research article investigation on molecular mechanism of...

10
Research Article Investigation on Molecular Mechanism of Fibroblast Regulation and the Treatment of Recurrent Oral Ulcer by Shuizhongcao Granule-Containing Serum Zhang Bo, 1 Qian Xiang, 2 Ruan Shan-ming, 3 Bei Wang, 3 Deng De-hou, 1 Xia Liang, 1 Li Qing-lin, 1 Tao Feng, 4 and Shen Min-he 3 1 Zhejiang Cancer Hospital, Hangzhou, Zhejiang 310022, China 2 Zhejiang Chinese Medical University, Hangzhou, Zhejiang 310053, China 3 e First Affiliated Hospital of Zhejiang Chinese Medical University, Hangzhou, Zhejiang 310006, China 4 Zhejiang Medical College, Hangzhou, Zhejiang 310053, China Correspondence should be addressed to Tao Feng; [email protected] and Shen Min-he; [email protected] Received 13 January 2015; Revised 17 May 2015; Accepted 26 May 2015 Academic Editor: Klaus Heese Copyright © 2015 Zhang Bo et al. is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. e purpose is to study the intervention, proliferation, and differentiation on fibroblast by Shuizhongcao Granule during the treatment of ROU and investigate the action mechanism in inflammatory microenvironment. Proliferation of rat fibroblasts was detected using CCK8. Western blot was used to detect the effect of drug-containing serum on the expression of protein associated with NF-B and ERK pathway in rat fibroblasts. Expression of IL-10 and IL-12 was detected by PCR. Shuizhongcao Granule group successfully inhibited proliferation of rat fibroblast. Western blot results revealed that p65 and IKKB were significantly less expressed in Chinese medicine group, while pIB and pIKK expression were significantly increased. We have also found that in this group the expression of pAKT was evidently suppressed and expression of pERK significantly decreased. PCR results showed significantly decreased expression levels of IL-10 and 1IL-12b in Chinese medicine group, while the expression of IL-12a was increased. Our results suggest that Shuizhongcao Granule can suppress the proliferation of fibroblast and inhibit the activation of NF-B and thus suppress inflammatory reactions, possibly involving the inhibited expression of phosphorylated AKT, rather than the canonical pathway. Furthermore, it can inhibit ERK pathway and reduce IL-10 and IL-12b gene expression while enhancing IL-12a expression. 1. Introduction Recurrent oral ulcer (ROU) is the most frequent oral mucosal disease with an incidence rate up to 25–30% [1]. e main type, minor ROU, accounts for 70–80% of all cases [2]. ROU is also one of the most common complications of chemotherapy. e current treatments mainly include antibi- otic therapy [3], hormonal therapy [4], medicine mouthwash [5], and laser therapy [6], but none of them proves to be very effective. Finding a safe and effective medication to suppress inflammation is a hot and difficult research topic in this field. Suppression of NF-B pathway to reduce the incidence gives a novel resolution to treat ROU [7]. From the perspective of traditional Chinese medicine, ROU is a type of “aphthae,” which is usually considered to be associated with the phase of “fire.” A proven formula in our hospital, Shuizhongcao Decoction (composed of buffalo horn, urine sediment, Callicarpa, etc.), exhibited great efficacy in the clinical treatment through a mechanism of heat reduction, blood cooling, and detoxification [8]. is study evaluated the intervention effects of serum containing Shuizhongcao on rat fibroblasts and tested the optimal dosage and intervention time. We also detected the effect of Shuizhongcao Granule on ERK and NF-B pathways using Western blot and expression of IL-12 and IL-10 by RT-PCR. erein, we evaluated the effect and the mechanism of Shuizhongcao Granule on Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 2015, Article ID 324091, 9 pages http://dx.doi.org/10.1155/2015/324091

Upload: ngomien

Post on 28-Apr-2018

217 views

Category:

Documents


4 download

TRANSCRIPT

Research ArticleInvestigation on Molecular Mechanism of FibroblastRegulation and the Treatment of Recurrent Oral Ulcer byShuizhongcao Granule-Containing Serum

Zhang Bo1 Qian Xiang2 Ruan Shan-ming3 Bei Wang3 Deng De-hou1

Xia Liang1 Li Qing-lin1 Tao Feng4 and Shen Min-he3

1Zhejiang Cancer Hospital Hangzhou Zhejiang 310022 China2Zhejiang Chinese Medical University Hangzhou Zhejiang 310053 China3The First Affiliated Hospital of Zhejiang Chinese Medical University Hangzhou Zhejiang 310006 China4Zhejiang Medical College Hangzhou Zhejiang 310053 China

Correspondence should be addressed to Tao Feng 12320934qqcom and Shen Min-he shenminhealiyuncom

Received 13 January 2015 Revised 17 May 2015 Accepted 26 May 2015

Academic Editor Klaus Heese

Copyright copy 2015 Zhang Bo et alThis is an open access article distributed under theCreativeCommonsAttribution License whichpermits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

The purpose is to study the intervention proliferation and differentiation on fibroblast by Shuizhongcao Granule during thetreatment of ROU and investigate the action mechanism in inflammatory microenvironment Proliferation of rat fibroblasts wasdetected using CCK8 Western blot was used to detect the effect of drug-containing serum on the expression of protein associatedwith NF-120581B and ERK pathway in rat fibroblasts Expression of IL-10 and IL-12 was detected by PCR Shuizhongcao Granule groupsuccessfully inhibited proliferation of rat fibroblastWestern blot results revealed that p65 and IKKBwere significantly less expressedin Chinesemedicine group while pI120581B120572 and pIKK120572120573 expression were significantly increasedWe have also found that in this groupthe expression of pAKTwas evidently suppressed and expression of pERK significantly decreased PCR results showed significantlydecreased expression levels of IL-10 and 1IL-12b inChinesemedicine groupwhile the expression of IL-12awas increasedOur resultssuggest that ShuizhongcaoGranule can suppress the proliferation of fibroblast and inhibit the activation ofNF-120581B and thus suppressinflammatory reactions possibly involving the inhibited expression of phosphorylated AKT rather than the canonical pathwayFurthermore it can inhibit ERK pathway and reduce IL-10 and IL-12b gene expression while enhancing IL-12a expression

1 Introduction

Recurrent oral ulcer (ROU) is themost frequent oralmucosaldisease with an incidence rate up to 25ndash30 [1] The maintype minor ROU accounts for 70ndash80 of all cases [2]ROU is also one of the most common complications ofchemotherapyThe current treatments mainly include antibi-otic therapy [3] hormonal therapy [4] medicine mouthwash[5] and laser therapy [6] but none of them proves to be veryeffective Finding a safe and effective medication to suppressinflammation is a hot and difficult research topic in this fieldSuppression of NF-120581B pathway to reduce the incidence givesa novel resolution to treat ROU [7] From the perspective of

traditional Chinese medicine ROU is a type of ldquoaphthaerdquowhich is usually considered to be associated with the phaseof ldquofirerdquo A proven formula in our hospital ShuizhongcaoDecoction (composed of buffalo horn urine sedimentCallicarpa etc) exhibited great efficacy in the clinicaltreatment through a mechanism of heat reduction bloodcooling and detoxification [8] This study evaluated theintervention effects of serum containing Shuizhongcao onrat fibroblasts and tested the optimal dosage and interventiontimeWe also detected the effect of Shuizhongcao Granule onERK and NF-120581B pathways usingWestern blot and expressionof IL-12 and IL-10 by RT-PCR Therein we evaluated theeffect and the mechanism of Shuizhongcao Granule on

Hindawi Publishing CorporationEvidence-Based Complementary and Alternative MedicineVolume 2015 Article ID 324091 9 pageshttpdxdoiorg1011552015324091

2 Evidence-Based Complementary and Alternative Medicine

the inflammatory microenvironment and the rat fibroblastsThe results are reported as follows

2 Materials

21 Experimental Cells Rat ear-tip fibroblasts were pur-chased from Shanghai SiDanSai Biotechnology Ltd (lotnumber 1702-100)

22 Experimental Animals Sixty Sprague-Dawley (SD) ratsin healthy and hygiene grade (weighted 180plusmn20 g 6ndash8 weekshalf male and half female) were provided by LaboratoryAnimal Center of Zhejiang Chinese Medical University

23 Chemicals and Medicines 5-FU was purchased fromZhejiang Chinese Medical Hospital manufactured by Tian-jin Jinyao Amino Acid Ltd (10mL 025 g lot number0909162 National Medicine Permit number H12020959)Chloral hydrate was purchased from Zhejiang Chinese Med-ical Hospital (specification 30m 3 g 30mLbottle Zhe-jiang Medicine Permit H20050357) NaOH crystal was pur-chased from Eastern China Medicine Ltd manufactured byHangzhou Xiaoshan Chemical Reagent Manufacturing (lotnumber 201003020) Shuizhongcao Granule (buffalo horntablet 30 g burned urine sediment 15 g and Callicarpa leaf15 g) 20 g crude drug per milliliter was purchased fromChinese Medicine Pharmacy of Zhejiang Chinese MedicalHospital (buffalo horn produced in Zhejiang lot number130112 burned urine sediment produced in Anhui lotnumber 121103 Callicarpa leaf produced in Zhejiang lotnumber 120922)

Preparation ofmedicine is as follows buffalo horn tabletsburned urine sediment and Callicarpa leaf (2 1 1 in weight)were soaked in pure water of 8ndash10 times in volume for30min Buffalo horn tablets were boiled alone for 30min andthen added with burned urine sediment and Callicarpa leafAfter boiling with high heat the medicines were then boiledwith low heat for 30min For the second time of boilingthe herb residues were added with pure water of 15 timesin volume and boiled for another 30min The decoctionsfrom the two boiling medcine juice were then condensed toa concentration with containing crude drug 20 gmL Themedicines were sterilized and packed for use

24 Reagents The reagents are trypsin (product number1310S Jinuo Biomedical Technology Hangzhou ZhejiangChina) fibroblast complete culture media (product number0810-500 Si Dan Sai Biotechnology Shanghai China) CCK8(catalog number CK04 Do jin do Molecular Technolo-gies Tokyo Japan) NF-120581B signaling pathway kit (prod-uct number 9936S Cell Signaling Technology Santa CruzCA USA) MAPK signaling pathway kit (product number8922S Cell Signaling Technology Santa Cruz CA USA)SIRT1 antibody (product number 9475S Cell Signaling Tech-nology Santa Cruz CA USA) Immobilon-P membrane(PVDF Shanghai Bai wei Biotechnology Shanghai China)RIPA lysis buffer (RIPA Beyotime Institute of Biotechnol-ogy Hangzhou Zhejiang China) BCA standard protein

(product number 10735108001 Roche Danvers MA USA)phosphatase inhibitor (number P5726-1mL Sigma-AldrichWI USA) protease inhibitor (product number WBP1265-1mL Sigma-Aldrich WI USA) 5x-loading-buffer (numberWB11236-1mL Sigma-Aldrich WI USA) anti-beta-actin(Actb 1 3000 Sigma-Aldrich WI USA) total RNA extrac-tion kit (product number 15596-026 Invitrogen New YorkUSA) Trizol (product number 1226-210 Invitrogen NewYork USA) PCR reverse transcription kit (product numberDRR037A TaKaRa Bio Inc Palo Alto CA USA) and SYBRPremix Ex TaqTM (product number RR420A Palo Alto CAUSA)

25 Laboratory Apparatus 5 CO2incubator HEPA Class

100 was purchased fromThermo Fisher Water bath thermo-stat oscylator was bought from Taicang Laboratory Instru-ment Manufacture CO

2incubator (5410-220) was made by

Precision Scientific Laminar flow hood was made by SuzhouAntai Air Technology Co Ltd (BCM-1000A) Counter topcentrifuge was purchased from Beijing Jingli Centrifuge CoLtd (LDZ 5-2) Electric Thermostat water bath (DK-450B type) was purchased from Shanghai Senxin Experimen-tal Instrument Co Ltd Liquid nitrogen tank was MVECRYOSYSTEM750 Microplate reader was made by ThermoFisher (3001-1249) UV spectrophotometer was made byEppendorf PCR gene amplifier was made by Bio-Rad Lab-oratories Inc (US) iQTM5 real-time quantitative PCR wasmade by Bio-Rad Laboratories Inc (US)

26 Preparation of Reagents Cell lysis buffer (025 pan-creatic enzyme +EDTA) was purchased freshly and storedin freezer at minus20∘C PBS buffer (pH 72ndash74) was purchasedfreshly and stored in refrigerator at 4∘C 30 acrylamidebissolution (propylene thalidomide 08 g and N-methylenebisacrylamide thalidomide 292 g in dd-water to a finalvolume of 100mL) was made in a fume hood stored at roomtemperature and protected from light 10 SDS (sodiumdodecyl sulfate) was made by dissolving 10 g SDS in dd-waterto a final volume of 100mL 10 ammonium persulfate (01 gammonium persulfate in 10mL dd-water) was made freshlyand stored at 4∘C less than a week 15mL 10 separatinggel was prepared in the fume hood with 6mL dd-water5mL 30 acrylamidebis solution 375mL pH 88 Tris-HCL150 120583L 10 SDS 150120583L 10 ammoniumpersulfate and 75120583LTEMED The gel was mixed and loaded immediately afterTEMED was added 5mL 5 stacking gel was preparedin the fume hood with 375mL dd-water 067mL 30acrylamidebis solution 062mLpH68 Tris-HCL 50120583L 10SDS 50 120583L 10 ammoniumpersulfate and 5120583LTEMEDThegel was mixed and loaded immediately after TEMED wasadded 1x electrophoresis buffer was made by diluting 100mL10x electrophoresis buffer in dd-water to a final volume of1000mL 1x transfer buffer was made by mixing 303 g Tris144 g glycine and 200mL methanol in dd-water to a finalvolume of 1000mL 10x TBS was made by dissolving 242 gTris and 80 gNaCl in dd-water to a final volume of 800mLadjusting pH to 75 using appropriate amount of HCl andbringing up to 1000mL dd-water 1x TBST was prepared

Evidence-Based Complementary and Alternative Medicine 3

by mixing 10x TBS 100mL and Tween 20 1mL in dd-waterto a final volume of 1000mL Blocking buffer was made bydissolving 5 g fat-free milk powder or bovine serum albumin(BSA) in 100mL 1x TBST

3 Methods

31 Experimental Animal and Group Assignment Sixtyhealthy rats (180 plusmn 20 g 6ndash8 weeks half male and halffemale) were fed for an acclimated period of a week and thenrandomized into three groups blank control group salinegroup and Shuizhongcao treatment group

32 Establishment of Experimental Animal Model The ratswere intraperitoneally administrated with 5-fluorouracil (5-Fu)with a dose of 5mg100 g for chemotherapyOn the fourthday after chemotherapy rats were anesthetized with 10chloral hydrate intraperitoneal injection (03mL100mL) Apiece of NaOH of appropriate size (15mm times 15mm) wasplaced by a straight head tweezer on the ratrsquos right sidecheekmucosa for 5ndash10 seconds until the naked appearance ofredness and ulcer Afterward all three groups were fed withnormal diet From the second day after surgery saline groupand Chinese medicine group were intragastrically adminis-trated with standard saline and Shuizhongcao (1mL100 g)twice a day respectively for a total of 10 days No additionaltreatment was applied to the blank control group

33 Preparation of Rat Serum At day 11 after surgery the ratswere anesthetized with 10 chloral hydrate intraperitonealinjection (03mL100mL) and euthanized by abdominalaorta exsanguination The peripheral blood obtained fromrats was pipetted into a centrifuge tube containing 10 EDTAand pancreatic enzymes After 10min centrifugation at 200 gthe supernatant which was the serum was collected andstored in an ultralow freezer at minus80∘C

34 Culture of Rat Fibroblast Rat fibroblasts were cultured infibroblast complete media and passaged when they reachedconfluence After being subcultured for 6-7 passages thecells reached the log phase of growth and were ready forexperiment

35 Detection of Drug-Containing Serum on Fibroblast byCCK8 Assay The fibroblasts in log growth phase werecounted and seeded in three 96-well plates labeled with 12 h24 h and 36 h respectively Each plate was divided into tengroups and each group contained 7 subgroups 5 10 and15 Chinese medicine group and 5 10 and 15 salinegroup and blank group After 12 h 24 h and 36 h incubationthe corresponding 96-well plates were taken out and CCK8solution was added to each well with 10 120583L and continuedincubation for 3h The absorbance was detected and growthcurve was plotted

36 NF-120581B and ERK Pathway Protein Expression Detectedby Western Blot Cells from Chinese medicine group salinegroup and blank group were collected washed in PBS

Table 1 Real-time PCR primers

Gene Primer sequence

GAPDH GGAGCGAGATCCCTCCAAAATGGCTGTTGTCATACTTCTCATGG

IL-10 GCTATGTTGCCTGCTCTTACTGTCTGGCTGACTGGGAAGTG

IL-12a AGACATCACACGGGACAAAACCACAGGGTCATCATCAAAGAAG

IL-12b AGCACTCCCCATTCCTACTTCTAACGCACCTTTCTGGTTAC

Group

0

02

04

06

08

1

12

OD

val

ue

Blan

k gr

oup

12h24h

36h48h

5

cont

rol

grou

p

10

cont

rol

grou

p

15

cont

rol

grou

p

5

Chi

nese

med

icin

e gro

up

10

Chi

nese

med

icin

e gro

up

15

Chi

nese

med

icin

e gro

up

Figure 1 Cell growth and time relationship following serumintervention in control group and Chinese medicine group Note995333119875 lt 005 between Chinese medicine group and control group at

the same time point

solution and lysed with lysis buffer Total protein wasextracted and quantified using BCA assay 40120583L proteinsample was loaded in each well for SDS-PAGE The proteinwas transferred from polyacrylamide gel to PVDFmembraneby electrotransfer The PVDF membrane with transferredprotein was blocked with TBST containing 5 BSA (bovineserum albumin) overnight The membrane was incubatedwith primary antibody (1 1000) for 2 h at 37∘C and washedwith TBS 3 times 10min each time The membrane wasthen incubated with secondary antibody (1 5000) for 2 h at37∘C and washed with TBS 3 times 10min each time Themembrane was developed using ECL solutions and imaged

