo Current Opinion in Microbiology vol 6no 3 pp 288ndash294 2003

[2] T J Gentry and J Zhou ldquoMicroarray-based microbial iden-tification and characterizationrdquo in Advanced Techniques inDiagnostic Microbiology Y-W Tang and C W Stratton Edspp 276ndash290 Springer New York NY USA 2006

[3] X-W Wang L Zhang L-Q Jin et al ldquoDevelopment andapplication of an oligonucleotide microarray for the detectionof food-borne bacterial pathogensrdquo Applied Microbiology andBiotechnology vol 76 no 1 pp 225ndash233 2007

[4] H S Eom B H Hwang D-H Kim I-B Lee Y H Kim andHJ Cha ldquoMultiple detection of food-borne pathogenic bacteriausing a novel 16S rDNA-based oligonucleotide signature chiprdquoBiosensors and Bioelectronics vol 22 no 6 pp 845ndash853 2007

[5] O C Stine A Carnahan R Singh et al ldquoCharacterization ofmicrobial communities from coastal waters using microarraysrdquoEnvironmental Monitoring and Assessment vol 81 no 1ndash3 pp327ndash336 2003


[6] R-F Wang M L Beggs L H Robertson and C E CerniglialdquoDesign and evaluation of oligonucleotide-microarray methodfor the detection of human intestinal bacteria in fecal samplesrdquoFEMS Microbiology Letters vol 213 no 2 pp 175ndash182 2002

[7] K Kakinuma M Fukushima and R Kawaguchi ldquoDetectionand identification of Escherichia coli Shigella and Salmonellabymicroarrays using the gyrB generdquo Biotechnology and Bioengi-neering vol 83 no 6 pp 721ndash728 2003

[8] K R Everett J Rees-George I P S Pushparajah B J Janssenand Z Luo ldquoAdvantages and disadvantages of microarraysto study microbial population dynamicsmdasha minireviewrdquo NewZealand Plant Protection vol 63 pp 1ndash6 2010

[9] J-M Xing S Zhang Y Du D Bi and L-H Yao ldquoRapid detec-tion of intestinal pathogens in fecal samples by an improvedreverse dot blotmethodrdquoWorld Journal of Gastroenterology vol15 no 20 pp 2537ndash2542 2009

[10] M Severgnini P Cremonesi C Consolandi G de Bellis andB Castiglioni ldquoAdvances in DNA microarray technology forthe detection of foodborne pathogensrdquo Food and BioprocessTechnology vol 4 no 6 pp 936ndash953 2011

[11] P Cremonesi G Pisoni M Severgnini et al ldquoPathogen detec-tion in milk samples by ligation detection reaction-mediateduniversal array methodrdquo Journal of Dairy Science vol 92 no7 pp 3027ndash3039 2009

[12] M Severgnini P Cremonesi C Consolandi G Caredda Gde bellis and B Castiglioni ldquoORMA a tool for identificationof species-specific variations in 16S rRNA gene and oligonu-cleotides designrdquo Nucleic Acids Research vol 37 no 16 p e1092009

[13] J D Thompson T J Gibson F Plewniak F Jeanmougin andD G Higgins ldquoThe CLUSTAL X windows interface flexiblestrategies for multiple sequence alignment aided by qualityanalysis toolsrdquoNucleic Acids Research vol 25 no 24 pp 4876ndash4882 1997

[14] K B Nicholas H B Nicholas and D W Deerfield ldquoGeneDocanalysis and visualization of genetic variationrdquoEMBNEWNewsvol 4 p 14 1997

[15] J Chen M A Iannone M-S Li et al ldquoA microsphere-basedassay for multiplexed single nucleotide polymorphism analysisusing single base chain extensionrdquoGenome Research vol 10 no4 pp 549ndash557 2000

[16] U Edwars T Rogall H Blocker M Emde and E C BottgerldquoIsolation and direct complete nucleotide determination ofentire genes Characterization of a gene coding for 16S riboso-mal RNArdquoNucleic Acids Research vol 17 no 19 pp 7843ndash78531989

[17] J W O Tam ldquoFlow through nucleic acid hybridisation devicerdquoGoogle Patents 2000

[18] F Cecchini L Iacumin M Fontanot G Comi and M Man-zano ldquoIdentification of the unculturable bacteria Candidatusarthromitus in the intestinal content of trouts using dot blot andsouthern blot techniquesrdquoVeterinary Microbiology vol 156 no3-4 pp 389ndash394 2012

