research article occurrence of bordetella infection...

Research ArticleOccurrence of Bordetella Infection in Pigs in Northern India

Sandeep Kumar Bhoj R Singh Monika Bhardwaj and Vidya Singh

Section of Epidemiology Centre for Animal Disease Research and Diagnosis (CADRAD) Indian Veterinary Research Institute (IVRI)Izatnagar Bareilly 243122 India

Correspondence should be addressed to Bhoj R Singh brs1762gmailcom

Received 15 July 2013 Revised 14 October 2013 Accepted 21 October 2013 Published 12 January 2014

Academic Editor Michael McClelland

Copyright copy 2014 Sandeep Kumar et alThis is an open access article distributed under the Creative CommonsAttribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Bordetella bronchiseptica infection causing atrophic rhinitis in pigs is reported from almost all countries In the present studyoccurrence of Bordetella infection in apparently healthy pigs was determined in 392 pigs sampled to collect 358 serum samplesand 316 nasal swabs from Northern India by conventional bacterioscopy detection of antigen with multiplex polymerase chainreaction (mPCR) and detection of antibodies with microagglutination test (MAT) and enzyme linked immune-sorbent assay(ELISA) Bordetella bronchiseptica could be isolated from six (192) nasal swabs Although isolates varied significantly in theirantimicrobial sensitivity they had similar plasmid profile The genus specific and species specific amplicons were detected from82 and 44 nasal swabs using mPCR with alc gene (genus specific) and fla gene and fim2 gene (species specific) primersrespectively Observations revealed that there may be other bordetellae infecting pigs because about 50 of the samples positiveusingmPCR for genus specific amplicons failed to confirmpresence ofB bronchiseptica Of the pig sera testedwithMAT and ELISAforBordetella antibodies 676 and 863 samples respectively were positive For antigen detectionmPCRwasmore sensitive thanconventional bacterioscopy while for detection of antibodies neither of the two tests (MAT and ELISA) had specificity in relationto antigen detection Study indicated high prevalence of infection in swine herds in Northern India

1 Introduction

Bordetellosis caused by Bordetella bronchiseptica in pigs isan economically important disease because infected pigsshow a 6ndash10 reduced daily weight gain [1] Althoughusually considered an opportunist or secondary invader[2] B bronchiseptica can cause pneumonia and atrophicrhinitis in growing pigs [3ndash9] Clinical signs of atrophicrhinitis or B bronchiseptica infection are sneezing abnormalnasal discharge or epistaxis and shorteningdeformity ofsnout The pathogen is enzootic in many pig herds and pigscarry infection without any apparent signs of disease [10]Bordetellosis in pigs is reported frequently from most of thecountries however information is scant on B bronchisepticainfection in pigs in India [11ndash13]Thedisease is rarely reportedin India except two outbreaks (on one farm) in Meghalaya aNorth Eastern Indian State in the recent past [12 13]Thoughpiggery is much more common in other states of India thedisease is not reported Besides a report of isolation fromslaughtered pigs from Uttar Pradesh North India [11] there

is scanty information on prevalence of B bronchiseptica pigseither as infection or a commensal Therefore the presentstudy was planned with an aim of studying the occurrenceof Bordetella infection in pigs in some parts of NorthernIndia The major question asked was does the pathogen existin different states of India To answer the question a fewstates with high density of pig population were selected forsampling to detect the status of Bordetella infection or thecommensalism

2 Material and Methods

21 Pig Samples From a total of 392 pigs 358 serum samplesand 316 nasal swabs were collected from backyard andorganized piggeries inUttar Pradesh Nagaland andHaryana(Tables 1 and 2) All the serum samples were brought to thelaboratory on ice within 12 to 36 h and all the nasal swabswere transferred to Amies Transport Media with charcoal(Hi-Media Mumbai) and brought to laboratory at ambienttemperature as soon as possible

Hindawi Publishing CorporationInternational Journal of MicrobiologyVolume 2014 Article ID 238575 6 pageshttpdxdoiorg1011552014238575