37 Expression of IL-10 IL-12a and IL-12b in Rat Fibroblastsin Each Group Detected by Real-Time Quantitative PCRTotal mRNA of cells from each group was extracted at 48 hafter serum treatment using absorption column centrifugalmethod After concentration purity and integrity assess-ment mRNA was reversely transcribed into cDNA followingthe instruction of reverse transcription kit Levels of IL-10 IL-12a and IL-12b were detected by fluorescence-basedquantitative RT-PCR Primers were designed using software

4 Evidence-Based Complementary and Alternative Medicine

Table 2 OD values of rat fibroblast following intervention by Chinese medicine containing serum and control serum (119883 plusmn 119878 119899 = 6)

Group Time Zero pores12 h 24 h 36 h 48 h

5 control group 04944 plusmn 001294 06412 plusmn 003167 08769 plusmn 003631 10179 plusmn 004123 00834 plusmn 00112310 control group 04240 plusmn 000884 05231 plusmn 002622 06874 plusmn 002147 07213 plusmn 001843 00782 plusmn 00087315 control group 03713 plusmn 000968 04035 plusmn 001732 05589 plusmn 001483 06633 plusmn 001627 00761 plusmn 0013745 Chinese medicine group 05833 plusmn 002643995333 06934 plusmn 001216995333 09088 plusmn 001736 10235 plusmn 003513 00851 plusmn 00116510 Chinese medicine group 04780 plusmn 001637995333 05687 plusmn 001072995333 07189 plusmn 002987995333 08636 plusmn 001532995333 00801 plusmn 00219815 Chinese medicine group 04083 plusmn 000996 04488 plusmn 000832995333 05986 plusmn 001653995333 07399 plusmn 001843995333 00719 plusmn 001682Blank group 05901 plusmn 002398 07287 plusmn 003128 09432 plusmn 003612 10213 plusmn 002871 00912 plusmn 001572Note 995333119875 lt 005 between Chinese medicine group and control group at the same time point

0200000400000600000800000

100000012000001400000

Gre

y le

vel

Target protein

p-P65

p-P65

IKK120573

IKK120573

p-I120581B120572

p-I120581B120572

p-IKK120572120573

p-IKK120572120573

Beta-actin

Beta-actin

Shuizhongcao group

Shuizhongcao group

NS group

NS group

Control group

Control group

Figure 2 Protein expression of NF-120581B pathway

Primer Premier 60 and Beacon Designer and synthesized byShenggong Bioengineering Technology Co Ltd (Shanghai)Primer sequences are listed in Table 1

Reaction conditions were as follows reverse transcrip-tion 37∘C for 15min and 85∘C for 5 sec PCR reaction wasas follows 95∘C for 5 sec and 60∘C for 30 sec (annealing) 40

cycles (fluorescence collection) melting curve analysis was50∘C to 95∘C

38 Statistical Analysis Quantitative data were expressed asmean plusmn standard deviation (119883 plusmn 119878) SPSS 170 statisticalsoftware was used for statistical and variance analysis

Evidence-Based Complementary and Alternative Medicine 5

0

500000

1000000

1500000

2000000

2500000

3000000

Target protein

Gre

y le

vel

p-ERK12

p-ERK12

ERK12 (internal reference)

ERK12 (internal reference)

Shuizhongcaogroup

Shuizhongcao group

NS group

NS group

Control group

Control group

Figure 3 Expression of phosphorylated ERK12

4 Results

41 Rat Model Establishment 12 h after rat model estab-lishment buccal mucosal vasodilatation increased capillarynetwork and tissue edema were observed At 24 h edemabecame serious The mucosal epithelial layer slightly exfoli-ated and the surface was covered with exudates At 48 h theoral ulcer formed and the mucosa turned red extensivelywhich was covered by large pieces of pseudomembranesappearing yellowish white in color and easily exfoliatedA specialist in pathology confirmed the diagnosis and thesuccess of model establishment

42 Culture of Rat Fibroblasts The rat fibroblast culture grewwell after subculturing

43 CCK8 Results of Fibroblast Intervention by ControlSerum andDrug-Containing Serum As shown in Table 2 andFigure 1 serum in both control group and Chinese medicinegroup was able to suppress rat fibroblast proliferation sig-nificantly different from that in blank group (119875 lt 005)The suppressive effect was positively but not proportionallycorrelated with dosage and treatment time The serum con-taining Chinese medicine reduced the suppressive effect of

inflammation on rat fibroblasts The difference between eachgroup was statistically significant (119875 lt 005)

44 Western Blot Results following Serum Intervention ofRat Fibroblasts

441 Expression of Protein Associated with NF-120581B Path-way The results showed that serum containing Shuizhong-cao Granule significantly downregulated the expression ofphosphorylated P65 demonstrating its ability to suppress theactivation and relevant protein expression of NF-120581B pathwayIn the meantime Shuizhongcao increased phosphorylatedI120581B120572 and phosphorylated IKK120572120573 expression facilitatingthe activation of canonical NF-120581B pathway The differencesbetween each parameter from Shuizhongcao group (exceptfor internal standard) and that of two other groups werestatistically significant (119875 lt 005) Differences between NSgroup (NS group is short for ldquonormal saline grouprdquo) andcontrol group were not significant See Figure 2

442 Expression of Phosphorylated ERK12 The resultsdemonstrated that Shuizhongcao-containing serum led tosuppressed expression of phosphorylated ERK12 and thusinhibited ERK mediated proliferation pathway The differ-ence of phosphorylated ERK12 expression level between

6 Evidence-Based Complementary and Alternative Medicine

0

200000

400000

600000

800000

1000000

1200000

1400000

1600000

1800000

2000000

p-AKT

p-AKT

Beta-actin

Beta-actin

Target protein

Gre

y le

vel

Shuizhongcao groupNS groupControl group

Shuizhongcaogroup

NS group Control group

Figure 4 Expression of phosphorylated AKT

Shuizhongcao group and control group as well as NS groupand control group was statistically significant (119875 lt 005) SeeFigure 3

443 Expression of Phosphorylated AKT The results demon-strated that Shuizhongcao-containing serum suppressed theexpression of phosphorylated AKT Differences between thephosphorylatedAKT expression level of Shuizhongcao groupand that of two other groups were statistically significant(119875 lt 005) respectively The difference between NS groupand control group was not significant See Figure 4

45 PCR Results of IL-10 IL-12a and IL-12b Consideringthe large variations in PCR measurements a normal groupwas set up that is using drug-containing rat serum withoutany treatment as reference The measurements in the con-trol group and Chinese medicine group were respectivelydivided by the values in the normal group to calculate relativeexpression amounts tomore objectively reflect the expressiondifference

The results showed that levels of IL-10 expression in bothChinesemedicine group and control group were significantlyincreased (119875 lt 001) compared with normal control groupThe expression levels of IL-10 and IL-12a in Chinesemedicinegroup were significantly decreased compared with those incontrol group (119875 lt 001) When compared with normal

group IL-12a expression level was increased in Chinesemedicine group while it decreased in control group withsignificant differences (119875 lt 001) When compared withnormal group the IL-12b expression level was decreased inChinese medicine group while it increased in control groupwith significant differences See Figure 5

5 Discussion

Fibroblast proliferation is crucial for the healing of oralulcers CCK8 assay indicated that Shuizhongcao Granuledid enhance fibroblast proliferation Western blot showedthat the serum containing Shuizhongcao Granule inhibitedAKT expression in fibroblasts We supposed that fibroblastproliferation was related to inflammation inhibition causedby AKT inhibition However this needs to be confirmed bycontrolled trial of gene silencing We aimed to identify theeffect of Shuizhongcao Granule on oral ulcers in animal andcell models using CCK8 assay and the results confirmed thatfibroblast proliferation was enhanced Subsequent Westernblot and PCR were intended to find out the reasons for thisand to collect data for analysis

According to our preliminary research ShuizhongcaoGranule was able to increase the red blood cell Cab receptorrosette formation rate but decrease immune complex rosetteformation rate in red blood cells [9] We also demonstratedthat in ROU Shuizhongcao Granule was capable of

Evidence-Based Complementary and Alternative Medicine 7

0

1

2

3

4

5

6

7

IL-10 IL-12a IL-12b

Blank groupChinese medicine group

Relat

ive e

xpre

ssio

n

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)

4000E minus 2

9000E minus 2

1400E minus 1

1900E minus 1

GAPDH

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-10

1300E minus 1

1100E minus 1

9000E minus 2

7000E minus 2

5000E minus 2

3000E minus 2

1000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12a

1800E minus 1

1300E minus 1

8000E minus 2

3000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12b

2400E minus 1

1900E minus 1

1400E minus 1

9000E minus 2

4000E minus 2

GAPDH

5000

4000

3000

2000

1000

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot

IL-12a

0 5 10 15 20 25 30 35 40

Cycle

5000

4000

3000

2000

1000

Amplification plot

IL-10

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4600

4100

3600

3100

2600

2100

1600

1100

6000E minus 1

IL-12b

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4400

3900

3400

2900

2400

1900

1400

9000E minus 1

4000E minus 1

Rn

Rn

Rn

RnRn

Rn

Rn

Rn

The PCR melting curve of GAPDH IL-10 IL-12a and IL-12b

The PCR amplification curve of GAPDH IL-10 IL-12a and IL-12b

Figure 5 Relative expression of IL-10 IL-12a and IL-12 Note 995333995333 compared with control group 119875 lt 001

increasing the percentage of CD3 and CD4 positive cellsCD4CD8 ratio and serum level of IL-12 and decreasingserum level of IL-10 [10] Through the rat ROU modelwe compared the recovery time of ulcers in Shuizhongcaogroup and model group and demonstrated the efficacy of

Shuizhongcao Granule in treating ROU The in vivo effect ofinflammation inhibition of Shuizhongcao was demonstratedby levels of IL-4 IL-8 and GM-CSF in rat serum

Based on the preliminary research this study focusedon exploring the pathways associated with inflammation

8 Evidence-Based Complementary and Alternative Medicine

NF-120581B is a canonical pathway associated among otherswith inflammation It has also been reported that NF-120581Bregulates several hundred genes involved in cell growthdifferentiation and apoptosis [11] Here we reported thatthe level of phosphorylated P65 in Chinese medicine groupwas significantly decreased compared with two other groupsSince the expression of NF-120581B pathway mainly relies on thebinding of phosphorylated P65 on the particular gene targetin the nucleus NF-120581B pathwaymight be inhibited in the Chi-nese medicine group However further experiments showedthat after the treatment of Chinese medicine expressionlevels of phosphorylated I120581B120572 and phosphorylated IKK120572120573increased while IKK120573 expression was decreased which wascontrary to what should be presented by the canonicalpathway Therefore we speculate that Shuizhongcao Granulesuppresses the activation of NF-120581B pathway through inhibit-ing an alternative unknown pathway rather than inhibitingthe canonical pathway

Our preliminary data showed that serum containingShuizhongcao facilitated fibroblast proliferation (or inhib-ited inflammation lesions) Thus we speculated that serumcontaining Shuizhongcao Granule would be able to acti-vate ERK pathway promote cell proliferation and suppressapoptosis However the results demonstrated that drug-containing serum inhibited the expression of phosphory-lated ERK12 which are the key players of ERK pathwayTherefore we inferred that the ability of ShuizhongcaoGranule to promote cell proliferation is through the inhibi-tion of p-AKT expression and thus to regulate the NF-120581Bpathway

As a major player on antiapoptotic pathway AKT canexert a dominant negative effect and inhibit insulin-likegrowth factor 1 (IGF1) mediated cell growth thus persistentactivation of AKT inhibits PTEN mediated apoptosis AKTalso affects cell survival by an indirect effect on Pi3k-AKTand P53 [12] It has been shown that [13ndash15] AKT indirectlyaffects NF-120581B and P53 and thus influences cell survivalBy phosphorylating and activating kB kinase (IKK) AKTleads to the degradation of I120581B an inhibitor of NF-120581B andthus results in cytoplasm release and nuclear translocationof NF-120581B which in turn activates its target genes andpromotes cell survival Our experiments showed that Chinesemedicine containing serum significantly inhibited the level ofphosphorylated AKT Therefore we inferred that it was theAKT-NF-120581B signaling pathway that Shuizhongcao Granuleacted through on fibroblasts

Our study confirmed the ability of Shuizhongcao toaccelerate the recovery of ROU rat and further demonstratedthat the mode of action was associated with inflammatoryreaction inhibition The mechanism underlying facilitationof fibroblast proliferation by Shuizhongcao is yet to bediscovered Our research provides an experimental rationalefor the application of Shuizhongcao in clinical therapy

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

Zhang Bo Ruan Shan-ming Wang Bei and Li Qing-lincontributed equally to the project and are considered co-firstauthors

Acknowledgments

The authors wish to acknowledge The Zhejiang ProvincialNatural Science Foundation of China (2010ZZ003) ldquoIntegra-tive Medicinerdquo Key Discipline of Zhejiang University Pro-gram and The First Affiliated Hospital of Zhejiang ChineseMedical University Eagles Program for the Cultivation ofTalents

References

[1] B Tarakji K Baroudi and Y Kharma ldquoThe effect of dietaryhabits on the development of the recurrent aphthous stomatitisrdquoNigerian Medical Journal vol 53 no 1 pp 9ndash11 2012

[2] W Meng Y Dong J Liu et al ldquoA clinical evaluation ofamlexanox oral adhesive pellicles in the treatment of recurrentaphthous stomatitis and comparison with amlexanox oraltablets a randomized placebo controlled blinded multicenterclinical trialrdquo Trials vol 10 article 30 2009

[3] S Tsuyuki K Kawaguchi Y Kawata et al ldquoUsefulness ofantimycotic agents (itraconazole) in chemotherapy-inducedmucositis of breast cancer patientsrdquo Gan To Kagaku Ryoho vol39 no 9 pp 1369ndash1373 2012

[4] A R Tappuni T Kovacevic P J Shirlaw et al ldquoClinicalassessment of disease severity in recurrent aphthous stomatitisrdquoJournal of Oral PathologyampMedicine vol 42 no 8 pp 635ndash6412013

[5] N Babaee D Moslemi M Khalilpour et al ldquoAntioxidantcapacity of calendula officinalis flowers extract and preventionof radiation induced oropharyngeal mucositis in patients withhead and neck cancers a randomized controlled clinical studyrdquoDaru vol 21 no 1 article 18 2013

[6] B V Caputo G A N Filho C C dos Santos Y Okida andE M Giovani ldquoLaser therapy of recurrent aphthous ulcer inpatient with HIV infectionrdquoCase Reports inMedicine vol 2012Article ID 695642 3 pages 2012

[7] X M Yang X H Wang L F Chen et al ldquoEffects of dihy-dromyricetin on tumor necrosis factor and NF-kappaB p65 ofRAU ratsrdquo Zhongguo Zhong Yao Za Zhi vol 37 no 17 pp 2612ndash2617 2012

[8] T Jin M-H Shen Y-F Sun et al ldquoShuizhongcao decoctiontreatment chemotherapy induced oral ulcerrdquo Chinese Archivesof Traditional ChineseMedicine vol 27 no 2 pp 303ndash305 2009

[9] M H Shen S M Ruan andMH Bao ldquoEffect of shuizhongcaogranule on cellular immune function of experimental animalwith recurrent aphthous stomatitisrdquo Zhongguo Zhong Xi Yi JieHe Za Zhi vol 29 no 10 pp 901ndash904 2009

[10] M H Shen S M Ruan and M H Bao ldquoResearch ofShuizhongcao Granule on experimental animal recurrentoralulcer of the red cell immune functionrdquo Chinese Archivesof Traditional Chinese Medicine vol 26 no 12 pp 2605ndash26072008

[11] A Siomek ldquoNF-120581B signaling pathway and free radical impactrdquoActa Biochimica Polonica vol 59 no 3 pp 323ndash331 2012

Evidence-Based Complementary and Alternative Medicine 9

[12] S-J Jeong C A Pise-Masison M F Radonovich H U Parkand J N Brady ldquoActivated AKT regulates NF-120581B activationp53 inhibition and cell survival in HTLV-1-transformed cellsrdquoOncogene vol 24 no 44 pp 6719ndash6728 2005

[13] F Busch A Mobasheri P Shayan R Stahlmann and MShakibaei ldquoSirt-1 is required for the inhibition of apoptosis andinflammatory responses in human tenocytesrdquo The Journal ofBiological Chemistry vol 287 no 31 pp 25770ndash25781 2012

[14] F Busch A Mobasheri P Shayan et al ldquoResveratrol modulatesinterleukin-1beta-induced phosphatidylinositol 3-kinase andnuclear factor kappaB signaling pathways in human tenocytesrdquoThe Journal of Biological Chemistry vol 287 no 45 pp 38050ndash38063 2012

[15] Y D Park Y S Kim Y M Jung et al ldquoPorphyromonasgingivalis lipopolysaccharide regulates interleukin (IL)-17 andIL-23 expression via SIRT1 modulation in human periodontalligament cellsrdquo Cytokine vol 60 no 1 pp 284ndash293 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

2 Evidence-Based Complementary and Alternative Medicine

the inflammatory microenvironment and the rat fibroblastsThe results are reported as follows

2 Materials

21 Experimental Cells Rat ear-tip fibroblasts were pur-chased from Shanghai SiDanSai Biotechnology Ltd (lotnumber 1702-100)

22 Experimental Animals Sixty Sprague-Dawley (SD) ratsin healthy and hygiene grade (weighted 180plusmn20 g 6ndash8 weekshalf male and half female) were provided by LaboratoryAnimal Center of Zhejiang Chinese Medical University

