research article macrofungi in some forests of telangana...

Research ArticleMacrofungi in Some Forests of Telangana State India

Gudikandula Krishna Burra Samatha S V S S S L Hima Bindu NidadavoluMetuku Ram Prasad Byram Rajitha and Maringanti Alha Singara Charaya

Department of Microbiology Kakatiya University Warangal 506009 India

Correspondence should be addressed to Gudikandula Krishna krishnagudikandulagmailcom

Received 25 September 2014 Revised 27 December 2014 Accepted 27 December 2014

Academic Editor Angel Domınguez

Copyright copy 2015 Gudikandula Krishna et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

The fruiting bodies of macrofungi were collected from some forests fences waste fields timber depots of Telangana state duringrainy season This is an attempt to give a broad picture of diversity of macrofungi belonging to the class Basidiomycetes in someforest areas of Telangana region A total number of 50 fruiting bodies were collected and cultured and among them only ten wereidentified based on their macroscopic features and molecular identification since they showed good lignolytic activity

1 Introduction

The total forest cover in India according to the latest ForestReport 2013 is 698 million hectares and this constitutes2064 of the geographic area The state of Telangana isone of the progressive states in the southern part of Indiawith an area of 114840 sqkm while the recorded forestarea is 2924208 sqkm The annual rainfall is between 900to 1500mm in northern Telangana and 700 to 900mm insouthern Telangana from the southwest monsoons and it isa semiarid area and has a predominantly hot and dry climateThe Basidiomycota is the second largest phylum of kingdomFungi with approximately 23000 species [1] including manyof the common macroscopic forest fungi (eg mushroomsshelf fungi) Mushroom is a general term utilised mostly forthe fruiting body of the macrofungi belongs to Ascomycotaand Basidiomycota and represents only a short reproductivestage in their life cycle Investigations on the taxonomy anddiversity of macrofungi are gaining importance as manymacrofungi are facing a threat of extinction due to envi-ronment destruction Wild mushrooms have deep biologicaland economical impact Information on mushroom diversityis important because of its major functions in natural andorganised eco-schemes as ectomycorrhizal fungi The fungalgroup becomes a significant component for reforestationprograms Furthermore they are significant as nourishmentsource for human beings and animals [2] The macrofungi

were also used as a bioindicator of environmental quality [3]Most of the fleshy and gilled macrofungi were prevalent inthe rainy times of the year as this time is favourable for theiroutput since there is ample moisture favourable warmthrelative humidity and sunshine which furthermore aids themacrofungi in the decomposition of dead organic tissue Theearly dry time of the year collection was predominated bythe polypores since there is decline in rainfall and relativehumidity boost in warmth and sunshine and most of thefleshy macrofungi will not withstand these conditions Dur-ing rainy season there is abundant growth of several kinds ofBasidiomycetes Many fungal species groups do not producevisible fruit bodies or other species-specific characteristicsor these characteristics are extremely rare and cannot bedetected in traditional surveys hence these can be studiedusing molecular methods [4ndash6] Further Basidiomycetes areconsidered to be a very interesting group of fungi with theirexceptional adjustment abilities and as natural lignocellulosedegraders with different ecological groups such as white rotbrown rot and leaf litter fungi [7] Many kinds of macrofungiare not edible but possess variety of pharmaceutical andmedicinal qualities A fraction of complete fungal wealth hasbeen subjected to scientific scrutiny andmycologists continueto unravel the unexplored and hidden wealth one-third offungal diversity of the globe exists in India and of this only50 is characterized until now [8] About 10000 specieswithin the overall fungal estimates of 15 million belong to

Hindawi Publishing CorporationJournal of MycologyVolume 2015 Article ID 382476 7 pageshttpdxdoiorg1011552015382476

2 Journal of Mycology

this groupMushrooms alone are represented by about 41000species of which approximately 850 species are recordedfrom India [9] Some of thewild ediblemushrooms have beenreported from South West India [10] The first listed IndianFungi was published [11] and that was revised by Vasudev [12]and extra additional lists appeared in between culminatingwith the fungi of India (Bilgrami et al [13])

