research open access role of hcv core gene of genotype 1a and 3a and host gene cox-2 ... · 2017....

RESEARCH Open Access

Role of HCV Core gene of genotype 1a and 3aand host gene Cox-2 in HCV-inducedpathogenesisShah Jahan, Saba Khaliq, Bushra Ijaz, Waqar Ahmad and Sajida Hassan*

Abstract

Background: Hepatitis C virus (HCV) Core protein is thought to trigger activation of multiple signaling pathwaysand play a significant role in the alteration of cellular gene expression responsible for HCV pathogenesis leading tohepatocellular carcinoma (HCC). However, the exact molecular mechanism of HCV genome specific pathogenesisremains unclear. We examined the in vitro effects of HCV Core protein of HCV genotype 3a and 1a on the cellulargenes involved in oxidative stress and angiogenesis. We also studied the ability of HCV Core and Cox-2 siRNAeither alone or in combination to inhibit viral replication and cell proliferation in HCV serum infected Huh-7 cells.

Results: Over expression of Core gene of HCV 3a genotype showed stronger effect in regulating RNA and proteinlevels of Cox-2, iNOS, VEGF, p-Akt as compared to HCV-1a Core in hepatocellular carcinoma cell line Huh-7accompanied by enhanced PGE2 release and cell proliferation. We also observed higher expression levels of abovegenes in HCV 3a patient’s blood and biopsy samples. Interestingly, the Core and Cox-2-specific siRNAs downregulated the Core 3a-enhanced expression of Cox-2, iNOS, VEGF, p-Akt. Furthermore, the combined siRNAtreatment also showed a dramatic reduction in viral titer and expression of these genes in HCV serum-infectedHuh-7 cells. Taken together, these results demonstrated a differential response by HCV 3a genotype in HCV-induced pathogenesis, which may be due to Core and host factor Cox-2 individually or in combination.

Conclusions: Collectively, these studies not only suggest a genotype-specific interaction between key players ofHCV pathogenesis but also may represent combined viral and host gene silencing as a potential therapeuticstrategy.

BackgroundAn estimated 3% of the world’s population is chronicallyinfected with Hepatitis C virus (HCV) which is the maincause of liver fibrosis and cirrhosis, often leading toHCC (hepatocellular carcinoma) in a substantial numberof patients. Almost 10 million people in Pakistan are liv-ing with HCV [1,2]. The most prevalent HCV genotypein Pakistan is 3a followed by 1a [3]. HCV virion isenveloped and has a positive strand genome comprising9.6 kb RNA which is processed by cellular and viral pro-teases into 10 viral proteins, Core, E1, E2, p7 (structuralproteins), NS2, NS3, NS4a, NS4b, NS5a and NS5b (non-structural proteins). Although specific mechanisms bywhich HCV disease progresses remains unknown, direct

interaction of specific viral proteins with host cell sys-tem has shown to be accounted for some of its patho-physiological profile of HCV patients [4].Besides nucleocaspid formation, HCV Core protein, in

particular, also modulates gene transcription, cell prolif-eration, cell death and interferes with metabolism lead-ing to oxidative stress, liver steatosis and eventuallyHCC. Oxidative stress has emerged as a key contributorin the development and progression of HCV-inducedpathogenesis of liver [5,6]. Several factors might contri-bute to oxidative stress associated with HCC, as HCVCore and NS5a proteins, which are able to up-regulateCox-2 expression; a key player of oxidative stress inhepatocytes derived cells [7]. The expression of Cox-2in HCC was found to correlate with the levels of severalkey molecules implicated in carcinogenesis such asiNOS (induced nitric oxide synthase), VEGF (vascular

* Correspondence: [email protected] and Functional Genomics Laboratory, National Centre of Excellencein Molecular Biology, University of Punjab, Lahore 53700, Pakistan

Jahan et al. Virology Journal 2011, 8:155http://www.virologyj.com/content/8/1/155

© 2011 Jahan et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.

mailto:[email protected]

http://creativecommons.org/licenses/by/2.0

endothelial growth factor) and p-Akt [8,9]. iNOS andCox-2 have carcinogenic effects achieved either directlyor by producing mediator that regulate cellular growth[10]. Cox-2 can induce angiogenesis growth factors viaVEGF in HCV associated HCC [9,11,12]. A number ofother inflammatory mediators including nitric oxide(NO), Cox-2, and prostaglandin E2 (PGE2) in culturedhepatocellular carcinoma cells also stimulate VEGF [11].Cox-2 activates Akt in human HCC via a p13-kinase-dependent mechanism [13], it acts as an importantsignal mediator, which regulates cell survival and prolif-eration [14,15]. Despite several studies, mechanismsinvolved in HCV-associated pathogenesis are not com-pletely understood; it may vary as a function of viralgenotype [16].Very few studies have been undertaken to evaluate the

role of HCV Core protein of genotype 3a and 1a inHCV induced pathogenesis. In this study, we selectedHuh-7 cells as culture model system for the transienttransfection using HCV 3a and 1a Core genes and viralload analysis using HCV-infected serum as inoculum.We found a greater effect of HCV Core of genotype 3aon the expression levels of Cox-2, iNOS, VEGF, p-Aktin transiently expressing Core protein and in serum-infected Huh-7 cells as well as in patient’s blood andliver biopsies samples. Although, HCV Core protein ishighly conserved between different genotypes, weobserved differences in the HCV Core region of 1a and3a and speculate that these differences may differentiallyregulate hepatic pathogenesis in HCV infectedindividuals.HCV RNA is highly susceptible to RNAi-induced

suppression, as many investigators have reported theinhibition of HCV RNA levels by targeting differentgenes using RNAi. In our previous study, we usedsiRNA against HCV 3a Core and inhibited its expres-sion not only in transiently transfected cells but also inserum infected Huh-7 cells [17]. Here, we used siRNAagainst Core and Cox-2 genes either alone or in com-bination with HCV 3a Core gene-transfected andserum-infected Huh-7 cells to further study HCV-induced pathogenesis. We observed additional inhibi-tory effect of HCV Core and Cox-2 silencing on theexpression levels of genes involved in HCV pathogen-esis, suggesting a possible virus host interaction amongthese, moreover, reduction of viral titer may alsorepresent potential combinational therapeutic approachagainst HCV infection.

ResultsRole of HCV Core in HCV induced pathogenesisHCV 1a and 3a Core genes were cloned into pCR3.1/FLAG tag (Figure 1A). The amino acid sequence com-parison showed that 3a Core protein has 90% similarity

to 1a Core protein and 98% similarity to their consensussequences (Figure 1B). We observed several nucleotidedifferences in both genotypes when compared with lit-erature. These changes are N in 1a at position 4 and Lin 3a, Q in 1 and H in 3 at position 8, N in 1 I in 3a atposition 16 and T in 1a and N in 3a at position 70. Theother reported difference is YATG in 1a and FATG in3a at position 164 amino acid (Figure 1B). In order toobserve whether 1a and 3a differentially regulate theexpression of Cox-2, iNOS, p-Akt and VEGF, Huh-7cells were transiently transfected with or without 0.4 μgHCV genotype 1a and 3a Core expressing plasmids for48 hrs. The mRNA expression levels of Cox-2, iNOS,and VEGF genes were determined using Real-TimePCR. As shown in Figure 1C, HCV 3a Core induced theexpression of Cox-2, iNOS and VEGF genes at signifi-cantly higher levels as compared to HCV 1a Core gene.Up-regulated levels for Cox-2, iNOS and VEGF were4.1, 2.4 and 2.8-fold, respectively, with HCV 3a Corewhereas; HCV 1a Core induced Cox-2 (1.3-fold), iNOS

