research article transplantation of neural stem cells...

Research ArticleTransplantation of Neural Stem Cells Cotreated with ThyroidHormone and GDNF Gene Induces Neuroprotection in Rats ofChronic Experimental Allergic Encephalomyelitis

Xiaoqing Gao Guangqiang Hu Li Deng Guangbi Fan Chaoxian Yang and Jie Du

Department of Anatomy and Neurobiology Sichuan Medical University No 319 Zhongshan Road Luzhou Sichuan 646000 China

Correspondence should be addressed to Jie Du dujie75915sohucom

Received 27 May 2015 Revised 5 August 2015 Accepted 12 August 2015

Academic Editor Sara Xapelli

Copyright copy 2016 Xiaoqing Gao et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

The present study investigates whether transplantation of NSCs treated with T3 alone (T3NSCs) or in conjunction with GDNFgene (GDNF-T3NSCs) provides a better therapeutic effect than NSCs for chronic EAE EAE rats were respectively injected withNSCs T3NSCs GDNF-T3NSCs and saline at 10 days and sacrificed at 60 days after EAE immunization The three cell graftedgroups showed a significant reduction in clinical scores inflammatory infiltration and demyelination compared with the saline-injected group and among the cell grafted groups the reduction in GDNF-T3NSCs group was the most notable followed byT3NSCs group Grafted T3NSCs andGDNF-T3NSCs acquiredmoreMAP2 GalC and less GFAP in brain comparedwith graftedNSCs and grafted GDNF-T3NSCs acquired most MAP2 and least GalC among the cell grafted groups Furthermore T3NSCsand GDNF-T3NSCs grafting increased the expression of mRNA for PDGF120572R GalC and MBP in lesion areas of brain comparedwith NSCs grafting and the expression of mRNA for GalC and MBP in GDNF-T3NSCs group was higher than that in T3NSCsgroup In conclusion T3NSCs grafting especially GDNF-T3NSCs grafting provides a better neuroprotective effect for EAE thanNSCs transplantation

1 Introduction

Chronic experimental allergic encephalomyelitis (EAE) ananimal model of multiple sclerosis (MS) is an autoimmunedisease in the CNS characterized by extensive plaques orlesions throughout grey and white matter with loss of myelinandmyelinating cells as well as damage to axons and neurons[1] The general failure of endogenous remyelination andinflammation-related axonal damage lead to accumulatedneurological disability [2] The current immunomodulatingdrugs for MS such as interferon 120573 glatiramer acetate andnatalizumab prevent inflammatory damage to the CNSwhich do not effectively prevent the progressive clinicalneurological decline most likely because they lack a directaction on CNS axons and myelin [3] Neural stem cells(NSCs) which can differentiate into various neural cell types[2 4] and havemyelinogenic potential [5] in the injured areashave been introduced as a promising cell type of replacementtherapy Driving neurons and oligodendrocytes commitment

and development of transplanted NSCs should largely pro-mote the success of transplantation therapy for EAE

Thyroid hormone (T3) is required for production andmaturation of oligodendrocytes and proper myelination[6 7] T3 supplementation enhances remyelination axonprotection and nerve conduction preservation in variousanimal demyelinating models [8ndash10] Moreover NSCs fromEAE animals show a strong limitation in oligodendrocytegeneration which is completely recovered by T3 treatment[7] Glial cell line-derived neurotrophic factor (GDNF) hasbeen proved to have a potent neuroprotective effect onvarious neuronal damage [11ndash13] and also has an ability topromote axon regeneration and myelination after spinal cordinjury [14] GDNF gene modified-fibroblasts transplantationpromoted significant axons regeneration and remyelinationof regenerating axons following spinal cord transection injury[15] Additionally our previous studies also showed thatGDNF gene modified-NSCs provided more efficient neuro-protection for stroke rats than nativeNSCs [16] In the present

Hindawi Publishing CorporationNeural PlasticityVolume 2016 Article ID 3081939 9 pageshttpdxdoiorg10115520163081939

2 Neural Plasticity

study we investigated whether transplantation of NSCscotreated with T3 andGDNF provides better neuroprotectiveeffect than transplantation of native NSCs for EAE

2 Materials and Methods

21 Growth Induction and Infection of Rat NeurospheresThe cerebral hemispheres dissected from newborn Wistarrats (Animal House Center Sichuan Medical UniversitySichuan China) were minced and dissociated into singlecell suspensions The cells were suspended in 25mL flaskat a density of 1 times 105 cellsmL in stem medium (serum-free DMEMF12 medium supplemented with 20 ngmL ofbasic fibroblast growth factor (bFGF) 20 ngmL of epidermalgrowth factor (EGF) and 1 N2 supplement (all fromGibco USA)) After 5sim7 days of culture neurospheres wereformed and assayed for nestin expression by immunohisto-chemical staining Then neurospheres were triturated intosingle cells suspension The detached NSCs were dividedinto two groups One group was planted in stem mediumadditionally added 20 ngmL of T3 for 5 days (T3NSCs)the other was infected with GDNF recombinant adenovirus(pAdEasy-1-pAdTrack CMV-GDNF) for 2 days as describedin our laboratory [16] Adeasy-1 plasmid contains the genefor green fluorescent protein and the titers of viral were 1 times109 PFUmL Briefly 200120583L single cell suspensions mixing5 120583LGDNF recombinant adenovirus solutionwere planted ineachwell of a 24-well plate in 5CO

2at 37∘C for 2 hours then

300 120583L medium was added to each well to further incubatefor 2 days The postinfected cells were then planted in stemmedium containing 20 ngmL of T3 for 5 days (GDNF-T3NSCs) For labeling in vivo the grafted cells NSCsT3NSCs and GDNF-T3NSCs were pretreated for 3 daysprior to grafting with 10 120583M of 5-bromo-21015840-deoxyuridine(BrdU Sigma USA)

22 EAE Induction and Neurospheres Transplantation Allanimal experiments were approved by and performed inaccordance with the Chinese Academy of Sciences ChinaEAE is induced in female Wistar rats by guinea pig spinalcord homogenate emulsifiedwith complete Freundrsquos adjuvant(CFA Sigma) 6ndash8-week-old female Wistar rats (inbredstrain Animal House Center Sichuan Medical UniversitySichuan China) were injected in the four footpads of 100mgof guinea pig spinal cord in 04mL of PBS emulsifiedwith equal volume of CFA supplemented with 6mgmL ofmycobacterium tuberculosis H37Ra (Shijiazhuang WeitianScientific Instruments Equipment Co Ltd China) At dayof induction and at day 2 300 ng of bordetella pertussistoxin (Weitian) in 01mL PBS was injected subcutaneouslyThe animals were scored daily for neurological symptomsas follows (0) no clinical disease (1) limpness in tail (2)hind-leg ataxia (3) hind-leg paralysis (4) paraplegia and (5)moribund or dead Ten days after EAE induction rats wereanesthetized with intraperitoneal injection of pentobarbitalsodium (30mgkg) and were fixed on a stereotactic device(Angle Two Stereotaxic Instrument wRat Atlas Product464601 USA) Quantities of 5 times 105 cells (NSCs T3NSCs

andGDNF-T3NSCs) in a volume of 10 120583Lwere injected onceinto each lateral ventricle (AP =minus08 to 10mm119877 or 119871 = minus18to 20mm and 119881 = minus40 to 50mm) The control groupunderwent the same injection with 10 120583L saline into eachlateral ventricle