23 Chemicals and Medicines 5-FU was purchased fromZhejiang Chinese Medical Hospital manufactured by Tian-jin Jinyao Amino Acid Ltd (10mL 025 g lot number0909162 National Medicine Permit number H12020959)Chloral hydrate was purchased from Zhejiang Chinese Med-ical Hospital (specification 30m 3 g 30mLbottle Zhe-jiang Medicine Permit H20050357) NaOH crystal was pur-chased from Eastern China Medicine Ltd manufactured byHangzhou Xiaoshan Chemical Reagent Manufacturing (lotnumber 201003020) Shuizhongcao Granule (buffalo horntablet 30 g burned urine sediment 15 g and Callicarpa leaf15 g) 20 g crude drug per milliliter was purchased fromChinese Medicine Pharmacy of Zhejiang Chinese MedicalHospital (buffalo horn produced in Zhejiang lot number130112 burned urine sediment produced in Anhui lotnumber 121103 Callicarpa leaf produced in Zhejiang lotnumber 120922)

Preparation ofmedicine is as follows buffalo horn tabletsburned urine sediment and Callicarpa leaf (2 1 1 in weight)were soaked in pure water of 8ndash10 times in volume for30min Buffalo horn tablets were boiled alone for 30min andthen added with burned urine sediment and Callicarpa leafAfter boiling with high heat the medicines were then boiledwith low heat for 30min For the second time of boilingthe herb residues were added with pure water of 15 timesin volume and boiled for another 30min The decoctionsfrom the two boiling medcine juice were then condensed toa concentration with containing crude drug 20 gmL Themedicines were sterilized and packed for use

24 Reagents The reagents are trypsin (product number1310S Jinuo Biomedical Technology Hangzhou ZhejiangChina) fibroblast complete culture media (product number0810-500 Si Dan Sai Biotechnology Shanghai China) CCK8(catalog number CK04 Do jin do Molecular Technolo-gies Tokyo Japan) NF-120581B signaling pathway kit (prod-uct number 9936S Cell Signaling Technology Santa CruzCA USA) MAPK signaling pathway kit (product number8922S Cell Signaling Technology Santa Cruz CA USA)SIRT1 antibody (product number 9475S Cell Signaling Tech-nology Santa Cruz CA USA) Immobilon-P membrane(PVDF Shanghai Bai wei Biotechnology Shanghai China)RIPA lysis buffer (RIPA Beyotime Institute of Biotechnol-ogy Hangzhou Zhejiang China) BCA standard protein

(product number 10735108001 Roche Danvers MA USA)phosphatase inhibitor (number P5726-1mL Sigma-AldrichWI USA) protease inhibitor (product number WBP1265-1mL Sigma-Aldrich WI USA) 5x-loading-buffer (numberWB11236-1mL Sigma-Aldrich WI USA) anti-beta-actin(Actb 1 3000 Sigma-Aldrich WI USA) total RNA extrac-tion kit (product number 15596-026 Invitrogen New YorkUSA) Trizol (product number 1226-210 Invitrogen NewYork USA) PCR reverse transcription kit (product numberDRR037A TaKaRa Bio Inc Palo Alto CA USA) and SYBRPremix Ex TaqTM (product number RR420A Palo Alto CAUSA)

25 Laboratory Apparatus 5 CO2incubator HEPA Class

100 was purchased fromThermo Fisher Water bath thermo-stat oscylator was bought from Taicang Laboratory Instru-ment Manufacture CO

2incubator (5410-220) was made by

Precision Scientific Laminar flow hood was made by SuzhouAntai Air Technology Co Ltd (BCM-1000A) Counter topcentrifuge was purchased from Beijing Jingli Centrifuge CoLtd (LDZ 5-2) Electric Thermostat water bath (DK-450B type) was purchased from Shanghai Senxin Experimen-tal Instrument Co Ltd Liquid nitrogen tank was MVECRYOSYSTEM750 Microplate reader was made by ThermoFisher (3001-1249) UV spectrophotometer was made byEppendorf PCR gene amplifier was made by Bio-Rad Lab-oratories Inc (US) iQTM5 real-time quantitative PCR wasmade by Bio-Rad Laboratories Inc (US)

26 Preparation of Reagents Cell lysis buffer (025 pan-creatic enzyme +EDTA) was purchased freshly and storedin freezer at minus20∘C PBS buffer (pH 72ndash74) was purchasedfreshly and stored in refrigerator at 4∘C 30 acrylamidebissolution (propylene thalidomide 08 g and N-methylenebisacrylamide thalidomide 292 g in dd-water to a finalvolume of 100mL) was made in a fume hood stored at roomtemperature and protected from light 10 SDS (sodiumdodecyl sulfate) was made by dissolving 10 g SDS in dd-waterto a final volume of 100mL 10 ammonium persulfate (01 gammonium persulfate in 10mL dd-water) was made freshlyand stored at 4∘C less than a week 15mL 10 separatinggel was prepared in the fume hood with 6mL dd-water5mL 30 acrylamidebis solution 375mL pH 88 Tris-HCL150 120583L 10 SDS 150120583L 10 ammoniumpersulfate and 75120583LTEMED The gel was mixed and loaded immediately afterTEMED was added 5mL 5 stacking gel was preparedin the fume hood with 375mL dd-water 067mL 30acrylamidebis solution 062mLpH68 Tris-HCL 50120583L 10SDS 50 120583L 10 ammoniumpersulfate and 5120583LTEMEDThegel was mixed and loaded immediately after TEMED wasadded 1x electrophoresis buffer was made by diluting 100mL10x electrophoresis buffer in dd-water to a final volume of1000mL 1x transfer buffer was made by mixing 303 g Tris144 g glycine and 200mL methanol in dd-water to a finalvolume of 1000mL 10x TBS was made by dissolving 242 gTris and 80 gNaCl in dd-water to a final volume of 800mLadjusting pH to 75 using appropriate amount of HCl andbringing up to 1000mL dd-water 1x TBST was prepared

Evidence-Based Complementary and Alternative Medicine 3

by mixing 10x TBS 100mL and Tween 20 1mL in dd-waterto a final volume of 1000mL Blocking buffer was made bydissolving 5 g fat-free milk powder or bovine serum albumin(BSA) in 100mL 1x TBST

3 Methods

31 Experimental Animal and Group Assignment Sixtyhealthy rats (180 plusmn 20 g 6ndash8 weeks half male and halffemale) were fed for an acclimated period of a week and thenrandomized into three groups blank control group salinegroup and Shuizhongcao treatment group

32 Establishment of Experimental Animal Model The ratswere intraperitoneally administrated with 5-fluorouracil (5-Fu)with a dose of 5mg100 g for chemotherapyOn the fourthday after chemotherapy rats were anesthetized with 10chloral hydrate intraperitoneal injection (03mL100mL) Apiece of NaOH of appropriate size (15mm times 15mm) wasplaced by a straight head tweezer on the ratrsquos right sidecheekmucosa for 5ndash10 seconds until the naked appearance ofredness and ulcer Afterward all three groups were fed withnormal diet From the second day after surgery saline groupand Chinese medicine group were intragastrically adminis-trated with standard saline and Shuizhongcao (1mL100 g)twice a day respectively for a total of 10 days No additionaltreatment was applied to the blank control group

33 Preparation of Rat Serum At day 11 after surgery the ratswere anesthetized with 10 chloral hydrate intraperitonealinjection (03mL100mL) and euthanized by abdominalaorta exsanguination The peripheral blood obtained fromrats was pipetted into a centrifuge tube containing 10 EDTAand pancreatic enzymes After 10min centrifugation at 200 gthe supernatant which was the serum was collected andstored in an ultralow freezer at minus80∘C

34 Culture of Rat Fibroblast Rat fibroblasts were cultured infibroblast complete media and passaged when they reachedconfluence After being subcultured for 6-7 passages thecells reached the log phase of growth and were ready forexperiment

35 Detection of Drug-Containing Serum on Fibroblast byCCK8 Assay The fibroblasts in log growth phase werecounted and seeded in three 96-well plates labeled with 12 h24 h and 36 h respectively Each plate was divided into tengroups and each group contained 7 subgroups 5 10 and15 Chinese medicine group and 5 10 and 15 salinegroup and blank group After 12 h 24 h and 36 h incubationthe corresponding 96-well plates were taken out and CCK8solution was added to each well with 10 120583L and continuedincubation for 3h The absorbance was detected and growthcurve was plotted

36 NF-120581B and ERK Pathway Protein Expression Detectedby Western Blot Cells from Chinese medicine group salinegroup and blank group were collected washed in PBS

Table 1 Real-time PCR primers

Gene Primer sequence

GAPDH GGAGCGAGATCCCTCCAAAATGGCTGTTGTCATACTTCTCATGG

IL-10 GCTATGTTGCCTGCTCTTACTGTCTGGCTGACTGGGAAGTG

IL-12a AGACATCACACGGGACAAAACCACAGGGTCATCATCAAAGAAG

IL-12b AGCACTCCCCATTCCTACTTCTAACGCACCTTTCTGGTTAC

Group

0

02

04

06

08

1

12

OD

val

ue

Blan

k gr

oup

12h24h

36h48h

5

cont

rol

grou

p

10

cont

rol

grou

p

15

cont

rol

grou

p

5

Chi

nese

med

icin

e gro

up

10

Chi

nese

med

icin

e gro

up

15

Chi

nese

med

icin

e gro

up

Figure 1 Cell growth and time relationship following serumintervention in control group and Chinese medicine group Note995333119875 lt 005 between Chinese medicine group and control group at

the same time point

solution and lysed with lysis buffer Total protein wasextracted and quantified using BCA assay 40120583L proteinsample was loaded in each well for SDS-PAGE The proteinwas transferred from polyacrylamide gel to PVDFmembraneby electrotransfer The PVDF membrane with transferredprotein was blocked with TBST containing 5 BSA (bovineserum albumin) overnight The membrane was incubatedwith primary antibody (1 1000) for 2 h at 37∘C and washedwith TBS 3 times 10min each time The membrane wasthen incubated with secondary antibody (1 5000) for 2 h at37∘C and washed with TBS 3 times 10min each time Themembrane was developed using ECL solutions and imaged

37 Expression of IL-10 IL-12a and IL-12b in Rat Fibroblastsin Each Group Detected by Real-Time Quantitative PCRTotal mRNA of cells from each group was extracted at 48 hafter serum treatment using absorption column centrifugalmethod After concentration purity and integrity assess-ment mRNA was reversely transcribed into cDNA followingthe instruction of reverse transcription kit Levels of IL-10 IL-12a and IL-12b were detected by fluorescence-basedquantitative RT-PCR Primers were designed using software

4 Evidence-Based Complementary and Alternative Medicine

Table 2 OD values of rat fibroblast following intervention by Chinese medicine containing serum and control serum (119883 plusmn 119878 119899 = 6)

Group Time Zero pores12 h 24 h 36 h 48 h

5 control group 04944 plusmn 001294 06412 plusmn 003167 08769 plusmn 003631 10179 plusmn 004123 00834 plusmn 00112310 control group 04240 plusmn 000884 05231 plusmn 002622 06874 plusmn 002147 07213 plusmn 001843 00782 plusmn 00087315 control group 03713 plusmn 000968 04035 plusmn 001732 05589 plusmn 001483 06633 plusmn 001627 00761 plusmn 0013745 Chinese medicine group 05833 plusmn 002643995333 06934 plusmn 001216995333 09088 plusmn 001736 10235 plusmn 003513 00851 plusmn 00116510 Chinese medicine group 04780 plusmn 001637995333 05687 plusmn 001072995333 07189 plusmn 002987995333 08636 plusmn 001532995333 00801 plusmn 00219815 Chinese medicine group 04083 plusmn 000996 04488 plusmn 000832995333 05986 plusmn 001653995333 07399 plusmn 001843995333 00719 plusmn 001682Blank group 05901 plusmn 002398 07287 plusmn 003128 09432 plusmn 003612 10213 plusmn 002871 00912 plusmn 001572Note 995333119875 lt 005 between Chinese medicine group and control group at the same time point

0200000400000600000800000

100000012000001400000

Gre

y le

vel

Target protein

p-P65

p-P65

IKK120573

IKK120573

p-I120581B120572

p-I120581B120572

p-IKK120572120573

p-IKK120572120573

Beta-actin

Beta-actin

Shuizhongcao group

Shuizhongcao group

NS group

NS group

Control group

Control group

Figure 2 Protein expression of NF-120581B pathway

Primer Premier 60 and Beacon Designer and synthesized byShenggong Bioengineering Technology Co Ltd (Shanghai)Primer sequences are listed in Table 1

Reaction conditions were as follows reverse transcrip-tion 37∘C for 15min and 85∘C for 5 sec PCR reaction wasas follows 95∘C for 5 sec and 60∘C for 30 sec (annealing) 40

cycles (fluorescence collection) melting curve analysis was50∘C to 95∘C

38 Statistical Analysis Quantitative data were expressed asmean plusmn standard deviation (119883 plusmn 119878) SPSS 170 statisticalsoftware was used for statistical and variance analysis

Evidence-Based Complementary and Alternative Medicine 5

0

500000

1000000

1500000

2000000

2500000

3000000

Target protein

Gre

y le

vel

p-ERK12

p-ERK12

ERK12 (internal reference)

ERK12 (internal reference)

Shuizhongcaogroup

Shuizhongcao group

NS group

NS group

Control group

Control group

Figure 3 Expression of phosphorylated ERK12

4 Results

41 Rat Model Establishment 12 h after rat model estab-lishment buccal mucosal vasodilatation increased capillarynetwork and tissue edema were observed At 24 h edemabecame serious The mucosal epithelial layer slightly exfoli-ated and the surface was covered with exudates At 48 h theoral ulcer formed and the mucosa turned red extensivelywhich was covered by large pieces of pseudomembranesappearing yellowish white in color and easily exfoliatedA specialist in pathology confirmed the diagnosis and thesuccess of model establishment

42 Culture of Rat Fibroblasts The rat fibroblast culture grewwell after subculturing

43 CCK8 Results of Fibroblast Intervention by ControlSerum andDrug-Containing Serum As shown in Table 2 andFigure 1 serum in both control group and Chinese medicinegroup was able to suppress rat fibroblast proliferation sig-nificantly different from that in blank group (119875 lt 005)The suppressive effect was positively but not proportionallycorrelated with dosage and treatment time The serum con-taining Chinese medicine reduced the suppressive effect of

inflammation on rat fibroblasts The difference between eachgroup was statistically significant (119875 lt 005)

44 Western Blot Results following Serum Intervention ofRat Fibroblasts

441 Expression of Protein Associated with NF-120581B Path-way The results showed that serum containing Shuizhong-cao Granule significantly downregulated the expression ofphosphorylated P65 demonstrating its ability to suppress theactivation and relevant protein expression of NF-120581B pathwayIn the meantime Shuizhongcao increased phosphorylatedI120581B120572 and phosphorylated IKK120572120573 expression facilitatingthe activation of canonical NF-120581B pathway The differencesbetween each parameter from Shuizhongcao group (exceptfor internal standard) and that of two other groups werestatistically significant (119875 lt 005) Differences between NSgroup (NS group is short for ldquonormal saline grouprdquo) andcontrol group were not significant See Figure 2

442 Expression of Phosphorylated ERK12 The resultsdemonstrated that Shuizhongcao-containing serum led tosuppressed expression of phosphorylated ERK12 and thusinhibited ERK mediated proliferation pathway The differ-ence of phosphorylated ERK12 expression level between

6 Evidence-Based Complementary and Alternative Medicine

0

200000

400000

600000

800000

1000000

1200000

1400000

1600000

1800000

2000000

p-AKT

p-AKT

Beta-actin

Beta-actin

Target protein

Gre

y le

vel

Shuizhongcao groupNS groupControl group

Shuizhongcaogroup

NS group Control group

Figure 4 Expression of phosphorylated AKT

Shuizhongcao group and control group as well as NS groupand control group was statistically significant (119875 lt 005) SeeFigure 3

443 Expression of Phosphorylated AKT The results demon-strated that Shuizhongcao-containing serum suppressed theexpression of phosphorylated AKT Differences between thephosphorylatedAKT expression level of Shuizhongcao groupand that of two other groups were statistically significant(119875 lt 005) respectively The difference between NS groupand control group was not significant See Figure 4

45 PCR Results of IL-10 IL-12a and IL-12b Consideringthe large variations in PCR measurements a normal groupwas set up that is using drug-containing rat serum withoutany treatment as reference The measurements in the con-trol group and Chinese medicine group were respectivelydivided by the values in the normal group to calculate relativeexpression amounts tomore objectively reflect the expressiondifference

The results showed that levels of IL-10 expression in bothChinesemedicine group and control group were significantlyincreased (119875 lt 001) compared with normal control groupThe expression levels of IL-10 and IL-12a in Chinesemedicinegroup were significantly decreased compared with those incontrol group (119875 lt 001) When compared with normal

group IL-12a expression level was increased in Chinesemedicine group while it decreased in control group withsignificant differences (119875 lt 001) When compared withnormal group the IL-12b expression level was decreased inChinese medicine group while it increased in control groupwith significant differences See Figure 5

5 Discussion

Fibroblast proliferation is crucial for the healing of oralulcers CCK8 assay indicated that Shuizhongcao Granuledid enhance fibroblast proliferation Western blot showedthat the serum containing Shuizhongcao Granule inhibitedAKT expression in fibroblasts We supposed that fibroblastproliferation was related to inflammation inhibition causedby AKT inhibition However this needs to be confirmed bycontrolled trial of gene silencing We aimed to identify theeffect of Shuizhongcao Granule on oral ulcers in animal andcell models using CCK8 assay and the results confirmed thatfibroblast proliferation was enhanced Subsequent Westernblot and PCR were intended to find out the reasons for thisand to collect data for analysis

According to our preliminary research ShuizhongcaoGranule was able to increase the red blood cell Cab receptorrosette formation rate but decrease immune complex rosetteformation rate in red blood cells [9] We also demonstratedthat in ROU Shuizhongcao Granule was capable of

Evidence-Based Complementary and Alternative Medicine 7

0

1

2

3

4

5

6

7

IL-10 IL-12a IL-12b

Blank groupChinese medicine group

Relat

ive e

xpre

ssio

n

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)

