A Bmi1-miRNAs Cross-Talk Modulates ChemotherapyResponse to 5-Fluorouracil in Breast Cancer CellsJiang Yin1☯, Guopei Zheng1☯, Xiaoting Jia1, Zhijie Zhang1, Weijia Zhang1, Ying Song1, Yan Xiong2, ZhiminHe1*

1 Cancer Research Institute and Cancer Hospital, Guangzhou Medical University, Guangzhou, Guangdong, P. R. China, 2 Department of Pharmacology,Guangzhou Medical University, Guangzhou, Guangdong, P. R. China

Abstract

The polycomb group transcriptional modifier Bmi1 is often upregulated in numerous cancers and is intensely involvedin normal and cancer stem cells, and importantly is as a prognostic indicator for some cancers, but its role in breastcancer remains unclear. Here, we found Bmi1 overexpression in 5-Fu (5-fluorouracil)-resistant MCF-7 cells(MCF-7/5-Fu) derived from MCF-7 breast cancer cells, MDA-MB-231 and MDA-MB-453 breast cancer cellscompared to MCF-7 cells, was related with 5-Fu resistance and enrichment of CD44+/CD24- stem cell subpopulation.Bmi1 knockdown enhanced the sensitivity of breast cancer cells to 5-Fu and 5-Fu induced apoptosis viamitochondrial apoptotic pathway, and decreased the fraction of CD44+/CD24- subpopulation. In addition, our analysisshowed inverse expression pattern between Bmi1 and miR-200c and miR-203 in selected breast cancer cell lines,and miR-200c and miR-203 directly repressed Bmi1 expression in protein level confirmed by luciferase reporterassay. MiR-200c and miR-203 overexpression in breast cancer cells downregulated Bmi1 expression accompaniedwith reversion of resistance to 5-Fu mediated by Bmi1. Inversely, Bmi1 overexpression inhibited miR-200cexpression in MCF-7 cells, but not miR-203, however ectopic wild-type p53 expression reversed Bmi1 mediatedmiR-200c downregulation, suggesting the repressive effect of Bmi1 on miR-200c maybe depend on p53. Thus, ourstudy suggests a cross-talk between Bmi1 and miR-200c mediated by p53, and Bmi1 interference would improvechemotherapy efficiency in breast cancer via susceptive apoptosis induction and cancer stem cell enrichmentinhibition.

Citation: Yin J, Zheng G, Jia X, Zhang Z, Zhang W, et al. (2013) A Bmi1-miRNAs Cross-Talk Modulates Chemotherapy Response to 5-Fluorouracil inBreast Cancer Cells. PLoS ONE 8(9): e73268. doi:10.1371/journal.pone.0073268

Editor: Ming Tan, University of South Alabama, United States of America

Received May 18, 2013; Accepted July 19, 2013; Published September 9, 2013

Copyright: © 2013 He et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This study was supported by grants from National Natural Science Foundation (81272450) of China. The funders had no role in study design,data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

* E-mail: Hezhimin2005@yahoo.com

☯ These authors contributed equally to this work.

Introduction

Breast cancer is the most frequently diagnosed cancer andthe leading cause of cancer death in females worldwide,accounting for 23% (1.38 million) of the total new cancer casesand 14% (458,400) of the total cancer deaths in 2008 [1].Today, although the improvement of breast cancer treatment,there are still more than 1.3 million worldwide are diagnosedwith breast cancer each year and nearly half-a-million womenstill die from this disease each year [2]. Current treatmentstrategies for breast cancer combine surgery withchemotherapy and/or radiotherapy and/or hormonal therapyand/or targeted therapy. However, it is estimated that one oftwo breast cancer patients will fail to respond to initialtreatments or will rapidly acquire resistance to un-surgerytreatments [3]. Moreover, the majority of cancer patients, even

if they show an initial response to chemotherapy drugs, willdevelop aggressive malignancies including metastasis andrelapse, which exhibit up to 90% resistance to one or moredrugs [4,5]. This intensely suggests that drug resistance,whether intrinsic or acquired over time, constitutes a majorhurdle to successful breast cancer treatment, leading toultimate cancer death. The underlying mechanisms of chemo-resistance are still poorly understood, although someresistance-related molecules have been identified based onestablished resistant-cellular models [6,7]. Several alternativebut not necessarily mutually exclusive hypotheses have beenproposed to explain this treatment failure and recurrence. Inparticular, it has been suggested that a small subpopulation ofcells within tumors, termed as “tumor-initiating cells” (TICs) or“cancer stem cells” (CSCs), may be resistant to chemotherapyand hence may reinitiate tumor growth after treatment [8]. And

PLOS ONE | www.plosone.org 1 September 2013 | Volume 8 | Issue 9 | e73268

there is increasing evidence that TICs or CSTs mediate tumorgrowth and metastasis and, by virtue of their intrinsicresistance to chemotherapy and radiation therapy, may alsocontribute to tumor recurrence [9]. In breast cancer, the CSCspopulation is defined as CD44+CD24- lineage subpopulation bysurface markers. In fact, chemotherapy in vitro or in vivo leadsto an increase in the number of CD44+CD24- CSCs andCD44+CD24- CSCs appears to be more relatively resistant tochemotherapy, which represents a potentially importantmechanism of acquired drug resistance in breast cancer[10,11,12]. So full understanding on CSCs may offer promisefor eliciting the mechanisms of intrinsic or acquired resistance,and may also reveal the molecular targets for revising theresistance.