23 Histological and Immunohistochemical Assessment EAErats were sacrificed with a lethal dose of pentobarbitalsodium at day 60 after EAE induction 20 rats (5 per group)were perfused via the ascending aorta with PBS followedby 4 paraformaldehyde The brains were removed andpostfixed for 24 hours by immersion in the same fixativeHistopathology and immunohistochemistry were assessed in6 120583m thick paraffin sections at 02sim16mm below the bregmalevels Hematoxylin-eosin (HE) staining was used to evaluateinflammatory infiltration 10 nuclei or more gathered incerebrum white matter or surrounded by a blood vessel wereconsidered as an infiltration lesion To estimate the extentof inflammation the number of infiltration lesions and thenumber of cells per infiltration lesion were counted Luxolfast blue (LFB Sigma) staining was performed to detect thedegree of demyelination and themeasurement parameter wasthe integrated optical density (IOD)

BrdU and neural special markers double immunohisto-chemistry staining were used to identify grafted cells andthe differentiated cells from the grafted cells in vivo Thespecial markers were neuronal specific markers microtubule-associated protein 2 (rabbit anti-MAP2 1 100 Abcam UK)astrocytes specific markers glial fibrillary acidic protein (rab-bit anti-GFAP 1 100 Abcam) and oligodendrocyte specificmarker galactocerebroside (rabbit anti-GalC 1 50 Chemi-con USA) Briefly sections were incubated in 03 H

2O2

in methanol for 10 minutes followed by incubation with01 Triton X-100 in 01 sodium citrate for 10 minutes Thesections were treated with 2N HCl at 37∘C for 1 hour andthen incubated withmouse anti-BrdU (1 200 Abcam) at 4∘Covernight After a goat anti-mouse IgG secondary antibody(1 100 Wuhan Boster Biological Technology China) wasadded for 30 minutes alkaline phosphatase- (AP-) strepta-vidin (Boster) was incubated for 30 minutes and 5-bromo-4-chloro-3-indolyl phosphatenitroblue tetrazolium chloride(BCIPNBT Boster) was then used as a chromogen for10min After PBS washes the sections were reincubatedwith primary antibody for rabbit ant-MAP2 GFAP or GalCfollowed by incubation with goat anti-rabbit IgG (1 100Boster) and horseradish peroxidase- (HRP-) streptavidin(Boster) Diaminobenzidine (DAB Boster) or 3-amino-9-ethylcarbazole (AEC Boster) was then used as a chromogenfor light microscopy Negative control sections from eachanimalwere carried out except that the primary antibodywasomitted

IOD was counted in corpus callosum in 3 sections peranimal using ImageJ 144p software Inflammatory infiltra-tion and positive cells were assessed in 6 regions of interestsituated within bilaterally white matter tracts in 3 sectionsper animal Measurement was made in a predefined field(06mm times 06mm) using image-pro plus 60 software Thepercentage ofMAP2+ GFAP+ andGalC+ cellswas quantified

Neural Plasticity 3

Table 1 The PCR sequences of the primers sizes of the products and the annealing temperatures

Gene Primer sequence (51015840-31015840) Length (bp) Annealing temperature (∘C)

PDGF120572R F CCAAATACTCCGACATCC 404 57R CCAGAGCAGAACGCCATA

GalC F CGGTGCCCTTGTTGTTGTG 252 59R TGCCGTCTGTTGTTTGTCC

MBP F TTCTTTAGCGGTGACAGGG 156 55R GGAGCCGTAGTGGGTAGTT

GAPDH F ACCACAGTCCATGCCATCAC 450 57R TCCACCACCCTGTTGCTGTA

Table 2 The reduction of infiltrates and improvement of myelin after neurospheres transplantation (mean plusmn SD 119899 = 5)

Mean number of infiltrates Mean number of cellsinfiltrates LFB densityControl 236 plusmn 43 574 plusmn 84 862 plusmn 056NSCs 126 plusmn 31lowast 420 plusmn 86lowast 1501 plusmn 145lowast

T3NSCs 92 plusmn 19lowast 216 plusmn 59lowast 2147 plusmn 203lowast

GDNF-T3NSCs 580 plusmn 130lowast 122 plusmn 26lowast120595 2899 plusmn 139lowast120595lowastComparison with control group 119875 lt 005 comparison with NSCs group 119875 lt 005 120595comparison with T3NSCs 119875 lt 005

by normalizing total MAP2+ GFAP+ or GalC+ cells to thetotal number of BrdU+ cells

24 Reverse Transcription-PCR Analysis For quantitativeassessments of relative mRNA levels total RNA from brainsof 20 rats (5 per group) was extracted using the TRIZOLreagent (Invitrogen USA) following the manufacturerrsquosinstructions 2120583g of RNAwas reverse transcribed into cDNAusing a Takara RNA PCR kit (Takara Biotechnology DalianChina) The reaction conditions were 30∘C for 10 minutes42∘C for 30 minutes 99∘C for 5 minutes and 5∘C for 5minutes cDNA was subsequently amplified by PCR withspecific primers Sequences of the primers length of theproducts and the annealing temperatures were described inTable 1 Amplification included one stage of 2 minutes at94∘C followed by 30 cycles of three-step loop 30 secondsat 94∘C 30 seconds at appropriate annealing temperaturesand 1 minute at 72∘C RT-PCR products were analysed by2 agarose gel electrophoresis and stained by ethidiumbromide The ratio of platelet-derived growth factor 120572 recep-tor (PDGF120572R) GalC and myelin basic protein (MBP) toglyceraldehyde-3-phosphate dehydrogenase (GAPDH) wascalculated as the relative level of mRNA expression

25 Statistical Analysis All data were presented as meanplusmn SD Statistical analysis was performed using SPSS (ver-sion 170) Group differences were compared using one-wayANOVA followed by post hoc tests 119875 values lt 005 wereconsidered statistically significant