Figure 1 HCV Core expression plasmids and protein sequencescomparison of HCV genotype 1a and 3a. A) Schematic diagramof HCV Core expression plasmid illustrating the FLAG tag sequenceshaving ATG start site and with HCV3a and 1a Core (1-573 bp)sequence insertion into mammalian expression plasmid pCR3.1. TheCMV promoter and BGHpA regions of pCR3.1 are also shown. (B)Amino acid sequence comparison of HCV Core 1a and 3a clones.Comparison of full predicted amino acid sequence of HCV Coreisolates in our study against a consensus genotype 3a clone(3aCON) and 1a (1aCON) from the HCV sequence database,performed using the ClustalW program. Sequences different fromconsensus are boldface and underlined. Differences in the individualamino acid Core 1a and Core 3a are highlighted. Asterisks at thebottom of a sequence comparison indicate complete identity atthat position.


of 13

(1.2-fold) and VEGF (1.3-fold) as compared to control(Figure 2A). Similar results were obtained with HCV1a and 3a infected patient’s PBMCs. Up-regulation ofgenes in HCV 3a infected blood was as follow: Cox-2(4.19-fold), iNOS (3.4-fold), and VEGF (3.22-fold) ascompared to HCV 1a infected patient’s blood and nor-mal samples (Figure 2B). In HCV 3a infected biopsysamples, the expression levels for these genes were inthis fashion: Cox-2 (4.97-fold), iNOS (5.08-fold), andVEGF (6.49-fold) compared with normal samples (Fig-ure 2C). Cell lysates from Core transfected Huh-7 cellswere examined by Western blot analysis using Core,Cox-2, VEGF, and p-Akt specific antibodies. Significantincrease (p < 0.001) in the protein expression levels in

HCV 3a genotype was observed as compared to HCV1a (Figure 2D).In order to determine the effect of HCV Core gene

expression on cell proliferation, PGE2 levels weredetermined by Biotrak Prostaglandin E2 EnzymeImmunoassay system. HCV Core protein of both geno-types significantly increased the production of PGE2more with HCV 3a Core than HCV 1a in Huh-7 cells(Figure 3A). Core induced cell proliferation was alsodetermined through MTT cell proliferation assay.These results mirrored those observed with PGE2, asignificant enhanced cell proliferation observed withboth genotypes. HCV 3a genotype has greater effectcompared with HCV 1a genotype (Figure 3B). Taken

Figure 2 HCV 3a Core gene shows higher induction of Cox-2, iNOS, VEGF and p-Akt compared to HCV 1a Core gene. (A) Comparison ofgene expression of Cox-2, iNOS and VEGF in Huh-7 cells transiently transfected with HCV Core 1a (C1a), 3a (C3a) and pCR3.1 plasmid alone asmock (M) samples (0.4 μg DNA/well of each plasmid). After 48 hrs incubation, relative gene expression levels were determined. (B) Comparisonof expression of Cox-2, iNOS, and VEGF genes expressed as relative fold induction in HCV 1a and 3a infected patient’s blood samples versesnormal. (C) Expression of Cox-2, iNOS and VEGF genes in HCV 3a genotype infected liver biopsies verses normal. (D) The protein expressionlevels were determined by Western blot analysis of Huh-7 cell lysates transfected with HCV Core vectors 1a, 3a and effect on Cox-2, VEGF, p-Aktand GAPDH using specific antibodies. Blots were also normalized by measuring the amount of GAPDH (histogram). Bars are mean of opticaldensity ratio of each group.* p < 0.001 verses control and Core 1a. GAPDH gene was used as internal control for normalization in Real-Time PCRand in Western blotting. All experiments were performed in 3 independent experiments having triplicate samples in each.


of 13

together, these results show a genome-specific involve-ment of HCV Core in the induction of Cox-2, iNOS,p-Akt and VEGF host genes at RNA/protein levels inHuh-7 cells. Their high expression in HCV 3a infectedpatient’s samples and cell proliferation assay/PGE2levels further supported genome-specific role of HCVin its pathogenesis.

Effect of HCV 3a Core-specific siRNA on the expression ofCox-2, iNOS and VEGF genesHCV 3a Core showed significantly higher induction levelsas compared to HCV 1a Core. Therefore, we utilized genesilencing against HCV 3a Core to investigate its involve-ment in the regulation of Cox-2, iNOS, p-Akt and VEGFgenes. Transient transfection of two in-vitro transcribedsiRNAs Csi27 and Csi352 in Huh-7 cells after 48 hrsshowed a dramatic reduction of mRNA expression levelsof HCV 3a Core gene in a dose-dependent manner. Maxi-mum inhibition of 3-fold and 2-fold was observed for

Csi27 and Csi352 at 40 μM concentrations, respectively,when compared with scramble siRNA (Figure 4A). Theeffect of HCV 3a Core siRNAs on mRNA expression levelsof Cox-2, iNOS, VEGF genes in Huh-7 cells was alsodetermined. Although, both Csi27 and Csi352 siRNAsdecreased the expression levels of all four genes, Csi27showed dramatic reduction for Cox-2 (2.5-fold) gene,whereas, expression of iNOS, and VEGF was reduced to 1fold, respectively (Figure 4B). Complementary to reducedmRNA levels, HCV 3a Core protein expression was alsoinhibited 90% and 76% with Csi27 and Csi352 siRNA,respectively. These siRNA also inhibited protein expres-sion levels of Cox-2 (85% with Csi27 and 70% withCsi352) and VEGF (75% with Csi27 and 65% with Csi352)as compared to control scramble siRNA (Figure 4C). Simi-larly, the expression of Cox-2 gene was reduced to thebasal levels with its own siRNA, whereas, Cox-2 siRNAtreatment decreased the expression levels of iNOS andVEGF genes to 2 and 3-fold, respectively (Figure 5A).

Inhibition of genes with combined silencing of HCV 3aCore and host Cox-2 genesWe further investigated whether HCV Core 3a is regu-lating gene expression directly or via Cox-2. HCV Core3a transfected cells were treated with Core and Cox-2specific or scrambled siRNAs either alone or in combi-nation. Real-Time PCR results showed that Core-induced expression of Cox-2, iNOS and VEGF geneswas markedly reduced to 3, 2 and 1.5 fold respectively,after co-treatment with HCV 3a Core and Cox-2 speci-fic siRNA (Figure 5A). A dramatic reduction wasobserved at protein levels for Cox-2, VEGF and p-Aktin cells treated with Core and Cox-2 siRNA in combina-tion (Figure 5B). The over all mechanism of regulationof oxidative stress by HCV Core and Cox-2 has beenshown in Figure 6.

Suppression of viral load and gene expression by HCVCore and Cox-2 siRNA in Huh-7 cellsAdditionally, the efficacy of siRNA against HCV 3a Coreand Cox-2 genes alone or in combination was evaluatedin serum-infected Huh-7 cells. A remarkable suppres-sion of HCV RNA was observed up to 92% with HCV3a Core-siRNA, 83% with Cox-2 siRNA and 95% withcombination of both siRNAs (Figure 7A). Both siRNAeither alone or in combination inhibited the RNAexpression levels of Cox-2, iNOS and VEGF. Theseresults indicate that siRNA against HCV 3a Core andCox-2 genes decreased the mRNA expression levels ofCox-2 (2-fold), iNOS (1.5-fold) and VEGF (1.8-fold)genes (Figure 7B). Additionally, there was significantreduction at protein levels of Cox-2, VEGF and p-Akt incells treated with Core and Cox-2 siRNA (Figure 7C).