2 International Journal of Microbiology

Table 1 Details of samples collected from pigs under different rearing systems

Rearing system Type of sampleType of animals

Total (MF)Piglet Grower AdultM F M F M F

Backyard (215)Only N 0 0 8 1 0 0 9 (8 1)Only S 2 1 2 6 15 35 61 (19 42)

Both N and S 5 7 25 12 53 43 145 (83 62)Total 7 8 35 19 68 78 215 (110 105)

Organized (177)Only N 3 4 4 14 0 0 25 (7 18)Only S 0 0 15 0 0 0 15 (15 0)

Both N and S 15 8 65 44 0 5 137 (80 57)Total 18 12 84 58 0 5 177 (102 75)Grand total (392) 25 20 119 77 68 83 392 (212 180)N nasal swab S serum sample P piglet G grower A adult M male F female

Table 2 Details of samples collected from pigs at different places

State PlacePig breeds

Nondescript Pure bred CrossbredM F M F M F

Uttar Pradesh

Aligarh (56) 0 0 0 0 37 19Barabanki (12) 0 0 0 0 6 6IVRI Bareilly (32) 0 0 0 0 20 12Abattoir Bareilly (106) 2 3 0 0 66 35Chandpur Bijnaur (16) 1 0 0 0 8 7Gajraula Amroha (18) 0 0 0 0 5 13Meerut (34) 0 0 0 0 9 25

Nagaland

Akuluto (12) 0 0 0 0 5 7Jalukie (8) 0 0 0 0 4 4Jharnapani (28) 0 0 15 13 0 0Kohima (4) 0 0 0 0 2 2Merangkong (6) 0 0 0 0 2 4Saltazu (6) 0 0 0 0 2 4Tizit (8) 0 0 0 0 1 7Tuensang (12) 0 0 0 0 2 10Wokha (5) 0 0 0 0 1 4Dimapur (14) 0 0 9 5 0 0

Haryana Gurgaon (15) 0 0 0 0 15 0Total 3 3 24 18 185 159M male F female

22 Conventional Bacteriology Methods for Isolation of Bbronchiseptica from Nasal Swabs Swab samples were asep-tically transferred to the five mL buffered peptone water(Difco Saprks USA) and incubated for 2ndash6 h at 37∘CGrowthwas streaked on blood agar (BA) and MacConkey lactoseagar (MLA) plates The suspected colonies (small whitishand slightly sticky) on BA were tested for catalase oxidaseproduction and string formation with 10 KOH Positivecolonies were re-restreaked on brain heart infusion (BHI)agar (Difco) and incubated at 37∘C for 24 hours Pure cultureswere tested for citrate utilization nitrate reduction reactionon triple sugar iron (TSI) hydrolysis of tweenmotility ureaseand indole production lysine decarboxylation and sugar

fermentationThe isolates which utilized citrate as sole sourceof carbon reduced nitrate to nitrite produced urease butnot fermented any sugar including glucose lactose sucroseor salicin were suspected for B bronchiseptica and furtherconfirmed morphologically by Gramrsquos staining and withmPCR Reference strain of B bronchiseptica (MTCC-6838)procured from IMTECH Chandigarh was used throughoutthe study as control

23 Antimicrobial Susceptibility of Bordetella bronchisep-tica Isolates All B bronchiseptica isolates were tested forantimicrobial sensitivity with disc diffusion method on

International Journal of Microbiology 3

Muller-Hinton (MHA) agar (Himedia) plates (CLSI 2012)against amoxicillin (30mcg) amoxicillin + clavulanic acid(30mcg) azithromycin (30mcg) aztreonam (30mcg) cefo-taxime (10mcg) cefoxitin (30mcg) ceftazidime (30mcg)ceftazidime + clavulanic acid (30 + 10mcg) ceftriax-one (30mcg) ceftriaxone + sulbactam (30 + 15mcg)ceftriaxone + tazobactam (30 + 10 120583g) chloramphenicol(10mcg) ciprofloxacin (30mcg) clindamycin (10mcg) col-istin (25mcg) cotrimoxazole (25mcg) doxycycline HCl(10mcg) ertapenem (10mcg) erythromycin (10mcg) gen-tamicin (10mcg) imipenem (10mcg) lincomycin (10mcg)nalidixic acid (30mcg) nitrofurantoin (300mcg) penicillinG piperacillin + tazobactam (100 + 10 120583g) polymyxin B(50U) roxithromycin (30mcg) tetracycline (30mcg) andvancomycin (30mcg)