The present communication is the collection cultureidentification and preservation of the macrofungi in someforests of Telangana regionThis study adds extra informationto the present knowledge on the data of diversity of fungi inTelangana region and also to understand their bioprospects

2 Materials and Methods

21 Study Area The fruiting bodies of white rot fungi werecollected in rainy season from the forest of EtunagaramBhadrachalam Kothagudem Narsampet Ilandhu Kham-mam Bodhan and Nirmal of Telangana region

22 Culturing and Preservation The collected fruit bodieswere cultured for their mycelial growth as per the methodsuggested [14] A small piece of fruiting body was dippedin 001 mercuric chloride to remove surface contaminationand washed several times with distilled water to remove thetraces of mercuric chloride and transferred aseptically on to3 malt extract agar [15] slants and was incubated for 5ndash7 days The mycelium collected from the growing edge ofthose slants was transferred on to newmalt extract agar slantsand incubated further 5ndash7 days to obtain pure culture Purecultures were subcultured on malt extract agar slants andplates every fortnight

23 Characterization of Macrofungi Based on macroscopicfeatures namely size shape sporocarp nature color sporeprint margin of pileus characters of lamella spacing of gillscharacters of the stipe and the presence or absence of veilson stipes the fungi were identified httpenwikipediaorgwikiTemplateMycomorphbox

24 Identification of Macrofungi

241 Macroscopic Identification Seven mycological char-acters useful in tentative identification of mushrooms arehymenium type cap shape gills stipe character color of thespore print ecological type and edibility

242 Molecular Identification Based on their lignolyticactivity (data not shown here) ten species of wild macro-fungi were selected for confirmation of their identitiesusing molecular methods (see Figure 1) Collected fruitingbodies are initially cultured on malt agar (MEA) andthe genomic DNA of the macrofungi was extracted usingmodified CTAB method [16] The genomic DNA of themacrofungi was then subjected to PCR to amplify the ITSregions of the nuclear ribosomal DNA using two primersITS 1 (51015840TCCGTAGGTGAA CCTTGCGG31015840) and ITS 4

(51015840TCCTCCGCTTATTGATATGC31015840) [17] The PCR prod-ucts were then purified using QIAGEN purification kitfollowing the manufacturerrsquos instructions and the purifiedPCR products were sent to SciGenom Cochin for outdoorDNA sequencing Related gene sequences for each of themacrofungal specimens were obtained from NCBI GenBankand then automatically aligned using ClustalW programincorporated in BioEdit v 719 [18] Manual sequence align-ments were then performed using Bioedit to allow max-imum sequence similarity Finally phylogenetic tree wasconstructed based onmaximumparsimonyusing PAUPv 40b10 [19]

3 Results

The fruiting bodies of white rot fungi were collected in rainyseason from few forest areas of Telangana state (Table 1)The collected fruit bodies were cultured until the purecultures were obtained The lists of identified wild mush-rooms were depicted in Tables 2 and 3 The fungi thatbelong to Polyporales are more in number than other ordersSchizophyllum radiatum belong to the order Agaricales Allthe collected fungi were saprotrophic and were not edibleBased on seven mycological characters they were charac-terized The climatic conditions in Telangana are congenialfor prevalence of macrofungi and hence recorded maximumgenera During the systematic surveys at different forestsof Telangana total 50 mushroom samples were collectedand these samples belong to different genera out of whichonly 10 mushroom samples were identified based on theirlignolytic activity (data not shown here) and were identifiedbasing on the molecular identification and macroscopiccharacters All collected mushrooms have been deposited inthe department herbarium with accession numbers The tenidentified mushrooms by molecular level are Trametes versi-color (GenBank Accession number HF953984) Pycnoporuscinnabarinus strain SYBCndashL14 Daedaleopsis flavida strain5ATrametes elegans voucher Trametes hirsuta Fomitopsis feei(GenBank Accession number AY 5153271) Trametes gibbosa(GenBank Accession number AY3519241) Trametes ele-gans GenBank (Accession number AY3519251) Ganodermalucidum and Schizophyllum radiatum (GenBank Accessionnumber HE8637421)