Figure 3 Enhanced expression of PGE2 and cell proliferation inCore transfected Huh-7 cells. (A) Prostaglandin E2 production inresponse to HCV 1a and 3a Core transfected Huh-7 cells weremeasured with Biotrak Prostaglandin E2 Enzyme Immunoassaysystem. (B) MTT assay shows that HCV 3a Core significantlyincreased the proliferation of Huh-7 cells as compared to mock andCore 1a transfected cells, observed at 570 nm wavelength. Allexperiments were performed in 3 independent experiments havingtriplicate samples in each. Error bars indicate, mean S.D, *p < 0.01verses mock.


of 13

DiscussionHCV-induced pathogenesis like liver injury, insulinresistance and steatosis may be genotype specific. Ahigh rate of HCV associated HCC prevalence in Asiahas been observed with genotype 3 followed by 1responsible for most of the cases in Pakistan [3,18-20].Several studies have been conducted to unravel theHCV pathogenesis related to genotype 1 and 2 [20,21].However, no studies related to role of HCV genotype 3ain oxidative stress are currently available. In this study,we compared the expression of HCV genotype 1a and3a in oxidative stress.Our results showed a significantly higher expression of

Cox-2, iNOS, and VEGF genes in HCV 3a patient bloodas compared with HCV 1a genotype at mRNA levels.We observed the significant stimulation of Cox-2, iNOS,and VEGF in HCV 3a infected patients biopsy samples

compared to normal. Unfortunately, we were unable tocompare the expression level of these genes in HCVinfected 1a patients biopsy samples because of non-availability of 1a liver biopsy samples as very fewpatients agreed to underwent liver biopsy. The expres-sion levels of Cox-2, iNOS, p-Akt and VEGF are posi-tively correlated in cultured cells and in human livercancer tissues suggesting their involvement in chronicliver diseases. NO and Cox-2 have carcinogenic effectsachieved either directly or by producing mediators thatregulate cellular growth [9,10]. Over expression of Cox-2 induces angiogenesis through increased levels ofproinflammatory molecule PGE2 which in return acti-vates VEGF [22] and Akt that promote the growth ofhuman HCC cells [9,13].HCV Core protein is involved in a whole array of host

cell functions including signal transduction and

Figure 4 HCV 3a Core-specific siRNA inhibit expression of genes involved in HCV pathogenesis. Huh-7 cells were transfected with HCV 3aCore expression vector or mock along with or without siRNA. (A) Dose dependent mRNA expression of HCV 3a Core gene as a result of 10 μM,20 μM and 40 μM of siRNAs for 48 hrs. Cells were harvested and relative RNA levels in PCR Csi27 and Csi352 siRNAs tranfected cells weredetermined using semi-quantitative PCR. Expression levels for mock-transfected (M), HCV 3a Core expression plasmid (C), scramble siRNA (SC)and GAPDH are also shown. (B) Silencing effect of HCV 3a Core gene on the RNA expression levels of cellular genes (Cox-2, iNOS and VEGF) 48hrs post transfection on Real-Time PCR using gene specific primers in comparison to mock was performed. GAPDH was used as internal control.Three independent experiments were performed having triplicate samples. Error bars indicate, mean S.D, *p < 0.001 verses Core. (C) Silencing ofHCV 3a Core gene and its effect on Cox-2 and VEGF protein level using specific antibodies were determined by Western blot analysis after 48hrs transfection in Huh-7 cells with GAPDH as internal control. Bars are mean of optical density ratio of each group.* p < 0.001 verses controland Core 3a.


of 13

transcriptional regulation of genes in the liver (5). It isreported that HCV Core protein regulates Cox-2 expres-sion in hepatocytes and causes oxidative stress leadingto HCC [7]. In the present study, Core protein of HCV3a was found to enhance the expression of cellulargenes Cox-2, iNOS, p-Akt and VEGF at mRNA andprotein at higher level compared to Core gene of HCV1a in Huh-7 cell line. The production of PGE2 was

assayed in HCV 1a and 3a transfected cells and resultsindicated that the level of PGE2 was increased in HCV3a Core transfected cells as compared to 1a. Further-more, cell proliferation was found to be enhanced inCore 3a transfected cells because of Core-induced Cox-2 activation of PGE2 release at 48hrs post transfection(Figure 3). Our results support the observation thatenhanced synthesis of Cox-2 as a consequence of Core3a induced PGE2 that stimulates the release of proan-giogenic factor VEGF. VEGF production is regulated byCOX-2, suggesting a promoting role of COX-2 in tumorangiogenesis through the COX-2/VEGF system [[20,23]and [24]].Many studies have reported that substitutions in the

HCV Core region results in enhanced insulin resistance,steatosis, oxidative stress and hepatocellular carcinoma[25,26]. Amino acid substitution at the sequence YATG(1b) and FATG (3a) of HCV Core gene was found to beimportant for FAS activation in genome specific manner[21]. Previously, Hourioux et al., (2007) showed agreater involvement of these HCV 3a amino acid

Figure 5 Combined effect of Cox-2 and HCV 3a Core siRNAs onCox-2, iNOS, VEGF and p-Akt gene expression. (A) Huh-7 cellswere transfected with HCV 3a Core expression vector (C) or mock-treated (M) along with or without siRNAs (Csi27 and COXsi) alone orin combination (Csi27+COXsi) for 48 hrs. Total RNA was quantifiedby Real-Time PCR and is shown as fold induction for Cox-2, iNOSand VEGF genes using their gene specific primers. (B) Western blotanalysis of Huh-7 cells treated with and without Core, Cox-2 andcombined siRNA was carried out using specific antibodies. Threeindependent experiments with triplicate determinations wereperformed. Error bars indicate mean S.D, * p < 0.01 verses serum 1a.

Figure 6 HCV Core protein affects on the cellular genesinvolved in oxidative stress, apoptosis, cell survival andangiogenesis. Schematic diagram illustrating the role of HCV Coreon cellular genes. In HCV, normal angiogenesis process can bemalignant by deregulation of genes involved in this pathway. HCVCore protein up-regulates NFKB, which further up-regulates iNOSand COX-2 pathways, and inhibit apoptosis by blocking bad andcaspase pathway. COX-2 up-regulation leads to apoptosis inhibitionvia VEGF pathway. VEGF can trigger angiogenesis either by iNOS orAKT activation. AKT singling also up-regulates AR and inhibit BADand Caspase9 that leads to angiogenesis via cell survival. AKT alsohave direct impact on iNOS regulation that also escorts toangiogenesis. We corroborated that using siRNA against Core, orCox-2 either alone or in combination can block angiogenesisdirectly or via Cox-2 reduced expression. PLC, PhosphoLipase; DAG,diacylglycerol; PKC, protein kinase C; iNOS, inducible nitric oxidesynthase; NO, nitric oxide; VEGF, vascular endothelial growth factor;PGE2, prostaglandin E2; COX-2, cyclooxygenase-2; NFKB, nuclearfactor kappa-B; P13K, phosphoinositide-3-kinase; PIP3,phosphatidylinositol 3,4,5-trisphosphate; PRAS40, proline-rich Aktsubstrate of 40 kDa; AR, Aldose reductase; BAD, Bcl-XL/Bcl-2-associated death promoter; CASPASE9, apoptosis-related cysteinepeptidase.


of 13

sequences in lipid accumulation and steatosis in cell cul-ture system [27]. Furthermore, Jhaveri et al., (2008)reported that amino acid substitution of HCV 3a Core(LLSCLIH) at 182 and 186 positions are associated withHCV induced steatosis [28]. Amino acid substitution inHCV Core gene has different impact in hepatic steatosisand oxidative stress in chornic HCV patients. Tachi etal (2009) has reported that in HCV genotype 1b infectedpatients with hepatic steatosis, there was amino acidsubstitution ‘Q’ at 70 while in patients without steatosisArg was present. He also reported that Met91aa of Coreregion in patients infected with HCV 1b have high oxi-dative stress measured through the level of 8-hydroxy-20-deoxyguanosine as compared in those with Leu91aa[20]. Mann et al., observed that the divergence in Core