24 Plasmid Isolation The standard culture field isolateand a reference multiplasmid Escherichia coli (E-382) strainswere inoculated in 3mL tryptic soya broth (TSB) incubatedovernight at 37∘C Aliquot of 2mL culture was used forplasmid isolation using QIAprep Spin Miniprep Kit (QIA-GEN Germany) as per instructions of the manufacturerThe plasmid DNA eluent was electrophoresed on agarose gelsimilar to PCR product described elsewhere

25 Multiplex Polymerase Chain Reaction (mPCR)

251 Template For snap-chilled template one mL aliquotfrom nasal swabs inoculated in buffered peptone water (for2ndash6 h) was transferred to thin walled microcentrifuge tubeand incubated at minus20∘C for fifteen min and then the tubeswere transiently transferred to boiling water bath Thereaftermicrocentrifuge tubes were centrifuged at 10000 rpm for tenmin and supernatant was collected aseptically into freshsterile vials and stored at minus20∘C till used for mPCR Similarlytemplets were also prepared from reference culture (MTCC-6838) and B bronchiseptica isolates in the study

252 Primers mPCR was standardized by using one genus(in house designed) and two species specific (Table 3) primers[14 15] The primers were designed by using bioinformatictool They were tested with standard strain before sam-ple analysis Primers were custom synthesized (EurofinsGenomic India Pvt Ltd Bangalore) and diluted to 10 pM120583Lin nuclease free water for use

253 Master Mix For performing mPCR master mix wasused To make 900120583L of master mix ingredients (Promega)were 100 120583L of 10 times PCR buffer 100 120583LMgCl

2(25mM) 60 120583L

dNTPs (10mM) 20 120583L each of the six primers (10 pM) 20units of Taq polymerase and nuclease free water to make thevolume 900120583L

To performmPCR five 120583L of template from snap-chilledsupernatant was mixed with 45 120583L of master mix in a 200120583LPCR tube The PCR amplification was carried out with aninitial denaturation at 95∘C for ten min denaturation of 35cycles at 94∘C for 30 s annealing at 53∘C for 30 s extension at72∘C for 45 s and a final extension at 72∘C for seven min

Ten 120583L of mPCR products was mixed with 2 120583L of 6xready to use gel loading dye (MBI Fermentas) and run alongwith 100 bp DNA ladder (MBI Fermentas) in 1 agarose gel(IBI Scientific Peosta Lowa) containing 10mgmL ethidiumbromide at 100 volts using 1x TBE electrophoresis buffer (BioBasic Inc)The gels were visualized and photographed underUV-gel documentation system (Alpha Innotech Co USA)

Before multiplexing both the primer sets were usedto perform uniplex PCR but it was not done (to savethe time and reagents) for all the samples because duringstandardization there was no difference between sensitivityand specificity of uniplex and multiplex PCR results

The products of genus specific PCR using in-housedesigned primers from two of the samples positive for genusspecific PCR but not for species specific PCR were sentfor custom sequencing (Eurofins Genomic India Pvt LtdBangalore)

26 Determination of Bordetella bronchiseptica Antibodies inPig Serum

261 Preparation of Antigen for Microagglutination Test(MAT) The method of Boot et al [16] was followed toprepare phase I antigen from B bronchiseptica (MTCC-6838) The stock antigen was diluted 1 20 in 05 formalsaline to OD

26905 The protein concentration was measured

using Lowryrsquos method for protein estimation (GeNei ProteinEstimation Kit Bangalore India) The antigen was testedfor autoagglutination and self-flocculation [17 18] flawlessantigen was used in the study