4000E minus 2

9000E minus 2

1400E minus 1

1900E minus 1

GAPDH

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-10

1300E minus 1

1100E minus 1

9000E minus 2

7000E minus 2

5000E minus 2

3000E minus 2

1000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12a

1800E minus 1

1300E minus 1

8000E minus 2

3000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12b

2400E minus 1

1900E minus 1

1400E minus 1

9000E minus 2

4000E minus 2

GAPDH

5000

4000

3000

2000

1000

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot

IL-12a

0 5 10 15 20 25 30 35 40

Cycle

5000

4000

3000

2000

1000

Amplification plot

IL-10

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4600

4100

3600

3100

2600

2100

1600

1100

6000E minus 1

IL-12b

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4400

3900

3400

2900

2400

1900

1400

9000E minus 1

4000E minus 1

Rn

Rn

Rn

RnRn

Rn

Rn

Rn

The PCR melting curve of GAPDH IL-10 IL-12a and IL-12b

The PCR amplification curve of GAPDH IL-10 IL-12a and IL-12b

Figure 5 Relative expression of IL-10 IL-12a and IL-12 Note 995333995333 compared with control group 119875 lt 001

increasing the percentage of CD3 and CD4 positive cellsCD4CD8 ratio and serum level of IL-12 and decreasingserum level of IL-10 [10] Through the rat ROU modelwe compared the recovery time of ulcers in Shuizhongcaogroup and model group and demonstrated the efficacy of

Shuizhongcao Granule in treating ROU The in vivo effect ofinflammation inhibition of Shuizhongcao was demonstratedby levels of IL-4 IL-8 and GM-CSF in rat serum

Based on the preliminary research this study focusedon exploring the pathways associated with inflammation

8 Evidence-Based Complementary and Alternative Medicine

NF-120581B is a canonical pathway associated among otherswith inflammation It has also been reported that NF-120581Bregulates several hundred genes involved in cell growthdifferentiation and apoptosis [11] Here we reported thatthe level of phosphorylated P65 in Chinese medicine groupwas significantly decreased compared with two other groupsSince the expression of NF-120581B pathway mainly relies on thebinding of phosphorylated P65 on the particular gene targetin the nucleus NF-120581B pathwaymight be inhibited in the Chi-nese medicine group However further experiments showedthat after the treatment of Chinese medicine expressionlevels of phosphorylated I120581B120572 and phosphorylated IKK120572120573increased while IKK120573 expression was decreased which wascontrary to what should be presented by the canonicalpathway Therefore we speculate that Shuizhongcao Granulesuppresses the activation of NF-120581B pathway through inhibit-ing an alternative unknown pathway rather than inhibitingthe canonical pathway

Our preliminary data showed that serum containingShuizhongcao facilitated fibroblast proliferation (or inhib-ited inflammation lesions) Thus we speculated that serumcontaining Shuizhongcao Granule would be able to acti-vate ERK pathway promote cell proliferation and suppressapoptosis However the results demonstrated that drug-containing serum inhibited the expression of phosphory-lated ERK12 which are the key players of ERK pathwayTherefore we inferred that the ability of ShuizhongcaoGranule to promote cell proliferation is through the inhibi-tion of p-AKT expression and thus to regulate the NF-120581Bpathway

As a major player on antiapoptotic pathway AKT canexert a dominant negative effect and inhibit insulin-likegrowth factor 1 (IGF1) mediated cell growth thus persistentactivation of AKT inhibits PTEN mediated apoptosis AKTalso affects cell survival by an indirect effect on Pi3k-AKTand P53 [12] It has been shown that [13ndash15] AKT indirectlyaffects NF-120581B and P53 and thus influences cell survivalBy phosphorylating and activating kB kinase (IKK) AKTleads to the degradation of I120581B an inhibitor of NF-120581B andthus results in cytoplasm release and nuclear translocationof NF-120581B which in turn activates its target genes andpromotes cell survival Our experiments showed that Chinesemedicine containing serum significantly inhibited the level ofphosphorylated AKT Therefore we inferred that it was theAKT-NF-120581B signaling pathway that Shuizhongcao Granuleacted through on fibroblasts

Our study confirmed the ability of Shuizhongcao toaccelerate the recovery of ROU rat and further demonstratedthat the mode of action was associated with inflammatoryreaction inhibition The mechanism underlying facilitationof fibroblast proliferation by Shuizhongcao is yet to bediscovered Our research provides an experimental rationalefor the application of Shuizhongcao in clinical therapy

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

Zhang Bo Ruan Shan-ming Wang Bei and Li Qing-lincontributed equally to the project and are considered co-firstauthors

Acknowledgments

The authors wish to acknowledge The Zhejiang ProvincialNatural Science Foundation of China (2010ZZ003) ldquoIntegra-tive Medicinerdquo Key Discipline of Zhejiang University Pro-gram and The First Affiliated Hospital of Zhejiang ChineseMedical University Eagles Program for the Cultivation ofTalents

References

[1] B Tarakji K Baroudi and Y Kharma ldquoThe effect of dietaryhabits on the development of the recurrent aphthous stomatitisrdquoNigerian Medical Journal vol 53 no 1 pp 9ndash11 2012

[2] W Meng Y Dong J Liu et al ldquoA clinical evaluation ofamlexanox oral adhesive pellicles in the treatment of recurrentaphthous stomatitis and comparison with amlexanox oraltablets a randomized placebo controlled blinded multicenterclinical trialrdquo Trials vol 10 article 30 2009

[3] S Tsuyuki K Kawaguchi Y Kawata et al ldquoUsefulness ofantimycotic agents (itraconazole) in chemotherapy-inducedmucositis of breast cancer patientsrdquo Gan To Kagaku Ryoho vol39 no 9 pp 1369ndash1373 2012

[4] A R Tappuni T Kovacevic P J Shirlaw et al ldquoClinicalassessment of disease severity in recurrent aphthous stomatitisrdquoJournal of Oral PathologyampMedicine vol 42 no 8 pp 635ndash6412013

[5] N Babaee D Moslemi M Khalilpour et al ldquoAntioxidantcapacity of calendula officinalis flowers extract and preventionof radiation induced oropharyngeal mucositis in patients withhead and neck cancers a randomized controlled clinical studyrdquoDaru vol 21 no 1 article 18 2013

[6] B V Caputo G A N Filho C C dos Santos Y Okida andE M Giovani ldquoLaser therapy of recurrent aphthous ulcer inpatient with HIV infectionrdquoCase Reports inMedicine vol 2012Article ID 695642 3 pages 2012

[7] X M Yang X H Wang L F Chen et al ldquoEffects of dihy-dromyricetin on tumor necrosis factor and NF-kappaB p65 ofRAU ratsrdquo Zhongguo Zhong Yao Za Zhi vol 37 no 17 pp 2612ndash2617 2012

[8] T Jin M-H Shen Y-F Sun et al ldquoShuizhongcao decoctiontreatment chemotherapy induced oral ulcerrdquo Chinese Archivesof Traditional ChineseMedicine vol 27 no 2 pp 303ndash305 2009

[9] M H Shen S M Ruan andMH Bao ldquoEffect of shuizhongcaogranule on cellular immune function of experimental animalwith recurrent aphthous stomatitisrdquo Zhongguo Zhong Xi Yi JieHe Za Zhi vol 29 no 10 pp 901ndash904 2009

[10] M H Shen S M Ruan and M H Bao ldquoResearch ofShuizhongcao Granule on experimental animal recurrentoralulcer of the red cell immune functionrdquo Chinese Archivesof Traditional Chinese Medicine vol 26 no 12 pp 2605ndash26072008

[11] A Siomek ldquoNF-120581B signaling pathway and free radical impactrdquoActa Biochimica Polonica vol 59 no 3 pp 323ndash331 2012

Evidence-Based Complementary and Alternative Medicine 9

[12] S-J Jeong C A Pise-Masison M F Radonovich H U Parkand J N Brady ldquoActivated AKT regulates NF-120581B activationp53 inhibition and cell survival in HTLV-1-transformed cellsrdquoOncogene vol 24 no 44 pp 6719ndash6728 2005

[13] F Busch A Mobasheri P Shayan R Stahlmann and MShakibaei ldquoSirt-1 is required for the inhibition of apoptosis andinflammatory responses in human tenocytesrdquo The Journal ofBiological Chemistry vol 287 no 31 pp 25770ndash25781 2012

[14] F Busch A Mobasheri P Shayan et al ldquoResveratrol modulatesinterleukin-1beta-induced phosphatidylinositol 3-kinase andnuclear factor kappaB signaling pathways in human tenocytesrdquoThe Journal of Biological Chemistry vol 287 no 45 pp 38050ndash38063 2012

[15] Y D Park Y S Kim Y M Jung et al ldquoPorphyromonasgingivalis lipopolysaccharide regulates interleukin (IL)-17 andIL-23 expression via SIRT1 modulation in human periodontalligament cellsrdquo Cytokine vol 60 no 1 pp 284ndash293 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 3

by mixing 10x TBS 100mL and Tween 20 1mL in dd-waterto a final volume of 1000mL Blocking buffer was made bydissolving 5 g fat-free milk powder or bovine serum albumin(BSA) in 100mL 1x TBST

3 Methods

31 Experimental Animal and Group Assignment Sixtyhealthy rats (180 plusmn 20 g 6ndash8 weeks half male and halffemale) were fed for an acclimated period of a week and thenrandomized into three groups blank control group salinegroup and Shuizhongcao treatment group

32 Establishment of Experimental Animal Model The ratswere intraperitoneally administrated with 5-fluorouracil (5-Fu)with a dose of 5mg100 g for chemotherapyOn the fourthday after chemotherapy rats were anesthetized with 10chloral hydrate intraperitoneal injection (03mL100mL) Apiece of NaOH of appropriate size (15mm times 15mm) wasplaced by a straight head tweezer on the ratrsquos right sidecheekmucosa for 5ndash10 seconds until the naked appearance ofredness and ulcer Afterward all three groups were fed withnormal diet From the second day after surgery saline groupand Chinese medicine group were intragastrically adminis-trated with standard saline and Shuizhongcao (1mL100 g)twice a day respectively for a total of 10 days No additionaltreatment was applied to the blank control group

33 Preparation of Rat Serum At day 11 after surgery the ratswere anesthetized with 10 chloral hydrate intraperitonealinjection (03mL100mL) and euthanized by abdominalaorta exsanguination The peripheral blood obtained fromrats was pipetted into a centrifuge tube containing 10 EDTAand pancreatic enzymes After 10min centrifugation at 200 gthe supernatant which was the serum was collected andstored in an ultralow freezer at minus80∘C

34 Culture of Rat Fibroblast Rat fibroblasts were cultured infibroblast complete media and passaged when they reachedconfluence After being subcultured for 6-7 passages thecells reached the log phase of growth and were ready forexperiment

35 Detection of Drug-Containing Serum on Fibroblast byCCK8 Assay The fibroblasts in log growth phase werecounted and seeded in three 96-well plates labeled with 12 h24 h and 36 h respectively Each plate was divided into tengroups and each group contained 7 subgroups 5 10 and15 Chinese medicine group and 5 10 and 15 salinegroup and blank group After 12 h 24 h and 36 h incubationthe corresponding 96-well plates were taken out and CCK8solution was added to each well with 10 120583L and continuedincubation for 3h The absorbance was detected and growthcurve was plotted

36 NF-120581B and ERK Pathway Protein Expression Detectedby Western Blot Cells from Chinese medicine group salinegroup and blank group were collected washed in PBS

Table 1 Real-time PCR primers

Gene Primer sequence

GAPDH GGAGCGAGATCCCTCCAAAATGGCTGTTGTCATACTTCTCATGG

IL-10 GCTATGTTGCCTGCTCTTACTGTCTGGCTGACTGGGAAGTG

IL-12a AGACATCACACGGGACAAAACCACAGGGTCATCATCAAAGAAG

IL-12b AGCACTCCCCATTCCTACTTCTAACGCACCTTTCTGGTTAC

Group

0

02

04

06

08

1

12

OD

val

ue

Blan

k gr

oup

12h24h

36h48h

5

cont

rol

grou

p

10

cont

rol

grou

p

15

cont

rol

grou

p

5

Chi

nese

med

icin

e gro

up

10

Chi

nese

med

icin

e gro

up

15

Chi

nese

med

icin

e gro

up

Figure 1 Cell growth and time relationship following serumintervention in control group and Chinese medicine group Note995333119875 lt 005 between Chinese medicine group and control group at

the same time point

solution and lysed with lysis buffer Total protein wasextracted and quantified using BCA assay 40120583L proteinsample was loaded in each well for SDS-PAGE The proteinwas transferred from polyacrylamide gel to PVDFmembraneby electrotransfer The PVDF membrane with transferredprotein was blocked with TBST containing 5 BSA (bovineserum albumin) overnight The membrane was incubatedwith primary antibody (1 1000) for 2 h at 37∘C and washedwith TBS 3 times 10min each time The membrane wasthen incubated with secondary antibody (1 5000) for 2 h at37∘C and washed with TBS 3 times 10min each time Themembrane was developed using ECL solutions and imaged

37 Expression of IL-10 IL-12a and IL-12b in Rat Fibroblastsin Each Group Detected by Real-Time Quantitative PCRTotal mRNA of cells from each group was extracted at 48 hafter serum treatment using absorption column centrifugalmethod After concentration purity and integrity assess-ment mRNA was reversely transcribed into cDNA followingthe instruction of reverse transcription kit Levels of IL-10 IL-12a and IL-12b were detected by fluorescence-basedquantitative RT-PCR Primers were designed using software

4 Evidence-Based Complementary and Alternative Medicine

Table 2 OD values of rat fibroblast following intervention by Chinese medicine containing serum and control serum (119883 plusmn 119878 119899 = 6)

Group Time Zero pores12 h 24 h 36 h 48 h

5 control group 04944 plusmn 001294 06412 plusmn 003167 08769 plusmn 003631 10179 plusmn 004123 00834 plusmn 00112310 control group 04240 plusmn 000884 05231 plusmn 002622 06874 plusmn 002147 07213 plusmn 001843 00782 plusmn 00087315 control group 03713 plusmn 000968 04035 plusmn 001732 05589 plusmn 001483 06633 plusmn 001627 00761 plusmn 0013745 Chinese medicine group 05833 plusmn 002643995333 06934 plusmn 001216995333 09088 plusmn 001736 10235 plusmn 003513 00851 plusmn 00116510 Chinese medicine group 04780 plusmn 001637995333 05687 plusmn 001072995333 07189 plusmn 002987995333 08636 plusmn 001532995333 00801 plusmn 00219815 Chinese medicine group 04083 plusmn 000996 04488 plusmn 000832995333 05986 plusmn 001653995333 07399 plusmn 001843995333 00719 plusmn 001682Blank group 05901 plusmn 002398 07287 plusmn 003128 09432 plusmn 003612 10213 plusmn 002871 00912 plusmn 001572Note 995333119875 lt 005 between Chinese medicine group and control group at the same time point

0200000400000600000800000

100000012000001400000

Gre

y le

vel

Target protein

p-P65

p-P65

IKK120573

IKK120573

p-I120581B120572

p-I120581B120572

p-IKK120572120573

p-IKK120572120573

Beta-actin

Beta-actin

Shuizhongcao group

Shuizhongcao group

NS group

NS group

Control group

Control group

Figure 2 Protein expression of NF-120581B pathway

Primer Premier 60 and Beacon Designer and synthesized byShenggong Bioengineering Technology Co Ltd (Shanghai)Primer sequences are listed in Table 1

Reaction conditions were as follows reverse transcrip-tion 37∘C for 15min and 85∘C for 5 sec PCR reaction wasas follows 95∘C for 5 sec and 60∘C for 30 sec (annealing) 40

cycles (fluorescence collection) melting curve analysis was50∘C to 95∘C

38 Statistical Analysis Quantitative data were expressed asmean plusmn standard deviation (119883 plusmn 119878) SPSS 170 statisticalsoftware was used for statistical and variance analysis

Evidence-Based Complementary and Alternative Medicine 5

0

500000

1000000

1500000

2000000

2500000

3000000

Target protein

Gre

y le

vel

p-ERK12

p-ERK12

ERK12 (internal reference)

ERK12 (internal reference)

Shuizhongcaogroup

Shuizhongcao group

NS group

NS group

Control group

Control group

Figure 3 Expression of phosphorylated ERK12

4 Results

41 Rat Model Establishment 12 h after rat model estab-lishment buccal mucosal vasodilatation increased capillarynetwork and tissue edema were observed At 24 h edemabecame serious The mucosal epithelial layer slightly exfoli-ated and the surface was covered with exudates At 48 h theoral ulcer formed and the mucosa turned red extensivelywhich was covered by large pieces of pseudomembranesappearing yellowish white in color and easily exfoliatedA specialist in pathology confirmed the diagnosis and thesuccess of model establishment

42 Culture of Rat Fibroblasts The rat fibroblast culture grewwell after subculturing

43 CCK8 Results of Fibroblast Intervention by ControlSerum andDrug-Containing Serum As shown in Table 2 andFigure 1 serum in both control group and Chinese medicinegroup was able to suppress rat fibroblast proliferation sig-nificantly different from that in blank group (119875 lt 005)The suppressive effect was positively but not proportionallycorrelated with dosage and treatment time The serum con-taining Chinese medicine reduced the suppressive effect of

inflammation on rat fibroblasts The difference between eachgroup was statistically significant (119875 lt 005)

44 Western Blot Results following Serum Intervention ofRat Fibroblasts

441 Expression of Protein Associated with NF-120581B Path-way The results showed that serum containing Shuizhong-cao Granule significantly downregulated the expression ofphosphorylated P65 demonstrating its ability to suppress theactivation and relevant protein expression of NF-120581B pathwayIn the meantime Shuizhongcao increased phosphorylatedI120581B120572 and phosphorylated IKK120572120573 expression facilitatingthe activation of canonical NF-120581B pathway The differencesbetween each parameter from Shuizhongcao group (exceptfor internal standard) and that of two other groups werestatistically significant (119875 lt 005) Differences between NSgroup (NS group is short for ldquonormal saline grouprdquo) andcontrol group were not significant See Figure 2