9-11 amino acid at genotype level modulate the NF-kBactivation, a transcription factor which play importantfactor in inflammation and liver injury. Core encodingRKP failed to activate NF-kB signaling in vitro whileNF-kB activation by Core encoding RQT does not differfrom control RKT Core [29]. Steatosis and oxidativestress are interlinked and arise due to accumulation oftriglyceride rich lipids in cytoplasm [4,30]. We have alsoobserved the same amino acid variations that were pre-viously reported plus few other substitutions in HCV 3aCore sequence in comparison with 1a (Figure 1B).Although there is 90% amino acid sequence similarity,however, we observed few sequence differences too.These changes are N in 1a at position 4 and L in 3a, Qin 1 and H in 3 at position 8, N in 1 I in 3a at position

Figure 7 Silencing of Cox-2 and HCV 3a Core genes either alone or in combination and reduction of viral titer in Huh-7 cells infectedwith HCV 3a sera. (A) After 3 days of post infection of Huh-7 cells with HCV 3a sera (Ser 3a), cells were transfected with siRNAs (Csi27 andCOXsi) either alone or in combinations (Csi27+COXsi). Data are expressed as mean percent viral load of non-siRNA treated samples. (B) Geneexpression analysis was performed using Real-Time PCR. The effect of siRNA on the induction of genes in serum infected and siRNA treatedHuh-7 cells. Data are expressed as relative fold reduction to mock sample for Cox-2, iNOS and VEGF genes. (C) The effect of siRNA on proteinexpression levels of Cox-2, VEGF, p-Akt and GAPDH were determined after 72 hrs post infection with HCV 3a Serum by Western blot analysisfrom Huh-7 cell lysates using specific antibodies. Three independent experiments with triplicate determinations were performed. Error barsindicate, mean S.D. *#p < 0.001 verses Csi27. * p < 0.001 verses Ser3a.


of 13

16 and T in 1a and N in 3a at position 70. Therefore,we speculate that these sequences may play a role in dif-ferentially regulating genes involved in oxidative stressleading to HCC. Vidali et al., found a relationshipbetween oxidative and hepatic steatosis in the progres-sion of chronic hepatitis C [16]. Several recent studieshave shown variable responses for interferon IFN-riba-virin combination therapy, oxidative stress/steatosis andinsulin resistance due to the amino acid substitutions inthe HCV Core region [26,31-33]. Since, there is no pre-vious report linking amino acid variations to oxidativestress in a genome-specific manner, additional studiesare needed to identify the contribution of these substitu-tions to the HCV induced pathogenesis.We silenced Core gene using siRNA to further con-

firm the role of HCV 3a Core gene in HCV infectionand stimulation of cellular genes. RNAi activity directedagainst multiple target sequences of the HCV genomehas been found to block effectively the synthesis ofreplicon RNA [17,34]. We observed efficient inhibitionof HCV Core by siRNA against this functionally impor-tant region of HCV 3a genotype. Protein expressionanalysis revealed suppression of HCV Core proteinlevels by 90% in Csi27, while suppression by Csi352siRNA was 76% (Figure 4). Two different groups haveused siRNA against Core gene of HCV 1a and 1b geno-type and observed 60% and 80% reduction in mRNAand protein expression, respectively [34,35]. Silencing ofHCV Core through Core specific siRNA resulted inreduced expression of host cellular genes Cox-2, iNOSand VEGF in Core transfected Huh-7 cells at bothmRNA and protein levels. The significant inhibition ofCore mRNA in siRNA transfected cells also resulted in50% reduction in PGE2 production and cell prolifera-tion. The ability of Core siRNAs to inhibit HCV expres-sion correlates well with the established role of HCV 3aCore gene in oxidative stress and angiogenesis by regu-lating these genes.HCV Core up-regulate Cox-2 levels that correlated

with genes involved in HCV pathogenesis. Since theinhibitors of Cox-2, such as siRNAs and celecoxibshowed an inhibition of cell proliferation and carcino-genesis, we used Cox-2 specific siRNA to determine itseffect on gene expression. Cox-2 specific siRNA(COXsi) significantly decreased the expression of notonly the Cox-2 itself but also the expression levels of p-Akt, iNOS and VEGF. These results suggest that Cox-2pathway is involved in mediating the activation of p-Akt, iNOS and VEGF in HCV Core expressing cells(Additional file 1 and Additional file 2, Figure S1).Additionally, we explored whether HCV Core induced

Cox-2 gene, which in turn activated Akt (phosphryla-tion), iNOS, and VEGF or it has a direct role in activat-ing cellular genes understudy. We observed significant

reduction in the expression of Core and these geneswhen treated with Csi27 and COXsi in combination atboth mRNA and protein levels (Figure 5). The signifi-cant inhibition of Core and Cox-2 mRNA in siRNAtransfected cells either alone or in combination alsoresulted in reduced PGE2 production and cell prolifera-tion to 50%, 65% and 85%, respectively (Additional file 1and Additional file 3, Figure S2). The reduction of thesegenes by both HCV Core and Cox-2 siRNA indicatethat HCV Core is involved in HCV pathogenesis notonly by exerting its effect through Cox-2 signaling but isalso directly involved in the regulation of gene expres-sion. Zhao et al., (2007) observed reduced production ofPGE2 and VEGF level in treated Huh-7 cells, and sup-pressed HCC-associated angiogenesis in vitro and invivo using Cox-2 siRNA [20].Most of the studies are conducted in Huh-7 derived

cell lines and with replicons supporting HCV RNA tran-scription and protein synthesis. Recently, differentgroups have studied the HCV replication in seruminfected liver cell lines [17,36-39]. In order to confirmabove results, we infected Huh-7 cells with native viralparticles from HCV genotype 3a positive serum, themost prevalent type in Pakistan using already establishedprotocol [37,40]. Previously in our laboratory, Khaliq etal., 2010 infected Huh-7, HEK, MDBK and HeLa cellline with HCV 3a infected serum and observed thatMDBK and HeLa cell lines did not support HCV infec-tion [41].The current therapies against HCV have limited effi-

cacy due to the development of viral resistance andHCV high mutation rate. The problem of viral mutantscould be resolved by using a mixture of siRNAs againstdifferent sequences. Several studies have also demon-strated the feasibility of targeting host cellular and viralfactors involved in HCV infection as potential targetsfor therapy either alone or in combinations of both likeLamin A/C, Caspase-8, Hsp90 and HCV genes [42-47].The effect of HCV sera on the expression of Cox-2,iNOS and VEGF genes and their inhibition by siRNAagainst HCV Core and host gene Cox-2 was alsoobserved. The expression of Cox-2, iNOS and VEGFgenes both at mRNA and protein levels were found tobe more stimulated in Huh-7 cells infected with HCV3a serum as compared to HCV 1a (Data shown in Addi-tional file 1 and Additional file 4, Figure S3). Theseresults were consistent with our HCV Core over-expres-sion studies. We observed HCV replication in the Huh-7 cells through detection of 5’UTR by Real-Time PCRin cells at 3rd and 5th day post-infection and 92% reduc-tion with Csi27, 83% with COXsi and 95% inhibitionwhen both siRNAs were used (Figure 7). At the day 3rd

post infection, we observed that the decline of viral titerusing Core and Cox-2 siRNA in liver cells also reduced


of 13

the expression of Cox-2, pAkt, iNOS and VEGF. Zekriet al., has reported that siRNA against HCV Core and5’UTR effectively blocked HCV replication in seruminfected Huh-7 cells [40]. Many authors have observedand also correlated amino acid substitution in Core inHCV infected patient’s samples with steatosis, interferonresponse, insulin resistance and oxidative stress. HCVstructural proteins play a direct role in the developmentof liver steatosis and increase the risk of liver cancer intransgenic mice [48-50]. In transgenic mouse model,expressing HCV structural proteins produced profoundliver damage leading to hepatocellular carcinoma. Mor-iya et al., (1997) reported that transgenic mouse modelexpressing HCV Core protein showed hepatic tumor,lipid accumulation in 16 months old mice [51]. Trans-genic mice with steatosis displayed dysplastic growth ofcells evolving into tumor formation. Furthermore, trans-genic mice showed deposition of collagen and progres-sive fibrosis [52]. In our study, we observed highexpression of oxidative stress related genes in patientsinfected with HCV genotype 3a as compared to 1a. Infuture, the correlation of amino acid substitutions areneed to be address in transgenic mouse model or theother natural victim of HCV that is chimpanzee to con-firm our results and the full understanding of thepathogenesis.