262 MAT Procedure The microagglutination test on dogsera was performed in U-bottom 96-well microtitre plates(Axygen Scientific USA) using 150120583L serum twofold seri-ally diluted in 150 120583L PBS pH 72 (final dilution 1 2) Thefirst and last row in each plate were used as positive andnegative control respectively To each well 150120583L of dilutedB bronchiseptica antigen was added Microtitre plates wereincubated in a humid chamber to prevent drying of the platesand incubated for 48 h at 37∘C Plates were read against adark background after 48 h [17] The end point titre of MATis defined as the final dilution of serum at which 50 ofbordetellae are agglutinated The reciprocal of the highestdilution up to which no button at bottom of the well inmicroplate was visible was considered as positive titre Titreabove and equal to 1 64 was considered as positive

263 Preparation of Antigen for ELISA Antigen was pre-pared using the method of Boot et al [17] One standardand five field strains of B bronchiseptica isolated from diversesources were grown on BHI agar medium to harvest phaseI antigen in PBS (with 01 merthiolate) and incubatedovernight at room temperature On the second day theharvested culturewas centrifuged at 6000 rpm for fifteenminThe supernatant was discarded and pellet was resuspendedin merthiolated PBS and stored at 4∘C as stock antigenGeNei Protein Estimation Kit (Bangalore India) was usedto estimate protein concentration in whole cell antigen The


Table 3 Genus specific and species specific primers used in multiplex PCR for detection of Bordetella bronchiseptica

Name of primers Sequence 51015840-31015840 Product length (bp) ReferencesB688Bbalc-F ACCAACCGCATTTATTCCTACTA 324 This studyB1012Bbalc-R GGCCCTGGAGTTCGTATTTATG425BBfim-1 F TGAACAATGGCGTGAAAGC 425 Xin et al 2008 [15]425BBfim-2 R TCGATAGTAGGACGGGAGGAT237BBFla 4 F TGGCGCCTGCCCTATC 237 Hozbor et al 1999 [14]237BBFla 2 R AGGCTCCCAAGAGAGAAAF forward primer R reverse primer

stock antigen was diluted in 01M carbonate bicarbonatebuffer (01M pH 96) to give final concentration of 10 120583gmL

264 Protocol for ELISA Antigen coated (each well with100 120583L of 10 120583gmL) were blocked for two h with 2 bovineserum albumin (BSA) Single dilution ELISA (1 200 dilutedserums in PBS having 1 bovine serum albumin) was per-formed in triplicate Goat-anti-pig-IgG alkaline phosphatase(Santacruz) conjugate was diluted 1 1500 in PBS with 1bovine serum albumin and 100 120583L was used in each wellpara-Nitrophenylphosphate PNPP (Chem Cruz) dissolved(1mgmL) in carbonate buffer (01M pH 98) was usedas substrate and plates were incubated in dark for 30minafter adding substrate Then in each well 30 ul of 1MNaOHwas added to stop the reaction and plates were read withELISA reader at 405 nm wavelength For washing the platesat different steps PBS with 005 tween-20 was used

ELISA Titres Were Determined Using the Following FormulaELISA titre = [(Average of test OD minus average of negativecontrol OD) lowast 200]Average of negative control OD

ELISA titre values equal to or more than the half ofthe positive control (reference positive serum available inlaboratorywith titre of 300)were considered as positive for allinferences A known negative serum giving no agglutinationwith the antigen and repeatedly yielding OD reading lt0070was used as negative control

Data was analysed using MS Excel worksheet using 1205942test

3 Result and Discussion

31 Bacteriological Results On bacteriological analysis of 316pig nasal swabs B bronchiseptica could be isolated from six(192) samples There was no apparent effect of differentmedia on isolation rate of B bronchiseptica Although growthwas much better on blood agar than on MLA Proteus ofteninterfered with isolation on BA and thus use of both mediaappeared to be satisfactory rather than one The isolationrate in the present study varied from 0 to 36 fromplace to place The lower isolation rate was reported earlierby many workers and may be due to geographic variation[18] type of sample used [13 18 19] overgrowth of thecontaminantscommensal organisms on highly nutritious(BA)media [20 21] and the different primary isolationmediaemployed to isolate the pathogen [22] All isolates of B