4 Discussion

In Basidiomycotina more than 2000 species of edible mush-rooms are reported in the publications from different com-ponents of the world People all over Asian countries inthe twentieth century know that mushrooms are importantbiosource of novel secondary metabolites In India thealternative systems of medicine utilize the curative proper-ties of mushrooms Secondary metabolites of these mush-rooms are chemically diverse and possess a broad spectrumof biological activities which are explored in traditionalmedicines [20] In India several mushrooms have beenreported as medicinal mushrooms which have antioxidantantimicrobial and anti-inflammatory activity with antitumor

Journal of Mycology 3

Trametes versicolor Pycnoporus cinnabarinus strain SYBC-L14

Daedaleopsis flavida strain 5A Trametes elegans voucher

Trametes hirsuta Fomitopsis feei

Trametes gibbosa Trametes elegans

Schizophyllum radiatum Ganoderma lucidum

Figure 1 Photographs of identified macrofungi


Table 1 List of macrofungi collected in some forests of Telangana state

Site Number Site name Strain name Source AltitudeAbortiporus biennis Ground-dwelling

Agaricus xanthodermus HardwoodCantharellus subalbidus Hardwood

Eturnagaram forest Tyromyces sp TreeGleophyllum sp TreeGomophus sp Tree

Trametes pubescens Dead wood

1Trametes elegans

voucher Wood log 18∘ 201015840 2010158401015840N80∘ 251015840 4510158401015840 E

Pycnoporus cinnabarinus Wood logTrametes hirsuta Wood logOligoporus sp Wood log

Eturnagaram Timber Depot Schizophyllum radiatum Wood logTrichaptum Wood log

Trametes versicolor Wood logTrametes gibbosa Wood logFomitopsis feei Tree

Auricularia auricula Wood logClitocybe philophylla TreeTremella foliacea Fallen branchesTrametes hirsuta Dead wood

2 Bhadrachalam forest Daedaleopsis flavida Fallen branches 17∘ 401015840 1210158401015840N80∘ 521015840 4810158401015840 EGanoderma lucidum Wood log

Stereum hirsutum Dead woodTrametes betulina Wood logGanoderma sp Wood logInonotus hispidus TreePhellinus igniarius TreeTremella aurantia Wood log

3 Bodhan Stereum ostrea Tree barks 18∘ 401015840 1210158401015840 N77∘ 541015840 010158401015840 E

Dichomitus sp Wood logTrametes sp Wood log

Ganoderma applanatum TreeAmauroderma Wood log

4 Nirmal Trametes ochracea Wood log 19∘ 61015840 010158401015840 N78∘ 211015840 010158401015840 E

Trametes elegans Wood logPycnoporus coccineus Wood log

Pleurotus sp Wood logTrametes sp Wood log

5 Illandu Timber Depot Daedaleopsis confragosa Wood log 17∘ 361015840 010158401015840 N80∘ 191015840 4810158401015840 E

Pycnoporus sanguineus Dead woodPhyllotopsis Wood log


Table 1 Continued

Site Number Site name Strain name Source AltitudePiptoporus betulinus Tree

6 Kothagudem Trametes sp Wood log 17∘ 331015840 010158401015840 N80∘ 371015840 4810158401015840 E

Ganoderma sp Wood logGanoderma sp Wood log

7 Narsampet Daedaleopsis sp Wood log 17∘ 551015840 350210158401015840 N79∘ 531015840 489910158401015840 ETrametes sp Wood log

Pycnoporus sp

8 Khammam Schizophyllum commune Wood log 17∘ 151015840 010158401015840N80∘ 91015840 010158401015840 ETrametes sp Wood log