3 Results

31 The Culture and Infection of NSCs NSCs were iso-lated from newborn Wistar rats cerebral hemispheres andproliferated into round floating spheres after 5sim7 days of

culture (Figure 1(a)) as nestin-positive cells (Figure 1(b))NSCs infected by GDNF recombinant adenovirus for 2 daysshowed green fluorescence under fluorescence microscope(Figure 1(c))

32 Attenuation of Clinical Disease following NeurospheresTransplantation To evaluate the effects of NSCs on diseaseprogression in EAE neurospheres (NSCs T3NSCs andGDNF-T3NSCs) were transplanted into lateral ventricles atday 10 after EAE induction Disabilities appeared typically ineach group at days 11sim14 after EAE induction with an averageclinical score of 23sim25 reaching to the maximum scoreafter 6sim7 days The animals in three neurosphere-graftedgroups showed clinical symptoms rapidly reduced comparedto saline-injected animals (119875 lt 005) and recovered normalgait after 40sim50 days of inductionwhereas the saline-injectedEAE rats still had slight symptoms at the end of follow-up period (Figure 2) Moreover the improvement of clinicalsymptoms in GDNF-T3NSCs group was the most notableamong the grafted groups (Figure 2)

33 Reduction of Brain Inflammation and DemyelinatingProcess by Neurospheres Transplantation To assess if NSCstransplantation attenuates brain inflammation and demyeli-nation HE staining was used to evaluate the number andsize of infiltration lesions Luxol fast blue (LFB) stain-ing was used to assess the demyelination Saline-injectedrats showed much more typical inflammatory cell infil-tration (Figure 3(a)) and marked myelin sparse and loss(Figure 3(e)) In contrast neurosphere-treated animals dis-played reduced number and size of inflammatory cell infil-trations (Figures 3(b)ndash3(d) Table 2) concomitant with apreservation of themyelin structure and an increase ofmyelindensity (Figures 3(f)ndash3(h) Table 2) indicating that saline-injected EAE rats experienced progressive inflammation and

4 Neural Plasticity

(a) (b)

(c)

Figure 1 Characterization of the neurosphere prior to transplantation (a) Neurospheres derived from cerebral parenchyma of newborn ratsfor 7 days (b) Immunocytochemical staining of nestin in neurospheres (c) Neurospheres infected with GDNF recombinant adenovirus onlaunching green fluorescence Bar (andashc) = 75120583m

0

05

1

15

2

25

3

35

4

45

Clin

ical

scor

e

Days after EAE induction (days)

ControlNSCs

T3NSCsT3-GDNFNSCs

1 5 10 15 20 25 30 35 40 45 50 55 60

lowast lowastlowast

Figure 2 Clinical severity improvement following neurospheretransplantation (mean plusmn SD 119899 = 5) lowastComparison with controlgroup 119875 lt 005 comparison with NSCs group 119875 lt 005

demyelination which was blocked by neurospheres trans-plantation No significant differences in the mean numberof infiltration lesions were observed between the NSCs andthe T3NSCs groups however the mean number of cellsper infiltrate in the T3NSCs groups was less than that inNSCs group (119875 lt 005) and the myelin structure was also

more perfect and myelin density was higher than that ofNSCs group (119875 lt 005) Additionally the mean number ofinfiltration lesions and mean number of cells per infiltratein GDNF-T3NSCs group were apparently less than thosein T3NSCs group (119875 lt 005) and the myelin structure inGDNF-T3NSCs group was also most complete and myelindensity was highest among the transplanted groups (119875 lt005) The above results showed GDNF-T3NSCs had thestrongest improvement in inflammation and demyelinationfor EAE and T3NSCs were stronger than NSCs

34 Integration of Transplanted Neurospheres in the HostEAE Brain The transplanted cells at 60 days after EAEinduction disseminated predominantly in the inflamed areasNo significant differences in the density of BrdU-positive cellsper mm2 in brain between NSCs and T3NSCs groups wereobserved (119875 gt 005) The density of BrdU-positive cells permm2 in the GDNF-T3NSCs group was significantly higher(119875 lt 005) than that in the NSCs and T3NSCs groupswhich suggested treatment of GDNF gene raised graftedNSCs survival in EAE brain Double immunohistochemistryshowed that transplanted T3NSCs and GDNF-T3NSCsacquiredmoreMAP2 andGalC and fewer GFAP than graftedNSCs (119875 lt 005) and the GDNF-T3NSCs group had thehighest MAP2 and lowest GFAP among the three groups ofcells transplantation (119875 lt 005) (Figures 4(a)ndash4(i) Table 3)

Neural Plasticity 5

Control

(a)

NSCs

(b)

T3NSCs

(c)

GDNF-T3NSCs

(d)

Control

(e)

NSCs

(f)

T3NSCs

(g)

GDNF-T3NSCs

(h)

Figure 3 HE staining of inflammatory lesions of the cerebral parenchyma and LFB staining of demyelination of the corpus callosum incontrol NSCs T3NSCs and GDNF-T3NSCs groups respectively (a) Control group showed much more inflammatory cell infiltrations((b) (c) and (d)) Neurosphere-treated groups displayed reduced number and size of inflammatory cell infiltrations especially in GDNF-T3NSCs groups (d) (e) Control group showed marked myelin sparse and loss ((f) (g) and (h)) Neurosphere-treated groups displayed apreservation of the myelin structure especially in GDNF-T3NSCs groups (h) (andashd) = 50 120583m (endashh) = 100 120583m

NSCs MAP2+BrdU+

(a)

T3NSCs MAP2+BrdU+

(b)

GDNF-T3NSCs MAP2+BrdU+

(c)

NSCs GalC+BrdU+

(d)

T3NSCs GalC+BrdU+

(e)

GDNF-T3NSCs GalC+BrdU+

(f)

NSCs GFAP+BrdU+

(g)

T3NSCs GFAP+BrdU+

(h)

GDNF-T3NSCs GFAP+BrdU+

(i)

Control GFAP+

(j)

Normal GFAP+

(k)

Figure 4 Immunohistochemical double staining of BrdU MAP2 GFAP and GalC positive cells in the cerebral parenchyma of rats (andashc) MAP2minusBrdU+ cells (solid arrow) MAP2+BrdUminus cells (dotted arrow) and MAP2+BrdU+ cells (arrowhead) in NSCs T3NSCs andGDNF-T3NSCs group respectively (dndashf) GalCminusBrdU+ positive cells (solid arrow) GalC+BrdUminus cells (dotted arrow) and GalC+BrdU+cells (arrowhead) in NSCs T3NSCs and GDNF-T3NSCs group respectively (gndashi) GFAPminusBrdU+ cells (solid arrow) GFAP+BrdUminus cells(dotted arrow) and GFAP+BrdU+ cells (arrowhead) in NSCs T3NSCs and GDNF-T3NSCs group respectively (j) GFAP+ cells (dottedarrow) in control group (k) GFAP+ cells (dotted arrow) in normal group Bar (andashk) = 25120583m