bronchiseptica were similar in morphological growth andbiochemical characteristics The pathogen was detected innasal swabs of 22 grower and 2 adult pigs No isolationof B bronchiseptica from piglets might be due to passivelyacquired immunity from sows [23] Consistent with thisobservation in previous studies B bronchiseptica infectionshave been reported in pigs mainly after the age of threeweeks when maternal immunity has waned [24] In ourstudy out of six samples positive for B bronchiseptica 4were from male (22) and two were from females withoutany statistical significance (119875 gt 01) Isolation rate ofB bronchiseptica from nasal swabs of backyard pigs was13 and that of farmed pigs was 25 with no statisticallysignificant difference (119875 gt 01) between the two groupsFrom the single case of atrophic rhinitis observed duringstudy both Pasteurella multocida type D and B bronchisepticawere isolated indicating that mixed infection is required forprecipitation of clinical disease [2 6 8] No attempts weremade to isolate P multocida in the study to thoroughlyconcentrate on B bronchiseptica so that occurrence of thepathogen in pigs in India may be determined

32 Antimicrobial Sensitivity Assay All B bronchisepticastrains were resistant to amoxycillin aztreonam cefotax-ime ceftazidime clindamycin ceftazidime + clavulanic acidcefoxitin lincomycin polymyxin B penicillin and vanc-omycin Additionally the strain isolated frompig ofNagalandwas resistant for amoxicillin + clavulanic acid while the iso-late froma sample fromAligarhwas resistant to ciprofloxacincotrimoxazole nalidixic acid and doxycycline For otherantimicrobials including azithromycin colistin ertapenemimipenem gentamicin and piperacillintazobactam all theB bronchiseptica strains were sensitive Due to variation inantibiogram of isolates from different places no uniformantibiotic regimen may be recommended for treatment ofbordetellosis in pigs In china Zhao et al [25] reported simi-lar variation (sim40 antibiogram types) in antibiotic sensitivitypattern among B bronchiseptica isolates from healthy pigs ofdifferent provinces

33 Detection of Bordetella with mPCR The mPCR stan-dardized in the study had similar sensitivity and specificityas the uniplex PCR for genus and specific PCR The mPCRstandardized in the study was able to detect up to five cfuof B bronchiseptica and three amplicons could be visualizedin positive samples (Figure 1) A total of 14 samples were


1000 bp

500bp425bp324bp237bp

Figure 1 Multiplex PCR (mPCR) targeting fim2 (425 bp) alc(324 bp) and fla (237 bp) gene Lane 1 positive control (B bron-chiseptica snap-chilled supernatant DNA) Lanes 2 3 and 5 fieldsample (snap chilled supernatant) Lane 4 100 bp ladder Lane 6negative control

positive for all three ampliconswhile 12 for only genus specificamplicons Customized sequencing of the PCR product fromthe two samples that were positive only for genus specificPCR showed the amplicons were 99 similar to the sequenceof the alc gene of Bordetella indicating the validity of thePCR results Among the fourteen positive samples for Bbronchiseptica specific PCR eight (39) were from pigson backyard piggeries and six (38) were from pigs onorganized piggeries with no significant (119875 gt 01) differenceamong pigs reared under the two systems of piggery None ofthe samples from indigenous pig was positive while samplesfrom one large black Yorkshire and thirteen crossbred pigswere positive for B bronchiseptica specific amplicon in PCRAmong the positive samples 7 each were from grower andadult animals but none from piglets In previous studies tooB bronchiseptica infections have been reported mainly inpigs after the age of three weeks when maternal immunityhas waned [24] Of the positives with PCR nine sampleswere from male and 5 from female pigs showing significantdifference in carriage of the pathogen by the animals of thetwo sexes (119875 lt 010) Detection of B bronchiseptica byPCR in a greater number of pigs than detected by cultureindicated that PCR method was more sensitive than theconventional method as reported earlier in several studies[14 15] Similar results have also been reported earlier instudies on B bronchiseptica associated kennel cough in India[26] Therefore multiplex PCR may be recommended forrapid diagnosis of the B bronchiseptica infection at an earlystage and in carrier pigs