In recent years, growing evidence demonstrate Bmi1 (Blymphoma mouse Moloney leukemia virus insertion region 1)plays a key role in regulating and maintaining proliferation andself-renewal for normal and cancer stem cells [13,14,15]. Bmi1is a member of the Polycomb (PcG) family of transcriptionalrepressors that mediate gene silencing by regulating chromatinstructure [16]. Bmi1 was first described as a proto-oncogenecooperating with c-Myc during the initiation of lymphomas[17,18]. Then, Bmi1 overexpression has been frequentlyobserved in a series of human cancers with diverse functionalroles, such as non-small cell lung cancer [19], myeloidleukemia [20] and nasopharyngeal carcinoma [21]. Bmi1 isnecessary for hepatic progenitor cell expansion and liver tumordevelopment [22] and for hedgehog pathway-drivenmedulloblastoma expansion [23]. In addition, Bmi1 canenhance CSCs function and tumorigenicity in pancreaticadenocarcinoma [24]. Some molecular mechanisms underlyingthe role of Bmi1 in cancer development or progression havebeen proposed, such as inhibition of the tumor suppressorsp16INK4a and p19ARF (p14ARF in humans) [25], and PTEN topromote EMT (epithelial-mesenchymal transition) andmalignancy [26]. However, the role of Bmi1 in breast cancerchemotherapy response or resistance remains unknown. Inorder to explore the mechanisms responsible for acquired drugresistance in breast cancer, we have established a 5-Furesistant-MCF-7 cell line (MCF-7/5-Fu) with typical EMT traitsderived from MCF-7 breast cancer cells in our previous study[27,28]. In the present study, will first determine the expressionpattern of Bmi1 in MCF-7/5-Fu and selected primary breastcancer cell lines, then investigate the role of Bmi1 in breastcancer drug resistance and the expression regulation of Bmi1-self.

Material and Methods

Cell cultureThe human breast cancer cell lines MCF-7, MDA-MB-231

and MDA-MB-453 and the stable 5-Fu-resistant cell lineMCF-7/5-Fu were cultured in RPMI-1640 (Gibco, Carlsbad, CA,USA) containing 10% fetal bovine serum (Gibco) at 37°C in ahumiditied atmosphere containing 5% CO2. To maintain theresistance phenotype, 1mg/L 5-Fu (sigma) was added to theculture media for MCF-7/5-Fu cells. The human embryonic

kidney cell line (HEK-293T) was cultured in DMEM (Gibco) with10% fetal bovine serum.

TransfectionBmi1 expression plasmid PMSCV-BMI1 was gifted from Dr.

Musheng Zeng (Sun Yat-Sen University Cancer Center, China)and short hairpin RNAs (shRNA) for Bmi1 knockdown plasmidspcDNA6.2-GW/EmGFP-shBmi1 were purchased fromnovobiosci (Shanghai, China). Cells were transfected withthese plasmids respectively with Lipofectamine 2000(Invitrogen) in accordance with the manufacturer’s instructionsin 24-well plate. 24h later, the cells were selected with 4µg/mlpuromycin and 8µg/ml Blasticidin respectively for 2 weeks andthe individual stable clones were analyzed with western blot.The miR-200c mimics and miR-203 expression vectorpSilencer2.1-U6-miR-203 were transfected in the 10mm dishby Lipofectamine 2000. Cells were harvested 72h later andfollowing experiments were performed.

MTS assayThe Cell Titer 96® AQueous One Solution Cell Proliferation

Assay kit (Promega, Madison, WI, USA) was used to determinethe sensitivity of cells to 5-Fu. In brief, cells were seeded in 96-well plates at a density of 4×103 cells/well (0.20ml/well) for 24 hbefore use. The culture medium was replaced with freshmedium containing 5-Fu with different concentrations for 72h.Then, MTS (0.02ml/well) was added. After 2 h furtherincubation, the absorbance at 490 nm of each well wasrecorded on the Biotex ELX800. Growth rate was calculated asthe ratio of the absorbance of the experimental well to that ofthe control well. The IC50 (the concentration of drug thatresults in 50% of control value) was also calculated.

Real-Time PCR for Mature miRNAs and mRNAsmiRNAs from cultured cells were isolated and purified with

miRNA isolation system (Exiqon). cDNA was generated withthe miScript II RT Kit (QIAGEN, Hilden, Germany) and thequantitative real-time PCR (qRT-PCR) was done by using themiScript SYBR Green PCR Kit (QIAGEN) following themanufacturer’s instructions. The miRNA sequence-specific RT-PCR primers and endogenous control RNU6 were purchasedfrom QIAGEN. The relative quantization expression wascalculated by normalizing with RNU6. Total RNA was extractedwith a Trizol protocol, and cDNAs from the mRNAs weresynthesized with the first-strand synthesis system (FermentasLife Science). Real-time PCRs were carried out according tothe standard protocol on ABI 7500fast with SYBR Greendetection (Fermentas SYBR green supermix). GAPDH wasused as an internal control and the qRT-PCR was repeatedthree times. The primers for Bmi1 and GAPDH were showedfollowed: for Bmi1, forward: 5-CCACCTGATGTGTGTGCTTTG-3 and Reverse: 5-TTCAGTAGTGGTCTGGTCTTGT-3; for GAPDH: forward: 5-ATTCCATGGCACCG-3 and reverse: 5-TTCTCCATGGTGGTGAAGACGCCA-3

Bmi1-miRNAs Cross-Talk in Chemo-Response

PLOS ONE | www.plosone.org 2 September 2013 | Volume 8 | Issue 9 | e73268

FACS AnalysisThe anti-CD44 (clone G44-26) and anti-CD24 (clone ML5)

antibodies used for FACS analysis were obtained from BDBioscience. Briefly, cells were incubated with trypsin–EDTAand dissociated. Cells were pelleted by centrifugation at 500 gfor 5 minutes at 4°C, resuspended in 100 µL of monoclonalmouse anti-human CD24-PE antibody and a monoclonalmouse anti-human CD44-APC antibody, and incubated for 20minutes at 4°C. The sorting was performed following themanufacturer’s instructions. Apoptosis induced by treatmentwith 100mg/L 5-Fu for 12h was assayed using an AnnexinV-FITC/PI Apoptosis Detection Kit (BD Pharmingen, USA)according to standard protocol with FACS analysis.