442 Expression of Phosphorylated ERK12 The resultsdemonstrated that Shuizhongcao-containing serum led tosuppressed expression of phosphorylated ERK12 and thusinhibited ERK mediated proliferation pathway The differ-ence of phosphorylated ERK12 expression level between

6 Evidence-Based Complementary and Alternative Medicine

0

200000

400000

600000

800000

1000000

1200000

1400000

1600000

1800000

2000000

p-AKT

p-AKT

Beta-actin

Beta-actin

Target protein

Gre

y le

vel

Shuizhongcao groupNS groupControl group

Shuizhongcaogroup

NS group Control group

Figure 4 Expression of phosphorylated AKT

Shuizhongcao group and control group as well as NS groupand control group was statistically significant (119875 lt 005) SeeFigure 3

443 Expression of Phosphorylated AKT The results demon-strated that Shuizhongcao-containing serum suppressed theexpression of phosphorylated AKT Differences between thephosphorylatedAKT expression level of Shuizhongcao groupand that of two other groups were statistically significant(119875 lt 005) respectively The difference between NS groupand control group was not significant See Figure 4

45 PCR Results of IL-10 IL-12a and IL-12b Consideringthe large variations in PCR measurements a normal groupwas set up that is using drug-containing rat serum withoutany treatment as reference The measurements in the con-trol group and Chinese medicine group were respectivelydivided by the values in the normal group to calculate relativeexpression amounts tomore objectively reflect the expressiondifference

The results showed that levels of IL-10 expression in bothChinesemedicine group and control group were significantlyincreased (119875 lt 001) compared with normal control groupThe expression levels of IL-10 and IL-12a in Chinesemedicinegroup were significantly decreased compared with those incontrol group (119875 lt 001) When compared with normal

group IL-12a expression level was increased in Chinesemedicine group while it decreased in control group withsignificant differences (119875 lt 001) When compared withnormal group the IL-12b expression level was decreased inChinese medicine group while it increased in control groupwith significant differences See Figure 5

5 Discussion

Fibroblast proliferation is crucial for the healing of oralulcers CCK8 assay indicated that Shuizhongcao Granuledid enhance fibroblast proliferation Western blot showedthat the serum containing Shuizhongcao Granule inhibitedAKT expression in fibroblasts We supposed that fibroblastproliferation was related to inflammation inhibition causedby AKT inhibition However this needs to be confirmed bycontrolled trial of gene silencing We aimed to identify theeffect of Shuizhongcao Granule on oral ulcers in animal andcell models using CCK8 assay and the results confirmed thatfibroblast proliferation was enhanced Subsequent Westernblot and PCR were intended to find out the reasons for thisand to collect data for analysis

According to our preliminary research ShuizhongcaoGranule was able to increase the red blood cell Cab receptorrosette formation rate but decrease immune complex rosetteformation rate in red blood cells [9] We also demonstratedthat in ROU Shuizhongcao Granule was capable of

Evidence-Based Complementary and Alternative Medicine 7

0

1

2

3

4

5

6

7

IL-10 IL-12a IL-12b

Blank groupChinese medicine group

Relat

ive e

xpre

ssio

n

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)

4000E minus 2

9000E minus 2

1400E minus 1

1900E minus 1

GAPDH

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-10

1300E minus 1

1100E minus 1

9000E minus 2

7000E minus 2

5000E minus 2

3000E minus 2

1000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12a

1800E minus 1

1300E minus 1

8000E minus 2

3000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12b

2400E minus 1

1900E minus 1

1400E minus 1

9000E minus 2

4000E minus 2

GAPDH

5000

4000

3000

2000

1000

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot

IL-12a

0 5 10 15 20 25 30 35 40

Cycle

5000

4000

3000

2000

1000

Amplification plot

IL-10

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4600

4100

3600

3100

2600

2100

1600

1100

6000E minus 1

IL-12b

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4400

3900

3400

2900

2400

1900

1400

9000E minus 1

4000E minus 1

Rn

Rn

Rn

RnRn

Rn

Rn

Rn

The PCR melting curve of GAPDH IL-10 IL-12a and IL-12b

The PCR amplification curve of GAPDH IL-10 IL-12a and IL-12b

Figure 5 Relative expression of IL-10 IL-12a and IL-12 Note 995333995333 compared with control group 119875 lt 001

increasing the percentage of CD3 and CD4 positive cellsCD4CD8 ratio and serum level of IL-12 and decreasingserum level of IL-10 [10] Through the rat ROU modelwe compared the recovery time of ulcers in Shuizhongcaogroup and model group and demonstrated the efficacy of

Shuizhongcao Granule in treating ROU The in vivo effect ofinflammation inhibition of Shuizhongcao was demonstratedby levels of IL-4 IL-8 and GM-CSF in rat serum

Based on the preliminary research this study focusedon exploring the pathways associated with inflammation

8 Evidence-Based Complementary and Alternative Medicine

NF-120581B is a canonical pathway associated among otherswith inflammation It has also been reported that NF-120581Bregulates several hundred genes involved in cell growthdifferentiation and apoptosis [11] Here we reported thatthe level of phosphorylated P65 in Chinese medicine groupwas significantly decreased compared with two other groupsSince the expression of NF-120581B pathway mainly relies on thebinding of phosphorylated P65 on the particular gene targetin the nucleus NF-120581B pathwaymight be inhibited in the Chi-nese medicine group However further experiments showedthat after the treatment of Chinese medicine expressionlevels of phosphorylated I120581B120572 and phosphorylated IKK120572120573increased while IKK120573 expression was decreased which wascontrary to what should be presented by the canonicalpathway Therefore we speculate that Shuizhongcao Granulesuppresses the activation of NF-120581B pathway through inhibit-ing an alternative unknown pathway rather than inhibitingthe canonical pathway

Our preliminary data showed that serum containingShuizhongcao facilitated fibroblast proliferation (or inhib-ited inflammation lesions) Thus we speculated that serumcontaining Shuizhongcao Granule would be able to acti-vate ERK pathway promote cell proliferation and suppressapoptosis However the results demonstrated that drug-containing serum inhibited the expression of phosphory-lated ERK12 which are the key players of ERK pathwayTherefore we inferred that the ability of ShuizhongcaoGranule to promote cell proliferation is through the inhibi-tion of p-AKT expression and thus to regulate the NF-120581Bpathway

As a major player on antiapoptotic pathway AKT canexert a dominant negative effect and inhibit insulin-likegrowth factor 1 (IGF1) mediated cell growth thus persistentactivation of AKT inhibits PTEN mediated apoptosis AKTalso affects cell survival by an indirect effect on Pi3k-AKTand P53 [12] It has been shown that [13ndash15] AKT indirectlyaffects NF-120581B and P53 and thus influences cell survivalBy phosphorylating and activating kB kinase (IKK) AKTleads to the degradation of I120581B an inhibitor of NF-120581B andthus results in cytoplasm release and nuclear translocationof NF-120581B which in turn activates its target genes andpromotes cell survival Our experiments showed that Chinesemedicine containing serum significantly inhibited the level ofphosphorylated AKT Therefore we inferred that it was theAKT-NF-120581B signaling pathway that Shuizhongcao Granuleacted through on fibroblasts

Our study confirmed the ability of Shuizhongcao toaccelerate the recovery of ROU rat and further demonstratedthat the mode of action was associated with inflammatoryreaction inhibition The mechanism underlying facilitationof fibroblast proliferation by Shuizhongcao is yet to bediscovered Our research provides an experimental rationalefor the application of Shuizhongcao in clinical therapy

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

Zhang Bo Ruan Shan-ming Wang Bei and Li Qing-lincontributed equally to the project and are considered co-firstauthors

Acknowledgments

The authors wish to acknowledge The Zhejiang ProvincialNatural Science Foundation of China (2010ZZ003) ldquoIntegra-tive Medicinerdquo Key Discipline of Zhejiang University Pro-gram and The First Affiliated Hospital of Zhejiang ChineseMedical University Eagles Program for the Cultivation ofTalents

References

[1] B Tarakji K Baroudi and Y Kharma ldquoThe effect of dietaryhabits on the development of the recurrent aphthous stomatitisrdquoNigerian Medical Journal vol 53 no 1 pp 9ndash11 2012

[2] W Meng Y Dong J Liu et al ldquoA clinical evaluation ofamlexanox oral adhesive pellicles in the treatment of recurrentaphthous stomatitis and comparison with amlexanox oraltablets a randomized placebo controlled blinded multicenterclinical trialrdquo Trials vol 10 article 30 2009

[3] S Tsuyuki K Kawaguchi Y Kawata et al ldquoUsefulness ofantimycotic agents (itraconazole) in chemotherapy-inducedmucositis of breast cancer patientsrdquo Gan To Kagaku Ryoho vol39 no 9 pp 1369ndash1373 2012

[4] A R Tappuni T Kovacevic P J Shirlaw et al ldquoClinicalassessment of disease severity in recurrent aphthous stomatitisrdquoJournal of Oral PathologyampMedicine vol 42 no 8 pp 635ndash6412013

[5] N Babaee D Moslemi M Khalilpour et al ldquoAntioxidantcapacity of calendula officinalis flowers extract and preventionof radiation induced oropharyngeal mucositis in patients withhead and neck cancers a randomized controlled clinical studyrdquoDaru vol 21 no 1 article 18 2013

[6] B V Caputo G A N Filho C C dos Santos Y Okida andE M Giovani ldquoLaser therapy of recurrent aphthous ulcer inpatient with HIV infectionrdquoCase Reports inMedicine vol 2012Article ID 695642 3 pages 2012

[7] X M Yang X H Wang L F Chen et al ldquoEffects of dihy-dromyricetin on tumor necrosis factor and NF-kappaB p65 ofRAU ratsrdquo Zhongguo Zhong Yao Za Zhi vol 37 no 17 pp 2612ndash2617 2012

[8] T Jin M-H Shen Y-F Sun et al ldquoShuizhongcao decoctiontreatment chemotherapy induced oral ulcerrdquo Chinese Archivesof Traditional ChineseMedicine vol 27 no 2 pp 303ndash305 2009

[9] M H Shen S M Ruan andMH Bao ldquoEffect of shuizhongcaogranule on cellular immune function of experimental animalwith recurrent aphthous stomatitisrdquo Zhongguo Zhong Xi Yi JieHe Za Zhi vol 29 no 10 pp 901ndash904 2009

[10] M H Shen S M Ruan and M H Bao ldquoResearch ofShuizhongcao Granule on experimental animal recurrentoralulcer of the red cell immune functionrdquo Chinese Archivesof Traditional Chinese Medicine vol 26 no 12 pp 2605ndash26072008

[11] A Siomek ldquoNF-120581B signaling pathway and free radical impactrdquoActa Biochimica Polonica vol 59 no 3 pp 323ndash331 2012

Evidence-Based Complementary and Alternative Medicine 9

[12] S-J Jeong C A Pise-Masison M F Radonovich H U Parkand J N Brady ldquoActivated AKT regulates NF-120581B activationp53 inhibition and cell survival in HTLV-1-transformed cellsrdquoOncogene vol 24 no 44 pp 6719ndash6728 2005

[13] F Busch A Mobasheri P Shayan R Stahlmann and MShakibaei ldquoSirt-1 is required for the inhibition of apoptosis andinflammatory responses in human tenocytesrdquo The Journal ofBiological Chemistry vol 287 no 31 pp 25770ndash25781 2012

[14] F Busch A Mobasheri P Shayan et al ldquoResveratrol modulatesinterleukin-1beta-induced phosphatidylinositol 3-kinase andnuclear factor kappaB signaling pathways in human tenocytesrdquoThe Journal of Biological Chemistry vol 287 no 45 pp 38050ndash38063 2012

[15] Y D Park Y S Kim Y M Jung et al ldquoPorphyromonasgingivalis lipopolysaccharide regulates interleukin (IL)-17 andIL-23 expression via SIRT1 modulation in human periodontalligament cellsrdquo Cytokine vol 60 no 1 pp 284ndash293 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

4 Evidence-Based Complementary and Alternative Medicine

Table 2 OD values of rat fibroblast following intervention by Chinese medicine containing serum and control serum (119883 plusmn 119878 119899 = 6)

Group Time Zero pores12 h 24 h 36 h 48 h

5 control group 04944 plusmn 001294 06412 plusmn 003167 08769 plusmn 003631 10179 plusmn 004123 00834 plusmn 00112310 control group 04240 plusmn 000884 05231 plusmn 002622 06874 plusmn 002147 07213 plusmn 001843 00782 plusmn 00087315 control group 03713 plusmn 000968 04035 plusmn 001732 05589 plusmn 001483 06633 plusmn 001627 00761 plusmn 0013745 Chinese medicine group 05833 plusmn 002643995333 06934 plusmn 001216995333 09088 plusmn 001736 10235 plusmn 003513 00851 plusmn 00116510 Chinese medicine group 04780 plusmn 001637995333 05687 plusmn 001072995333 07189 plusmn 002987995333 08636 plusmn 001532995333 00801 plusmn 00219815 Chinese medicine group 04083 plusmn 000996 04488 plusmn 000832995333 05986 plusmn 001653995333 07399 plusmn 001843995333 00719 plusmn 001682Blank group 05901 plusmn 002398 07287 plusmn 003128 09432 plusmn 003612 10213 plusmn 002871 00912 plusmn 001572Note 995333119875 lt 005 between Chinese medicine group and control group at the same time point

0200000400000600000800000

100000012000001400000

Gre

y le

vel

Target protein

p-P65

p-P65

IKK120573

IKK120573

p-I120581B120572

p-I120581B120572

p-IKK120572120573

p-IKK120572120573

Beta-actin

Beta-actin

Shuizhongcao group

Shuizhongcao group

NS group

NS group

Control group

Control group

Figure 2 Protein expression of NF-120581B pathway

Primer Premier 60 and Beacon Designer and synthesized byShenggong Bioengineering Technology Co Ltd (Shanghai)Primer sequences are listed in Table 1

Reaction conditions were as follows reverse transcrip-tion 37∘C for 15min and 85∘C for 5 sec PCR reaction wasas follows 95∘C for 5 sec and 60∘C for 30 sec (annealing) 40

cycles (fluorescence collection) melting curve analysis was50∘C to 95∘C

38 Statistical Analysis Quantitative data were expressed asmean plusmn standard deviation (119883 plusmn 119878) SPSS 170 statisticalsoftware was used for statistical and variance analysis

Evidence-Based Complementary and Alternative Medicine 5

0

500000

1000000

1500000

2000000

2500000

3000000

Target protein

Gre

y le

vel

p-ERK12

p-ERK12

ERK12 (internal reference)

ERK12 (internal reference)

Shuizhongcaogroup

Shuizhongcao group

NS group

NS group

Control group

Control group

Figure 3 Expression of phosphorylated ERK12

4 Results

41 Rat Model Establishment 12 h after rat model estab-lishment buccal mucosal vasodilatation increased capillarynetwork and tissue edema were observed At 24 h edemabecame serious The mucosal epithelial layer slightly exfoli-ated and the surface was covered with exudates At 48 h theoral ulcer formed and the mucosa turned red extensivelywhich was covered by large pieces of pseudomembranesappearing yellowish white in color and easily exfoliatedA specialist in pathology confirmed the diagnosis and thesuccess of model establishment

42 Culture of Rat Fibroblasts The rat fibroblast culture grewwell after subculturing

43 CCK8 Results of Fibroblast Intervention by ControlSerum andDrug-Containing Serum As shown in Table 2 andFigure 1 serum in both control group and Chinese medicinegroup was able to suppress rat fibroblast proliferation sig-nificantly different from that in blank group (119875 lt 005)The suppressive effect was positively but not proportionallycorrelated with dosage and treatment time The serum con-taining Chinese medicine reduced the suppressive effect of

inflammation on rat fibroblasts The difference between eachgroup was statistically significant (119875 lt 005)

44 Western Blot Results following Serum Intervention ofRat Fibroblasts

441 Expression of Protein Associated with NF-120581B Path-way The results showed that serum containing Shuizhong-cao Granule significantly downregulated the expression ofphosphorylated P65 demonstrating its ability to suppress theactivation and relevant protein expression of NF-120581B pathwayIn the meantime Shuizhongcao increased phosphorylatedI120581B120572 and phosphorylated IKK120572120573 expression facilitatingthe activation of canonical NF-120581B pathway The differencesbetween each parameter from Shuizhongcao group (exceptfor internal standard) and that of two other groups werestatistically significant (119875 lt 005) Differences between NSgroup (NS group is short for ldquonormal saline grouprdquo) andcontrol group were not significant See Figure 2

442 Expression of Phosphorylated ERK12 The resultsdemonstrated that Shuizhongcao-containing serum led tosuppressed expression of phosphorylated ERK12 and thusinhibited ERK mediated proliferation pathway The differ-ence of phosphorylated ERK12 expression level between

6 Evidence-Based Complementary and Alternative Medicine

0

200000

400000

600000

800000

1000000

1200000

1400000

1600000

1800000

2000000

p-AKT

p-AKT

Beta-actin

Beta-actin

Target protein

Gre

y le

vel

Shuizhongcao groupNS groupControl group

Shuizhongcaogroup

NS group Control group

Figure 4 Expression of phosphorylated AKT

Shuizhongcao group and control group as well as NS groupand control group was statistically significant (119875 lt 005) SeeFigure 3

443 Expression of Phosphorylated AKT The results demon-strated that Shuizhongcao-containing serum suppressed theexpression of phosphorylated AKT Differences between thephosphorylatedAKT expression level of Shuizhongcao groupand that of two other groups were statistically significant(119875 lt 005) respectively The difference between NS groupand control group was not significant See Figure 4