6 Neural Plasticity

Table 3 Differentiation of NSCs T3NSCs and GDNF-T3NSCs in vivo (mean plusmn SD 119899 = 5)

BrdU+ (mm2) MAP2+BrdU+ () GalC+BrdU+ () GFAP+BrdU+ ()NSCs 11558 plusmn 1934 1635 plusmn 341 1732 plusmn 598 4901 plusmn 845T3NSCs 10628 plusmn 125 2503 plusmn 566lowast 3273 plusmn 465lowast 2658 plusmn 621lowast

GDNF-T3NSCs 13560 plusmn 945lowast 4367 plusmn 769lowast 3693 plusmn 794lowast 1638 plusmn 414lowastlowastComparison with NSCs group 119875 lt 005 comparison with T3NSCs 119875 lt 005

Table 4 The expression of endogenous astrocytes in lesion areas in each group (mean plusmn SD 119899 = 5)

Normal Control NSCs T3NSCs GDNF-T3NSCsEndogenous Astrocytes (mm2) 2240 plusmn 404 8320 plusmn 746lowast 5340 plusmn 305lowast 4320 plusmn 259lowast120595 3220 plusmn 311lowast120595ΔlowastComparison with normal group 119875 lt 005 comparison with control group 119875 lt 005 120595comparison with NSCs group 119875 lt 005 Δcomparison with T3NSCsgroup 119875 lt 005

Table 5 Relative expression of PDGF120572R GalC and MBP mRNA(PDGF120572RGAPDH GalCGAPDH and MBPGAPDH) (119899 = 5mean plusmn SD)

PDGF120572R GalC MBPControl 043 plusmn 007 040 plusmn 009 049 plusmn 007NSCs 090 plusmn 011lowast 074 plusmn 009lowast 110 plusmn 014lowast


GDNF-T3NSCs 152 plusmn 009lowast 169 plusmn 008lowast120595 162 plusmn 010lowast120595lowastComparison with control group 119875 lt 005 comparison with NSCs group119875 lt 005 120595comparison with T3NSCs 119875 lt 005

35 Inhibition of Endogenous Astrocytes Proliferation by Neu-rospheres Transplantation Astrogliosis induced all perturba-tions of the CNS environment virtually and it has becomea pathological hallmark of CNS structural lesions In orderto determine the effect of neurospheres transplantation onproliferation of endogenous astrocytes GFAP+BrdUminus cellswere counted in the grafted rats and GFAP+ cells in normaland control rats were also counted as controls All the EAErats showed significantly increased expression of endogenousastrocytes in lesion areas compared with normal rats (119875 lt005) The EAE rats receiving neurospheres transplantationhowever showed reduced number of endogenous astrocytescompared with the EAE rats receiving saline injection (119875 lt005) Among the three groups of cells transplantationGDNF-T3NSCs group had the lowest proliferation (119875 lt005) and T3NSCs group was lower than NSCs group (119875 lt005) (Figures 4(g)ndash4(k) Table 4)

36 Increase of mRNA of Oligodendrocyte Lineage Cellsafter Neurospheres Transplantation Cells grafting signifi-cantly increased the expression ofmRNA for PDGF120572RGalCand MBP (the markers of oligodendrocyte lineage cells) incerebral lesion areas compared with saline-injected controlEAE rats (119875 lt 005) The three mRNA expressions in T3NSCs and GDNF-T3NSCs groups were higher than thatin NSCs group (119875 lt 005) the expression of mRNA forGalC and MBP in GDNF-T3NSCs group was higher thanthat in T3NSCs group (119875 lt 005) (Figure 5 Table 5)

(bp)

600

500

400

300

200

100

GAPDH

GalC

MBP

PDGF120572R

1 2 3 4

Figure 5 Expression of mRNA for PDGF120572R GalC andMBP in thecerebral lesion areas in each group 1 control group 2 NSCs group3 T3NSCs group 4 GDNF-T3NSCs group

The results suggested T3NSCs grafting especially GDNF-T3NSCs grafting promotes oligodendrogenesis and remyeli-nation for EAE rats compared to NSCs grafting

4 Discussion

Our study shows that grafting NSCs T3NSCs and GDNF-T3NSCs into rats subjected to EAE significantly improvedfunctional outcome compared with control group T3NSCsand GDNF-T3NSCs groups reduced significantly inflamma-tory infiltrations and demyelination compared with NSCsgroup and greater reductions in GDNF-T3NSCs group wereobserved compared with the T3NSCs group T3NSCs andGDNF-T3NSCs generated more MAP2 and GalC positivecells and less GFAP positive cells compared with native NSCsin EAE rats and more MAP2 and less GFAP positive cellswere generated from GDNF-T3NSCs than T3NSCs More-over the number of endogenous astrocytes in T3NSCs andGDNF-T3NSCs groups was less than that in NSCs groupand between T3NSCs and GDNF-T3NSCs groups GDNF-T3NSCs group was less than T3NSCs group T3NSCs andGDNF-T3NSCs grafting significantly increased the expres-sion of mRNA for PDGF120572R GalC and MBP in lesion areasof brain and the expression of mRNA for GalC and MBP

Neural Plasticity 7

in GDNF-T3NSCs group was higher than that in T3NSCsgroup Furthermore the number of transplanted cells inhost brain in GDNF-T3NSCs group was significantly morecompared with T3NSCs and NSCs groups

EAE is believed to be initiated byT cell-mediated immuneresponses tomyelin antigens [17] EAEbeginswhen peripher-ally activated myelin-reactive T cells infiltrate the CNS Onceinside the CNS myelin-reactive T cells become activatedupon exposure to myelin antigens and secrete inflammatorycytokines thereby triggering an inflammatory cascade thatleads to extensive demyelination and neuronaxonal loss [18]Transplanted NSCs could steadily restrain the expansion ofantigen-specific encephalitogenic T cells in lymph nodes ofEAE mice therefrom reducing immune cell mobilizationfrom the periphery [19 20] And transplanted NSCs inducedapoptosis of blood-borne CNS-infiltrating encephalitogenicT cells in perivascular CNS areas [21] Previous studiesshowed that NSCs transplantation ameliorated the clinicalsigns and reduced tissue injury after EAE which was asso-ciated with reducing the number of perivascular infiltratesand of encephalitogenic T cells in brain of EAE animals [22ndash24] Here we showed a significant reduction in the number ofinflammatory infiltrates in brain after neurospheres graftingand the size of infiltration lesions in T3NSCs and GDNF-T3NSCs groups was smaller than that in NSCs group thesize in GDNF-T3NSCs group was the smallest among allthe groups The results suggest that T3NSCs especiallyGDNF-T3NSCs more effectively reduce CNS-infiltratinginflammatory cells thus exerting better effect than NSCs onEAE