Table 2 Classification of identified wild mushrooms

Division Class Order Family Genus Species Place

Basidiomycota Agaricomycetes Polyporales Polyporaceae

TrametesTrametesTrametesGanodermaDaedaleopsisTrametesTrametes

versicolorhirsuta

elegans voucherlucidumflavidagibbosaelegans

EtunagaramEtunagaramEtunagaram

DepottBhadrachalamEtunagaramEtunagaram

Depot

Basidiomycota Basidiomycetes Polyporales Polyporaceae PycnoporusFomitopsis

cinnabarinusfeei

EtunagaramEtunagaram

Basidiomycota Basidiomycetes Agaricales Schizophyllaceae Schizophyllum radiatum Khammam

and other properties [21] Study on mushrooms in SouthIndia such as Tamil Nadu Kerala Karnataka and AndhraPradesh was neglected as regards to studies on agaricsuntil 1975 [22] All these collected white rot fungi wererich in medical importance Ganoderma lucidum is wellknown to promote health and longevity lowers the risk ofcancer and heart disease and boosts the immune system[23] Polysaccharides from mushrooms as anticancer agentsother constituents exhibiting antioxidants and antihyper-tensive cholesterol-lowering liver protection antifibroticanti-inflammatory antidiabetic antiviral and antimicrobial-like activities have overtly primed its potential as dietarysupplements [24] Some of the Indian mushrooms whichare having the medicinal properties are Agaricus bisporus[25]Astraeus hygrometricus [26]Volvariella bombycina [27]Ramaria formosa [28] Pleurotus sajor-caju [29] Pleurotuspulmonarius [30] Pleurotus ostreatus [31] Phellinus rimosus[32 33] Lycoperdon perlatum [34] Lentinus tuber-regium[35] and Lentinus squarrosulus [36] One of the authors[37] worked on Schizophyllum radiatum and reported thepotentials of extracellular biosynthesis of silver nanoparticlestheir characterization and antimicrobial activity on gram-positive and gram-negative bacteria The S radiatum wasalso studied for its antimicrobial and antioxidative propertiesunder submerged fermentation The supernatant of the seedmedia obtained after separating themycelia has been used forthe synthesis of silver nanoparticles whereas the species ofFomitopsis feei were recorded in decolorization of triphenyl

methane dyes namely bromophenol blue basic fuchsinmethyl violet methyl green ethyl violet and malachite green[38] This report clearly explains that the bioremediationby utilising fungal organisms was advised to be the cost-effective and ecofriendly method of decolorization of efflu-ents released from the dye industriesThe genusTrametes andits species have many immunomodulatory and anticancereffects [39] The genus of Daedaleopsis has antibiotic antihy-persensitive and antitumour properties [40]

A constant monitoring and collection identification andpreservation of the wild mushrooms are the need of thehour to explore and make use of the bioprospects of thediversified macrofungal species This is a preliminary andbasic work carried out to locate and identify the bioprospectsof the existing macrofungi which will pave the way forunderstanding an elaborate study on this aspect

5 Conclusion

Amongst the vast number of living forms very little amountof attention has been paid to conservation of fungal biodi-versity Due to loss of natural habitats soil and air pollutionexpansion of monocropping and loss of genetic diversitymany fungal species are on threat For the smooth working ofthis terrestrial environment the preservation of mushroomdifferences is discriminating Keeping in view this giganticmushroom treasure it is the high time to completely savethis biodiversity A few mushrooms are known to be the


Table 3 Mycological characters of identified wild mushrooms

Name Hymenium type Cap shape Which gills Stipe character Spore printcolour

Ecologicaltype Edibility

T versicolor Pores Offset or distinct Decurrent mdash White toyellow Saprotrophic Edible but

unpalatableT hirsuta Pores Distinct Decurrent Bare Cream Saprotrophic InedibleT elegans voucher Pores and gills No distinct cap Decurrent mdash White Saprotrophic InedibleGanoderma lucidum Pores Offset or indistinct Irregular Bare Brown Saprotrophic EdibleDaedaleopsis flavida Pores No distinct cap Decurrent mdash White Saprotrophic Inedible