[19] Y-C Chiang C-Y Yang C Li Y-C Ho C-K Lin and H-YTsen ldquoIdentification ofBacillus sppEscherichia coli Salmonellaspp Staphylococcus spp and Vibrio spp with 16S ribosomalDNA-based oligonucleotide array hybridizationrdquo InternationalJournal of Food Microbiology vol 107 no 2 pp 131ndash137 2006

[20] G Zhou SWen Y Liu et al ldquoDevelopment of a DNAmicroar-ray for detection and identification of Legionella pneumophilaand ten other pathogens in drinking waterrdquo InternationalJournal of Food Microbiology vol 145 no 1 pp 293ndash300 2011

[21] M C Lin H H Ay Y T Hau H-C Wong and C C TsungldquoUse of oligonucleotide array for identification of six foodbornepathogens and Pseudomonas aeruginosa grown on selectivemediardquo Journal of Food Protection vol 68 no 11 pp 2278ndash22862005

[22] G Keramas D D Bang M Lund et al ldquoDevelopment ofa sensitive DNA microarray suitable for rapid detection ofCampylobacter spprdquo Molecular and Cellular Probes vol 17 no4 pp 187ndash196 2003

[23] B Cao R Li S Xiong et al ldquoUse of aDNAmicroarray for detec-tion and identification of bacterial pathogens associated withfishery productsrdquoApplied and Environmental Microbiology vol77 no 23 pp 8219ndash8225 2011

[24] M L Giannino M Aliprandi M Feligini L Vanoni MBrasca and F Fracchetti ldquoA DNA array based assay for thecharacterization of microbial community in raw milkrdquo Journalof Microbiological Methods vol 78 no 2 pp 181ndash188 2009

[25] K M Myers J Gaba and S F al-Khaldi ldquoMolecular identifi-cation of Yersinia enterocolitica isolated from pasteurized wholemilk using DNAmicroarray chip hybridizationrdquoMolecular andCellular Probes vol 20 no 2 pp 71ndash80 2006

[26] B Castiglioni E Rizzi A Frosini et al ldquoDevelopment of auniversal microarray based on the ligation detection reactionand 16S rRNA gene polymorphism to target diversity ofcyanobacteriardquo Applied and Environmental Microbiology vol70 no 12 pp 7161ndash7172 2004

[27] J Ritari J Hultman R Fingerroos et al ldquoDetection of humanpapillomaviruses by polymerase chain reaction and ligationreaction on universal microarrayrdquo PLoS ONE vol 7 no 3Article ID e34211 2012

[28] J Hultman J Ritari M Romantschuk L Paulin and P Auvi-nen ldquoUniversal ligation-detection-reaction microarray appliedfor compost microbesrdquo BMC Microbiology vol 8 article 2372008

[29] J Ritari L Paulin J Hultman and P Auvinen ldquoApplicationof hybridization control probe to increase accuracy on ligationdetection or minisequencing diagnostic microarraysrdquo BMCResearch Notes vol 2 article 249 2009

[30] S Bai J Zhao Y Zhang et al ldquoRapid and reliable detectionof 11 food-borne pathogens using thin-film biosensor chipsrdquoApplied Microbiology and Biotechnology vol 86 no 3 pp 983ndash990 2010

[31] A Maggio A Giambona S P Cai J Wall Y W Kan andF F Chehab ldquoRapid and simultaneous typing of hemoglobinS hemoglobin C and seven mediterranean 120573-thalassemiamutations by covalent reverse dot-blot analysis application toprenatal diagnosis in Sicilyrdquo Blood vol 81 no 1 pp 239ndash2421993

[32] E S Kawasaki and F F Chehab ldquoAnalysis of gene sequencesby hybridization of PCR-amplified DNA to covalently boundoligonucleotide probes The reverse dot blot methodrdquo Methodsin Molecular Biology vol 28 pp 225ndash236 1994

[33] P Tao W Zheng Y Wang and M-L Bian ldquoSensitive HPVgenotyping based on the flow-through hybridization and genechiprdquo Journal of Biomedicine and Biotechnology vol 2012Article ID 938780 6 pages 2012