Astrocytes respond to CNS insults with a process ofcellular activation known as reactive astrogliosis [25] Astro-cytes activation plays an important role in demyelinatingdisorders [20 26ndash28] Activated astrocytes orchestrate CNSinflammatory response by producing proinflammatory fac-tors such as interleukin-1120573 interleukin-6 tumor necrosisfactor-120572 [29] and chemokines like CC chemokine ligand-2 [30 31] Furthermore astrogliosis hampers endogenousaxonal remyelination resulting in irreversible axonal loss andfunctional disability [20 22] NSCs transplantation greatlyreduced astrogliosis in EAE [22] Here we verified thatproliferation of astrocytes was reduced significantly afterneurospheres transplantation Moreover among the graftedgroups GDNF-T3NSCs group had the least proliferationand T3NSCs group was less than NSCs group The resultssuggested T3NSCs especially GDNF-T3NSCs had morepotent antiastrogliosis capacity than NSCs thus more pro-foundly suppressing inflammatory reaction and reducingdemyelination than NSCs

Demyelination and neuronal degeneration in EAE pro-mote disease evolution to the progressive form thus the ther-apeutic strategy on EAE still includes mechanisms protectingneurons and repairing demyelination [32] Newly generatedoligodendrocyte lineage cells and neurons from transplantedNSCs markedly decreased the extent of demyelination andpromoted axonal regeneration through replacing lost ordegenerative cells [1 22] In addition under pathologicalenvironments in the CNS transplanted NSCs differentiateinto astrocytes in vivo which potentially cause reactive gliosis

[33 34] Thus it is essential to reduce astrocyte differenti-ation of NSCs in EAE Present results showed transplantedT3NSCs and GDNF-T3NSCs generated more neuronsand oligodendrocytes and less astrocytes than transplantedNSCs and transplanted GDNF-T3NSCs generated mostneurons and fewest astrocytes By contrast the rats treatedwith T3NSCs andGDNF-T3NSCs had better clinical recov-ery and less inflammatory activity and demyelination thanthe rats treated with NSCs especially the rats treated withGDNF-T3NSCs

PDGF120572R which is expressed by oligodendrocyte progen-itor cells GalC which is expressed by immature and matureoligodendrocytes and MBP which is expressed by maturemyelinating oligodendrocytes were strongly diminished atthe chronic phase of EAE [6 35 36] In this study NSCsgrafting increased the expression of mRNA for PDGF120572RGalC and MBP in lesion areas of brain the expression inT3NSCs and GDNF-T3NSCs groups was higher than NSCsgroup and GDNF-T3NSCs group had the highest mRNAfor GalC andMBPThe results suggested that a great numberof oligodendrocyte lineage cells were generated after neuro-spheres grafting especially GDNF-T3NSCs grafting whichgreatly contributed to regenerating myelin as indicated bya marked decrease in extent of demyelination after cellstransplantation

In addition our results showed that the number of graftedcells inGDNF-T3NSCs rats was higher than that in T3NSCsand NSCs rats Therefore GDNF gene may increase survivalof graftedNSCs in injury brain tissue which is very crucial forimproving therapeutic effect of NSCs for many CNS diseases

In conclusion we showed here that T3NSCs especiallyGDNF-T3NSCs more effectively improved functional out-come of EAE rats alleviated the brain inflammatory infil-trations and demyelination reduced astrogliosis enhancedrepopulation of neurons and oligodendrocytes and increasedexpression of mRNA for oligodendrocyte lineage cells inbrain compared to NSCsThese results suggest that T3NSCsgrafting especially GDNF-T3NSCs grafting provides betterneuroprotection for EAE than NSCs grafting alone

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

Chaoxian Yang and Jie Du contributed equally to this paper

Acknowledgments

This study was supported by Scientific Research Fund ofSichuan Provincial Education Department (no 08zb087)Sichuan Provincial Health Bureau (no 100227) and Office ofScience and Technology of Luzhou (no 2013-S-47(120))

8 Neural Plasticity

References

[1] C M Rice K Kemp A Wilkins and N J Scolding ldquoCell ther-apy formultiple sclerosis an evolving concept with implicationsfor other neurodegenerative diseasesrdquoThe Lancet vol 382 no9899 pp 1204ndash1213 2013

[2] O Einstein N Grigoriadis R Mizrachi-Kol et al ldquoTrans-planted neural precursor cells reduce brain inflammation toattenuate chronic experimental autoimmune encephalomyeli-tisrdquo Experimental Neurology vol 198 no 2 pp 275ndash284 2006

[3] R P Murphy K J Murphy and M Pickering ldquoThe develop-ment of myelin repair agents for treatment of multiple sclerosisprogress and challengesrdquo Bioengineered vol 4 no 3 pp 140ndash146 2013

[4] M E Cohen N Muja N Fainstein J W M Bulte andT Ben-Hur ldquoConserved fate and function of ferumoxides-labeled neural precursor cells in vitro and in vivordquo Journal ofNeuroscience Research vol 88 no 5 pp 936ndash944 2010

[5] S Grade L Bernardino and J O Malva ldquoOligodendrogenesisfrom neural stem cells perspectives for remyelinating strate-giesrdquo International Journal of Developmental Neuroscience vol31 no 7 pp 692ndash700 2013

[6] M Fernandez A Giuliani S Pirondi et al ldquoThyroid hormoneadministration enhances remyelination in chronic demyelinat-ing inflammatory diseaserdquo Proceedings of the National Academyof Sciences of the United States of America vol 101 no 46 pp16363ndash16368 2004

[7] M Fernandez M Paradisi G Del Vecchio L Giardino andL Calza ldquoThyroid hormone induces glial lineage of primaryneurospheres derived from non-pathological and pathologicalrat brain implications for remyelination-enhancing therapiesrdquoInternational Journal of Developmental Neuroscience vol 27 no8 pp 769ndash778 2009

[8] P G Franco L Silvestroff E F Soto and J M PasquinildquoThyroid hormones promote differentiation of oligodendrocyteprogenitor cells and improve remyelination after cuprizone-induced demyelinationrdquo Experimental Neurology vol 212 no2 pp 458ndash467 2008

[9] J C Dugas A Ibrahim and B A Barres ldquoThe T3-induced geneKLF9 regulates oligodendrocyte differentiation and myelinregenerationrdquoMolecular and Cellular Neuroscience vol 50 no1 pp 45ndash57 2012