Subcellular fractionationAfter treatment, cells were washed with PBS-EDTA,

trypsined, and resuspended in mitochondrial buffer containing10 mM KCl, 0.15 mM MgCl2, 10 mM Tris-HCl pH7.6, 0.4 mMPMSF and 10 µM cytochalasin B. The cell suspensions wereincubated for 30 min and homogenized on ice at 4°C with 200strokes each in 250 mM sucrose, using a Dounce glasshomogenizer. The first centrifugation was at 800 g for 3 min at4°C to yield nuclei and unbroken cells as a pellet. Thesupernatant was centrifuged at 6,800 g for 10 min at 4°C andthe mitochondrial pellet was resuspended in mitochondrialbuffer. The cytosolic fraction was obtained as follows: cellswere resuspended in Cell Free System buffer (200mMmannitol,68mMsucrose, 2mMMgCl2, 2 mMNaCl, 2.5 mM KH2PO4, 0.5mM EGTA, 5 mM pyruvate, 1 mM DTT, 0.1 mM PMSF and 10mM HEPES-NaOH pH 7.4), subjected to 5 cycles of freezing/defrosting and centrifuged (150,000 g for 60 min at 4°C). Thesupernatant was kept and then submitted to western blotassay.

Western blot assayCells were collected and incubated with cell lysis buffer for

20min at 4°C. Equal amount protein was added to an SDS-PAGE GEL. After electrophoresis, protein bands weretransferred to PVDF membrane, blocked overnight with Tris-buffered contained 1% Tween-20 and 5% nonfat milk at 4°C.Primary antibodies used were listed as follow, p53 (cellsignaling technology 1:1000); Bmi1(cell signaling technology1:2000); cleaved-caspase7 (cell signaling technology 1:1000);cleaved-caspase9 (cell signaling technology 1:1000); β-actin(cell signaling 1:4000); Bcl-2(Santa Cruz biotechnology1:500); Bax (Santa Cruz biotechnology 1:500). 50 microgramstotal protein were loaded and separated in 10% SDS-PAGE.Anti-mouse and anti-rabbit second antibodies were purchasedfrom Merck (Merck KGaA, Darmstadt, Germany). The signalwas detected using the chemiluminescent detection system asdescribed by the manufacturer.

Luciferase reporter assayFour single strands of the wild type 3’ UTR with miR-200c

and miR-203 binding sites and four single strands of the mutanttype with 7 bases deleted in the miR-200c and miR-203 bindingsites (as mutant control) respectively, of Bmi1 were

synthesized with restriction sites for SpeI and HindIII located atboth ends of the oligonucleotides for further cloning. The singlestrand DNA sequences were following: the wild type 3’ UTR ofBmi1 for miR-200c (Sense: 5’-CTAGTATTGGTATATGACATAACAGGAAACAGTATTGTATGATATATTTATAAATGCTATA-3’; antisense: 5’-AGCTTATAGCATTTATAAATATATCATACAATACTGTTTCCTGTTATGTCA TATACCAATA-3’) and the mutated type 3’ UTRof Bmi1 for miR-200c (Sense: 5’-CTAGTATTGGTATATGACATAACAGGAAA-------GTATGATATATTTATAAATGCTATA-3’; antisense: 5’-AGCTTATAGCATTTATAAATATATCATAC-------TTTCCTGTTATGTCATATACCAATA-3’); the wild type 3’ UTRof Bmi1 for miR-203 (Sense: 5’-CTAGTGTATGGGAAAATTGTAGCTAAACATTTCATTGTCCCCAGTCTGCAAAAGAAGCAA-3’; antisense: 5’-AGCTTTGCTTCTTTTGCAGACTGGGGACAATGAAATGTTTAGCTACAATTTTCCCATACA-3’ the mutated type 3’ UTR ofBmi1 for miR-203 (sense: 5’-CTAGTGTATGGGAAAATTGTAGCTAAA-------TTGTCCCCAGTCTGCAAAAGAAGCAA-3’; antisense: 5’-AGCTTTGCTTCTTTTGCAGACTGGGGACAA-------TTTAGCTACAATTTTCCCATACA-3’). The correspondingsense and antisense strands were annealed and subsequentlycloned into pMir-Report plasmid downstream of fireflyluciferase reporter gene. Cells were seeded in 96 well-platesand co-transfected with pMir-Report luciferase vector, pRL-TKRenilla luciferase vector and miR-200c mimics or miR-203expression vector. 48h later the luciferase activities weredetermined using a Dual-Luciferase Reporter Assay System(Promega) where the Renilla luciferase activity was used asinternal control and the firefly luciferase activity was calculatedas the mean ± SD after being normalized by Renilla luciferaseactivity.

Co-immunoprecipitation assayCo-immunoprecipitation assay was performed followed the

manual protocol. Briefly, the cells were lysed. Total protein wasobtained from MCF7 cells. The immunoprecipitations wereperformed overnight at 4 °C with antibodies to Bmi1 or IgG (asa control). The immunopreciptates were then incubated for 2hwith protein G-agarose (Promega, USA). Products werewashed with lysis buffer, and the immune complexes wereresolved by SDS-PAGE. Western blot assay weresubsequently performed.

Statistical analysisEach experiment was repeated three times. Statistical

analysis was carried out using SPSS 16.0. Student’s t-test waschosen to analyze the statistical difference. Results werepresented as mean±SD. P<0.05 was considered statisticallysignificant.