ConclusionsIn conclusion, these studies for the first time suggest aninteraction of HCV 3a Core and Cox-2 in regulating thegenes involved in HCV pathogenesis which may providea better understanding for genome-specific mechanismsinvolved in disease progression regulating Cox-2, pAkt,iNOS, PGE2 and VEGF expression directly or indirectly.Another outcome of these studies is the viral titerreduction observed with combined gene silencing ofHCV Core and Cox-2, which support the idea of dualstrategy against both the viral and host genes to be apotent approach in the treatment of chronic hepatitis C.

MethodsPatient’s SamplesThe local HCV 3a and 1a patient’s serum samples used inthis investigation were collected from CAMB (Center forApplied Molecular Biology) Diagnostic Laboratory,Lahore, Pakistan after clinical diagnosis. ELISA and PCRpositive samples were stored at -80°C prior to RNAextraction. The genotyping and quantification was per-formed as previously described by Ahmad et al., (2010)[3]. None of the subjects had received antiviral therapy.Subjects with clinical evidence of HBV, diabetes and anyother type of cancer were excluded from study. The sub-ject population with chronic HCV infection, viral load >2×108 IU/ml of genotype 1a and 3a were included in this

study. Blood samples from three control and six HCVpositive patients for viral serum inoculations were takenand immediately stored at -20°C. For expression of oxida-tive stress related genes, three normal and six HCV posi-tive liver biopsies and their blood samples were alsocollected from Jinnah Hospital Lahore, Pakistan. Studywas approved from the Institutional Ethical Committeeand patient’s written consent was obtained.

RNA Isolation from Blood and Biopsy SamplesTotal RNA from liver biopsies was extracted by using Qia-gen RNeasy Mini kit (Qiagen, USA). For PBMCs, TRIzolreagent (Invitrogen, Carlsbad, CA) was used according tomanufacturer’s protocol. Briefly, first the white blood cells(PBMC) were separated from blood collected in anticoa-gulant (EDTA) tube. For the lysis of erythrocytes 900 μl ofRBC lysis solution (Gentra USA) was added in 300 μl ofwhole blood. The resulting mixture was incubated atroom temperature for 10 minutes and then, centrifuged at1000 rpm for 1 minute at 4°C. The same step was repeatedunless PBMC formed a tight white pellet at the bottom ofthe tube. Then Trizol reagent (Invitrogen, Carlsbad, CA)was used for the isolation of RNA from these cells accord-ing to manufacturer’s protocol.

Plasmid ConstructionViral RNA was isolated from thawed 100 μl serum ali-quots using Gentra RNA isolation kit (Gentra SystemPennsylvania, USA) according to the manufacturer’sinstructions. 100-200 ng extracted viral RNA was usedfor RT PCR using the SuperScript III one step RT-PCRsystem (Invitrogen). HCV complementary DNA (cDNA)encoding the full length Core protein (amino acid 1-191of HCV isolates of HCV 3a genotype) were amplifiedusing Core specific primers. The PCR conditions were94°C 3 min; 94°C 35 sec; 58°C 45 sec; 72°C 1 min for 35cycles and final extension at 72°C for 10 min. PCR pro-duct was cloned into pCR3.1 mammalian expressionplasmid with FLAG tag inserted at the 5’ end withrestriction sites EcoRV and Xba1 (Fermentas, USA).Similarly, The plasmid HFL (a kind gift provided by Dr.Zafar Nawaz University of Miami, USA) containing fulllength of HCV 1a was used as the template for PCR andlater cloning of HCV 1a Core in pCR3.1 mammalianexpression vector (Figure 1A). Sequencing was performedfor both expression plasmids by DNA Core facility atCAMB, Lahore, Pakistan. Accession number for HCV 3aCore sequences submitted to NCBI is EU266536.

Cell CultureHuh-7 cell line (kindly provided by Dr. Zafar Nawaz,University of Miami, USA) was maintained in 75 cm2

culture flasks (Iwaki, Japan) containing DMEM (SigmaAldrich, USA) supplemented with 100 μg/ml penicillin/


of 13

streptomycin, and 10% FBS as complete culture media(CCM) (Sigma Aldrich, USA), at 37°C with 5% CO2 .

The CCM was renewed every 3rd day and cells werepassaged every 4-5 days. Viable cells were counted using0.5% trypan blue (Sigma Aldrich, USA).

Transient TransfectionApproximately 5×105 Huh-7 cells were seeded into 6-well tissue culture plates, at 24 hrs prior to transfection.Huh-7 cells were transiently transfected with and with-out expression plasmids (0.4 μg) of HCV Core 1a and3a genotype in serum-free media using Lipofectamine™2000 (Invitrogen) according to the manufacturer’s proto-col. After 6 hours incubation at 37°C in 5% CO2, cellswere washed with 1× PBS and CCM was added to thecells. Cells were harvested at 48 hrs post-transfectionfor genes expression analysis by Real-Time PCR andwestern blot analysis.

Design and Synthesis of siRNAThe DNA sequencing facility at CAMB Lahore, Pakistancarried out sequencing of the Core gene of local HCV 3apatient’s from serum samples. These sequences werealigned using the software CLUSTAL_W option ofMEGA v.3.1. siRNA against HCV 3a Core and Cox-2were designed to the most conserved target region usingthe Ambion’s siRNA design tool http://www.ambion.com/techlib/misc/siRNA_tools.html (Table 1) and didnot show any homology to other known human genes. Anegative control siRNA (scrambled siRNA) was designedusing scrambled sequences (Table 1). siRNA weresynthesized using Ambion’s siRNA silencer kit accordingto the manufacturer’s instructions (Ambion, USA).

Viral InoculationHuh-7 cell line was used to establish the in vitro replica-tion of HCV. Cell culturing and viral inoculations wereconducted as published previously [37,40]. High viraltiter (> 1×108 IU/ml) from HCV 3a and 1a patient’s wasused as principle inoculums in these experiments. Huh-7 cells were maintained in 6-well culture plates, asdescribed above, to semi-confluence in CCM, washedtwice with serum-free medium, then inoculated with500 μl (5 × 107 IU/well) of HCV 3a and 1a infectedpatient sera and 400 μl serum free media. Cells weremaintained overnight at 37°C in 5% CO2. The next day,adherent cells were washed three times with 1× PBS,the CCM was added and incubation was continued foranother 48 hrs. Cells were harvested and viral RNA inHuh-7 cells assessed qualitatively by Real-Time PCR.