[10] M L DellrsquoAcqua L Lorenzini G DrsquoIntino et al ldquoFunc-tional and molecular evidence of myelin- and neuroprotectionby thyroid hormone administration in experimental allergicencephalomyelitisrdquo Neuropathology and Applied Neurobiologyvol 38 no 5 pp 454ndash470 2012

[11] L-F H Lin D H Doherty J D Lile S Bektesh and FCollins ldquoGDNF a glial cell line-derived neurotrophic factor formidbrain dopaminergic neuronsrdquo Science vol 260 no 5111 pp1130ndash1132 1993

[12] C E Henderson H S Phillips R A Pollock et al ldquoGDNF apotent survival factor for motoneurons present in peripheralnerve and musclerdquo Science vol 266 no 5187 pp 1062ndash10641994

[13] K D Beck J Valverde T Alexi et al ldquoMesencephalic dopamin-ergic neurons protected by GDNF from axotomy-induceddegeneration in the adult brainrdquo Nature vol 373 no 6512 pp339ndash341 1995

[14] M S Ramer J V Priestley and S B McMahon ldquoFunctionalregeneration of sensory axons into the adult spinal cordrdquoNature vol 403 no 6767 pp 312ndash316 2000

[15] A Blesch and M H Tuszynski ldquoCellular GDNF deliverypromotes growth of motor and dorsal column sensory axonsafter partial and complete spinal cord transections and inducesremyelinatiordquo Journal of Comparative Neurology vol 467 no 3pp 403ndash417 2003

[16] B Chen X-Q Gao C-X Yang et al ldquoNeuroprotective effectof grafting GDNF gene-modified neural stem cells on cerebralischemia in ratsrdquo Brain Research vol 1284 pp 1ndash11 2009

[17] J M Fletcher S J Lalor C M Sweeney N Tubridy andK H G Mills ldquoT cells in multiple sclerosis and experimen-tal autoimmune encephalomyelitisrdquo Clinical and ExperimentalImmunology vol 162 no 1 pp 1ndash11 2010

[18] J Yang Y Yan C-G Ma et al ldquoAccelerated and enhancedeffect of CCR5-transduced bone marrow neural stem cells onautoimmune encephalomyelitisrdquo Acta Neuropathologica vol124 no 4 pp 491ndash503 2012

[19] S Pluchino L Zanotti E Brambilla et al ldquoImmune regulatoryneural stemprecursor cells protect fromcentral nervous systemautoimmunity by restraining dendritic cell functionrdquo PLoSONE vol 4 no 6 Article ID e5959 2009

[20] R Brambilla P D Morton J J Ashbaugh S Karmally K LLambertsen and J R Bethea ldquoAstrocytes play a key role in EAEpathophysiology by orchestrating in the CNS the inflammatoryresponse of resident and peripheral immune cells and bysuppressing remyelinationrdquo Glia vol 62 no 3 pp 452ndash4672014

[21] S Pluchino L Zanotti B Rossi et al ldquoNeurosphere-derivedmultipotent precursors promote neuroprotection by animmunomodulatory mechanismrdquo Nature vol 436 no 7048pp 266ndash271 2005

[22] S Pluchino A Quattrini E Brambilla et al ldquoInjection of adultneurospheres induces recovery in a chronic model of multiplesclerosisrdquo Nature vol 422 no 6933 pp 688ndash694 2003

[23] M Aharonowiz O Einstein N Fainstein H Lassmann BReubinoff and T Ben-Hur ldquoNeuroprotective effect of trans-planted human embryonic stem cell-derived neural precursorsin an animal model of multiple sclerosisrdquo PLoS ONE vol 3 no9 Article ID e3145 2008

[24] C Hackett J Knight and Y Mao-Draayer ldquoTransplantationof Fas-deficient or wild-type neural stemprogenitor cells(NPCs) is equally efficient in treating experimental autoim-mune encephalomyelitis (EAE)rdquo American Journal of Transla-tional Research vol 6 no 2 pp 119ndash128 2014

[25] M V Sofroniew and H V Vinters ldquoAstrocytes biology andpathologyrdquoActa Neuropathologica vol 119 no 1 pp 7ndash35 2010

[26] R Brambilla T Persaud X Hu et al ldquoTransgenic inhibitionof astroglial NF-kappa B improves functional outcome inexperimental autoimmune encephalomyelitis by suppressingchronic central nervous system inflammationrdquo The Journal ofImmunology vol 182 no 5 pp 2628ndash2640 2009

[27] S M Moore A J Khalaj S Kumar et al ldquoMultiple functionaltherapeutic effects of the estrogen receptor 120573 agonist indazole-Cl in a mouse model of multiple sclerosisrdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 111 no 50 pp 18061ndash18066 2014

[28] LMayo S A TraugeM Blain et al ldquoB4GALT6 regulates astro-cyte activation during CNS inflammationrdquo Nature Medicinevol 20 no 10 pp 1147ndash1156 2014

[29] HWilms J Sievers U RickertM Rostami-Yazdi UMrowietzand R Lucius ldquoDimethylfumarate inhibits microglial andastrocytic inflammation by suppressing the synthesis of nitric

Neural Plasticity 9

oxide IL-1120573 TNF-120572 and IL-6 in an in-vitro model of braininflammationrdquo Journal of Neuroinflammation vol 7 article 302010

[30] L Izikson R S Klein I F CharoH LWeiner andAD LusterldquoResistance to experimental autoimmune encephalomyelitis inmice lacking the CC chemokine receptor (CCR)2rdquoThe Journalof Experimental Medicine vol 192 no 7 pp 1075ndash1080 2000

[31] Y Zhou Y Sonobe T Akahori et al ldquoIL-9 promotes Th17 cellmigration into the central nervous system via CC chemokineligand-20 produced by astrocytesrdquo Journal of Immunology vol186 no 7 pp 4415ndash4421 2011

[32] C E Pedraza C Taylor A Pereira et al ldquoInduction ofoligodendrocyte differentiation and in vitro myelination byinhibition of rho-associated kinaserdquo ASN Neuro vol 6 no 4pp 1ndash17 2014

[33] S Obayashi H Tabunoki S U Kim and J-I Satoh ldquoGeneexpression profiling of human neural progenitor cells follow-ing the serum-induced astrocyte differentiationrdquo Cellular andMolecular Neurobiology vol 29 no 3 pp 423ndash438 2009

[34] Z Gao Q Wen Y Xia et al ldquoOsthole augments therapeuticefficiency of neural stem cells-based therapy in experimentalautoimmune encephalomyelitisrdquo Journal of PharmacologicalSciences vol 124 no 1 pp 54ndash65 2014