34 Bordetella Antibody Detection Only 67 of serumsamples from Gurgaon (Haryana) 663 of samples fromNagaland and 718 of samples from Uttar Pradesh werepositive for Bordetella bronchiseptica agglutinins in MATBesides geography of the place of pig rearing farming systemappeared to be another important determinant for MATpositivity Significantly (119875 lt 010) more samples frombackyard (845) pigs were positive than the pigs reared onorganized farms (447) Earlier Attila-Lehel and Rapuntean[27] reported 42 positivity among growing andmature pigskeeping positive cutoff titre at 20The higher rate of positivityin the present study might be due to geographic variation

Of the positive samples 115 (584) were from male animalsand 127 (789) were from females (119875 lt 000) A total of342 piglets 55 growers and 90 adults were positivewith MAT showing positive correlation of prevalence of Bbronchiseptica agglutinins with advancing age Similarly five(833) indigenous three (88) large black Yorkshire and234 (736) crossbred pigs sampled were positive with MATfor Bordetella agglutinins

At cutoff titre (ge125) to have 100 sensitivity 309 (863)sera samples were positive for anti B bronchiseptica IgGswith ELISA Statewise nine (60) of Haryana 70 (737)of Nagaland and 230 (927) of Uttar Pradesh pig serumsamples were positive Among the positives 182 (883)samples were from pigs reared under backyard farming and127 (836) were from pigs under organized farming systemwith no significant effect of farming system (119875 gt 010)Of 309 pig serum samples positive with ELISA 170 (863)were from male and 139 (863) were from female pigs Ageappeared to be a significant determinant (119875 lt 010) forpositivity in ELISA Positivity in ELISA was correlated withincreasing age as only 632 piglets were positive in contrastto 882 and 921 positives among grower and adult pigsrespectively Similar to age breed was also a significant (119875 lt010) determinant for positivity in wc-ELISA as all the serumsamples of indigenous pigs 676 of large black Yorkshireand 889 of crossbred pigs were positive with ELISA

4 Conclusions

Isolation of the organism though difficult is the mostauthentic indication of infection and association with the dis-ease PCR is more sensitive than conventional bacterioscopyDetection of the genus specific amplicon in 26 samples incontrast to species specific amplicon in fourteen indicatedthat B bronchisepticamay not be the only Bordetella infectingpigs ELISA has limited value to be used as diagnostic testbut MAT can be used for screening pig herd More work isneeded to determine diversity among bordetellae infectingpigs so that proper control measures can be undertaken

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors are thankful to the Director JD (CADRAD)JD (A) and JD (R) of IVRI for permitting undertaking thestudy and for providing financial and laboratory supportDeemed University IVRI is acknowledged for providingfellowship to Sandeep Kumar and Monika Bhardwaj Theauthors are also thankful to the technical and supporting staffof Epidemiology Laboratory for timely assistance


References

[1] T Donko M Kovacs and T Magyar ldquoThe effect of atrophicrhinitis (AR) on the weight gain of swinerdquo Agriculturae Con-spectus Scientificus vol 68 pp 161ndash164 2003

[2] S T Cowan Cowan and Steelrsquos Manual for the Identificationof Medical Bacteria Cambridge University Press London UK2nd edition 1974

[3] D T Smith and L T Webster ldquoEpidemiological studies onrespiratory infections of the rabbit VI Etiology of otitis mediardquoJournal of Experimental Medicine vol 41 pp 275ndash283 1925

[4] J C Torrey and A H Rahe ldquoStudies in canine distemperrdquoJournal of Medical Research vol 27 pp 291ndash364 1913

[5] C E Phillips ldquoAlcaligenes (Brucella) bronchiseptica as a factorin porcine pneumoniasrdquo Canadian Journal of ComparativeMedicine and Veterinary Science vol 7 pp 58ndash59 1943

[6] J D Ray ldquoBordetella bronchisepticardquo Journal of the AmericanVeterinary Medical Association vol 116 p 51 1950

[7] H W Dunne D C Kradel and R B Doty ldquoBordetella bron-chiseptica (Brucella bronchiseptica) in pneumonia inrdquo Journal ofthe American Veterinary Medical Association vol 139 pp 897ndash899 1961