RNA InterferenceTo examine the effects of HCV Core and Cox-2 geneson cellular gene expression, cells were transfected with

Core and Cox-2 specific or scrambled siRNAs. Briefly,cells were seeded in 6-well (5×105/well) plates and cul-tured in CCM until they became 60-80% confluent.Cells were transiently transfected with 10, 20, 40 μM/well of specific siRNAs (Csi27, Csi352 and COXsi eitheralone or in combination) or scrambled siRNA alongwith 0.4 μg of HCV Core 3a in serum free media usingLipofectamine™ 2000 (Invitrogen) according to themanufacturer’s protocol. After 6 hrs incubation at 37°Cin 5% CO2, CCM was added to the cells. Cells werethen harvested for gene expression and protein analysisafter 48 hrs. Protein analysis was carried out for abovementioned experiments in 6-well plates.For HCV infected experiments, Huh-7 cells were

seeded in 6-well plates as described above and cellswere infected with HCV infected serum (see ViralInoculum section for details). To analyze the effect ofsiRNA on HCV infection, serum-infected Huh-7 cellswere seeded after three days of infection in 6 well platesand grown to 80% confluence with 2 ml of standardmedium. This was followed by transfection of infectedcells with or without 40 μM/well of Csi27 and COXsisiRNA either alone or in combination. Cells were

Table 1 Sequences of primers and target siRNAs

Primers used in vector construction

Core3a-sense ATGAGCACACTTCCTAAACC

Core3a-antisense CATGGCTGCTGGATGAATTA

3aCore-sense GCGATATCATGAGCACACTTCCTAAA

3aCore-antisense AATCTAGATCATGGCTGCTGGATGAAT

1aCore-sense GCGATATCAGCACGAATCCTAAAGGT

1aCore-antisense AATCTAGATTAGG CTGAAGCGGGCACGGT

Primers used in Real-Time PCR

RTp3.1-sense GGACGACGATGACAAGGACT

RT1a-antisense GGGGAGACAGGA GCCATC

RT3a-antisense GGCTGTGACCGTTCAGAAGT

Cox-2-sense AACCCACTCCAAACACAG

Cox-2-antisense CTGGCCCTCGCTTATGATCT

iNOS-sense CACCTTGGAGTTCACCCAGT

iNOS-antisense ACCA CTCGTACTTGGGATGC

VEGF-sense CTTGCCTTGCTGCTCTACC

VEGF-antisense CACACAGGATGGCTTGAAG

GAPDH-sense ACCACAGTCCATGCCATCAC

GAPDH-antisense TCCACCACCCTGTTGCTGTA

siRNAs used for silencing

Csi27-sense AAGGATGGTGTTTCTTTTGGTCCTGTCTC

Csi27-antisense AAACCAAAAGAAACACCATCCCCTGTCTC

Csi352-sense AAATCGATGACTTTACCCAAACCTGTCTC

Csi352-antisense AATTTGGGTAAAGTCATCGATCCTGTCTC

Scramble-sense AAGTCGAGTCGCGTATGCAGGCCTGTCTC

Scramble-antisense AACCTGCATACGCGACTCGACCCTGTCTC

COXsi-sense AATTATTTCTGAAACCCACTCCCTGTCTC

COXsi-antisense AAGAGTGGGTTTCAGAAATAACCTGTCTC


of 13

http://www.ambion.com/techlib/misc/siRNA_tools.html

http://www.ambion.com/techlib/misc/siRNA_tools.html

harvested and analyzed for gene expression analysis byReal-Time PCR and viral load determination asdescribed below.

Cell Proliferation Assay and PGE2 MeasurementsApproximately 2×103 Huh-7 cells were seeded into 96-well tissue culture plates for 24 hrs prior to transfec-tion. Huh-7 cells were transiently transfected with 0.1μg/well of HCV Core 1a and 3a plasmids with andwithout Core and Cox-2 siRNA in serum-free mediausing Lipofectamine™ 2000 (Invitrogen) according tothe manufacturer’s protocol. After 6 hrs incubation at37°C in 5% CO2, CCM was added to the cells. TheMTT colorimetric assay was performed to detect cellproliferation after 24 hrs and 48 hrs of incubation. Theabsorbance of resulting formazan crystals (solubilizedwith DMSO) was read at 590 nm on ELISA platereader. PGE2 levels were also determined in Huh-7cells using above cell culture/transfection conditionsand assayed with the Biotrak Prostaglandin E2 EnzymeImmunoassay system (Amersham Pharmacia Biotech,USA) according to the manufacturer’s protocol at 459nm wavelength.

Viral LoadViral RNA was isolated using Gentra RNA isolation kit(Gentra System Pennsylvania, USA) according to themanufacturer’s instructions. For viral quantificationSacace HCV quantitative analysis kit (Sacace Biotechnol-ogies Caserta, Italy) was used. Briefly, 10 μl of extractedviral RNA was mixed with an internal control derivedfrom 5’UTR provided by Sacace HCV Real TM Quantkit and subjected to viral quantification using Real-TimePCR Smart Cycler II system (Cepheid Sunnyvale, USA).For protein expression analysis at day 3rd of viral inocu-lation, cells were washed 3 times before harvesting andWestern blotting was performed.

Real-Time PCRFor gene expression analysis, total RNA from Huh-7cells transiently transfected with mock, HCV Core 1aand 3a was extracted using TRIzol Reagent (Invitro-gen, USA). cDNA was synthesized using 1 μg of totalRNA with SuperScript III Kit (Invitrogen, USA).Gene expression analysis was carried out using RealTime PCR ABI 7500 system (Applied Biosystems Inc,USA) with SYBR Green mix (Fermentas, Canada)using gene specific primers (see Table 1). PCR condi-tions were as follow: 95°C, 30 sec; 58°C, 30 sec andextension at 72°C for 45 sec, 40 cycles. The relativegene expression analysis was carried out using the“SDS 3.1 software” (provided by Applied BiosystemsInc, USA). GAPDH was used as internal control fornormalization.

Western BlottingTransfected and infected cells were lysed with Proteo-JET mammalian cell lysis reagent (Fermentas, Canada).Equal amounts of total proteins were subjected to elec-trophoresis on 12% SDS-PAGE and electrophoreticallytransferred to a nitrocellulose membrane using manu-facturer’s protocol (Bio-Rad, USA). Blots were incubatedwith specific-monoclonal antibodies of HCV Core, Cox-2, VEGF, p-Akt and GAPDH (Santa Cruz Biotechnology,Inc, USA). Proteins expression was evaluated using Che-miluminescence’s detection kit (Sigma Aldrich, USA).For protein quantifications X-ray films were scannedand fold inductions were calculated by densitometeranalysis.

Statistical AnalysisAll statistical analysis was performed by using SPSS soft-ware (version 16.0, SPSS Inc). Data are presented asmean ± SD. Numerical data were analyzed using stu-dent’s t-test and ANOVA. P value < 0.05 was consideredstatistically significant.

Additional material

Additional file 1: Supplemental Results. This file contains threeexperimental results as supporting data and has been mentioned in thetext.

Additional file 2: Figure S1. Silencing of host cellular gene, Cox-2show reduction in the expression of genes involved in HCVpathogenesis. Huh-7 cells were transfected with HCV-3a Core expressionvector or mock-treated along with or without 10 μM, 20 μM and 40 μMof Cox-2 siRNAs for 48 hrs. (A) Cox-2 siRNA (COXsi) reduced geneexpression of Core induced Cox-2 measured through semi-quantitativePCR. (B) Silencing of Cox-2 gene at protein expression level wasdetermined by Western blot analysis after 48 hrs transfection with mock(M), with and without siRNA (COXsi) and scramble siRNA (SC) in Huh-7cells. Protein levels for GAPDH gene are also shown as internal control.(C) Effect of silencing of Cox-2 gene on the relative gene expressionlevels quantified by Real-Time PCR 48 hrs post transfection are shown asfold induction for Cox-2/iNOS/VEGF genes. GAPDH was used as internalcontrol for normalization. Three independent experiments wereperformed having triplicate samples. Error bars indicate, mean S.D, *p <0.01 verses Core.