45 PCR Results of IL-10 IL-12a and IL-12b Consideringthe large variations in PCR measurements a normal groupwas set up that is using drug-containing rat serum withoutany treatment as reference The measurements in the con-trol group and Chinese medicine group were respectivelydivided by the values in the normal group to calculate relativeexpression amounts tomore objectively reflect the expressiondifference

The results showed that levels of IL-10 expression in bothChinesemedicine group and control group were significantlyincreased (119875 lt 001) compared with normal control groupThe expression levels of IL-10 and IL-12a in Chinesemedicinegroup were significantly decreased compared with those incontrol group (119875 lt 001) When compared with normal

group IL-12a expression level was increased in Chinesemedicine group while it decreased in control group withsignificant differences (119875 lt 001) When compared withnormal group the IL-12b expression level was decreased inChinese medicine group while it increased in control groupwith significant differences See Figure 5

5 Discussion

Fibroblast proliferation is crucial for the healing of oralulcers CCK8 assay indicated that Shuizhongcao Granuledid enhance fibroblast proliferation Western blot showedthat the serum containing Shuizhongcao Granule inhibitedAKT expression in fibroblasts We supposed that fibroblastproliferation was related to inflammation inhibition causedby AKT inhibition However this needs to be confirmed bycontrolled trial of gene silencing We aimed to identify theeffect of Shuizhongcao Granule on oral ulcers in animal andcell models using CCK8 assay and the results confirmed thatfibroblast proliferation was enhanced Subsequent Westernblot and PCR were intended to find out the reasons for thisand to collect data for analysis

According to our preliminary research ShuizhongcaoGranule was able to increase the red blood cell Cab receptorrosette formation rate but decrease immune complex rosetteformation rate in red blood cells [9] We also demonstratedthat in ROU Shuizhongcao Granule was capable of

Evidence-Based Complementary and Alternative Medicine 7

0

1

2

3

4

5

6

7

IL-10 IL-12a IL-12b

Blank groupChinese medicine group

Relat

ive e

xpre

ssio

n

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)

4000E minus 2

9000E minus 2

1400E minus 1

1900E minus 1

GAPDH

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-10

1300E minus 1

1100E minus 1

9000E minus 2

7000E minus 2

5000E minus 2

3000E minus 2

1000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12a

1800E minus 1

1300E minus 1

8000E minus 2

3000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12b

2400E minus 1

1900E minus 1

1400E minus 1

9000E minus 2

4000E minus 2

GAPDH

5000

4000

3000

2000

1000

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot

IL-12a

0 5 10 15 20 25 30 35 40

Cycle

5000

4000

3000

2000

1000

Amplification plot

IL-10

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4600

4100

3600

3100

2600

2100

1600

1100

6000E minus 1

IL-12b

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4400

3900

3400

2900

2400

1900

1400

9000E minus 1

4000E minus 1

Rn

Rn

Rn

RnRn

Rn

Rn

Rn

The PCR melting curve of GAPDH IL-10 IL-12a and IL-12b

The PCR amplification curve of GAPDH IL-10 IL-12a and IL-12b

Figure 5 Relative expression of IL-10 IL-12a and IL-12 Note 995333995333 compared with control group 119875 lt 001

increasing the percentage of CD3 and CD4 positive cellsCD4CD8 ratio and serum level of IL-12 and decreasingserum level of IL-10 [10] Through the rat ROU modelwe compared the recovery time of ulcers in Shuizhongcaogroup and model group and demonstrated the efficacy of

Shuizhongcao Granule in treating ROU The in vivo effect ofinflammation inhibition of Shuizhongcao was demonstratedby levels of IL-4 IL-8 and GM-CSF in rat serum

Based on the preliminary research this study focusedon exploring the pathways associated with inflammation

8 Evidence-Based Complementary and Alternative Medicine

NF-120581B is a canonical pathway associated among otherswith inflammation It has also been reported that NF-120581Bregulates several hundred genes involved in cell growthdifferentiation and apoptosis [11] Here we reported thatthe level of phosphorylated P65 in Chinese medicine groupwas significantly decreased compared with two other groupsSince the expression of NF-120581B pathway mainly relies on thebinding of phosphorylated P65 on the particular gene targetin the nucleus NF-120581B pathwaymight be inhibited in the Chi-nese medicine group However further experiments showedthat after the treatment of Chinese medicine expressionlevels of phosphorylated I120581B120572 and phosphorylated IKK120572120573increased while IKK120573 expression was decreased which wascontrary to what should be presented by the canonicalpathway Therefore we speculate that Shuizhongcao Granulesuppresses the activation of NF-120581B pathway through inhibit-ing an alternative unknown pathway rather than inhibitingthe canonical pathway

Our preliminary data showed that serum containingShuizhongcao facilitated fibroblast proliferation (or inhib-ited inflammation lesions) Thus we speculated that serumcontaining Shuizhongcao Granule would be able to acti-vate ERK pathway promote cell proliferation and suppressapoptosis However the results demonstrated that drug-containing serum inhibited the expression of phosphory-lated ERK12 which are the key players of ERK pathwayTherefore we inferred that the ability of ShuizhongcaoGranule to promote cell proliferation is through the inhibi-tion of p-AKT expression and thus to regulate the NF-120581Bpathway

As a major player on antiapoptotic pathway AKT canexert a dominant negative effect and inhibit insulin-likegrowth factor 1 (IGF1) mediated cell growth thus persistentactivation of AKT inhibits PTEN mediated apoptosis AKTalso affects cell survival by an indirect effect on Pi3k-AKTand P53 [12] It has been shown that [13ndash15] AKT indirectlyaffects NF-120581B and P53 and thus influences cell survivalBy phosphorylating and activating kB kinase (IKK) AKTleads to the degradation of I120581B an inhibitor of NF-120581B andthus results in cytoplasm release and nuclear translocationof NF-120581B which in turn activates its target genes andpromotes cell survival Our experiments showed that Chinesemedicine containing serum significantly inhibited the level ofphosphorylated AKT Therefore we inferred that it was theAKT-NF-120581B signaling pathway that Shuizhongcao Granuleacted through on fibroblasts

Our study confirmed the ability of Shuizhongcao toaccelerate the recovery of ROU rat and further demonstratedthat the mode of action was associated with inflammatoryreaction inhibition The mechanism underlying facilitationof fibroblast proliferation by Shuizhongcao is yet to bediscovered Our research provides an experimental rationalefor the application of Shuizhongcao in clinical therapy

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

Zhang Bo Ruan Shan-ming Wang Bei and Li Qing-lincontributed equally to the project and are considered co-firstauthors

Acknowledgments

The authors wish to acknowledge The Zhejiang ProvincialNatural Science Foundation of China (2010ZZ003) ldquoIntegra-tive Medicinerdquo Key Discipline of Zhejiang University Pro-gram and The First Affiliated Hospital of Zhejiang ChineseMedical University Eagles Program for the Cultivation ofTalents

References

[1] B Tarakji K Baroudi and Y Kharma ldquoThe effect of dietaryhabits on the development of the recurrent aphthous stomatitisrdquoNigerian Medical Journal vol 53 no 1 pp 9ndash11 2012

[2] W Meng Y Dong J Liu et al ldquoA clinical evaluation ofamlexanox oral adhesive pellicles in the treatment of recurrentaphthous stomatitis and comparison with amlexanox oraltablets a randomized placebo controlled blinded multicenterclinical trialrdquo Trials vol 10 article 30 2009

[3] S Tsuyuki K Kawaguchi Y Kawata et al ldquoUsefulness ofantimycotic agents (itraconazole) in chemotherapy-inducedmucositis of breast cancer patientsrdquo Gan To Kagaku Ryoho vol39 no 9 pp 1369ndash1373 2012

[4] A R Tappuni T Kovacevic P J Shirlaw et al ldquoClinicalassessment of disease severity in recurrent aphthous stomatitisrdquoJournal of Oral PathologyampMedicine vol 42 no 8 pp 635ndash6412013

[5] N Babaee D Moslemi M Khalilpour et al ldquoAntioxidantcapacity of calendula officinalis flowers extract and preventionof radiation induced oropharyngeal mucositis in patients withhead and neck cancers a randomized controlled clinical studyrdquoDaru vol 21 no 1 article 18 2013

[6] B V Caputo G A N Filho C C dos Santos Y Okida andE M Giovani ldquoLaser therapy of recurrent aphthous ulcer inpatient with HIV infectionrdquoCase Reports inMedicine vol 2012Article ID 695642 3 pages 2012

[7] X M Yang X H Wang L F Chen et al ldquoEffects of dihy-dromyricetin on tumor necrosis factor and NF-kappaB p65 ofRAU ratsrdquo Zhongguo Zhong Yao Za Zhi vol 37 no 17 pp 2612ndash2617 2012

[8] T Jin M-H Shen Y-F Sun et al ldquoShuizhongcao decoctiontreatment chemotherapy induced oral ulcerrdquo Chinese Archivesof Traditional ChineseMedicine vol 27 no 2 pp 303ndash305 2009

[9] M H Shen S M Ruan andMH Bao ldquoEffect of shuizhongcaogranule on cellular immune function of experimental animalwith recurrent aphthous stomatitisrdquo Zhongguo Zhong Xi Yi JieHe Za Zhi vol 29 no 10 pp 901ndash904 2009

[10] M H Shen S M Ruan and M H Bao ldquoResearch ofShuizhongcao Granule on experimental animal recurrentoralulcer of the red cell immune functionrdquo Chinese Archivesof Traditional Chinese Medicine vol 26 no 12 pp 2605ndash26072008

[11] A Siomek ldquoNF-120581B signaling pathway and free radical impactrdquoActa Biochimica Polonica vol 59 no 3 pp 323ndash331 2012

Evidence-Based Complementary and Alternative Medicine 9

[12] S-J Jeong C A Pise-Masison M F Radonovich H U Parkand J N Brady ldquoActivated AKT regulates NF-120581B activationp53 inhibition and cell survival in HTLV-1-transformed cellsrdquoOncogene vol 24 no 44 pp 6719ndash6728 2005

[13] F Busch A Mobasheri P Shayan R Stahlmann and MShakibaei ldquoSirt-1 is required for the inhibition of apoptosis andinflammatory responses in human tenocytesrdquo The Journal ofBiological Chemistry vol 287 no 31 pp 25770ndash25781 2012

[14] F Busch A Mobasheri P Shayan et al ldquoResveratrol modulatesinterleukin-1beta-induced phosphatidylinositol 3-kinase andnuclear factor kappaB signaling pathways in human tenocytesrdquoThe Journal of Biological Chemistry vol 287 no 45 pp 38050ndash38063 2012

[15] Y D Park Y S Kim Y M Jung et al ldquoPorphyromonasgingivalis lipopolysaccharide regulates interleukin (IL)-17 andIL-23 expression via SIRT1 modulation in human periodontalligament cellsrdquo Cytokine vol 60 no 1 pp 284ndash293 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 5

0

500000

1000000

1500000

2000000

2500000

3000000

Target protein

Gre

y le

vel

p-ERK12

p-ERK12

ERK12 (internal reference)

ERK12 (internal reference)

Shuizhongcaogroup

Shuizhongcao group

NS group

NS group

Control group

Control group

Figure 3 Expression of phosphorylated ERK12

4 Results

41 Rat Model Establishment 12 h after rat model estab-lishment buccal mucosal vasodilatation increased capillarynetwork and tissue edema were observed At 24 h edemabecame serious The mucosal epithelial layer slightly exfoli-ated and the surface was covered with exudates At 48 h theoral ulcer formed and the mucosa turned red extensivelywhich was covered by large pieces of pseudomembranesappearing yellowish white in color and easily exfoliatedA specialist in pathology confirmed the diagnosis and thesuccess of model establishment

42 Culture of Rat Fibroblasts The rat fibroblast culture grewwell after subculturing

43 CCK8 Results of Fibroblast Intervention by ControlSerum andDrug-Containing Serum As shown in Table 2 andFigure 1 serum in both control group and Chinese medicinegroup was able to suppress rat fibroblast proliferation sig-nificantly different from that in blank group (119875 lt 005)The suppressive effect was positively but not proportionallycorrelated with dosage and treatment time The serum con-taining Chinese medicine reduced the suppressive effect of

inflammation on rat fibroblasts The difference between eachgroup was statistically significant (119875 lt 005)

44 Western Blot Results following Serum Intervention ofRat Fibroblasts

441 Expression of Protein Associated with NF-120581B Path-way The results showed that serum containing Shuizhong-cao Granule significantly downregulated the expression ofphosphorylated P65 demonstrating its ability to suppress theactivation and relevant protein expression of NF-120581B pathwayIn the meantime Shuizhongcao increased phosphorylatedI120581B120572 and phosphorylated IKK120572120573 expression facilitatingthe activation of canonical NF-120581B pathway The differencesbetween each parameter from Shuizhongcao group (exceptfor internal standard) and that of two other groups werestatistically significant (119875 lt 005) Differences between NSgroup (NS group is short for ldquonormal saline grouprdquo) andcontrol group were not significant See Figure 2

442 Expression of Phosphorylated ERK12 The resultsdemonstrated that Shuizhongcao-containing serum led tosuppressed expression of phosphorylated ERK12 and thusinhibited ERK mediated proliferation pathway The differ-ence of phosphorylated ERK12 expression level between

6 Evidence-Based Complementary and Alternative Medicine

0

200000

400000

600000

800000

1000000

1200000

1400000

1600000

1800000

2000000

p-AKT

p-AKT

Beta-actin

Beta-actin

Target protein

Gre

y le

vel

Shuizhongcao groupNS groupControl group

Shuizhongcaogroup

NS group Control group

Figure 4 Expression of phosphorylated AKT

Shuizhongcao group and control group as well as NS groupand control group was statistically significant (119875 lt 005) SeeFigure 3

443 Expression of Phosphorylated AKT The results demon-strated that Shuizhongcao-containing serum suppressed theexpression of phosphorylated AKT Differences between thephosphorylatedAKT expression level of Shuizhongcao groupand that of two other groups were statistically significant(119875 lt 005) respectively The difference between NS groupand control group was not significant See Figure 4

45 PCR Results of IL-10 IL-12a and IL-12b Consideringthe large variations in PCR measurements a normal groupwas set up that is using drug-containing rat serum withoutany treatment as reference The measurements in the con-trol group and Chinese medicine group were respectivelydivided by the values in the normal group to calculate relativeexpression amounts tomore objectively reflect the expressiondifference

The results showed that levels of IL-10 expression in bothChinesemedicine group and control group were significantlyincreased (119875 lt 001) compared with normal control groupThe expression levels of IL-10 and IL-12a in Chinesemedicinegroup were significantly decreased compared with those incontrol group (119875 lt 001) When compared with normal

group IL-12a expression level was increased in Chinesemedicine group while it decreased in control group withsignificant differences (119875 lt 001) When compared withnormal group the IL-12b expression level was decreased inChinese medicine group while it increased in control groupwith significant differences See Figure 5

5 Discussion

Fibroblast proliferation is crucial for the healing of oralulcers CCK8 assay indicated that Shuizhongcao Granuledid enhance fibroblast proliferation Western blot showedthat the serum containing Shuizhongcao Granule inhibitedAKT expression in fibroblasts We supposed that fibroblastproliferation was related to inflammation inhibition causedby AKT inhibition However this needs to be confirmed bycontrolled trial of gene silencing We aimed to identify theeffect of Shuizhongcao Granule on oral ulcers in animal andcell models using CCK8 assay and the results confirmed thatfibroblast proliferation was enhanced Subsequent Westernblot and PCR were intended to find out the reasons for thisand to collect data for analysis

According to our preliminary research ShuizhongcaoGranule was able to increase the red blood cell Cab receptorrosette formation rate but decrease immune complex rosetteformation rate in red blood cells [9] We also demonstratedthat in ROU Shuizhongcao Granule was capable of

Evidence-Based Complementary and Alternative Medicine 7

0

1

2

3

4

5

6

7

IL-10 IL-12a IL-12b

Blank groupChinese medicine group

Relat

ive e

xpre

ssio

n

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)

4000E minus 2

9000E minus 2

1400E minus 1

1900E minus 1

GAPDH

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-10

1300E minus 1

1100E minus 1

9000E minus 2

7000E minus 2

5000E minus 2

3000E minus 2

1000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12a

1800E minus 1

1300E minus 1

8000E minus 2

3000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12b

2400E minus 1

1900E minus 1

1400E minus 1

9000E minus 2

4000E minus 2

GAPDH

5000

4000

3000

2000

1000

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot

IL-12a

0 5 10 15 20 25 30 35 40

Cycle

5000

4000

3000

2000

1000

Amplification plot

IL-10

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4600

4100

3600

3100

2600

2100

1600

1100

6000E minus 1

IL-12b

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4400

3900

3400

2900

2400

1900

1400

9000E minus 1

4000E minus 1

Rn

Rn

Rn

RnRn

Rn

Rn

Rn

The PCR melting curve of GAPDH IL-10 IL-12a and IL-12b

The PCR amplification curve of GAPDH IL-10 IL-12a and IL-12b

Figure 5 Relative expression of IL-10 IL-12a and IL-12 Note 995333995333 compared with control group 119875 lt 001

increasing the percentage of CD3 and CD4 positive cellsCD4CD8 ratio and serum level of IL-12 and decreasingserum level of IL-10 [10] Through the rat ROU modelwe compared the recovery time of ulcers in Shuizhongcaogroup and model group and demonstrated the efficacy of

Shuizhongcao Granule in treating ROU The in vivo effect ofinflammation inhibition of Shuizhongcao was demonstratedby levels of IL-4 IL-8 and GM-CSF in rat serum

Based on the preliminary research this study focusedon exploring the pathways associated with inflammation