[34] Z-Y Ou N Liu C-J Chen G Cheng and Y-S He ldquoRapid andaccurate genotyping of YMDDmotif variants in the hepatitis Bvirus genome by an improved reverse dot blot methodrdquo Journalof Clinical Microbiology vol 43 no 11 pp 5685ndash5689 2005


[35] R Zhang Y Deng C P Muller et al ldquoDetermination of hepa-titis B virus genotype by flow-through reverse dot blotrdquo Journalof Clinical Virology vol 39 no 2 pp 94ndash100 2007

[36] J W O Tam J Chow and R C Y Chan ldquoRapid genotypinganalysis for human papillomavirus and the device thereofrdquoGoogle Patents 2011

[37] B-X Hong L-F Jiang Y-S Hu D-Y Fang and H-Y GuoldquoApplication of oligonucleotide array technology for the rapiddetection of pathogenic bacteria of foodborne infectionsrdquoJournal of Microbiological Methods vol 58 no 3 pp 403ndash4112004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


target sequence In the last decade oligonucleotide arrayshave been successfully applied for the detection of bacterialpathogens in the clinical as well as in the food sector [3ndash7] However besides numerous advantages such as beinginformative and highly repeatable and the potential forminiaturization and ease of automation most describedmicroarraymethods require elevated costs for equipment anda more qualified personal circumstances that limit its broadapplication for routine analyses in common food controllaboratories In this sense reverse dot-blot (RDB) hybridiza-tion using membrane-based macroarrays represents a cost-effective alternative that needs less specialized equipmentand can be used in any well set up molecular biologylaboratory [8] Moreover a hybridization system in whichwith the help of negative pressure DNA samples activelyflow through membranes and the immobilized probes havebeen developed This flow-through hybridization system isthe most efficient method for molecular hybridization andhas the advantages of being very fast semiautomated cleanversatile and less expensive than traditional hybridizationIn addition the diffusivity and local reaction concentrationof DNA are increased due to three-dimensional volumesleading to a higher sensitivity [9]

Although the basic principle of the hybridization tech-nique is the discrimination between a perfect match andone single mismatch this specificity is difficult to reachwith classical oligoprobe arrays and cross-reactions can leadto false positive results [10] This is of special relevance tothe food control sector since bacterial species present infood products can differ significantly in their pathogenicand spoilage nature and it is necessary to detect specificallythose that represent a high microbial risk With the ligasedetection reaction (LDR) sequences can be differentiated byjust one polymorphism and closely related bacterial specieswith high sequence similarity can be discriminated Themicroarray technology based on LDR coupled to a universaloligonucleotide array has been described elsewhere [11] andrequires the design of two oligonucleotide probes specificfor each target sequence The discriminating probe carriesa label at the 51015840 end and the discriminating base at the31015840 end The common probe contains a unique sequenceat the 31015840 end that is addressed to a certain location on auniversal array (zipcode) In the ligase reaction both probesare joined only in the case that a complementary template ispresent and this template sequence exhibits a perfectmatch inthe discriminating position The described methodology hasbeen successfully applied for the detection and identificationof pathogenic bacterial species in milk [11]

Based on these previous works [11] the present workfocused on the design of specific LDR-probes for the detec-tion of food spoilage bacterial species Accordingly 16S rRNAgene sequences of the most relevant foodborne pathogenicand spoilage bacterial species were considered and singlenucleotide polymorphisms for the discrimination at thespecies level were determined with the bioinformatics toolORMA [12]

The objective of this study was the development of a fastand cost-effective flow-through hybridization technologybased on the high specific LDR approach coupled to universal

macroarrays on membranes The proposed methodologycombines the efficiency and specificity of the microarraytechnique with the rapidity and convenience of flow-throughhybridization being of special interest for microbial identi-fication in the food safety and quality field The applicationof this sensitive method would result in the rapid and earlydetection of food spoilage bacteria and thus contribute to theaccurate analysis and control of microbial risks