T gibbosa Pores Offset Decurrent Bare White tocream Saprotrophic Inedible

T elegans Pores Distinct Decurrent Bare Cream Saprotrophic InediblePycnoporus cinnabarinus Pores Distinct Decurrent Bare Cream Saprotrophic InedibleFomitopsis feei Pores No distinct cap Decurrent mdash Brown Saprotrophic InedibleSchizophyllum communae Pores Offset or indistinct Decurrent mdash White Saprotrophic Inedible

wellsprings of different bioactive substances like antibac-terial antifungal antiviral antiparasitic antioxidant anti-inflammatory antiproliferative anticancer antitumour cyto-toxic anti-HIV hypocholesterolemic antidiabetic anticoag-ulant and hepatoprotective substances among others Thesemushrooms have been utilized as ethnomedicines by tribalsfor treatment of different sicknesses Numerous mushroomsstill stay unreported and their healthful and in additionmedical advantages are obscure to us Henceforth an oppor-tune examination in regard to isolation identification andcharacterization of the current mushroom vegetation is vitalBiotechnological devices can be utilized with a specific endgoal to accomplish the in situ and ex situ preservation ofhuge numbers of the mushroom species The outcome of thepresent study elaborates the information on the facts andfigures of diversity of fungi of the study area

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

References

[1] D L Hawksworth P M Kirk B C Sutton and D M PeglerAinsworth amp Bisbyrsquos Dictionary of the Fungi CAB InternationalWallingford UK 8th edition 1995

[2] P Wongchalee and C Pukahute ldquoDiversity of mushroomsin Dry Dipterocarp forest at Phuphan National Park SakonNakhon Provincerdquo Natural Science vol 4 no 12 pp 1153ndash11602012

[3] E E Andrew T R Kinge E M Tabi N Thiobal and A MMih ldquoDiversity and distribution of macrofungi (mushrooms)in the Mount Cameroon Regionrdquo Journal of EnvironmentalMicrobiology vol 3 pp 318ndash334 2013

[4] R P Metuku S Burra H Nidadavolu S Pabba and M ASingaracharya ldquoSelection of highest lignolytic white rot fungusand its molecular identificationrdquo Journal of Cell and TissueResearch vol 11 no 1 pp 2557ndash2562 2011

[5] M D M Jones I Forn C Gadelha et al ldquoDiscovery of novelintermediate forms redefines the fungal tree of liferdquoNature vol474 no 7350 pp 200ndash204 2011

[6] Y Liu J He G Shi L An M Opik and H Feng ldquoDiversecommunities of arbuscular mycorrhizal fungi inhabit sites withvery high altitude in Tibet Plateaurdquo FEMSMicrobiology Ecologyvol 78 no 2 pp 355ndash365 2011

[7] T T Chang andW N Chou ldquoAntrodia cinnamomea sp nov onCinnamomum kanehirai in TaiwanrdquoMycological Research vol99 no 6 pp 756ndash758 1995

[8] C Manoharachary K Sridhar R Singh et al ldquoFungal biodiver-sity distribution conservation and prospecting of fungi fromIndiardquo Current Science vol 89 no 1 pp 58ndash71 2005

[9] S K Deshmukh ldquoBiodiversity of tropical basidiomycetes assources of novel secondary metabolitesrdquo in Microbiology andBiotechnology for Sustainable Development P C Jain Ed pp121ndash140 CBS Publishers and Distributors New Delhi India2004

[10] A V Sathe and S M Kulkarni ldquoA checklist of wild ediblemushrooms from South-West Indiardquo in Indian MushroomScience II T N Kaul and B M Kapur Eds pp 411ndash413Regional Research Laboratory Jammu India 1987

[11] E J Butler and G R Bisby The Fungi of India Science Mono-graph No 1 The Imperial Council of Agricultural ResearchCalcutta India 1931

[12] R S Vasudev The Fungi of India ICAR Publications NewDelhi India 1960

[13] K S Bilgrami Jammludin and M A Rizvi Fungi of IndiaPart-II TodayampTomorrowPrinters and Publishers NewDelhiIndia 1979