Bmi1-miRNAs Cross-Talk in Chemo-Response

PLOS ONE | www.plosone.org 3 September 2013 | Volume 8 | Issue 9 | e73268

Results

Bmi1 contributes to resistance to 5-Fu and BCSCstraits maintain in breast cancer cells

To elucidate the role of Bmi1 in breast cancer cells, we firstused real-time PCR and western blot to determine Bmi1expression in MCF-7, MCF-7/5-Fu, MDA-MB-231 and MDA-MB-453 breast cancer cells with differential sensitivity to 5-Fu.As showed in Figure 1A, there was no significant differentialexpression of Bmi1 in mRNA levels between selected cell lines;however, Bmi1 protein was overexpressed in MCF-7/5-Fu,MDA-MB-231 and MDA-MB-453 cells compared to MCF-7cells. Consistently, survival-concentration curves andcalculated IC50 values showed MCF-7/5-Fu, MDA-MB-231 andMDA-MB-453 cells are more resistant to 5-Fu (Figure 1B). Toconfirm the role of Bmi1, gain-of-function and loss-of-functionapproaches with Bmi1 overexpression vector and Bmi1-targeting-shRNA expression vectors were used, and 2#shRNAhad the most effect and was selected for following experiments(Figure 1C). We found ectopic expression of Bmi1 enhancedMCF-7 resistant to 5-Fu, and Bmi1 knockdown with shRNAsensitized MCF-7/5-Fu, MDA-MB-231 and MDA-MB-453 cellsto 5-Fu (Figure 1D). Expectedly, we observed Bmi1 enrichedbreast cancer stem cell CD44+/CD24- subpopulation in MCF-7cells. However, Bmi1 knockdown declined CD44+/CD24-

subpopulation in MCF-7/5-Fu, MDA-MB-231 and MDA-MB-453cells lines (Figure 1E). But Bmi1 had no significant effect oncell phenotype change. These results strongly implied intenseassociation between Bmi1 and resistance to 5-Fu and CSCsenrichment in breast cancer cells.

Bmi1 repressed apoptosis induced by 5-Fu throughmitochondrial apoptotic pathway in breast cancer cells

As showed above, Bmi1 can mediate breast cancer cellsresistant to 5-Fu, but the molecular mechanisms remainsunclear. The antiapoptotic activity was measured via V-FITC/PIApoptosis Detection Kit using Flow Cytometry. After beingtreated with 100mg/L 5-Fu for 12h, despite increased apoptosisin all selected cell lines, the apoptotic rate of MCF-7 was muchhigher than that of ectopic Bmi1 overexpressed MCF-7 cellsand apoptotic rate of cell lines with Bmi1 knockdown was muchhigher than that of controlled cell lines, so as the total celldeath rate (Figure 2A). In regard to apoptotic mechanism, wethen focused on mitochondrial apoptotic pathway whetherchanged by Bmi1. We found Bmi1 positively regulated Bcl2expression and the inverse relationship between Bmi1 and Baxexpression also was observed (Figure 2B). Furthermore, wefound Bmi1 was inversely related with cytochrome-C releaseand casepase9 and caspase7 activation after 100mg/L 5-Futreatment on selected cell lines for 24h (Figure 2C and D),suggesting Bmi1 affect the mitochondrial apoptotic pathwayinduced by 5-Fu in breast cancer cells.

MiR-200c and miR-203 directly target Bmi1 expressionBecause of the important role of Bmi1 in drug resistance and

comparable overexpression of Bmi1 in breast cancer cells withcomparable more resistant to 5-Fu, the exploration ofmechanisms responsible for Bmi1 expression seems extremely

necessary. There was no differential mRNA expression inselected cell lines (Figure 1A), so we focused on miRNAswhich usually bind to the 3′-untranslated region (3′UTR) oftarget mRNA, leading to translational repression. Thebioinformatic analysis using the public database-TargetScan(http://www.targetscan.org) combined with differentialexpression miRNAs screen using miRNA microarray betweenMCF-7 and MCF-7/5-Fu cells (data not shown) suggestedmiR-200c and miR-203 maybe target Bmi1, because Bmi1possessed critically conserved nucleotides indicative of alegitimate target of miR-200c and miR-203 (Figure 3A).Accordingly, miR-200c and miR-203 were significantlydownregulated in MCF-7/5-Fu, MDA-MB-231 and MDA-MB-453 cell lines compared to MCF-7 cells (Figure 3B). Both40nM miR-200c mimics and pSilencer2.1-U6-miR-203 vectorsignificantly increased miR-200c and miR-203 expressionrespectively (Figure 3C). Expectedly, miR-200c and miR-203overexpression effectively inhibited Bmi1 protein in MCF-7/5-Fu, MDA-MB-231 and MDA-MB-453 cells respectively (Figure3D). To assess whether miR-200c or miR-203 directlyregulates Bmi1 expression through target the binding site in the3’ UTR of Bmi1 mRNA, a luciferase reporter vector with theputative Bmi1 3’ UTR target site for miR-200c or miR-203downstream of the luciferase gene (pMir-Bmi1-Wt) and mutantversion thereof with a deletion of nucleotieds in the seed regionwas constructed (pMir-Bmi1-Mut). HEK293T cells were co-transfected with Luciferase reporter vector, pRL-TK Renillaluciferase vector and miR-200c mimics or miR-203 expressionvector or control. These results showed miR-200c and miR-203can reduce the luciferase activity of the vector with the wild-type Bmi1 3’ UTR by 65% and 53%, but the mutant versionabrogated the repressive ability of miR-200c and miR-203respectively (Figure 3E and F). These results stronglydemonstrated the specificity of miR-200c and miR-203targeting Bmi1.