2 Materials and Methods

21 Design of Specific Oligonucleotide Probes For the probedesign up to fifty 16S rRNA gene sequences of bacterialspecies exhibiting pathogenic or spoilage activity were down-loaded from public databases (NCBI RDP) and aligned withthe bioinformatics program ClustalX 21 [13] Consensussequences were determined for every species andor genuswith the program GenDoc 27 [14] considering polymor-phisms with a percentage higher than 30 Based on theconsensus sequences of every species andor genus candidateprobes were designed with the bioinformatics tool Oligonu-cleotide Retrieving for Molecular Applications (ORMA) [12]All potential candidate probes were tested in silico againstreference databases (RDP NCBI) for their specificity At theend four probes were selected to carry out the studies ofthe present work being specific for the genera AeromonasPseudomonas Shewanella and for the species Morganellamorganii respectively The sequences of the specific probepairs and the corresponding zipcode positions are listed inTable 1 The DNA sequences of the zipcodes were randomlyselected as previously described [15]

22 Bacterial Strains and Culture Media For the validationof the synthesized probes 16 reference strains were tested(Table 2) Bacterial reference strains were obtained from theSpanish Type Culture Collection (CECT) The strains werereactivated in brain-heart infusion (BHI) broth (BectonDickinson and Company Le Pont de Claix France) andincubated for 24 h at 30∘C Afterwards bacterial cultureswere grown on plate count agar (PCA) (Oxoid HampshireEngland) at 30∘C and single colonies were isolated For DNAextraction a single colony was incubated in BHI for 24 h at30∘C

23 DNA Extraction and PCR Amplification Total genomicDNA was extracted by means of the DNeasy tissue minikit(Qiagen Valencia CA USA) and the 16S rRNA gene wasamplified as described elsewhere [11] using the universalprimer pair 20F1500R [16] The PCR products were purifiedby using aWizard SV gel and PCRClean-Up System purifica-tion kit (Promega Italia Milan Italy) and quantified by elec-trophoresis in agarose gel with the quantitative LowRanger100 bp DNA Ladder (Norgen Biotek CorpThorold OntarioCanada)

24 Ligase Detection Reaction (LDR) Selected probes wereordered for synthesis (Thermo Fisher Scientific GmbH UlmGermany) Each probe pair consisted of a common probe



















119890119909 543 nm 120582

119890119898


3 Results








66

03 120583L

66

02 120583L

63

02 120583L

66

02 120583L

63

02 120583L

66

02 120583L

63

02 120583L

66

03 120583L66

03 120583L

63

03 120583L63

03 120583L63

03 120583L








4 Discussion




(a) (b) (c)

(i)

(ii)

(iii)


(a) (b) (c)



(a) (b) (c)


C 63 66

o 14 17

23 29 14

17 23 29

66 63 C







(a) (b) (c) (d) (e) (f)

















5 Conclusion




Acknowledgments


References















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



















119890119909 543 nm 120582

119890119898


3 Results








66

03 120583L

66

02 120583L

63

02 120583L

66

02 120583L

63

02 120583L

66

02 120583L

63

02 120583L

66

03 120583L66

03 120583L

63

03 120583L63

03 120583L63

03 120583L








4 Discussion




(a) (b) (c)

(i)

(ii)

(iii)


(a) (b) (c)



(a) (b) (c)


C 63 66

o 14 17

23 29 14

17 23 29

66 63 C







(a) (b) (c) (d) (e) (f)

















5 Conclusion




Acknowledgments


References















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


66

03 120583L

66

02 120583L

63

02 120583L

66

02 120583L

63

02 120583L

66

02 120583L

63

02 120583L

66

03 120583L66

03 120583L

63

03 120583L63

03 120583L63

03 120583L








4 Discussion




(a) (b) (c)

(i)

(ii)

(iii)


(a) (b) (c)



(a) (b) (c)


C 63 66

o 14 17

23 29 14

17 23 29

66 63 C







(a) (b) (c) (d) (e) (f)

















5 Conclusion




Acknowledgments


References















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


(a) (b) (c)

(i)

(ii)

(iii)


(a) (b) (c)



(a) (b) (c)


C 63 66

o 14 17

23 29 14

17 23 29

66 63 C







(a) (b) (c) (d) (e) (f)

















5 Conclusion




Acknowledgments


References















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


(a) (b) (c)


C 63 66

o 14 17

23 29 14

17 23 29

66 63 C







(a) (b) (c) (d) (e) (f)

















5 Conclusion




Acknowledgments


References















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


(a) (b) (c) (d) (e) (f)

















5 Conclusion




Acknowledgments


References















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology







5 Conclusion




Acknowledgments


References















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology










































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article detection of food spoilage and pathogenic...

Documents