[14] K Bolla S V S S S L N Hima Bindu S Burra andM A Sin-garaCharya ldquoEffect of plant oils surfactants and organic acidson the production of mycelial biomass and exopolysaccharidesof Trametes spprdquo Journal of Agricultural Technology vol 7 pp957ndash965 2011

[15] T T Chang andW N Chou ldquoAntrodia cinnamomea sp nov onCinnamomum kanehirai in Taiwanrdquo Mycological Research vol99 no 6 pp 756ndash758 1995

[16] S O Rogers andA J Bendich ldquoExtraction of total cellular DNAfromplants algae and fungirdquo inPlantMolecular BiologyManualD1 S B Gelvin and R A Schilperoort Eds pp 1ndash8 KluwerAcademic Publishers Boston Mass USA 1994


[17] T J White T Bruns S Lee and J Taylor ldquoAmplificationand direct sequencing of fungal ribosomal RNA genes forphylogeneticsrdquo in PCR Protocols A Guide to Methods andApplications M A Innis D H Gelfand J J Sninsky and TJ White Eds pp 315ndash322 Academic Press San Diego CalifUSA 1990

[18] T Hall BioEdit Version 607 Department of MicrobiologyNorth Carolina State University 2004 httpwwwmbioncsueduBioEditbioedithtml

[19] D L Swofford PAUP Phylogenetic Analysis Using ParsimonyVersion 40b10 Sinauer Associates Sunderland Mass USA2002

[20] M Rai G Tidke and S P Wasser ldquoTherapeutic potential ofmushroomsrdquo Natural Product Radiance vol 4 pp 246ndash2572005

[21] H Thatoi and S K Singdevsachan ldquoDiversity nutritionalcomposition and medicinal potential of Indian mushrooms areviewrdquo African Journal of Biotechnology vol 13 no 4 pp 523ndash545 2014

[22] K Natarajan ldquoMushroom flora of South India (except Kerala)rdquoin Advances in Horticulture 13 Mushroom K L Chadha and SR Sharma Eds pp 381ndash397 Malhotra Publishing House NewDelhi India 1995

[23] S Wachtel-Galor B Tomlinson and I F F Benzie ldquoGano-derma lucidum (ldquoLingzhirdquo) a Chinese medicinal mushroombiomarker responses in a controlled human supplementationstudyrdquo British Journal of Nutrition vol 91 no 2 pp 263ndash2692004

[24] J K Zjawiony ldquoBiologically active compounds from Aphyl-lophorales (polypore) fungirdquo Journal of Natural Products vol67 no 2 pp 300ndash310 2004

[25] L K Jagadish V V Krishnan R Shenbhagaraman and VKaviyarasan ldquoComparitive study on the antioxidant anticancerand antimicrobial property of Agaricus bisporus (J E Lange)Imbach before and after boilingrdquo African Journal of Biotechnol-ogy vol 8 no 4 pp 654ndash661 2009

[26] I Chakraborty S Mondal M Pramanik D Rout and S SIslam ldquoStructural investigation of a water-soluble glucan froman edible mushroom Astraeus hygrometricusrdquo CarbohydrateResearch vol 339 no 13 pp 2249ndash2254 2004

[27] R Jagadeesh N Raaman K Periyasamy et al ldquoProximate anal-ysis and antibacterial activity of edible mushroom Volvariellabombycinardquo International Journal of Microbiology Research vol3 pp 110ndash113 2010

[28] C Ramesh and M G Pattar ldquoAntimicrobial properties antiox-idant activity and bioactive compounds from six wild ediblemushrooms of western ghats of Karnataka Indiardquo Pharmacog-nosy Research vol 2 no 2 pp 107ndash112 2010

[29] D H Tambekar T P Sonar M V Khodke and B S KhanteldquoThe novel antibacterials from two edible mushroomsAgaricusbisporus and Pleurotus sajor cajurdquo International Journal ofPharmacology vol 2 no 5 pp 582ndash585 2006