Bmi1 feedback inhibits miRNA200c through p53modulation

In the present study, low expression of miR-200c andmiR-203 contributed to overexpression of Bmi1, however,whether Bmi1 feedback inhibits miR-200c and miR-203expression to form a stable regulatory loop remains to bestudied. To address the question, we detected the expressionof miR-200c and miR-203 in Bmi1 interfered breast cancercells. We found ectopic overexpression of Bmi1 downregulatedmiR-200c expression in MCF-7 cells but not miR-203 and Bmi1knockdown upregulated miR-200c but not miR-203 in MCF-7/5-Fu, MDA-MB-231 and MDA-MB-453 cells (Figure 4A). Changeet al. have reported p53 could positively regulate miR-200cexpression at transcriptional level [27]. Coincidently, p53 wasdownregulated in MCF-7/5-Fu cells compared to MCF-7 cellspossessing wild-type p53 (Figure 4B). To ascertain whetherp53 regulates miR-200c expression in breast cancer cells, aseries of experiments were performed. As shown, ectopicexpression of wild-type p53 (WTp53) with pEGFP-N1-p53vector (Figure 4B) upregulated miR-200c expression in MCF-7and MCF-7/5-Fu cells and effectively restored Bmi1 inducedmiR-200c inhibition in MCF-7 cells (Figure 4C). Moreover,

Bmi1-miRNAs Cross-Talk in Chemo-Response

PLOS ONE | www.plosone.org 4 September 2013 | Volume 8 | Issue 9 | e73268

Figure 1. Bmi1 expression pattern and its role in 5-Fu resistance in breast cancer cells. (A) mRNA (up) and protein (down)expression levels of Bmi1 in selected breast cancer cells; (B) Dose-survival index curves (up) were plotted from MTS assay resultsfrom three independent experiments and IC50 values (down) for 5-Fu were calculated in selected cell lines with differentailexpression of Bmi1, vs MCF-7, * p<0.05, ** p<0.01; (C) MDA-MB-231 cell line was selected for verifying the knockdown efficianceyof Bmi1 specific shRNAs; (D) Dose-survival index curves (left) were plotted from MTS assay results from three independentexperiments and IC50 values (right) for 5-Fu were calculated in ectopic Bmi1 overexpressed or Bmi1 knockdown cell lines, vscontrol, * p<0.05; (E) FACS analysis of cell-surface marker CD44 and CD24 in cell lines to indicate the breast cancer stem cellsubpopulation.doi: 10.1371/journal.pone.0073268.g001

Bmi1-miRNAs Cross-Talk in Chemo-Response

PLOS ONE | www.plosone.org 5 September 2013 | Volume 8 | Issue 9 | e73268

Figure 2. Bmi1 affects the mitochondrial apoptotic pathway in breast cancer cells. (A) Effects of 100mg/L on selected celllines with different Bmi1 expression level. After exposure to 100mg/L 5-Fu for 12h, cells were harvested and cell death weremeasured with Apoptosis Detection Kit and each figures represents three independent experiments; (B) Western blot showed thereverse relationship between Bmi1 and apoptosis related molecules Bcl2 and Bax in selected cell lines; (C) Western blot showedcytochrome-C (Cyto-C) release and Caspase 9 and Caspase 7 activation after 100mg/L 5-Fu treatment on selected cell lines; (D)Effect of Bmi1 on 5-Fu-induced caspase 9 and caspase 7 activation on selected cell lines. The relative activation of caspase 9 andcaspase 7 was calculated from the average of three experiments, versus control, * p<0.05, ** p<0.01.doi: 10.1371/journal.pone.0073268.g002

Bmi1-miRNAs Cross-Talk in Chemo-Response

PLOS ONE | www.plosone.org 6 September 2013 | Volume 8 | Issue 9 | e73268

ectopic expression of wild-type p53 also exactly upregulatedmiR-200c expression in MDA-MB-231 and MDA-MB-453 celllines, both of which posses mutational p53 and so GFP screenunder fluorescence microscope used to monitor WTp53expression after transfection (Figure 4D and E). To verify Bmi1regulates miR-200c expression via p53 modulation, we foundectopic expression of Bmi1 factually led to p53 proteindecrease in MCF-7 cells and Bmi1 knockdown led to p53protein accumulation in MCF-7/5-Fu cells (Figure 4F).

Furthermore, coimmunoprecipitation experiment showed p53was detected in the anti-Bmi1 immunoprecipitation complex(Figure 4G), implying Bmi1 maybe mediate p53 downregulationin wild-type p53 breast cancer cells to inhibit miR-200cexpression.

Figure 3. miR-200c and miR-203 target Bmi1 expression. (A) Schematic of predicted miR-200c and miR-203 sites in the humanBmi1 3′UTR broadly conserved among vertebrates; (B) miR-200c and miR-203 expression status in selected cell lines, verse MCF-7* p<0.01; (C) miR-200c mimics and miR-203 expression vector increased miR-200c and miR-203 expression, verse control *p<0.01; (D) Inverse relationship between miR-200c and miR-203 and Bmi1 protein levels was showed; (E) and (F) Mir-200c andmiR-203 suppressed the activity of the luciferase gene linked by the 3′UTR of Bmi1 respectively and a Renilla luciferase reporter fornormalization. The data was obtained from three independent experiments. The mean of the results from 293T cells transfected withpMir-control and miR-200c mimics or pSlience-miR-203 were set as 1.0 respectively, * p<0.01.doi: 10.1371/journal.pone.0073268.g003

Bmi1-miRNAs Cross-Talk in Chemo-Response

PLOS ONE | www.plosone.org 7 September 2013 | Volume 8 | Issue 9 | e73268

Figure 4. Bmi1 inhibits miR-200c expression via p53 downregulation. (A) the inverse expression pattern between Bmi1 andmiR-200c was showed; (B) p53 protein was downregulated in MCF-7/5-Fu cells, and pEGFP-N1-WTp53 transfection increased p53protein in MCF-7 and MCF-7/5-Fu cells, respectively; (C) WTp53 upregulated miR-200c expression and restored Bmi1 mediatedmiR-200c downregulation; (D) GFP screen under fluorescence microscope to monitor ectopic WTp53 expression; (E) Ectopicexpression of WTp53 upregulated miR-200c in MDA-MB-231 and MDA-MB-453 with mutational p53; (F) Bmi1 negatively regulatedp53 protein expression; (G) coimmunoprecipitation showed Bmi1 interacted with p53 physically. All data was obtained from threeindependent experiments * p<0.05, * p<0.01.doi: 10.1371/journal.pone.0073268.g004