Additional file 3: Figure S2. Combined effect of Cox-2 and HCV 3aCore siRNAs on intracellular PGE2 production and the Huh-7 cellsproliferation. (A) Intracellular level of PGE2 was determined in Coretransfected cells with and without Core, Cox-2 and in combination ofboth siRNAs, using Biotrak prostaglandin Enzyme immunoassay systemaccording to manufacturer’s protocol. (B) Inhibition of Huh-7 cellsproliferation was observed in Core transfected cells with and withoutCore, Cox-2 and in combination of both siRNAs by using MTT assay.Three independent experiments were performed having triplicatesamples. Error bars indicate mean S.D, *#p < 0.001, *p < 0.01 verses Core.

Additional file 4: Figure S3. HCV 3a sera infection increasesexpression of genes involved in HCV pathogenesis as comparedwith HCV 1a sera. (A) Huh-7 cells were infected with high titer serasamples from HCV patients, either HCV-3a or HCV-1a genotype for 72 hrs.RNA expression levels as relative fold induction to normal sera are shownfor Cox-2, iNOS and VEGF genes. (B) The protein expression levels weredetermined by Western blot analysis from Huh-7 cell lysates infectedwith HCV-1a (S1a), 3a (S3a) serum compared to normal and effect onCox-2, VEGF and p-Akt expression using specific antibodies. Protein levels


of 13

http://www.biomedcentral.com/content/supplementary/1743-422X-8-155-S1.DOC

http://www.biomedcentral.com/content/supplementary/1743-422X-8-155-S2.BMP



for GAPDH gene are shown as internal control. Three independentexperiments with triplicate determinations were performed. Error barsindicate mean S.D, * p < 0.01 verses serum 1a.

List of abbreviationsHCV: Hepatitis C; RNAi: RNA interference; siRNAs: small interfering RNAs; HCC:hepatocellular carcinoma.

AcknowledgementsFinancial support by Higher Education Commission (Grant # 863) is highlyacknowledged.

Authors’ contributionsSJ, SK, BI, WA prepared, wrote manuscript and performed lab work. BI, WA,and SH prepared final version of manuscript. SH was also principalinvestigator and provides support and facilities to complete this work. Allauthors approved the manuscript.

Authors’ informationShah Jahan (PhD molecular Biology) and Saba Khaliq (PhD molecularBiology) are both PhD scholars, Bushra Ijaz (M Phil Molecular Biology) andWaqar Ahmad (M Phil Chemistry) are Research Officer, while Sajida Hassan(PhD Molecular Biology) is Principal Investigator at CEMB, University of thePunjab, Lahore.

Competing interestsThe authors declare that they have no competing interests.

Received: 1 December 2010 Accepted: 1 April 2011Published: 1 April 2011

References1. Giannini C, Brechot C: Hepatitis C virus biology. Cell Death Differ 2003, 10:

S27-S38.2. Raja NS, Janjua KA: Epidemiology of hepatitis C virus infection in

Pakistan. J Microbiol Immunol Infect 2008, 41:4-8.3. Ahmad W, Ijaz B, Javed FT, Jahan S, Shahid I, Khan FM, et al: HCV genotype

distribution and possible transmission risks in Lahore, Pakistan. World JGastroenterol 2010, 16:4321-4328.

4. Okuda M, Li K, Beard MR, et al: Mitochondrial injury, oxidative stress, andantioxidant gene expression are induced by hepatitis C virus coreprotein. Gastroenterology 2002, 122:568-57/1.

5. Moriya K, Fujie H, Shintani Y, Yotsuyanagi H, Tsutsumi T, Ishibashi K, et al:The core protein of hepatitis C virus induces hepatocellular carcinomain transgenic mice. Nat Med 1998, 4:1065-1067.

6. Tardif KD, Waris G, Siddiqui A: Hepatitis C virus, ER stress, and oxidativestress. Trends Microbiol 2005, 13:159-163.

7. Nunez O, Fernandez-Martinez A, Majano PL, Apolinario A, Gomez-Gonzalo M, Benedicto I, et al: Increased intrahepatic cyclooxygenase 2,matrix metalloproteinase 2, and matrix metalloproteinase 9expression is associated with progressive liver disease in chronichepatitis C virus infection: role of viral core and NS5A proteins. Gut2004, 53:1665-1672.

8. Koga H, Sakisaka S, Ohishi M, Kawaguchi T, Taniguchi E, Sasatomi K,et al: Expression of cyclooxygenase-2 in human hepatocellularcarcinoma: relevance to tumor dedifferentiation. Hepatology 1999,29:688-696.

9. Rahman MA, Kohno H, Nagasue N: COX-2 - a target for preventinghepatic carcinoma? Expert Opin Ther Targets 2002, 6:483-490.

10. Chiarugi V, Magnelli L, Gallo O: Cox-2, iNOS and p53 as play-makers oftumor angiogenesis. Int J Mol Med 1998, 2:715-719.

11. Cheng AS, Chan HL, To KF, Leung WK, Chan KK, Liew CT, et al:Cyclooxygenase-2 pathway correlates with vascular endothelial growthfactor expression and tumor angiogenesis in hepatitis B virus-associatedhepatocellular carcinoma. Int J Oncol 2004, 24:853-860.

12. Tang TC, Poon RT, Lau CP, Xie D, Fan ST: Tumor cyclooxygenase-2 levelscorrelate with tumor invasiveness in human hepatocellular carcinoma.World J Gastroenterol 2005, 11:1896-1902.

13. Leng J, Han C, Demetris AJ, Michalopoulos GK, Wu T: Cyclooxygenase-2promotes hepatocellular carcinoma cell growth through Akt activation:evidence for Akt inhibition in celecoxib-induced apoptosis. Hepatology2003, 38:756-768.

14. Testa JR, Bellacosa A: AKT plays a central role in tumorigenesis. Proc NatlAcad Sci USA 2001, 98:10983-10985.

15. Vivanco I, Sawyers CL: The phosphatidylinositol 3-Kinase AKT pathway inhuman cancer. Nat Rev Cancer 2002, 2:489-501.

16. Vidali M, Stewart SF, Albano E: Interplay between oxidative stress andimmunity in the progression of alcohol-mediated liver injury. Trends MolMed 2008, 14:63-71.

17. Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Pervais A, et al: Inhibition ofCore gene of HCV 3a genotype using synthetic and vector derivedsiRNAs. Virology J 2010, 7:318.

18. Idrees M, Rafique S, Rehman I, Akbar H, Yousaf MZ, Butt S, et al: Hepatitis Cvirus genotype 3a infection and hepatocellular carcinoma: Pakistanexperience. World J Gastroenterol 2009, 15:5080-5085.

19. Raza SA, Clifford GM, Franceschi S: Worldwide variation in the relativeimportance of hepatitis B and hepatitis C viruses in hepatocellularcarcinoma: a systematic review. Br J Cancer 2007, 96:1127-1134.

20. Tachi Y, Katano Y, Honda T, Hayashi K, Ishigami M, Itoh A, et al: Impact ofamino acid substitutions in the hepatitis C virus genotype 1b coreregion on liver steatosis and hepatic oxidative stress in patients withchronic hepatitis C. Liver Int 2009, 30:554-559.

21. Jackel-Cram C, Babiuk LA, Liu Q: Up-regulation of fatty acid synthasepromoter by hepatitis C virus core protein: genotype-3a core has astronger effect than genotype-1b core. J Hepatol 2007, 46:999-1008.

22. Zhao QT, Yue SQ, Cui Z, Wang Q, Cui X, Zhai HH, et al: Potentialinvolvement of the cyclooxygenase-2 pathway in hepatocellularcarcinoma-associated angiogenesis. Life Sci 2007, 80:484-492.

23. Bamba H, Ota S, Kato A, Kawamoto C, Fujiwara K: Prostaglandins up-regulate vascular endothelial growth factor production through distinctpathways in differentiated U937 cells. Biochem Biophys Res Commun 2000,273:485-491.