[30] N Jose T A Ajith and K K Janardhanan ldquoAntioxidant anti-inflammatory and antitumor activities of culinarymedicinalmushroom Pleurotus pulmonarius (Fr) Quel (Agaricomyce-tideae)rdquo International Journal of Medicinal Mushrooms vol 4no 4 pp 329ndash335 2002

[31] K KMaity S Patra B Dey et al ldquoA heteropolysaccharide fromaqueous extract of an ediblemushroom Pleurotus ostreatus cul-tivar structural and biological studiesrdquo Carbohydrate Researchvol 346 no 2 pp 366ndash372 2011

[32] T A Ajith and K K Janardhanan ldquoAntioxidant and anti-inflammatory activities ofmethanol extract of Phellinus rimosus(Berk) pilatrdquo Indian Journal of Experimental Biology vol 39 no11 pp 1166ndash1169 2001

[33] T A Ajith and K K Janardhanan ldquoIndian medicinal mush-rooms as a source of antioxidant and antitumor agentsrdquo Journalof Clinical Biochemistry andNutrition vol 40 no 3 pp 157ndash1622007


[35] JManjunathan andVKaviyarasan ldquoSolvent based effectivenessof antibacterial activity of edible mushroom Lentinus tuber-regium (Fr)rdquo International Journal of PharmTech Research vol2 no 3 pp 1910ndash1912 2010

[36] S K Bhunia B Dey K K Maity et al ldquoStructural characteri-zation of an immunoenhancing heteroglycan isolated from anaqueous extract of an edible mushroom Lentinus squarrosulus(Mont) Singerrdquo Carbohydrate Research vol 345 no 17 pp2542ndash2549 2010

[37] R P Metuku S Pabba S Burra S V S S S L N H BinduK Gudikandula and M A S Charya ldquoBiosynthesis of silvernanoparticles from Schizophyllum radiatum HE 8637421 theircharacterization and antimicrobial activityrdquo 3 Biotech vol 4 no3 pp 227ndash234 2014

[38] S V S S S L H B Nidadavolu K Gudikandula S K Pabbaand S C Maringanti ldquoDecolorization of triphenyl methanedyes by Fomitopsis feeirdquo Natural Science vol 5 no 6 pp 30ndash35 2013

[39] J E Ramberg E D Nelson and R A Sinnott ldquoImmunomod-ulatory dietary polysaccharides a systematic review of theliteraturerdquo Nutrition Journal vol 9 article 54 2010

[40] K Das ldquoDiversity and conservation of wild mushrooms inSikkim with special reference to Barsey Rhododendron Sanc-tuaryrdquo NeBIO vol 1 pp 1ndash13 2010

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


this groupMushrooms alone are represented by about 41000species of which approximately 850 species are recordedfrom India [9] Some of thewild ediblemushrooms have beenreported from South West India [10] The first listed IndianFungi was published [11] and that was revised by Vasudev [12]and extra additional lists appeared in between culminatingwith the fungi of India (Bilgrami et al [13])

The present communication is the collection cultureidentification and preservation of the macrofungi in someforests of Telangana regionThis study adds extra informationto the present knowledge on the data of diversity of fungi inTelangana region and also to understand their bioprospects

2 Materials and Methods

21 Study Area The fruiting bodies of white rot fungi werecollected in rainy season from the forest of EtunagaramBhadrachalam Kothagudem Narsampet Ilandhu Kham-mam Bodhan and Nirmal of Telangana region

22 Culturing and Preservation The collected fruit bodieswere cultured for their mycelial growth as per the methodsuggested [14] A small piece of fruiting body was dippedin 001 mercuric chloride to remove surface contaminationand washed several times with distilled water to remove thetraces of mercuric chloride and transferred aseptically on to3 malt extract agar [15] slants and was incubated for 5ndash7 days The mycelium collected from the growing edge ofthose slants was transferred on to newmalt extract agar slantsand incubated further 5ndash7 days to obtain pure culture Purecultures were subcultured on malt extract agar slants andplates every fortnight

23 Characterization of Macrofungi Based on macroscopicfeatures namely size shape sporocarp nature color sporeprint margin of pileus characters of lamella spacing of gillscharacters of the stipe and the presence or absence of veilson stipes the fungi were identified httpenwikipediaorgwikiTemplateMycomorphbox