Bmi1-miRNAs Cross-Talk in Chemo-Response

PLOS ONE | www.plosone.org 8 September 2013 | Volume 8 | Issue 9 | e73268

Discussion

Chemotherapy resistance has being the major obstacle foreffective breast cancer treatment. However, the mechanismsresponsible for chemotherapy resistance is far from fullunderstand. In order to explore the mechanisms responsible foracquired drug resistance in breast cancer, in our previousstudy, we have established a 5-Fu resistant-MCF-7 cell line(MCF-7/5-Fu) which shows typical EMT traits derived fromMCF-7 breast cancer cells [28,29]. EMT process is usuallyaccompanied with stem cell traits, so we suppose whetherBmi1 participates in the drug resistance maintain because of itsimportant role in normal and cancer stem cells. In the presentstudy, MCF-7, MCF-7/5-Fu, MDA-MB-231 and MDA-MB-453cell lines with different resistance potential to 5-Fu wereemployed as research model to investigate the role of Bmi1 indrug resistance in breast cancer. Here, we showed the inverseBmi1 expression pattern and 5-Fu effect and CD44+/CD24-

breast cancer stem cell population. In addition, Bmi1knockdown sensitized breast cancer cells to 5-Fu via enhancedmitochondrial apoptotic pathway activation with Bcl2downregulation and Bax upregulation and subsequentcytochrome-C release and caspase 9 and caspase 7 activationafter 5-Fu treatment.

As for the expression regulation of Bmi1-self, we focused onmiRNAs which usually elicit their regulatory effects in post-transcriptional regulation of genes by binding to the 3′-untranslated region (3′UTR) of target messenger RNA (mRNA),mainly leading to translational repression or target mRNAdegradation [30]. Biologically and clinically, a large amount ofliteratures have reported the important role of miRNAs inchemotherapy resistance [31,32]. Specific miRNAs havealtered expression in drug-resistant cancer cells. For example,miR-34a was downregulated in drug resistant prostate cancercells and ectopic expression of miR-34a resulted in growthinhibition and sensitized cells to camptothecin [33].Furthermore, miRNAs also modulate the EMT (Epithelial-mesenchymal transition) process and cancer stem cell programto influence the chemotherapy response to cancer treatment.Such as, Adam et al. showed miR-200 regulated EMT inbladder cancer cells and reversed resistance to EGFR inhibitortherapy [34]. Expectedly, our analysis demonstrated bothmiR-200c and miR-203 could directly target Bmi1 expression inbreast cancer cells. MiR-200c mediated Bmi1 regulation wasconsistent with published reports, but miR-203 as Bmi1regulator was identified by us for the first time [35]. Loss of

miR-200c expression has been linked with cancer progressionand chemotherapy resistance via EMT process and CDCsregulation [36,37]. Resent findings also strongly suggest loss ofmiR-200c expression contribute to drug resistance [38].Emerging evidences suggest the implication of miR-203expression loss in cancers, such as cancer cell proliferation,invasion and drug resistance [39,40,41], but the exactmechanism is still unclear. Here, our results showed miR-203targeted Bmi1 to elicit its role in breast cancer drug resistance.Interestingly, we found Bmi1 inhibited miR-200c expression,but not miR-203. Chang et al have reported p53 couldpositively regulate miR-200c [27], and here ectopic wild-typep53 expression factually upregulated miR-200c expression inselected cell lines and restored Bmi1 mediated miR-200cexpression inhibition. Recent study showed Bmi1 could lead top53 protein downregulation via interaction mediateddegradation [42]. Here, the inverse expression pattern of Bmi1and wild-type p53 protein also was showed andcoimmunoprecipitation assay showed the physical interaction,confirming the relationship. However, Bmi1 knockdwon alsorestored miR-200c expression in MDA-MB-231 and MDA-MB-453 cell lines with mutational p53, suggesting some othermechanisms responsible for Bmi1 mediating miR-200cregulation context dependently, which will be explored in ourfurther study. As for expression regulation of miR-203, Zhang[43] et al have found the promoter hypermethylationresponsible for miR-203 downregulation in metastatic breastcancer cell lines. However, whether promoter methylation isinvolved in miR-203 expression regulation in acquired anti-cancer drug –resistant breast cancer cells requires furtherinverstigation. Furthermore, the details on how Bmi1 regualtedBCSCs mediate chemotherapy response also require furtherexploration.

Collectively, here we showed the important role of Bmi1 inbreast cancer drug resistance and Bmi1-miRNAs cross-talkpartially maintained the high expression of Bmi1. The presentdata implies new potential strategy with Bmi1 interference topromote the effect of chemotherapy for breast cancer.

Author Contributions

Conceived and designed the experiments: ZH JY GZ.Performed the experiments: JY XJ WZ. Analyzed the data: JYZZ YS. Contributed reagents/materials/analysis tools: ZH YX.Wrote the manuscript: JY GZ.

References

1. Jemal A, Bray F, Center MM, Ferlay J, Ward E et al. (2011) Globalcancer statistics. CA Cancer J Clin 61: 69-90. doi:10.3322/caac.20107.PubMed: 21296855.

2. Grayson M (2012) Breast cancer. Nature 485: S49-S49. doi:10.1038/485S49a. PubMed: 22648496.

3. O’Driscoll L, Clynes M (2006) Biomarkers and multiple drug resistancein breast cancer. Curr Cancer Drug Targets 6: 365-384. doi:10.2174/156800906777723958. PubMed: 16918307.