24. Gallo O, Franhi A, Magnelli L, Sardi I, Vannacci A, Boddi V, et al:Cyclooxygenase-2 pathway Correlates with VEGF expression in head andneck cancer. Implications for tumor angiogenesis and metastasis.Neoplasia 2001, 3:53-61.

25. Hu Z, Muroyama R, Kowatari N, Chang J, Omata M, Kato N: Characteristicmutations in hepatitis virus core gene related to the occurrence ofhepatocellular carcinoma. Cancer Sci 2009, 100:2465-2468.

26. Pazienza V, Vinciguerra M, Andriulli A, Mangia A: Hepatitis C Virus coreprotein genotype 3a increases SOCS-7 expression through PPAR-{gamma} in Huh-7 cells. J Gen Virol 2010, 91:1678-1686.

27. Hourioux C, Patient R, Morin A, Blanchard E, Moreau A, Trassard S, et al: Thegenotype 3-specific hepatitis C virus core protein residue phenylalanine164 increases steatosis in an in vitro cellular model. Gut 2007,56:1302-1308.

28. Jhaveri R, McHutchison J, Patel K, Qiang G, Diehl AM: Specificpolymorphisms in hepatitis C virus genotype 3 core protein associatedwith intracellular lipid accumulation. J Infect Dis 2008, 197:283-291.

29. Mann AE, Stanford S, Sherman EK: Prevalence of mutations in hepatitis Cvirus core protein associated with alteration of NF-kB activation. VirusResearch 2006, 121:51-57.

30. Nunez O, Fernandez-Martinez A, Majano PL, Apolinario A, Gomez-Gonzalo M, Benedicto I, Lopez-Cabrera M, Bosca L, Clemente G, Garcia-Monzon C, Martin-Sanz P: Increased intrahepatic cyclooxygenase, matrixmetalloproteinase, and matrix metalloproteinase expression isassociated with progressive liver disease in chronic hepatitis C Virusinfection: role of viral core and NS5A proteins. Gut 2004, 53:1665-1672.

31. Akuta N, Suzuki F, Hirakawa M, Kawamura Y, Yatsuji H, Sezaki H, et al:Amino acid substitutions in the hepatitis C virus core region ofgenotype 1b are the important predictor of severe insulin resistance inpatients without cirrhosis and diabetes mellitus. J Med Virol 2009,81:1032-1039.

32. Akuta N, Suzuki F, Sezaki H, Suzuki Y, Hosaka T, Someya T, et al: Associationof amino acid substitution pattern in core protein of hepatitis C virusgenotype 1b high viral load and non-virological response to interferon-ribavirin combination therapy. Intervirology 2005, 48:372-380.

33. Donlin MJ, Cannon NA, Yao E, Li J, Wahed A, Taylor MW, et al:Pretreatment sequence diversity differences in the full-length hepatitis C


of 13

http://www.ncbi.nlm.nih.gov/pubmed/12655344?dopt=Abstract


















































































virus open reading frame correlate with early response to therapy. J Virol2007, 81:8211-8224.

34. Kim M, Shin D, Kim SI, Park M: Inhibition of hepatitis C virus geneexpression by small interfering RNAs using a tri-cistronic full-length viralreplicon and a transient mouse model. Virus Res 2006, 122:1-10.

35. Liu M, Ding H, Zhao P, Qin ZL, Gao J, Cao MM, et al: RNA interferenceeffectively inhibits mRNA accumulation and protein expression ofhepatitis C virus core and E2 genes in human cells. Biosci BiotechnolBiochem 2006, 70:2049-2055.

36. Buck M: Direct infection and replication of naturally occurring hepatitis Cvirus genotypes 1, 2, 3 and 4 in normal human hepatocyte cultures.PLoS One 2008, 3:e2660.

37. el-Awady MK, Tabll AA, el-Abd YS, Bahgat MM, Shoeb HA, Youssef SS, et al:HepG2 cells support viral replication and gene expression of hepatitis Cvirus genotype 4 in vitro. World J Gastroenterol 2006, 12:4836-4842.

38. Lazaro CA, Chang M, Tang W, Campbell J, Sullivan DG, Gretch DR, et al:Hepatitis C virus replication in transfected and serum-infected culturedhuman fetal hepatocytes. Am J Pathol 2007, 170:478-489.

39. Molina S, Castet V, Pichard-Garcia L, Wychowski C, Meurs E, Pascussi JM,et al: Serum-derived hepatitis C virus infection of primary humanhepatocytes is tetraspanin CD81 dependent. J Virol 2008, 82:569-574.

40. Zekri AR, Bahnassy AA, El-Din HM, Salama HM: Consensus siRNA forinhibition of HCV genotype-4 replication. Virol J 2009, 6:13.

41. Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S: Inhibition of HCV 3agenotype by siRNAs targeting envelope genes. Arch Virol 2010,156(3):433-442.

42. Henry SD, van der WP, Metselaar HJ, Tilanus HW, Scholte BJ, van derLaan LJ: Simultaneous targeting of HCV replication and viral bindingwith a single lentiviral vector containing multiple RNA interferenceexpression cassettes. Mol Ther 2006, 14:485-493.

43. Korf M, Jarczak D, Beger C, Manns MP, Kruger M: Inhibition of hepatitis Cvirus translation and subgenomic replication by siRNAs directed againsthighly conserved HCV sequence and cellular HCV cofactors. J Hepatol2005, 43:225-234.

44. Nakagawa S, Umehara T, Matsuda C, Kuge S, Sudoh M, Kohara M: Hsp90inhibitors suppress HCV replication in replicon cells and humanized livermice. Biochem Biophys Res Commun 2007, 353:882-888.

45. Randall G, Grakoui A, Rice CM: Clearance of replicating hepatitis C virusreplicon RNAs in cell culture by small interfering RNAs. Proc Natl Acad SciUSA 2003, 100:235-240.

46. Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, et al: RNA interferencetargeting Fas protects mice from fulminant hepatitis. Nat Med 2003,9:347-351.

47. Zender L, Hutker S, Liedtke C, Tillmann HL, Zender S, Mundt B, et al:Caspase 8 small interfering RNA prevents acute liver failure in mice. ProcNatl Acad Sci USA 2003, 100:7797-7802.

48. Lemon SM, Lerat H, Weinman SA, Honda M: A transgenic mouse model ofsteatosis and hepatocellular carcinoma associated with chronic hepatitisC virus infection in humans. Trans Am Clin Climatol Assoc 2000,111:146-156.

49. Lerat H, Honda M, Beard MR, et al: Steatosis and liver cancer in transgenicmice expressing the structural and nonstructural proteins of hepatitis Cvirus. Gastroenterology 2002, 122:352-365.

50. Ohata K, Hamasaki K, Toriyama K, et al: Hepatic steatosis is a risk factor forhepatocellular carcinoma in patients with chronic hepatitis C virusinfection. Cancer 2003, 97:3036-3043.

51. Moriya K, Yotsuyanagi H, Shintani Y, Fujie H, Ishibashi K, Matsuura Y,Miyamura T, Koike K: Hepatitis C virus core protein induces hepaticsteatosis in transgenic mice. J Gen Virol 1997, 78:1527-1531.

52. Kato T, Miyamoto M, Date T, et al: Repeated hepatocyte injury promoteshepatic tumorigenesis in hepatitis C virus transgenic mice. Cancer Sci2003, 94:679-68.

doi:10.1186/1743-422X-8-155Cite this article as: Jahan et al.: Role of HCV Core gene of genotype 1aand 3a and host gene Cox-2 in HCV-induced pathogenesis. VirologyJournal 2011 8:155.

Submit your next manuscript to BioMed Centraland take full advantage of:

• Convenient online submission

• Thorough peer review

• No space constraints or color figure charges

• Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar

• Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit


of 13















































research open access role of hcv core gene of genotype 1a and 3a and host gene cox-2 ... · 2017....

Documents