[8] R F Cross ldquoBordetella bronchiseptica-induced porcine atrophicrhinitisrdquo Journal of the American Veterinary Medical Associa-tion vol 141 pp 1467ndash1468 1962

[9] R F Ross J R Duncan and W P Switzer ldquoTurbinate atrophyin swine produced by pure cultures of B bronchisepticardquoVeterinary Medicine vol 58 pp 566ndash570 1963

[10] D A Bemis ldquoBordetella andMycoplasma respiratory infectionsin dogs and catsrdquo Veterinary Clinics of North America SmallAnimal Practice vol 22 no 5 pp 1173ndash1186 1992

[11] V K Chaturvedi and D P Singh ldquoIsolation of Bordetellabronchiseptica in Indian pigsrdquo Indian Veterinary Journal vol 76no 10 pp 928ndash929 1999

[12] B R Shome R Shome Y Mazumder et al ldquoCharacterizationof Bordetella bronchiseptica associated with atrophic rhinitisoutbreak in pigsrdquo Indian Journal of Animal Sciences vol 76 no6 pp 433ndash436 2006

[13] Y Mazumder A Das D Kar B R Shome B K Dutta andH Rahman ldquoIsolation of Bordetella bronchiseptica from pigs inNorth East Indiardquo Journal of Animal Science Advances vol 2pp 396ndash406 2012

[14] D Hozbor F Fouque and N Guiso ldquoDetection of Bordetellabronchiseptica by the polymerase chain reactionrdquo Research inMicrobiology vol 150 no 5 pp 333ndash341 1999

[15] W Xin Y ShiFeng andW Fang ldquoDevelopment and applicationof PCR assay for detection of Bordetella bronchiseptica inrabbitsrdquo in Pathology and Hygiene 9th World Rabbit Congresspp 879ndash1179 2008

[16] R Boot R H G Bakker H Thuis and J L Veenema ldquoAnenzyme-linked immunosorbent assay (ELISA) for monitoringguineapigs and rabbits for Bordetella bronchiseptica antibodiesrdquoLaboratory Animals vol 27 no 4 pp 342ndash349 1993

[17] B R Singh Labtop for Microbiology Laboratory LambertAcademic Saarbrucken Germany 2009

[18] Z Zhao C Wang Y Xue et al ldquoThe occurrence of Bordetellabronchiseptica in pigs with clinical respiratory diseaserdquo Veteri-nary Journal vol 188 no 3 pp 337ndash340 2011

[19] D Attila-Lehel Study regarding bacterial species from genusBordetella isolated from animals and their importance in theveterinary pathology [PhD thesis] University of AgriculturalScience and VeterinaryMedicine Cluj-Napoca Romania 2010

[20] H Radulescu B Valeria and I Pop Bacteriologie VeterinaraAplicata Ceres Bucuresti Romania 1973

[21] K B Register M R Ackermann and D W Dyer ldquoNon-radioactive colony lift-hybridization assay for detection ofBordetella bronchiseptica infection in swinerdquo Journal of ClinicalMicrobiology vol 33 no 10 pp 2675ndash2678 1995

[22] J E Hoppe ldquoBordetellardquo in Manual Clin Microbiol P RMurray E J Baron M A Pflaller F C Tenover and R HYolken Eds pp 116ndash137 ASM Press Washington DC USA1999

[23] M F de Jong Progressive and Nonprogressive Atrophic RhinitisDiseases of Swine Blackwell Publishing Iowa State UniversityPress Ames Iowa USA 9th edition 2006

[24] M F de Jong and G H Borst ldquoSelective medium for theisolation of P multocida and B bronchisepticardquo VeterinaryRecord vol 116 no 6 p 167 1985

[25] Z Zhao Y Xue C Wang et al ldquoAntimicrobial susceptibilityof Bordetella bronchiseptica isolates from pigs with respiratorydiseases on farms in Chinardquo Journal of Veterinary MedicalScience vol 73 no 1 pp 103ndash106 2011