[35] L Calza M Fernandez A Giuliani L Aloe and L GiardinoldquoThyroid hormone activates oligodendrocyte precursors andincreases a myelin-forming protein and NGF content in thespinal cord during experimental allergic encephalomyelitisrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 99 no 5 pp 3258ndash3263 2002

[36] F Girolamo G Ferrara M Strippoli et al ldquoCerebral cor-tex demyelination and oligodendrocyte precursor response toexperimental autoimmune encephalomyelitisrdquo Neurobiology ofDisease vol 43 no 3 pp 678ndash689 2011

Submit your manuscripts athttpwwwhindawicom

Neurology Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Alzheimerrsquos DiseaseHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

ScientificaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


BioMed Research International


Research and TreatmentSchizophrenia

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


Neural Plasticity


Parkinsonrsquos Disease


Research and TreatmentAutism

Sleep DisordersHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Neuroscience Journal

Epilepsy Research and TreatmentHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Psychiatry Journal


Computational and Mathematical Methods in Medicine

Depression Research and TreatmentHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Brain ScienceInternational Journal of

StrokeResearch and TreatmentHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Neurodegenerative Diseases


Journal of

Cardiovascular Psychiatry and NeurologyHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

2 Neural Plasticity

study we investigated whether transplantation of NSCscotreated with T3 andGDNF provides better neuroprotectiveeffect than transplantation of native NSCs for EAE

2 Materials and Methods

21 Growth Induction and Infection of Rat NeurospheresThe cerebral hemispheres dissected from newborn Wistarrats (Animal House Center Sichuan Medical UniversitySichuan China) were minced and dissociated into singlecell suspensions The cells were suspended in 25mL flaskat a density of 1 times 105 cellsmL in stem medium (serum-free DMEMF12 medium supplemented with 20 ngmL ofbasic fibroblast growth factor (bFGF) 20 ngmL of epidermalgrowth factor (EGF) and 1 N2 supplement (all fromGibco USA)) After 5sim7 days of culture neurospheres wereformed and assayed for nestin expression by immunohisto-chemical staining Then neurospheres were triturated intosingle cells suspension The detached NSCs were dividedinto two groups One group was planted in stem mediumadditionally added 20 ngmL of T3 for 5 days (T3NSCs)the other was infected with GDNF recombinant adenovirus(pAdEasy-1-pAdTrack CMV-GDNF) for 2 days as describedin our laboratory [16] Adeasy-1 plasmid contains the genefor green fluorescent protein and the titers of viral were 1 times109 PFUmL Briefly 200120583L single cell suspensions mixing5 120583LGDNF recombinant adenovirus solutionwere planted ineachwell of a 24-well plate in 5CO

2at 37∘C for 2 hours then

300 120583L medium was added to each well to further incubatefor 2 days The postinfected cells were then planted in stemmedium containing 20 ngmL of T3 for 5 days (GDNF-T3NSCs) For labeling in vivo the grafted cells NSCsT3NSCs and GDNF-T3NSCs were pretreated for 3 daysprior to grafting with 10 120583M of 5-bromo-21015840-deoxyuridine(BrdU Sigma USA)

22 EAE Induction and Neurospheres Transplantation Allanimal experiments were approved by and performed inaccordance with the Chinese Academy of Sciences ChinaEAE is induced in female Wistar rats by guinea pig spinalcord homogenate emulsifiedwith complete Freundrsquos adjuvant(CFA Sigma) 6ndash8-week-old female Wistar rats (inbredstrain Animal House Center Sichuan Medical UniversitySichuan China) were injected in the four footpads of 100mgof guinea pig spinal cord in 04mL of PBS emulsifiedwith equal volume of CFA supplemented with 6mgmL ofmycobacterium tuberculosis H37Ra (Shijiazhuang WeitianScientific Instruments Equipment Co Ltd China) At dayof induction and at day 2 300 ng of bordetella pertussistoxin (Weitian) in 01mL PBS was injected subcutaneouslyThe animals were scored daily for neurological symptomsas follows (0) no clinical disease (1) limpness in tail (2)hind-leg ataxia (3) hind-leg paralysis (4) paraplegia and (5)moribund or dead Ten days after EAE induction rats wereanesthetized with intraperitoneal injection of pentobarbitalsodium (30mgkg) and were fixed on a stereotactic device(Angle Two Stereotaxic Instrument wRat Atlas Product464601 USA) Quantities of 5 times 105 cells (NSCs T3NSCs

andGDNF-T3NSCs) in a volume of 10 120583Lwere injected onceinto each lateral ventricle (AP =minus08 to 10mm119877 or 119871 = minus18to 20mm and 119881 = minus40 to 50mm) The control groupunderwent the same injection with 10 120583L saline into eachlateral ventricle

23 Histological and Immunohistochemical Assessment EAErats were sacrificed with a lethal dose of pentobarbitalsodium at day 60 after EAE induction 20 rats (5 per group)were perfused via the ascending aorta with PBS followedby 4 paraformaldehyde The brains were removed andpostfixed for 24 hours by immersion in the same fixativeHistopathology and immunohistochemistry were assessed in6 120583m thick paraffin sections at 02sim16mm below the bregmalevels Hematoxylin-eosin (HE) staining was used to evaluateinflammatory infiltration 10 nuclei or more gathered incerebrum white matter or surrounded by a blood vessel wereconsidered as an infiltration lesion To estimate the extentof inflammation the number of infiltration lesions and thenumber of cells per infiltration lesion were counted Luxolfast blue (LFB Sigma) staining was performed to detect thedegree of demyelination and themeasurement parameter wasthe integrated optical density (IOD)

BrdU and neural special markers double immunohisto-chemistry staining were used to identify grafted cells andthe differentiated cells from the grafted cells in vivo Thespecial markers were neuronal specific markers microtubule-associated protein 2 (rabbit anti-MAP2 1 100 Abcam UK)astrocytes specific markers glial fibrillary acidic protein (rab-bit anti-GFAP 1 100 Abcam) and oligodendrocyte specificmarker galactocerebroside (rabbit anti-GalC 1 50 Chemi-con USA) Briefly sections were incubated in 03 H