8 Evidence-Based Complementary and Alternative Medicine

NF-120581B is a canonical pathway associated among otherswith inflammation It has also been reported that NF-120581Bregulates several hundred genes involved in cell growthdifferentiation and apoptosis [11] Here we reported thatthe level of phosphorylated P65 in Chinese medicine groupwas significantly decreased compared with two other groupsSince the expression of NF-120581B pathway mainly relies on thebinding of phosphorylated P65 on the particular gene targetin the nucleus NF-120581B pathwaymight be inhibited in the Chi-nese medicine group However further experiments showedthat after the treatment of Chinese medicine expressionlevels of phosphorylated I120581B120572 and phosphorylated IKK120572120573increased while IKK120573 expression was decreased which wascontrary to what should be presented by the canonicalpathway Therefore we speculate that Shuizhongcao Granulesuppresses the activation of NF-120581B pathway through inhibit-ing an alternative unknown pathway rather than inhibitingthe canonical pathway

Our preliminary data showed that serum containingShuizhongcao facilitated fibroblast proliferation (or inhib-ited inflammation lesions) Thus we speculated that serumcontaining Shuizhongcao Granule would be able to acti-vate ERK pathway promote cell proliferation and suppressapoptosis However the results demonstrated that drug-containing serum inhibited the expression of phosphory-lated ERK12 which are the key players of ERK pathwayTherefore we inferred that the ability of ShuizhongcaoGranule to promote cell proliferation is through the inhibi-tion of p-AKT expression and thus to regulate the NF-120581Bpathway

As a major player on antiapoptotic pathway AKT canexert a dominant negative effect and inhibit insulin-likegrowth factor 1 (IGF1) mediated cell growth thus persistentactivation of AKT inhibits PTEN mediated apoptosis AKTalso affects cell survival by an indirect effect on Pi3k-AKTand P53 [12] It has been shown that [13ndash15] AKT indirectlyaffects NF-120581B and P53 and thus influences cell survivalBy phosphorylating and activating kB kinase (IKK) AKTleads to the degradation of I120581B an inhibitor of NF-120581B andthus results in cytoplasm release and nuclear translocationof NF-120581B which in turn activates its target genes andpromotes cell survival Our experiments showed that Chinesemedicine containing serum significantly inhibited the level ofphosphorylated AKT Therefore we inferred that it was theAKT-NF-120581B signaling pathway that Shuizhongcao Granuleacted through on fibroblasts

Our study confirmed the ability of Shuizhongcao toaccelerate the recovery of ROU rat and further demonstratedthat the mode of action was associated with inflammatoryreaction inhibition The mechanism underlying facilitationof fibroblast proliferation by Shuizhongcao is yet to bediscovered Our research provides an experimental rationalefor the application of Shuizhongcao in clinical therapy

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

Zhang Bo Ruan Shan-ming Wang Bei and Li Qing-lincontributed equally to the project and are considered co-firstauthors

Acknowledgments

The authors wish to acknowledge The Zhejiang ProvincialNatural Science Foundation of China (2010ZZ003) ldquoIntegra-tive Medicinerdquo Key Discipline of Zhejiang University Pro-gram and The First Affiliated Hospital of Zhejiang ChineseMedical University Eagles Program for the Cultivation ofTalents

References

[1] B Tarakji K Baroudi and Y Kharma ldquoThe effect of dietaryhabits on the development of the recurrent aphthous stomatitisrdquoNigerian Medical Journal vol 53 no 1 pp 9ndash11 2012

[2] W Meng Y Dong J Liu et al ldquoA clinical evaluation ofamlexanox oral adhesive pellicles in the treatment of recurrentaphthous stomatitis and comparison with amlexanox oraltablets a randomized placebo controlled blinded multicenterclinical trialrdquo Trials vol 10 article 30 2009

[3] S Tsuyuki K Kawaguchi Y Kawata et al ldquoUsefulness ofantimycotic agents (itraconazole) in chemotherapy-inducedmucositis of breast cancer patientsrdquo Gan To Kagaku Ryoho vol39 no 9 pp 1369ndash1373 2012

[4] A R Tappuni T Kovacevic P J Shirlaw et al ldquoClinicalassessment of disease severity in recurrent aphthous stomatitisrdquoJournal of Oral PathologyampMedicine vol 42 no 8 pp 635ndash6412013

[5] N Babaee D Moslemi M Khalilpour et al ldquoAntioxidantcapacity of calendula officinalis flowers extract and preventionof radiation induced oropharyngeal mucositis in patients withhead and neck cancers a randomized controlled clinical studyrdquoDaru vol 21 no 1 article 18 2013

[6] B V Caputo G A N Filho C C dos Santos Y Okida andE M Giovani ldquoLaser therapy of recurrent aphthous ulcer inpatient with HIV infectionrdquoCase Reports inMedicine vol 2012Article ID 695642 3 pages 2012

[7] X M Yang X H Wang L F Chen et al ldquoEffects of dihy-dromyricetin on tumor necrosis factor and NF-kappaB p65 ofRAU ratsrdquo Zhongguo Zhong Yao Za Zhi vol 37 no 17 pp 2612ndash2617 2012

[8] T Jin M-H Shen Y-F Sun et al ldquoShuizhongcao decoctiontreatment chemotherapy induced oral ulcerrdquo Chinese Archivesof Traditional ChineseMedicine vol 27 no 2 pp 303ndash305 2009

[9] M H Shen S M Ruan andMH Bao ldquoEffect of shuizhongcaogranule on cellular immune function of experimental animalwith recurrent aphthous stomatitisrdquo Zhongguo Zhong Xi Yi JieHe Za Zhi vol 29 no 10 pp 901ndash904 2009

[10] M H Shen S M Ruan and M H Bao ldquoResearch ofShuizhongcao Granule on experimental animal recurrentoralulcer of the red cell immune functionrdquo Chinese Archivesof Traditional Chinese Medicine vol 26 no 12 pp 2605ndash26072008

[11] A Siomek ldquoNF-120581B signaling pathway and free radical impactrdquoActa Biochimica Polonica vol 59 no 3 pp 323ndash331 2012

Evidence-Based Complementary and Alternative Medicine 9

[12] S-J Jeong C A Pise-Masison M F Radonovich H U Parkand J N Brady ldquoActivated AKT regulates NF-120581B activationp53 inhibition and cell survival in HTLV-1-transformed cellsrdquoOncogene vol 24 no 44 pp 6719ndash6728 2005

[13] F Busch A Mobasheri P Shayan R Stahlmann and MShakibaei ldquoSirt-1 is required for the inhibition of apoptosis andinflammatory responses in human tenocytesrdquo The Journal ofBiological Chemistry vol 287 no 31 pp 25770ndash25781 2012

[14] F Busch A Mobasheri P Shayan et al ldquoResveratrol modulatesinterleukin-1beta-induced phosphatidylinositol 3-kinase andnuclear factor kappaB signaling pathways in human tenocytesrdquoThe Journal of Biological Chemistry vol 287 no 45 pp 38050ndash38063 2012

[15] Y D Park Y S Kim Y M Jung et al ldquoPorphyromonasgingivalis lipopolysaccharide regulates interleukin (IL)-17 andIL-23 expression via SIRT1 modulation in human periodontalligament cellsrdquo Cytokine vol 60 no 1 pp 284ndash293 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

6 Evidence-Based Complementary and Alternative Medicine

0

200000

400000

600000

800000

1000000

1200000

1400000

1600000

1800000

2000000

p-AKT

p-AKT

Beta-actin

Beta-actin

Target protein

Gre

y le

vel

Shuizhongcao groupNS groupControl group

Shuizhongcaogroup

NS group Control group

Figure 4 Expression of phosphorylated AKT

Shuizhongcao group and control group as well as NS groupand control group was statistically significant (119875 lt 005) SeeFigure 3

443 Expression of Phosphorylated AKT The results demon-strated that Shuizhongcao-containing serum suppressed theexpression of phosphorylated AKT Differences between thephosphorylatedAKT expression level of Shuizhongcao groupand that of two other groups were statistically significant(119875 lt 005) respectively The difference between NS groupand control group was not significant See Figure 4

45 PCR Results of IL-10 IL-12a and IL-12b Consideringthe large variations in PCR measurements a normal groupwas set up that is using drug-containing rat serum withoutany treatment as reference The measurements in the con-trol group and Chinese medicine group were respectivelydivided by the values in the normal group to calculate relativeexpression amounts tomore objectively reflect the expressiondifference

The results showed that levels of IL-10 expression in bothChinesemedicine group and control group were significantlyincreased (119875 lt 001) compared with normal control groupThe expression levels of IL-10 and IL-12a in Chinesemedicinegroup were significantly decreased compared with those incontrol group (119875 lt 001) When compared with normal

group IL-12a expression level was increased in Chinesemedicine group while it decreased in control group withsignificant differences (119875 lt 001) When compared withnormal group the IL-12b expression level was decreased inChinese medicine group while it increased in control groupwith significant differences See Figure 5

5 Discussion

Fibroblast proliferation is crucial for the healing of oralulcers CCK8 assay indicated that Shuizhongcao Granuledid enhance fibroblast proliferation Western blot showedthat the serum containing Shuizhongcao Granule inhibitedAKT expression in fibroblasts We supposed that fibroblastproliferation was related to inflammation inhibition causedby AKT inhibition However this needs to be confirmed bycontrolled trial of gene silencing We aimed to identify theeffect of Shuizhongcao Granule on oral ulcers in animal andcell models using CCK8 assay and the results confirmed thatfibroblast proliferation was enhanced Subsequent Westernblot and PCR were intended to find out the reasons for thisand to collect data for analysis

According to our preliminary research ShuizhongcaoGranule was able to increase the red blood cell Cab receptorrosette formation rate but decrease immune complex rosetteformation rate in red blood cells [9] We also demonstratedthat in ROU Shuizhongcao Granule was capable of

Evidence-Based Complementary and Alternative Medicine 7

0

1

2

3

4

5

6

7

IL-10 IL-12a IL-12b

Blank groupChinese medicine group

Relat

ive e

xpre

ssio

n

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)

4000E minus 2

9000E minus 2

1400E minus 1

1900E minus 1

GAPDH

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-10

1300E minus 1

1100E minus 1

9000E minus 2

7000E minus 2

5000E minus 2

3000E minus 2

1000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12a

1800E minus 1

1300E minus 1

8000E minus 2

3000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12b

2400E minus 1

1900E minus 1

1400E minus 1

9000E minus 2

4000E minus 2

GAPDH

5000

4000

3000

2000

1000

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot

IL-12a

0 5 10 15 20 25 30 35 40

Cycle

5000

4000

3000

2000

1000

Amplification plot

IL-10

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4600

4100

3600

3100

2600

2100

1600

1100

6000E minus 1

IL-12b

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4400

3900

3400

2900

2400

1900

1400

9000E minus 1

4000E minus 1

Rn

Rn

Rn

RnRn

Rn

Rn

Rn

The PCR melting curve of GAPDH IL-10 IL-12a and IL-12b

The PCR amplification curve of GAPDH IL-10 IL-12a and IL-12b

Figure 5 Relative expression of IL-10 IL-12a and IL-12 Note 995333995333 compared with control group 119875 lt 001

increasing the percentage of CD3 and CD4 positive cellsCD4CD8 ratio and serum level of IL-12 and decreasingserum level of IL-10 [10] Through the rat ROU modelwe compared the recovery time of ulcers in Shuizhongcaogroup and model group and demonstrated the efficacy of

Shuizhongcao Granule in treating ROU The in vivo effect ofinflammation inhibition of Shuizhongcao was demonstratedby levels of IL-4 IL-8 and GM-CSF in rat serum

Based on the preliminary research this study focusedon exploring the pathways associated with inflammation

8 Evidence-Based Complementary and Alternative Medicine

NF-120581B is a canonical pathway associated among otherswith inflammation It has also been reported that NF-120581Bregulates several hundred genes involved in cell growthdifferentiation and apoptosis [11] Here we reported thatthe level of phosphorylated P65 in Chinese medicine groupwas significantly decreased compared with two other groupsSince the expression of NF-120581B pathway mainly relies on thebinding of phosphorylated P65 on the particular gene targetin the nucleus NF-120581B pathwaymight be inhibited in the Chi-nese medicine group However further experiments showedthat after the treatment of Chinese medicine expressionlevels of phosphorylated I120581B120572 and phosphorylated IKK120572120573increased while IKK120573 expression was decreased which wascontrary to what should be presented by the canonicalpathway Therefore we speculate that Shuizhongcao Granulesuppresses the activation of NF-120581B pathway through inhibit-ing an alternative unknown pathway rather than inhibitingthe canonical pathway

Our preliminary data showed that serum containingShuizhongcao facilitated fibroblast proliferation (or inhib-ited inflammation lesions) Thus we speculated that serumcontaining Shuizhongcao Granule would be able to acti-vate ERK pathway promote cell proliferation and suppressapoptosis However the results demonstrated that drug-containing serum inhibited the expression of phosphory-lated ERK12 which are the key players of ERK pathwayTherefore we inferred that the ability of ShuizhongcaoGranule to promote cell proliferation is through the inhibi-tion of p-AKT expression and thus to regulate the NF-120581Bpathway

As a major player on antiapoptotic pathway AKT canexert a dominant negative effect and inhibit insulin-likegrowth factor 1 (IGF1) mediated cell growth thus persistentactivation of AKT inhibits PTEN mediated apoptosis AKTalso affects cell survival by an indirect effect on Pi3k-AKTand P53 [12] It has been shown that [13ndash15] AKT indirectlyaffects NF-120581B and P53 and thus influences cell survivalBy phosphorylating and activating kB kinase (IKK) AKTleads to the degradation of I120581B an inhibitor of NF-120581B andthus results in cytoplasm release and nuclear translocationof NF-120581B which in turn activates its target genes andpromotes cell survival Our experiments showed that Chinesemedicine containing serum significantly inhibited the level ofphosphorylated AKT Therefore we inferred that it was theAKT-NF-120581B signaling pathway that Shuizhongcao Granuleacted through on fibroblasts

Our study confirmed the ability of Shuizhongcao toaccelerate the recovery of ROU rat and further demonstratedthat the mode of action was associated with inflammatoryreaction inhibition The mechanism underlying facilitationof fibroblast proliferation by Shuizhongcao is yet to bediscovered Our research provides an experimental rationalefor the application of Shuizhongcao in clinical therapy

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

Zhang Bo Ruan Shan-ming Wang Bei and Li Qing-lincontributed equally to the project and are considered co-firstauthors

Acknowledgments

The authors wish to acknowledge The Zhejiang ProvincialNatural Science Foundation of China (2010ZZ003) ldquoIntegra-tive Medicinerdquo Key Discipline of Zhejiang University Pro-gram and The First Affiliated Hospital of Zhejiang ChineseMedical University Eagles Program for the Cultivation ofTalents

References

[1] B Tarakji K Baroudi and Y Kharma ldquoThe effect of dietaryhabits on the development of the recurrent aphthous stomatitisrdquoNigerian Medical Journal vol 53 no 1 pp 9ndash11 2012

[2] W Meng Y Dong J Liu et al ldquoA clinical evaluation ofamlexanox oral adhesive pellicles in the treatment of recurrentaphthous stomatitis and comparison with amlexanox oraltablets a randomized placebo controlled blinded multicenterclinical trialrdquo Trials vol 10 article 30 2009

[3] S Tsuyuki K Kawaguchi Y Kawata et al ldquoUsefulness ofantimycotic agents (itraconazole) in chemotherapy-inducedmucositis of breast cancer patientsrdquo Gan To Kagaku Ryoho vol39 no 9 pp 1369ndash1373 2012

[4] A R Tappuni T Kovacevic P J Shirlaw et al ldquoClinicalassessment of disease severity in recurrent aphthous stomatitisrdquoJournal of Oral PathologyampMedicine vol 42 no 8 pp 635ndash6412013

[5] N Babaee D Moslemi M Khalilpour et al ldquoAntioxidantcapacity of calendula officinalis flowers extract and preventionof radiation induced oropharyngeal mucositis in patients withhead and neck cancers a randomized controlled clinical studyrdquoDaru vol 21 no 1 article 18 2013

[6] B V Caputo G A N Filho C C dos Santos Y Okida andE M Giovani ldquoLaser therapy of recurrent aphthous ulcer inpatient with HIV infectionrdquoCase Reports inMedicine vol 2012Article ID 695642 3 pages 2012

[7] X M Yang X H Wang L F Chen et al ldquoEffects of dihy-dromyricetin on tumor necrosis factor and NF-kappaB p65 ofRAU ratsrdquo Zhongguo Zhong Yao Za Zhi vol 37 no 17 pp 2612ndash2617 2012

[8] T Jin M-H Shen Y-F Sun et al ldquoShuizhongcao decoctiontreatment chemotherapy induced oral ulcerrdquo Chinese Archivesof Traditional ChineseMedicine vol 27 no 2 pp 303ndash305 2009

[9] M H Shen S M Ruan andMH Bao ldquoEffect of shuizhongcaogranule on cellular immune function of experimental animalwith recurrent aphthous stomatitisrdquo Zhongguo Zhong Xi Yi JieHe Za Zhi vol 29 no 10 pp 901ndash904 2009

[10] M H Shen S M Ruan and M H Bao ldquoResearch ofShuizhongcao Granule on experimental animal recurrentoralulcer of the red cell immune functionrdquo Chinese Archivesof Traditional Chinese Medicine vol 26 no 12 pp 2605ndash26072008

[11] A Siomek ldquoNF-120581B signaling pathway and free radical impactrdquoActa Biochimica Polonica vol 59 no 3 pp 323ndash331 2012

Evidence-Based Complementary and Alternative Medicine 9

[12] S-J Jeong C A Pise-Masison M F Radonovich H U Parkand J N Brady ldquoActivated AKT regulates NF-120581B activationp53 inhibition and cell survival in HTLV-1-transformed cellsrdquoOncogene vol 24 no 44 pp 6719ndash6728 2005

[13] F Busch A Mobasheri P Shayan R Stahlmann and MShakibaei ldquoSirt-1 is required for the inhibition of apoptosis andinflammatory responses in human tenocytesrdquo The Journal ofBiological Chemistry vol 287 no 31 pp 25770ndash25781 2012