4. Ellis LM, Hicklin DJ (2009) Resistance to targeted therapies: refininganticancer therapy in the era of molecular oncology. Clin Cancer Res15: 7471-7478. doi:10.1158/1078-0432.CCR-09-1070. PubMed:20008847.

5. Sorrentino A, Liu C-G, Addario A, Peschle C, Scambia G et al. (2008)Role of microRNAs in drug-resistant ovarian cancer cells. GynecolOncol 111: 478–486. doi:10.1016/j.ygyno.2008.08.017. PubMed:18823650.

6. Iwasa Y, Nowak MA, Michor F (2006) Evolution of resistance duringclonal expansion. Genetics 172: 2557-2566. PubMed: 16636113.

7. Lee AJ, Endesfelder D, Rowan AJ, Walther A, Birkbak NJ et al. (2011)Chromosomal instability confers intrinsic multidrug resistance. CancerRes 71: 1858-1870. doi:10.1158/0008-5472.CAN-10-3604. PubMed:21363922.

8. Dick JE (2008) Stem cell concepts renew cancer research. Blood 112:4793-4807. doi:10.1182/blood-2008-08-077941. PubMed: 19064739.

Bmi1-miRNAs Cross-Talk in Chemo-Response

PLOS ONE | www.plosone.org 9 September 2013 | Volume 8 | Issue 9 | e73268

9. Eyler CE, Rich JN (2008) Survival of the fittest: cancer stem cells intherapeutic resistance and angiogenesis. J Clin Oncol 26: 2839-2845.doi:10.1200/JCO.2007.15.1829. PubMed: 18539962.

10. Li X, Lewis MT, Huang J, Gutierrez C, Osborne CK et al. (2008)Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy.J Natl Cancer Inst 100: 672-679. doi:10.1093/jnci/djn123. PubMed:18445819.

11. Li Q-Q, Xu J-D, Wang W-J, Cao X-X, Chen Q et al. (2009) Twist1-mediated adriamycin-induced epithelial-mesenchymal transition relatesto multidrug resistance and invasive potential in breast cancer cells.Clin Cancer Res 15: 2657-2665. doi:10.1158/1078-0432.CCR-08-2372.PubMed: 19336515.

12. Creighton CJ, Li X, Landis M, Dixon JM, Neumeister VM et al. (2009)Residual breast cancers after conventional therapy displaymesenchymal as well as tumor-initiating features. Proc Natl Acad SciUSA 106: 13820-13825. doi:10.1073/pnas.0905718106. PubMed:19666588.

13. Sauvageau M, Sauvageau G (2010) Polycomb group proteins: multi-faceted regulators of somatic stem cells and cancer. Cell Stem Cell 7:299-313. doi:10.1016/j.stem.2010.08.002. PubMed: 20804967.

14. Siddique HR, Saleem M (2012) Role of BMI1, a stem cell factor, incancer recurrence and chemoresistance: preclinical and clinicalevidences. Stem Cells 30: 372-378. doi:10.1002/stem.1035. PubMed:22252887.

15. Cao L, Bombard J, Cintron K, Sheedy J, Weetall ML et al. (2011) BMI1as a novel target for drug discovery in cancer. J Cell Biochem 112:2729-2741. doi:10.1002/jcb.23234. PubMed: 21678481.

16. Pirrotta V (1998) Polycombing the genome: PcG, trxG, and chromatinsilencing. Cell 93: 333–336. doi:10.1016/S0092-8674(00)81162-9.PubMed: 9590168.

17. Haupt Y, Alexander WS, Barri G, Klinken SP, Adams JM (1991) Novelzinc finger gene implicated as myc collaborator by retrovirallyaccelerated lymphomagenesis in E mu-myc transgenic mice. Cell 65:753-763. doi:10.1016/0092-8674(91)90383-A. PubMed: 1904009.

18. van Lohuizen M, Verbeek S, Scheijen B, Wientjens E, van der GuidonH et al. (1991) Identification of cooperating oncogenes in Eμ- myctransgenic mice by provirus tagging. Cell 65: 737-752. doi:10.1016/0092-8674(91)90382-9. PubMed: 1904008.

19. Vonlanthen S, Heighway J, Altermatt HJ, Gugger M, Kappeler A et al.(2001) The bmi-1 oncoprotein is differentially expressed in non-smallcell lung cancer and correlates with INK4A-ARF locus expression. Br JCancer 84: 1372–1376. doi:10.1054/bjoc.2001.1791. PubMed:11355949.

20. Sawa M, Yamamoto K, Yokozawa T, Kiyoi H, Hishida A et al. (2005)BMI-1 is highly expressed in M0-subtype acute myeloid leukemia. Int JHematol 82: 42-47. doi:10.1532/IJH97.05013. PubMed: 16105758.

21. Song LB, Zeng MS, Liao WT, Zhang L, Mo HY et al. (2006) Bmi-1 is anovel molecular marker of nasopharyngeal carcinoma progression andimmortalizes primary human nasopharyngeal epithelial cells. CancerRes 66: 6225–6232. doi:10.1158/0008-5472.CAN-06-0094. PubMed:16778197.

22. Fan L, Xu C, Wang C, Tao J, Ho C et al. (2012) Bmi1 is required forhepatic progenitor cell expansion and liver tumor development. PLOSONE 7: e46472. doi:10.1371/journal.pone.0046472. PubMed:23029524.

23. Michael LE, Westerman BA, Ermilov AN, Wang AQ, Ferris J et al.(2008) Bmi1 Is Required for Hedgehog Pathway-DrivenMedulloblastoma Expansion. Neoplasia 10: 1343-U1328. PubMed:19048113.

24. Proctor E, Waghray M, Lee CJ, Heidt DG, Yalamanchili M et al. (2013)Bmi1 enhances tumorigenicity and cancer stem cell function inpancreatic adenocarcinoma. PLOS ONE 8: e55820. doi:10.1371/journal.pone.0055820. PubMed: 23437065.