[26] M Bhardwaj B R Singh S Kumar and A M PawdeldquoPoor association of Bordetella bronchiseptica infection withkennel cough in dogs in Northern Indiardquo Universal Journal ofMicrobiology Research vol 1 pp 10ndash14 2013

[27] D Attila-Lehel and Gh Rapuntean ldquoDetection of Bordetellabronchiseptica infection in swine using agglutination testrdquoBuletin USAMV Cluj Seria Zootehnie Biotehnologii MedicinaVeterinara 2007

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Table 1 Details of samples collected from pigs under different rearing systems

Rearing system Type of sampleType of animals

Total (MF)Piglet Grower AdultM F M F M F

Backyard (215)Only N 0 0 8 1 0 0 9 (8 1)Only S 2 1 2 6 15 35 61 (19 42)

Both N and S 5 7 25 12 53 43 145 (83 62)Total 7 8 35 19 68 78 215 (110 105)

Organized (177)Only N 3 4 4 14 0 0 25 (7 18)Only S 0 0 15 0 0 0 15 (15 0)

Both N and S 15 8 65 44 0 5 137 (80 57)Total 18 12 84 58 0 5 177 (102 75)Grand total (392) 25 20 119 77 68 83 392 (212 180)N nasal swab S serum sample P piglet G grower A adult M male F female

Table 2 Details of samples collected from pigs at different places

State PlacePig breeds

Nondescript Pure bred CrossbredM F M F M F

Uttar Pradesh

Aligarh (56) 0 0 0 0 37 19Barabanki (12) 0 0 0 0 6 6IVRI Bareilly (32) 0 0 0 0 20 12Abattoir Bareilly (106) 2 3 0 0 66 35Chandpur Bijnaur (16) 1 0 0 0 8 7Gajraula Amroha (18) 0 0 0 0 5 13Meerut (34) 0 0 0 0 9 25

Nagaland

Akuluto (12) 0 0 0 0 5 7Jalukie (8) 0 0 0 0 4 4Jharnapani (28) 0 0 15 13 0 0Kohima (4) 0 0 0 0 2 2Merangkong (6) 0 0 0 0 2 4Saltazu (6) 0 0 0 0 2 4Tizit (8) 0 0 0 0 1 7Tuensang (12) 0 0 0 0 2 10Wokha (5) 0 0 0 0 1 4Dimapur (14) 0 0 9 5 0 0

Haryana Gurgaon (15) 0 0 0 0 15 0Total 3 3 24 18 185 159M male F female

22 Conventional Bacteriology Methods for Isolation of Bbronchiseptica from Nasal Swabs Swab samples were asep-tically transferred to the five mL buffered peptone water(Difco Saprks USA) and incubated for 2ndash6 h at 37∘CGrowthwas streaked on blood agar (BA) and MacConkey lactoseagar (MLA) plates The suspected colonies (small whitishand slightly sticky) on BA were tested for catalase oxidaseproduction and string formation with 10 KOH Positivecolonies were re-restreaked on brain heart infusion (BHI)agar (Difco) and incubated at 37∘C for 24 hours Pure cultureswere tested for citrate utilization nitrate reduction reactionon triple sugar iron (TSI) hydrolysis of tweenmotility ureaseand indole production lysine decarboxylation and sugar

fermentationThe isolates which utilized citrate as sole sourceof carbon reduced nitrate to nitrite produced urease butnot fermented any sugar including glucose lactose sucroseor salicin were suspected for B bronchiseptica and furtherconfirmed morphologically by Gramrsquos staining and withmPCR Reference strain of B bronchiseptica (MTCC-6838)procured from IMTECH Chandigarh was used throughoutthe study as control

23 Antimicrobial Susceptibility of Bordetella bronchisep-tica Isolates All B bronchiseptica isolates were tested forantimicrobial sensitivity with disc diffusion method on








2(25mM) 60 120583L


























1000 bp







4 Conclusions




Acknowledgments



References



































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








2(25mM) 60 120583L


























1000 bp







4 Conclusions




Acknowledgments



References



































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology















1000 bp







4 Conclusions




Acknowledgments



References



































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


References



































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article occurrence of bordetella infection...

Documents