24 Identification of Macrofungi

241 Macroscopic Identification Seven mycological char-acters useful in tentative identification of mushrooms arehymenium type cap shape gills stipe character color of thespore print ecological type and edibility

242 Molecular Identification Based on their lignolyticactivity (data not shown here) ten species of wild macro-fungi were selected for confirmation of their identitiesusing molecular methods (see Figure 1) Collected fruitingbodies are initially cultured on malt agar (MEA) andthe genomic DNA of the macrofungi was extracted usingmodified CTAB method [16] The genomic DNA of themacrofungi was then subjected to PCR to amplify the ITSregions of the nuclear ribosomal DNA using two primersITS 1 (51015840TCCGTAGGTGAA CCTTGCGG31015840) and ITS 4

(51015840TCCTCCGCTTATTGATATGC31015840) [17] The PCR prod-ucts were then purified using QIAGEN purification kitfollowing the manufacturerrsquos instructions and the purifiedPCR products were sent to SciGenom Cochin for outdoorDNA sequencing Related gene sequences for each of themacrofungal specimens were obtained from NCBI GenBankand then automatically aligned using ClustalW programincorporated in BioEdit v 719 [18] Manual sequence align-ments were then performed using Bioedit to allow max-imum sequence similarity Finally phylogenetic tree wasconstructed based onmaximumparsimonyusing PAUPv 40b10 [19]

3 Results

The fruiting bodies of white rot fungi were collected in rainyseason from few forest areas of Telangana state (Table 1)The collected fruit bodies were cultured until the purecultures were obtained The lists of identified wild mush-rooms were depicted in Tables 2 and 3 The fungi thatbelong to Polyporales are more in number than other ordersSchizophyllum radiatum belong to the order Agaricales Allthe collected fungi were saprotrophic and were not edibleBased on seven mycological characters they were charac-terized The climatic conditions in Telangana are congenialfor prevalence of macrofungi and hence recorded maximumgenera During the systematic surveys at different forestsof Telangana total 50 mushroom samples were collectedand these samples belong to different genera out of whichonly 10 mushroom samples were identified based on theirlignolytic activity (data not shown here) and were identifiedbasing on the molecular identification and macroscopiccharacters All collected mushrooms have been deposited inthe department herbarium with accession numbers The tenidentified mushrooms by molecular level are Trametes versi-color (GenBank Accession number HF953984) Pycnoporuscinnabarinus strain SYBCndashL14 Daedaleopsis flavida strain5ATrametes elegans voucher Trametes hirsuta Fomitopsis feei(GenBank Accession number AY 5153271) Trametes gibbosa(GenBank Accession number AY3519241) Trametes ele-gans GenBank (Accession number AY3519251) Ganodermalucidum and Schizophyllum radiatum (GenBank Accessionnumber HE8637421)

4 Discussion

In Basidiomycotina more than 2000 species of edible mush-rooms are reported in the publications from different com-ponents of the world People all over Asian countries inthe twentieth century know that mushrooms are importantbiosource of novel secondary metabolites In India thealternative systems of medicine utilize the curative proper-ties of mushrooms Secondary metabolites of these mush-rooms are chemically diverse and possess a broad spectrumof biological activities which are explored in traditionalmedicines [20] In India several mushrooms have beenreported as medicinal mushrooms which have antioxidantantimicrobial and anti-inflammatory activity with antitumor














1Trametes elegans

















Table 1 Continued





Pycnoporus sp






versicolorhirsuta




Depot


cinnabarinusfeei






5 Conclusion













References

















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology














1Trametes elegans

















Table 1 Continued





Pycnoporus sp






versicolorhirsuta




Depot


cinnabarinusfeei






5 Conclusion













References

















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


Table 1 Continued





Pycnoporus sp






versicolorhirsuta




Depot


cinnabarinusfeei






5 Conclusion













References

















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology












References

















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article macrofungi in some forests of telangana...

Documents