25. Smith KS, Chanda SK, Lingbeek M, Ross DT, Botstein D et al. (2003)Bmi-1 regulation of INK4A-ARF is a downstream requirement fortransformation of hematopoietic progenitors by E2a-Pbx1. Mol Cell 12:393-400. doi:10.1016/S1097-2765(03)00277-6. PubMed: 14536079.

26. Song LB, Li J, Liao WT, Feng Y, Yu CP et al. (2009) The polycombgroup protein Bmi-1 represses the tumor suppressor PTEN andinduces epithelial-mesenchymal transition in human nasopharyngeal

epithelial cells. J Clin Invest 119: 3626-3636. doi:10.1172/JCI39374.PubMed: 19884659.

27. Chang CJ, Chao CH, Xia W, Yang JY, Xiong Y et al. (2011) p53regulates epithelial-mesenchymal transition and stem cell propertiesthrough modulating miRNAs. Nat Cell Biol 13: 317-323. doi:10.1038/ncb2173. PubMed: 21336307.

28. Zheng G, Peng F, Ding R, Yu Y, Ouyang Y et al. (2010) Identification ofproteins responsible for the multiple drug resistance in 5-fluorouracil-induced breast cancer cell using proteomics analysis. J Cancer ResClin Oncol 136: 1477-1488. doi:10.1007/s00432-010-0805-z. PubMed:20700687.

29. Zhang W, Feng M, Zheng G, Chen Y, Wang X et al. (2012)Chemoresistance to 5-fluorouracil induces epithelial–mesenchymaltransition via up-regulation of Snail in MCF7 human breast cancer cells.Biochem Biophys Res Commun 417: 679-685. doi:10.1016/j.bbrc.2011.11.142. PubMed: 22166209.

30. Croce CM, Calin GA (2005) miRNAs, cancer, and stem cell division.Cell 122: 6-7. doi:10.1016/j.cell.2005.06.036. PubMed: 16009126.

31. Sarkar FH, Li Y, Wang Z, Kong D, Ali S (2010) Implication ofmicroRNAs in drug resistance for designing novel cancer therapy. DrugResist Update 13: 57-66. doi:10.1016/j.drup.2010.02.001. PubMed:20236855.

32. Blower PE, Chung J-H, Verducci JS, Lin S, Park J-K et al. (2008)MicroRNAs modulate the chemosensitivity of tumor cells. Mol CancerTher 7: 1-9. doi:10.1186/1476-4598-7-1. PubMed: 18187804.

33. Fujita Y, Kojima K, Hamada N, Ohhashi R, Akao Y et al. (2008) Effectsof miR-34a on cell growth and chemoresistance in prostate cancer PC3cells. Biochem Biophys Res Commun 377: 114-119. doi:10.1016/j.bbrc.2008.09.086. PubMed: 18834855.

34. Adam L, Zhong M, Choi W, Qi W, Nicoloso M et al. (2009) miR-200expression regulates epithelial-to-mesenchymal transition in bladdercancer cells and reverses resistance to epidermal growth factorreceptor therapy. Clin Cancer Res 15: 5060-5072. doi:10.1158/1078-0432.CCR-08-2245. PubMed: 19671845.

35. Shimono Y, Zabala M, Cho RW, Lobo N, Dalerba P et al. (2009)Downregulation of miRNA-200c links breast cancer stem cells withnormal stem cells. Cell 138: 592-603. doi:10.1016/j.cell.2009.07.011.PubMed: 19665978.

36. Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A et al. (2008)The miR-200 family and miR-205 regulate epithelial to mesenchymaltransition by targeting ZEB1 and SIP1. Nat Cell Biol 10: 593-601. doi:10.1038/ncb1722. PubMed: 18376396.

37. Hurteau GJ, Carlson JA, Spivack SD, Brock GJ (2007) Overexpressionof the microRNA hsa-miR-200c leads to reduced expression oftranscription factor 8 and increased expression of E-cadherin. CancerRes 67: 7972-7976. doi:10.1158/0008-5472.CAN-07-1058. PubMed:17804704.

38. Lerner M, Haneklaus M, Harada M, Grandér D (2012) MiR-200cregulates Noxa expression and sensitivity to proteasomal inhibitors.PLoS One 7: e36490.

39. Zhang Z, Zhang B, Li W, Fu L, Fu L, et al. (2011) Epigenetic silencingof miR-203 upregulates SNAI2 and contributes to the invasiveness ofmalignant breast cancer cells. Genes & Cancer 2: 782-791.

40. Abella V, Valladares M, Rodriguez T, Haz M, Blanco M et al. (2012)miR-203 Regulates Cell Proliferation through Its Influence on HakaiExpression. PLOS ONE 7: e52568. doi:10.1371/journal.pone.0052568.PubMed: 23285092.

41. Li Y, Yuan Y, Tao K, Wang X, Xiao Q et al. (2013) Inhibition ofBCR/ABL Protein Expression by miR-203 Sensitizes for ImatinibMesylate. PLOS ONE 8: e61858. doi:10.1371/journal.pone.0061858.PubMed: 23613955.

42. Calao M, Sekyere EO, Cui HJ, Cheung BB, Thomas WD et al. (2012)Direct effects of Bmi1 on p53 protein stability inactivates oncoproteinstress responses in embryonal cancer precursor cells at tumorinitiation. Oncogene 32: 1-11. PubMed: 22907436.

43. Zhang Z, Zhang B, Li W, Fu L, Fu L et al. (2011) Epigenetic silencing ofmiR-203 upregulates SNAI2 and contributes to the invasiveness ofmalignant breast cancer cells. Genes and Cancer,2(8): 782-791.PubMed: 22393463.

Bmi1-miRNAs Cross-Talk in Chemo-Response

PLOS ONE | www.plosone.org 10 September 2013 | Volume 8 | Issue 9 | e73268