2O2

in methanol for 10 minutes followed by incubation with01 Triton X-100 in 01 sodium citrate for 10 minutes Thesections were treated with 2N HCl at 37∘C for 1 hour andthen incubated withmouse anti-BrdU (1 200 Abcam) at 4∘Covernight After a goat anti-mouse IgG secondary antibody(1 100 Wuhan Boster Biological Technology China) wasadded for 30 minutes alkaline phosphatase- (AP-) strepta-vidin (Boster) was incubated for 30 minutes and 5-bromo-4-chloro-3-indolyl phosphatenitroblue tetrazolium chloride(BCIPNBT Boster) was then used as a chromogen for10min After PBS washes the sections were reincubatedwith primary antibody for rabbit ant-MAP2 GFAP or GalCfollowed by incubation with goat anti-rabbit IgG (1 100Boster) and horseradish peroxidase- (HRP-) streptavidin(Boster) Diaminobenzidine (DAB Boster) or 3-amino-9-ethylcarbazole (AEC Boster) was then used as a chromogenfor light microscopy Negative control sections from eachanimalwere carried out except that the primary antibodywasomitted

IOD was counted in corpus callosum in 3 sections peranimal using ImageJ 144p software Inflammatory infiltra-tion and positive cells were assessed in 6 regions of interestsituated within bilaterally white matter tracts in 3 sectionsper animal Measurement was made in a predefined field(06mm times 06mm) using image-pro plus 60 software Thepercentage ofMAP2+ GFAP+ andGalC+ cellswas quantified

Neural Plasticity 3














3 Results





4 Neural Plasticity

(a) (b)

(c)


0

05

1

15

2

25

3

35

4

45

Clin

ical

scor

e


ControlNSCs

T3NSCsT3-GDNFNSCs

1 5 10 15 20 25 30 35 40 45 50 55 60

lowast lowastlowast





Neural Plasticity 5

Control

(a)

NSCs

(b)

T3NSCs

(c)

GDNF-T3NSCs

(d)

Control

(e)

NSCs

(f)

T3NSCs

(g)

GDNF-T3NSCs

(h)


NSCs MAP2+BrdU+

(a)

T3NSCs MAP2+BrdU+

(b)


(c)

NSCs GalC+BrdU+

(d)

T3NSCs GalC+BrdU+

(e)


(f)

NSCs GFAP+BrdU+

(g)

T3NSCs GFAP+BrdU+

(h)


(i)

Control GFAP+

(j)

Normal GFAP+

(k)


6 Neural Plasticity












(bp)

600

500

400

300

200

100

GAPDH

GalC

MBP

PDGF120572R

1 2 3 4



4 Discussion


Neural Plasticity 7













Acknowledgments


8 Neural Plasticity

References






























Neural Plasticity 9





















Neural Plasticity










Psychiatry Journal









Journal of


Neural Plasticity 3














3 Results





4 Neural Plasticity

(a) (b)

(c)


0

05

1

15

2

25

3

35

4

45

Clin

ical

scor

e


ControlNSCs

T3NSCsT3-GDNFNSCs

1 5 10 15 20 25 30 35 40 45 50 55 60

lowast lowastlowast





Neural Plasticity 5

Control

(a)

NSCs

(b)

T3NSCs

(c)

GDNF-T3NSCs

(d)

Control

(e)

NSCs

(f)

T3NSCs

(g)

GDNF-T3NSCs

(h)


NSCs MAP2+BrdU+

(a)

T3NSCs MAP2+BrdU+

(b)


(c)

NSCs GalC+BrdU+

(d)

T3NSCs GalC+BrdU+

(e)


(f)

NSCs GFAP+BrdU+

(g)

T3NSCs GFAP+BrdU+

(h)


(i)

Control GFAP+

(j)

Normal GFAP+

(k)


6 Neural Plasticity












(bp)

600

500

400

300

200

100

GAPDH

GalC

MBP

PDGF120572R

1 2 3 4



4 Discussion


Neural Plasticity 7













Acknowledgments


8 Neural Plasticity

References






























Neural Plasticity 9





















Neural Plasticity










Psychiatry Journal









Journal of


4 Neural Plasticity

(a) (b)

(c)


0

05

1

15

2

25

3

35

4

45

Clin

ical

scor

e


ControlNSCs

T3NSCsT3-GDNFNSCs

1 5 10 15 20 25 30 35 40 45 50 55 60

lowast lowastlowast





Neural Plasticity 5

Control

(a)

NSCs

(b)

T3NSCs

(c)

GDNF-T3NSCs

(d)

Control

(e)

NSCs

(f)

T3NSCs

(g)

GDNF-T3NSCs

(h)


NSCs MAP2+BrdU+

(a)

T3NSCs MAP2+BrdU+

(b)


(c)

NSCs GalC+BrdU+

(d)

T3NSCs GalC+BrdU+

(e)


(f)

NSCs GFAP+BrdU+

(g)

T3NSCs GFAP+BrdU+

(h)


(i)

Control GFAP+

(j)

Normal GFAP+

(k)


6 Neural Plasticity












(bp)

600

500

400

300

200

100

GAPDH

GalC

MBP

PDGF120572R

1 2 3 4



4 Discussion


Neural Plasticity 7













Acknowledgments


8 Neural Plasticity

References






























Neural Plasticity 9





















Neural Plasticity










Psychiatry Journal









Journal of


Neural Plasticity 5

Control

(a)

NSCs

(b)

T3NSCs

(c)

GDNF-T3NSCs

(d)

Control

(e)

NSCs

(f)

T3NSCs

(g)

GDNF-T3NSCs

(h)


NSCs MAP2+BrdU+

(a)

T3NSCs MAP2+BrdU+

(b)


(c)

NSCs GalC+BrdU+

(d)

T3NSCs GalC+BrdU+

(e)


(f)

NSCs GFAP+BrdU+

(g)

T3NSCs GFAP+BrdU+

(h)


(i)

Control GFAP+

(j)

Normal GFAP+

(k)


6 Neural Plasticity












(bp)

600

500

400

300

200

100

GAPDH

GalC

MBP

PDGF120572R

1 2 3 4



4 Discussion


Neural Plasticity 7













Acknowledgments


8 Neural Plasticity

References






























Neural Plasticity 9





















Neural Plasticity










Psychiatry Journal









Journal of


6 Neural Plasticity












(bp)

600

500

400

300

200

100

GAPDH

GalC

MBP

PDGF120572R

1 2 3 4



4 Discussion


Neural Plasticity 7













Acknowledgments


8 Neural Plasticity

References






























Neural Plasticity 9





















Neural Plasticity










Psychiatry Journal









Journal of


Neural Plasticity 7













Acknowledgments


8 Neural Plasticity

References






























Neural Plasticity 9





















Neural Plasticity










Psychiatry Journal









Journal of


8 Neural Plasticity

References






























Neural Plasticity 9





















Neural Plasticity










Psychiatry Journal









Journal of


Neural Plasticity 9





















Neural Plasticity










Psychiatry Journal









Journal of














Neural Plasticity










Psychiatry Journal









Journal of


research article transplantation of neural stem cells...

Documents