[14] F Busch A Mobasheri P Shayan et al ldquoResveratrol modulatesinterleukin-1beta-induced phosphatidylinositol 3-kinase andnuclear factor kappaB signaling pathways in human tenocytesrdquoThe Journal of Biological Chemistry vol 287 no 45 pp 38050ndash38063 2012

[15] Y D Park Y S Kim Y M Jung et al ldquoPorphyromonasgingivalis lipopolysaccharide regulates interleukin (IL)-17 andIL-23 expression via SIRT1 modulation in human periodontalligament cellsrdquo Cytokine vol 60 no 1 pp 284ndash293 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 7

0

1

2

3

4

5

6

7

IL-10 IL-12a IL-12b

Blank groupChinese medicine group

Relat

ive e

xpre

ssio

n

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)

4000E minus 2

9000E minus 2

1400E minus 1

1900E minus 1

GAPDH

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-10

1300E minus 1

1100E minus 1

9000E minus 2

7000E minus 2

5000E minus 2

3000E minus 2

1000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12a

1800E minus 1

1300E minus 1

8000E minus 2

3000E minus 2

Dissociation curve

600600

650 700 750 800 850 900 950

Temperature (∘C)IL-12b

2400E minus 1

1900E minus 1

1400E minus 1

9000E minus 2

4000E minus 2

GAPDH

5000

4000

3000

2000

1000

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot

IL-12a

0 5 10 15 20 25 30 35 40

Cycle

5000

4000

3000

2000

1000

Amplification plot

IL-10

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4600

4100

3600

3100

2600

2100

1600

1100

6000E minus 1

IL-12b

0 5 10 15 20 25 30 35 40

Cycle

Amplification plot4400

3900

3400

2900

2400

1900

1400

9000E minus 1

4000E minus 1

Rn

Rn

Rn

RnRn

Rn

Rn

Rn

The PCR melting curve of GAPDH IL-10 IL-12a and IL-12b

The PCR amplification curve of GAPDH IL-10 IL-12a and IL-12b

Figure 5 Relative expression of IL-10 IL-12a and IL-12 Note 995333995333 compared with control group 119875 lt 001

increasing the percentage of CD3 and CD4 positive cellsCD4CD8 ratio and serum level of IL-12 and decreasingserum level of IL-10 [10] Through the rat ROU modelwe compared the recovery time of ulcers in Shuizhongcaogroup and model group and demonstrated the efficacy of

Shuizhongcao Granule in treating ROU The in vivo effect ofinflammation inhibition of Shuizhongcao was demonstratedby levels of IL-4 IL-8 and GM-CSF in rat serum

Based on the preliminary research this study focusedon exploring the pathways associated with inflammation

8 Evidence-Based Complementary and Alternative Medicine

NF-120581B is a canonical pathway associated among otherswith inflammation It has also been reported that NF-120581Bregulates several hundred genes involved in cell growthdifferentiation and apoptosis [11] Here we reported thatthe level of phosphorylated P65 in Chinese medicine groupwas significantly decreased compared with two other groupsSince the expression of NF-120581B pathway mainly relies on thebinding of phosphorylated P65 on the particular gene targetin the nucleus NF-120581B pathwaymight be inhibited in the Chi-nese medicine group However further experiments showedthat after the treatment of Chinese medicine expressionlevels of phosphorylated I120581B120572 and phosphorylated IKK120572120573increased while IKK120573 expression was decreased which wascontrary to what should be presented by the canonicalpathway Therefore we speculate that Shuizhongcao Granulesuppresses the activation of NF-120581B pathway through inhibit-ing an alternative unknown pathway rather than inhibitingthe canonical pathway

Our preliminary data showed that serum containingShuizhongcao facilitated fibroblast proliferation (or inhib-ited inflammation lesions) Thus we speculated that serumcontaining Shuizhongcao Granule would be able to acti-vate ERK pathway promote cell proliferation and suppressapoptosis However the results demonstrated that drug-containing serum inhibited the expression of phosphory-lated ERK12 which are the key players of ERK pathwayTherefore we inferred that the ability of ShuizhongcaoGranule to promote cell proliferation is through the inhibi-tion of p-AKT expression and thus to regulate the NF-120581Bpathway

As a major player on antiapoptotic pathway AKT canexert a dominant negative effect and inhibit insulin-likegrowth factor 1 (IGF1) mediated cell growth thus persistentactivation of AKT inhibits PTEN mediated apoptosis AKTalso affects cell survival by an indirect effect on Pi3k-AKTand P53 [12] It has been shown that [13ndash15] AKT indirectlyaffects NF-120581B and P53 and thus influences cell survivalBy phosphorylating and activating kB kinase (IKK) AKTleads to the degradation of I120581B an inhibitor of NF-120581B andthus results in cytoplasm release and nuclear translocationof NF-120581B which in turn activates its target genes andpromotes cell survival Our experiments showed that Chinesemedicine containing serum significantly inhibited the level ofphosphorylated AKT Therefore we inferred that it was theAKT-NF-120581B signaling pathway that Shuizhongcao Granuleacted through on fibroblasts

Our study confirmed the ability of Shuizhongcao toaccelerate the recovery of ROU rat and further demonstratedthat the mode of action was associated with inflammatoryreaction inhibition The mechanism underlying facilitationof fibroblast proliferation by Shuizhongcao is yet to bediscovered Our research provides an experimental rationalefor the application of Shuizhongcao in clinical therapy

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

Zhang Bo Ruan Shan-ming Wang Bei and Li Qing-lincontributed equally to the project and are considered co-firstauthors

Acknowledgments

The authors wish to acknowledge The Zhejiang ProvincialNatural Science Foundation of China (2010ZZ003) ldquoIntegra-tive Medicinerdquo Key Discipline of Zhejiang University Pro-gram and The First Affiliated Hospital of Zhejiang ChineseMedical University Eagles Program for the Cultivation ofTalents

References

[1] B Tarakji K Baroudi and Y Kharma ldquoThe effect of dietaryhabits on the development of the recurrent aphthous stomatitisrdquoNigerian Medical Journal vol 53 no 1 pp 9ndash11 2012

[2] W Meng Y Dong J Liu et al ldquoA clinical evaluation ofamlexanox oral adhesive pellicles in the treatment of recurrentaphthous stomatitis and comparison with amlexanox oraltablets a randomized placebo controlled blinded multicenterclinical trialrdquo Trials vol 10 article 30 2009

[3] S Tsuyuki K Kawaguchi Y Kawata et al ldquoUsefulness ofantimycotic agents (itraconazole) in chemotherapy-inducedmucositis of breast cancer patientsrdquo Gan To Kagaku Ryoho vol39 no 9 pp 1369ndash1373 2012

[4] A R Tappuni T Kovacevic P J Shirlaw et al ldquoClinicalassessment of disease severity in recurrent aphthous stomatitisrdquoJournal of Oral PathologyampMedicine vol 42 no 8 pp 635ndash6412013

[5] N Babaee D Moslemi M Khalilpour et al ldquoAntioxidantcapacity of calendula officinalis flowers extract and preventionof radiation induced oropharyngeal mucositis in patients withhead and neck cancers a randomized controlled clinical studyrdquoDaru vol 21 no 1 article 18 2013

[6] B V Caputo G A N Filho C C dos Santos Y Okida andE M Giovani ldquoLaser therapy of recurrent aphthous ulcer inpatient with HIV infectionrdquoCase Reports inMedicine vol 2012Article ID 695642 3 pages 2012

[7] X M Yang X H Wang L F Chen et al ldquoEffects of dihy-dromyricetin on tumor necrosis factor and NF-kappaB p65 ofRAU ratsrdquo Zhongguo Zhong Yao Za Zhi vol 37 no 17 pp 2612ndash2617 2012

[8] T Jin M-H Shen Y-F Sun et al ldquoShuizhongcao decoctiontreatment chemotherapy induced oral ulcerrdquo Chinese Archivesof Traditional ChineseMedicine vol 27 no 2 pp 303ndash305 2009

[9] M H Shen S M Ruan andMH Bao ldquoEffect of shuizhongcaogranule on cellular immune function of experimental animalwith recurrent aphthous stomatitisrdquo Zhongguo Zhong Xi Yi JieHe Za Zhi vol 29 no 10 pp 901ndash904 2009

[10] M H Shen S M Ruan and M H Bao ldquoResearch ofShuizhongcao Granule on experimental animal recurrentoralulcer of the red cell immune functionrdquo Chinese Archivesof Traditional Chinese Medicine vol 26 no 12 pp 2605ndash26072008

[11] A Siomek ldquoNF-120581B signaling pathway and free radical impactrdquoActa Biochimica Polonica vol 59 no 3 pp 323ndash331 2012

Evidence-Based Complementary and Alternative Medicine 9

[12] S-J Jeong C A Pise-Masison M F Radonovich H U Parkand J N Brady ldquoActivated AKT regulates NF-120581B activationp53 inhibition and cell survival in HTLV-1-transformed cellsrdquoOncogene vol 24 no 44 pp 6719ndash6728 2005

[13] F Busch A Mobasheri P Shayan R Stahlmann and MShakibaei ldquoSirt-1 is required for the inhibition of apoptosis andinflammatory responses in human tenocytesrdquo The Journal ofBiological Chemistry vol 287 no 31 pp 25770ndash25781 2012

[14] F Busch A Mobasheri P Shayan et al ldquoResveratrol modulatesinterleukin-1beta-induced phosphatidylinositol 3-kinase andnuclear factor kappaB signaling pathways in human tenocytesrdquoThe Journal of Biological Chemistry vol 287 no 45 pp 38050ndash38063 2012

[15] Y D Park Y S Kim Y M Jung et al ldquoPorphyromonasgingivalis lipopolysaccharide regulates interleukin (IL)-17 andIL-23 expression via SIRT1 modulation in human periodontalligament cellsrdquo Cytokine vol 60 no 1 pp 284ndash293 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

8 Evidence-Based Complementary and Alternative Medicine

NF-120581B is a canonical pathway associated among otherswith inflammation It has also been reported that NF-120581Bregulates several hundred genes involved in cell growthdifferentiation and apoptosis [11] Here we reported thatthe level of phosphorylated P65 in Chinese medicine groupwas significantly decreased compared with two other groupsSince the expression of NF-120581B pathway mainly relies on thebinding of phosphorylated P65 on the particular gene targetin the nucleus NF-120581B pathwaymight be inhibited in the Chi-nese medicine group However further experiments showedthat after the treatment of Chinese medicine expressionlevels of phosphorylated I120581B120572 and phosphorylated IKK120572120573increased while IKK120573 expression was decreased which wascontrary to what should be presented by the canonicalpathway Therefore we speculate that Shuizhongcao Granulesuppresses the activation of NF-120581B pathway through inhibit-ing an alternative unknown pathway rather than inhibitingthe canonical pathway

Our preliminary data showed that serum containingShuizhongcao facilitated fibroblast proliferation (or inhib-ited inflammation lesions) Thus we speculated that serumcontaining Shuizhongcao Granule would be able to acti-vate ERK pathway promote cell proliferation and suppressapoptosis However the results demonstrated that drug-containing serum inhibited the expression of phosphory-lated ERK12 which are the key players of ERK pathwayTherefore we inferred that the ability of ShuizhongcaoGranule to promote cell proliferation is through the inhibi-tion of p-AKT expression and thus to regulate the NF-120581Bpathway

As a major player on antiapoptotic pathway AKT canexert a dominant negative effect and inhibit insulin-likegrowth factor 1 (IGF1) mediated cell growth thus persistentactivation of AKT inhibits PTEN mediated apoptosis AKTalso affects cell survival by an indirect effect on Pi3k-AKTand P53 [12] It has been shown that [13ndash15] AKT indirectlyaffects NF-120581B and P53 and thus influences cell survivalBy phosphorylating and activating kB kinase (IKK) AKTleads to the degradation of I120581B an inhibitor of NF-120581B andthus results in cytoplasm release and nuclear translocationof NF-120581B which in turn activates its target genes andpromotes cell survival Our experiments showed that Chinesemedicine containing serum significantly inhibited the level ofphosphorylated AKT Therefore we inferred that it was theAKT-NF-120581B signaling pathway that Shuizhongcao Granuleacted through on fibroblasts

Our study confirmed the ability of Shuizhongcao toaccelerate the recovery of ROU rat and further demonstratedthat the mode of action was associated with inflammatoryreaction inhibition The mechanism underlying facilitationof fibroblast proliferation by Shuizhongcao is yet to bediscovered Our research provides an experimental rationalefor the application of Shuizhongcao in clinical therapy

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

Zhang Bo Ruan Shan-ming Wang Bei and Li Qing-lincontributed equally to the project and are considered co-firstauthors

Acknowledgments

The authors wish to acknowledge The Zhejiang ProvincialNatural Science Foundation of China (2010ZZ003) ldquoIntegra-tive Medicinerdquo Key Discipline of Zhejiang University Pro-gram and The First Affiliated Hospital of Zhejiang ChineseMedical University Eagles Program for the Cultivation ofTalents

References

[1] B Tarakji K Baroudi and Y Kharma ldquoThe effect of dietaryhabits on the development of the recurrent aphthous stomatitisrdquoNigerian Medical Journal vol 53 no 1 pp 9ndash11 2012

[2] W Meng Y Dong J Liu et al ldquoA clinical evaluation ofamlexanox oral adhesive pellicles in the treatment of recurrentaphthous stomatitis and comparison with amlexanox oraltablets a randomized placebo controlled blinded multicenterclinical trialrdquo Trials vol 10 article 30 2009

[3] S Tsuyuki K Kawaguchi Y Kawata et al ldquoUsefulness ofantimycotic agents (itraconazole) in chemotherapy-inducedmucositis of breast cancer patientsrdquo Gan To Kagaku Ryoho vol39 no 9 pp 1369ndash1373 2012

[4] A R Tappuni T Kovacevic P J Shirlaw et al ldquoClinicalassessment of disease severity in recurrent aphthous stomatitisrdquoJournal of Oral PathologyampMedicine vol 42 no 8 pp 635ndash6412013

[5] N Babaee D Moslemi M Khalilpour et al ldquoAntioxidantcapacity of calendula officinalis flowers extract and preventionof radiation induced oropharyngeal mucositis in patients withhead and neck cancers a randomized controlled clinical studyrdquoDaru vol 21 no 1 article 18 2013

[6] B V Caputo G A N Filho C C dos Santos Y Okida andE M Giovani ldquoLaser therapy of recurrent aphthous ulcer inpatient with HIV infectionrdquoCase Reports inMedicine vol 2012Article ID 695642 3 pages 2012

[7] X M Yang X H Wang L F Chen et al ldquoEffects of dihy-dromyricetin on tumor necrosis factor and NF-kappaB p65 ofRAU ratsrdquo Zhongguo Zhong Yao Za Zhi vol 37 no 17 pp 2612ndash2617 2012

[8] T Jin M-H Shen Y-F Sun et al ldquoShuizhongcao decoctiontreatment chemotherapy induced oral ulcerrdquo Chinese Archivesof Traditional ChineseMedicine vol 27 no 2 pp 303ndash305 2009

[9] M H Shen S M Ruan andMH Bao ldquoEffect of shuizhongcaogranule on cellular immune function of experimental animalwith recurrent aphthous stomatitisrdquo Zhongguo Zhong Xi Yi JieHe Za Zhi vol 29 no 10 pp 901ndash904 2009

[10] M H Shen S M Ruan and M H Bao ldquoResearch ofShuizhongcao Granule on experimental animal recurrentoralulcer of the red cell immune functionrdquo Chinese Archivesof Traditional Chinese Medicine vol 26 no 12 pp 2605ndash26072008

[11] A Siomek ldquoNF-120581B signaling pathway and free radical impactrdquoActa Biochimica Polonica vol 59 no 3 pp 323ndash331 2012

Evidence-Based Complementary and Alternative Medicine 9

[12] S-J Jeong C A Pise-Masison M F Radonovich H U Parkand J N Brady ldquoActivated AKT regulates NF-120581B activationp53 inhibition and cell survival in HTLV-1-transformed cellsrdquoOncogene vol 24 no 44 pp 6719ndash6728 2005

[13] F Busch A Mobasheri P Shayan R Stahlmann and MShakibaei ldquoSirt-1 is required for the inhibition of apoptosis andinflammatory responses in human tenocytesrdquo The Journal ofBiological Chemistry vol 287 no 31 pp 25770ndash25781 2012

[14] F Busch A Mobasheri P Shayan et al ldquoResveratrol modulatesinterleukin-1beta-induced phosphatidylinositol 3-kinase andnuclear factor kappaB signaling pathways in human tenocytesrdquoThe Journal of Biological Chemistry vol 287 no 45 pp 38050ndash38063 2012

[15] Y D Park Y S Kim Y M Jung et al ldquoPorphyromonasgingivalis lipopolysaccharide regulates interleukin (IL)-17 andIL-23 expression via SIRT1 modulation in human periodontalligament cellsrdquo Cytokine vol 60 no 1 pp 284ndash293 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 9

[12] S-J Jeong C A Pise-Masison M F Radonovich H U Parkand J N Brady ldquoActivated AKT regulates NF-120581B activationp53 inhibition and cell survival in HTLV-1-transformed cellsrdquoOncogene vol 24 no 44 pp 6719ndash6728 2005

[13] F Busch A Mobasheri P Shayan R Stahlmann and MShakibaei ldquoSirt-1 is required for the inhibition of apoptosis andinflammatory responses in human tenocytesrdquo The Journal ofBiological Chemistry vol 287 no 31 pp 25770ndash25781 2012

[14] F Busch A Mobasheri P Shayan et al ldquoResveratrol modulatesinterleukin-1beta-induced phosphatidylinositol 3-kinase andnuclear factor kappaB signaling pathways in human tenocytesrdquoThe Journal of Biological Chemistry vol 287 no 45 pp 38050ndash38063 2012

[15] Y D Park Y S Kim Y M Jung et al ldquoPorphyromonasgingivalis lipopolysaccharide regulates interleukin (IL)-17 andIL-23 expression via SIRT1 modulation in human periodontalligament cellsrdquo Cytokine vol 60 no 1 pp 284ndash293 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom