ORIGINAL PAPER

Retinoblastoma (RB1) pocket domain mutations and promoterhyper-methylation in head and neck cancer

Maimoona Sabir & Ruqia Mehmood Baig & Kashif Ali &Ishrat Mahjabeen & Muhammad Saeed &

Mahmood Akhtar Kayani

Accepted: 15 May 2014# International Society for Cellular Oncology 2014

AbstractBackground The RB1 gene plays a pivotal role in cell cycleregulation. In this case–control study we searched for alter-ations in the RB1 pocket domain and its promoter region inhead and neck cancer (HNC) patients in the Pakistanipopulation.Methods For germline mutation analyses, 380 blood samplesfrom HNC patients and 350 blood samples from controlindividuals were included. Polymerase chain reaction (PCR)and single strand conformational polymorphism (SSCP) as-says, followed by sequence analyses, were used for the RB1pocket domain mutation screens. For the RB1 promoter meth-ylation screens, 72 HNC tumor samples along with adjacent

uninvolved tissues were tested using a methylation-specificpolymerase chain reaction (MSP) assay.Results RB1 (pocket domain and spacer region) sequenceanalysis revealed one frameshift and seven non-synonymousmissense mutations. The frequency of missense mutations inexon 14, i.e., g76474C>T, g76475G>C and g76476A>G,resulting in Arg455Ser, was found to be highest (0.10). Mis-sense mutations g76467G>C (exon14), g76468T>C(exon14), g77041A>T and g77043A>T (exon 16), whenanalyzed via Alamut biosoftware version 2.0, were found tobe present in highly conserved amino acids with Align GVGDscores C15 (GV: 0.00 - GD: 21.82), C65 (GV: 0.00 - GD:83.33) and C65 (GV: 0.00 - GD: 98.69), respectively. Thesemissense mutations were found to be deleterious by SIFTscore: 0.00 (median 3.64). RB1 promoter methylation analysisrevealed that 16 % of its cytosines (3 % in CpG) weremethylated in the HNC tumor samples.Conclusion Our findings indicate that both genetic and epi-genetic RB1 changes may contribute to the pathogenesis ofHNC in the Pakistani population.

Keywords HNC . RB1 .Mutation analysis . Promotermethylation analysis . Carcinogenesis

1 Introduction

Head and neck cancer (HNC) represents an aggressive malig-nancy that is associated with abnormalities in genes involvedin DNA repair, apoptosis, angiogenesis, proliferation, differ-entiation and cell cycle regulation pathways. The RB1 proteinplays a pivotal role in the cell cycle regulation pathway,promoting G1/S phase arrest and growth restriction throughinhibition of E2F [1]. Human RB1 is a nucleophosphoproteincomposed of 928 amino acids, including an amino acid ter-minal domain (N), a pocket domain (A,B) and a carboxyl acid

M. Sabir : R. M. Baig :K. Ali : I. Mahjabeen :M. Saeed :M. A. Kayani (*)Cancer Genetics Lab, Department of Biosciences, COMSATSInstitute of Information Technology, Park Road Chak shahzad,Islamabad, Pakistane-mail: mkayani@comsats.edu.pk

M. Sabire-mail: monasabir@live.com

R. M. Baige-mail: ruqiamehmood@gmail.com

K. Alie-mail: Kashif_129@yahoo.co.uk

I. Mahjabeene-mail: Ishrat_qau@yahoo.com

M. Saeede-mail: Muhammadsaeed@comstas.edu.pk

K. AliSchool of Medicine, Cardiff University-Peeking University CancerInstitute, Heath Park, Cardiff, UK

R. M. BaigDepartment of Zoology, PMAS Arid Agriculture University,Rawalpindi, Pakistan

Cell Oncol.DOI 10.1007/s13402-014-0173-9

terminal domain (C). The pocket domain, best conservedamong the RB protein family, plays a crucial role in itsregulatory functions. It directly binds to the E2Ftransactivation domain, which is required for cell cycle pro-gression [2]. This pocket domain is also essential for theinteraction of RB1 with other proteins. It consists of A andB boxes, which form a tight hydrophobic interface and arecovalently linked by a spacer region [3]. Mutations affectingthe A and B boxes of the pocket domain and the spacer regionare known to result in RB1 proteins with disturbed functions.Alterations in both boxes have been found to potentiallydisrupt a hydrogen-bond network via in-silico structure anal-ysis, suggesting that mutations at this location may affect RB1function and stability [4]. Indeed, alterations in RB1 havefrequently been observed in (hereditary) retinoblastomas [5],lung carcinomas [6], breast cancers [4], bladder cancers [7],prostate cancers [8], liver cancers [9], gliomas [10], sarcomas[11] and leukemias [12]. Previous studies have reported con-flicting results regarding the role of RB1 in HNC. Somestudies have reported that loss of RB1 function may play aminor role in HNC risk [13–15], whereas others have shown amajor involvement of the RB1 protein in oral cancers and itspremalignant lesions [13, 16, 17]. RB1 abnormalities (loss ofexpression) have been observed in 6 % to 74 % of HNCs [13,15–17] and loss of heterozygosity (LOH) studies have report-ed loss of one RB1 allele in 14 % to 59 % of oral carcinomas[15, 18]. Such (somatic) allelic deletions thus appear to becommon, underscoring its involvement in HNC development[19]. The first part of the current study aims at mutationanalysis of the RB1 pocket domain in HNC patients.

Epigenetic changes may synergize with genetic chang-es in the initiation and progression of HNCs, and aberrantDNA methylation patterns may serve as powerful diag-nostic, prognostic and risk assessment biomarkers [20,21]. Indeed, aberrant methylation of tumor suppressorgenes such as p14, p16, RASSFI1 or DNA repair genessuch as MGMT has been reported to occur in tumortissues of oral cavity cancer patients [21–23]. Promotermethylation of p16, MGMT, DAPK1 and CDH1 has alsobeen assessed in relation to HNC survival. Results fromthese studies have indicated that methylation of p16 is afrequent event in primary HNCs and plays a major role insilencing of its expression during tumor development [23,24]. Similarly, RB1 has been shown to be inactivatedthrough a combination of genetic and epigenetic alter-ations [25]. The RB1 gene harbors a CpG island thatencompasses the essential promoter region, which hasbeen found to be hyper-methylated in different tumorssuch as retinoblastomas [20], pituitary adenomas [26]and nervous system tumors [25]. However, the role ofRB1 promoter hyper-methylation on outcome in oral, pha-ryngeal and laryngeal cancer, a specific subset of HNC,has so far not yet been addressed in different populations.

The second part of the current study aims at analyzing theRB1 promoter methylation status to assess its role in HNCdevelopment.

2 Materials and methods

2.1 Sample collection and clinical data

The present case–control study was conducted with priorapproval from ethical committees of the COMSATS Instituteof Information Technology, Islamabad (CIIT) and the respec-tive institutes and hospitals. Two HNC study groups wereincluded in this study. A first cohort (cohort I study group)was used for germline mutation analysis of the RB1 gene, forwhich blood samples of 380 HNC patients (pathologicallyconfirmed) were collected from the National Oncology andRadiotherapy Institute (Islamabad, Pakistan), the PakistanInstitute of Medical Sciences (Islamabad, Pakistan) and theMilitary Hospital (Rawalpindi, Pakistan). In total 350 age,gender and ethnicity matched, cancer-free healthy individualswere selected as controls. The inclusion criterion for thecontrol samples was the absence of a prior history of canceror a pre-cancerous lesion. Patients and controls suffering fromfamilial diseases (i.e., diabetes, blood pressure and cardiovas-cular impairment) were excluded from this study. The demo-graphic and clinical characteristics of the cancer patients in-cluded in this cohort are listed in Table 1. A second cohort(cohort II study group) was used for RB1 promoter methyla-tion analysis. For this, 72 HNC tumor samples (pathologicallyconfirmed) were collected from the Pakistan Institute of Med-ical Sciences (Islamabad, Pakistan) and the Military Hospital(Rawalpindi, Pakistan) during the period 2009–2012. Bothtumor composition and content in the tissues samples wereconfirmed by a consultant pathologist after hematoxylin andeosin (H&E) staining. Control samples were selected micro-scopically, with uninvolved areas more than 2 cm away fromthe tumor areas. After obtaining informed consent, all indi-viduals were personally interviewed using a specifically de-signed questionnaire. The clinical, epidemiological and histo-pathological characteristics of this cohort are also listed inTable 1.

2.2 DNA extraction

Blood samples from patients and controls were collected andstored at 4 °C. DNAwas isolated from white blood cells usinga standard phenol-chloroform extraction method [27] andstored at −20 °C for further processing. Briefly, 750 μl bloodsamples were gently mixed with 750 μl solution A (0.32 MSucrose, 5 mM MgCl2, 10 mM Tris) and centrifuged at32,000 rpm for 1 min. The pellets were re-suspended in400 μl solution A and the above mentioned centrifugation

M. Sabir et al.

procedure was repeated. Next, 400 μl solution B (100 mMNaCl2,10 mM Tris,2 mM EDTA), 12 μl 20 % SDS and 25 μlproteinase K were added, and the tubes were incubated at37 °C overnight or for 3 h at 56 °C. After this incubation,500 μl phenol and 500 μl solution C (Isoamyl alcohol andChloroform in a ratio of 1:24) were added and the suspensionswere mixed and centrifuged at 13,000 rpm for 5 min. Theaqueous phases were transferred to new tubes, mixed with500 μl solution C and centrifuged at 13,000 rpm for 10 min.To the resulting supernatants 500 μl ice-chilled isopropanolsolution (95 %) and 55 μl sodium acetate were added and themixtures were centrifuged at 13,000 rpm for 10 min. Next,500 μl 70 % ethanol was added to the supernatants and themixtures were centrifuged at 13,000 rpm for 5 min, afterwhich the supernatants were discarded. The resulting DNApellets were dissolved in 100 μl distilled water and stored at4 °C. The procedures were carried out under sterile conditionsto avoid contamination. The quantity and quality of the iso-lated DNAs were determined using gel electrophoresis andspectrophotometric analyses (BioDoc Analyze, Biometra).

2.3 Polymerase chain reaction (PCR)

The RB1 (ID 5925) sequence was taken from Ensembl(Human Genome Database) and PCR primers were de-signed using Primer 3 input software version 0.4.0.Next to the coding regions, exon/intron boundaries wereincluded to identify splice site variants. The primer

sequences, their annealing temperatures and productsizes are listed in Table 2. Each exon was amplifiedin a separate PCR reaction. The total reaction volumefor each PCR reaction was 20 μl, containing 2 μl PCRbuffer (10×), 2 μl of each primer solution (10 mM),0.24 μl of 25 mM deoxynucleotide triphosphate(dNTPs), 0.2 μl Taq polymerase (5 U/μl) and 2 μlgenomic DNA (50 ng/μl). The amplification conditionsincluded an initial denaturing step of 5 min at 94 °C,followed by 35 cycles of 45 sec at 94 ˚C, annealing for45 sec and 1 min at 72 °C, and a final extension of10 min at 72 °C. The PCR products were electropho-resed in 2 % agarose gels, stained with ethidiumbromideand visualized using an UV trans-illuminator (BioDocAnalyze, Biometra).

2.4 Mutation screening and sequencing

The RB1 PCR products were subjected to single strandedconformational polymorphism (SSCP) analyses using a pre-viously described procedure [28]. After ethidium bromidestaining, the SSCP products were analyzed using a gel docu-mentation system (BioDoc Analyze, Biometra) andphotographed. The samples showing mobility shifts were thensequenced (MC LAB, USA). Control (normal) samples werealso sequenced, along with the cases. The sequencing resultswere analyzed using BioEdit and Alamut biosoftware version2.0 for the detection of mutations, as well as for determiningtheir effects on the genomic, cDNA and protein levels. Thedetected mutations were also analyzed by Align GVGD, SIFTand Mutation Taster software [27].

2.5 Methylation analysis

2.5.1 DNA extraction and bisulphite conversion

For methylation-specific PCR (MSP), genomic DNA wasextracted from tumor samples as described previously [29].Briefly, tissues (50 mg) were transferred to tubes and 1 mlDNA buffer (1 M Tris–HCl, pH 7.5, 0.5 M EDTA, pH 8.0,400 mMNaCl), 25μl proteinase K(10mg/ml) and 25μl 10%sodium dodecylsulphate (SDS) were added and the mixtureswere incubated overnight at 45 °C. Then, buffered phenol(500 μl) was added and the mixtures were centrifuged at13,000 rpm for 5 min. To the supernatants equal volumes ofphenol and chloroform/isoamyl alcohol (24:1) were added.After centrifugation at 13,000 rpm for 5 min. 25 μl sodiumacetate (3 M, pH 5.2) and 1 ml ethanol were added to thesupernatant and shaken gently until the DNAwas precipitated.Next, 500 μl 70 % ethanol was added and the mixture wascentrifuged at 13,000 rpm for 5 min. The DNA pellet wasdried, dissolved in 100 μl distilled water and stored at 4 °C.2 μl of this DNA solution was then used for bisulphite

Table 1 Demographic and clinical characteristic of HNC patients

Variables Cases N (%) Control N (%)

Cohort I

Age * 48(18–78) 42(20–56)

Gender Male 196(52.5) 179(51.1)

Female 184(48.5) 171(48.8)

Family history Yes 35(9.21) 18(5.14)

No 345(90.7) 332(94.8)

Smoking history Smokers 238(62.5) 197(56.2)

Non-smokers 142(37.5) 153(43.7)

Cohort II

Age* 56(28–70) 56(28–7)

Gender Male 42(58.4) 42(58.4)

Female 30 (42.6) 30 (42.6)

Clinical stage I 13 (18.0) -

II 19(26.3) -

III 25(34.7) -

IV 15(20.8) -

Tumor grade Well 18(25.0) -

Moderate 23(31.9) -

Poor 31(43.0) -

* Values are given in median (range), N stands for number of individuals

Genetic and epigenetic analysis of RB1 gene in HNC

conversion using a commercially available kit (Invitrogen) asper manufacturer’s protocol provided with the kit.

2.5.2 Methylation-specific PCR and sequencing

The RB1 promoter methylation status was analyzed byMSP in 72 HNC tumor samples as described previously[30]. The methylated (MSP) and unmethylated (U-MSP)-specific primers used in this study are listed inTable 2 [26]. Each 20 μl reaction mixture containedPCR buffer (1×), 1.5 mM MgCl2, 0.5 mM of eachdeoxynucleotide triphosphate (dNTPs), 0.2 μM of eachprimer, 0.2 μl (5 U/μl) Taq polymerase (Fermentas) and2 μl (50 ng) genomic DNA (after bisulphite conver-sion). The PCR reactions for the methylated-specificprimers were carried out for 35 cycles of 1 min at95 °C, 45 sec at 65 °C annealing temperature and1 min a t 72 °C. The PCR reac t ions for theunmethylated-specific primers were carried out for 35 cy-cles of 1 min at 95 °C, 45 sec at 61 °C annealingtemperature and 1 min at 72 ˚C. Both PCRs werecarried out with an initial 5 min of denaturation at95 °C and a final extension of 10 min at 72 ˚C. Afteramplification, the PCR products were visualized on 2 %agarose gels. A positive control (Universal methylatedDNA, Millipore) and two negative controls (modifiedDNA from healthy donors and water) were also includ-ed in each reaction. For the unmethylated-specific PCR

untreated DNA (without bisulphite treatment) was usedas positive control.

The amplified PCR products were purified throughethanol precipitation. Subsequent sequencing was carriedout using the BigdyeTM terminator cycle sequencing kit(Applied Biosystems, USA). To this end, 25–30 ng ofpurified PCR product was amplified using 1 μl primer(3.2 pmol), 1 μl 5× reaction buffer (400 mM TrispH 8.7, 10 mM MgCl2), 1 μl BigDye and up to10 μl distilled water. After initial denaturation at96 °C for 20 sec, 25 cycles were repeated at 96 °Cfor 15 sec, 50 °C for 15 sec and 60 °C for 4 min,respectively, with a final extension at 60 °C for 4 min.The PCR products were then ethanol precipitated andresuspended in 15 μl highly deionized formamide. Abrief heat shock was given at 95 °C for 5 min, afterwhich the samples were shifted to ice and run on anABI 3,100 Genetic Analyzer. Several independentclones of bisulphite modified DNA were generated byPCR and the methylation patterns in each of theseclones were determined by sequencing.

2.6 Statistical analyses

Statistical analyses were carried out using GraphPadPrism 6.04 and SPSS 17.0 software packages. p valueswere calculated using χ2 test, one way ANOVA andStudent t-test. Odd ratios (ORs) and 95 % confidence

Table 2 Primers for PCR-SSCP and promoter methylation analysis of RB1

Primer for Exon Primer sequence Fragment size (bp) Annealing temp.

11 F11R

GATTTTATGAGACAACAGAAGCAATCTGAAACACTATAAAGCCATG

244 52˚C

12 F12R

AGAGACAAGTGGGAGGCAGTGGATAACTACATGTTAGATAGGAG

327 55˚C

13 F13R

CTGATTACACAGTATCCTCGAC ATACGAACTGGAAAGATGCTGC 239 58˚C

14 F14R

ATTGTGATTTTCTAAAATAGCAGGCAGGATGATCTTGATGCCTTG

229 58˚C

15/16 F15/16R

CAATGCTGACACAAATAAGGTTAAGAAACACACCACATTTTAACT 321 52˚C

17 F17R

AGCTCAAGGGTTAATATTTCATAAAATTTGTTAGCCATATGCACATG

302 52˚C

20 F20R

CTGGGGGAAAGAAAAGAGTGG GAGGAGAGAAGGTGAAGTGCT 328 58˚C

21 F21R

GAACAAAACCATGTAATAAAATTCTACCTATGTTATGTTATGGATATGG 219 55˚C

22 F22R

ACTGTTCTTCCTCAGACATTCATTGGTGGACCCATTACATTAGA 182 55˚C

23 F23R

CTAATGTAATGGGTCCACCAAATCCCCCTCTCATTCTTTACTAC 270 52˚C

MS FMS R

GGG AGT TTC GCG GACGTG ACACG TCGAAA CAC GCC CCG

172 65˚C

UM FUM R

GGGAGTTTTGTGGATGTGATACATCAAAACACACCCCA

172 61˚C

M. Sabir et al.

intervals (CIs) were calculated. Multivariate analyseswere performed to correlate mutations with gender,smoking status and anatomical localization.

3 Results

3.1 RB1 germline mutations in HNC patients

For the detection of RB1 germline mutations, exons 11–23 (pocket domain A, B and spacer region) were ana-lyzed using blood samples of 380 head and neck cancer(HNC) patients and 350 control samples (normal indi-viduals). SSCP analysis in conjunction with DNA se-quencing revealed one frameshift and seven non-synonymous missense mutations in the HNC cases.These are listed in Table 3. None of these variants wereobserved in the control samples. In exon 12, a five basepair deletion was observed with a frequency of ~4 %(18/380), resul t ing in the frameshif t mutat ion(g70285_70289del GATGA) (Fig. 1a). The seven non-synonymous missense mutations included five mutationsin exon 14 and two mutations in exon 16. The totalfrequency of non-synonymous missesnse mutations was~25 % (95/380). Three of the non-synonymous missensemutations were observed in the same codon in exon 14(g76474C>T, g76475G>C and g76476 A>G), resultingin an amino acid change from arginine to serine(Arg455Ser) with a frequency of ~10 % (40/380). Twoother non-synonymous missense mutations were alsoobserved in exon 14 (g76467G>C and g76468 T>C),with a frequency of ~7 % (27/380), resulting in aminoacid changes of leucine to phenylalanine (Leu452Phe)and threonine to histidine (Thr453His), respectively(Fig. 1b and c). The two non-synonymous missensemutations observed in exon 16 (g77041A>T andg77043 A>T) had a frequency of ~2 % (10/380) andresulted in amino acid changes of histidine to leucine

(His483Leu) and methionine to leucine (Met484Leu),respectively (Fig. 1d). All these missense mutationswere assessed with respect to gender, smoking statusand anatomical localization. No significant associationof any of these mutations was found with either genderor smoking status. However, missense mutations in exon14 (g76474C>T, g76475G>C, g76476A>G) were foundto be significantly more frequent in smokers as com-pared to non-smokers (p<0.04). When analyzed accord-ing to anatomical localization, it was found that patientswith oral cavity cancer exhibited a higher number ofmutations compared to patients with laryngeal or pha-ryngeal cancer (Table 4).

3.2 Aberrant RB1 promoter methylation in HNC tumorsamples

Next to the germline mutation analyses, we set out toperform RB1 promoter methylation analyses. To thisend, tumor samples from 72 HNC patients and controls(adjacent un-involved tissues) were analyzed usingmethylation-specific PCR (MSP). By doing so, wefound that 12 samples (~16 %) showed RB1 promoterhyper-methylation (Fig. 2a and b). Subsequently, theseMSP results were confirmed by sequence analysis, re-vealing that 40 out of 243 cytosines (region: −600 - +101) were methylated, which accounts for 16 % of thecytosines present in this region. Among these 16 %methylated cytosines 3 % were located at CpG sites,compared to the sequences from the control samples(adjacent un-involved tissues) (Fig. 2c). ClustalW (mul-tiple sequence alignment tool) revealed that CpG cyto-sines at positions −40 and +60 of the promoter regionwere methylated in all tumor samples (100 %), whileCpG cytosines at position −85 were methylated in only50 % of the tumor samples exhibiting methylation(Fig. 3). Associations between RB1 promoter region

Table 3 Mutation spectrum of RB1 in HNC patients

RBIRegion

Change in codon Change in nucleotide sequence (Position intranscript)

Change in amino acid sequence Mutationtype

frequency

Exon 12 TTAATGATGATTT>

TTGTCTTT

g70285_70289del GATGA - Frame shift* 0.048

Exon 14 TTG>TTCTAT>CAT

g76467G>Cg76468T>C

Leu452PheThr453His

Missense*Missense*

0.072

Exon 14 CGA>TCG g76474C>Tg76475G>Cg76476A>G

Arg455Ser Missense *Missense*Missense*

0.107

Exon 16 CAT>CTTATG>TTG

g77041A>Tg77043A>T

His483leuMet484leu

Missense*Missense*

0.026

*Novel mutations identified in this study. Mutations are designated according to their position in the genome sequence of RB1

Genetic and epigenetic analysis of RB1 gene in HNC

Fig. 1 Nucleotide sequences of RB1 fragments (a) Electro-pherogram of observed mutation in exon 12: Frameshift mutation(g70285_70289delGATGA). (b) Electropherogram of observed muta-tions in exon 14: Missense mutations (g76471G>C) and (g76472T>C).(c) Electropherogram of observed mutations in exon 14: Missense

mutations (g76474C>T), (g76475G>C) and (g76476A>G). (d) Electro-pherogram of observed mutations in exon 16: Missense mutations(g77041A>T) and (g77043A>T) arrows mark variants. Arrow headindicates these variations with wild type sequence.

M. Sabir et al.

methylation status and clinical characteristics of thevarious samples are provided in Table 5. In a multivar-iate analysis, a ~5-fold higher methylation level wasobserved in smokers [OR 5.4, 95 % CI (1.07–27.47)

p<0.04] compared to non-smokers, and a ~6-fold highermethylation level was observed in oral cavity comparedto pharyngeal cancers [OR 5.6, 95 % CI (0.62–51.97)p<0.03].

Table 4 Association of RB1 mutations with gender, smoking status and anatomic localization

Variables Exon 12, frameshift mutation(g70285_70289delGATGA)OR 95 % CI p value

Exon 14, missense mutationsg76467G>C, g76468T>COR 95 %CI p value

Exon 14, missense mutationsg76474C>T, g76475G>C,g76476A>GOR 95 % CI p-value

Exon 16, missense mutationsg77041A>T, g77043A>TOR 95 % CI p value

Gender

Male vs.female

1 0.27–3.65 NS 1.54 0.54–4.45 NS 1.48 0.62–3.50 NS 4.57 0.82–25.24 NS

Smoking status

Smoker vs.non-smoker

1.54 0.42–5.58 NS 2.06 0.71–5.95 NS 2.68 1.12–6.41<0.04 2.1 0.38–11.81 NS

Anatomic localization

Oral cavityvs.pharynx

1.91 0.53–6.96 NS 5.13 1.76–14.94<0.005 2.46 1.02–5.93 NS 14.68 2.63–81.79<0.005

Oral cavityvs. larynx

9.89 2.44–40.02<0.002 7.30 2.47–21.59<0.006 6.53 2.60–16.41<0.005 14.68 2.63–81.79<0.005

Pharynx vs.larynx

6.25 1.38–30.71<0.04 1.61 0.41–6.31 NS 3.1 1.09–8.81<0.05 1 0.05–17.25 NS

Multivariate analysis, NS non significant

OR odd ratio, CI confidence interval

Fig. 2 Methylation analysis of RB1 promoter region. (a) Tumor sample(1–4)-derived unmethylated-specific PCR (U-MSP) products. (b) Tumorsample (5–8)-derived methylated-specific PCR (MSP) products. U:unmethylated, M: methylated. Negative control DNA, positive controluniversally methylated DNA and 100 bp DNA ladder are included. (c)

Sequences of bisulphate converted DNAs from HNC tumor tissues andcontrol tissues. The upper panels show sequences of promoter regionsfrom patient samples (i.e., methylated cytosines), where as the lowerpanels show conversions of cytosines to thymines in control samples(i.e., unmethylated cytosines)

Genetic and epigenetic analysis of RB1 gene in HNC

4 Discussion

Genetic and epigenetic alterations of the RB1 gene, includingloss of RB1 expression [13, 16], mutations and large deletions[31, 32], allelic imbalances [19], protein hyper-phosphorylation [33] and CpG island hyper-methylation ofthe promoter region [34], are frequently observed in humancancers. These changes contribute significantly to the patho-genesis of these cancers, including head and neck cancer

(HNC) [15]. The incidence of HNC is increasing alarminglyin Pakistan [28], and biomarkers are urgently needed for theearly detection and subsequent treatment of HNC. In thisstudy we assessed possible associations of RB1 germlinevariants and somatic RB1 promoter methylation patterns withthe pathogenesis of HNC. By using SSCP analysis in con-junction with DNA sequencing, germline mutations wereobserved in RB1 coding regions (exon 11–23) with a signifi-cantly higher frequency in HNC patients than in healthy

Fig. 3 CpG sites in theRB1promoter region ranging from positions−600 to +101. ClustalWmultiple sequence alignment revealed that CpG cytosines atpositions −40 and +60 were hyper-methylated (100 %)

Table 5 Correlation of methylation status of RB1 promoter region with clinical characteristics of head and neck cancer patients

Variables Methylated Unmethylated

OR 95% CI p value OR 95% CI p value

Gender

Male vs. female 1 0.28–3.51 NS 1 0.30–3.74 NS

Smoking status

Smoker vs. non-smoker 5.4 1.07–27.47 <0.04 0.2 0.04–1.21 NS

Anatomic localization

Oral cavity vs. pharynx 5.6 0.62–51.97 <0.03 0.17 0.02–1.60 NS

Oral cavity vs. larynx 1.6 0.41–6.63 NS 0.68 0.18–2.61 NS

Pharynx vs. larynx 0.21 0.02–2.00 NS 3.9 0.41–53.36 <0.05

Clinical stage

I-II vs. III-IV 0.5 0.13–1.88 NS 1.75 0.47–6.44 NS

Tumor grade

Well vs. moderate 0.9 0.17–5.02 NS 1.05 0.20–5.44 NS

Moderate vs. poor 1.05 0.21–5.18 NS 0.96 0.26–4.60 NS

Poor vs. well 1.12 0.25–4.88 NS 0.91 0.21–3.86 NS

p-value computed using χ2-test and one-way ANOVA

Multivariate analysis, NS non significant

OR odd ratio, CI confidence interval

M. Sabir et al.

controls. These results underscore other mutation studies inthe Pakistani population [28, 35] and in distinct populationsworldwide [36, 37].

The non-synonymous missense mutations that we ob-served in exon 14 and exon 16 of the RB1 gene may berelevant, as they were found in the region coding for pocketdomain A. This pocket domain is well-conserved among theRB1 protein family and plays a crucial role in cell cycleprogression [38, 39]. Missense mutations g76467G>C(exon14), 76468 T>C (exon14) and g77041A>T (exon 16)were found to affect highly conserved amino acids [AlignGVGD score: C15 (GV: 0.00 - GD: 21.82), C65 (GV: 0.00 -GD: 83.33) and C65 (GV: 0.00 - GD: 98.69), respectively]and, in addition, were found to be deleterious [SIFT 0.00(median 3.64)] as SIFT scores<0.05 are considered to bedeleterious [32]. Additionally, according to Mutation Taster,these mutations are predicted to be disease causing with a p-value (probability) of 1.0. Another non-synonymous missensemutation in exon 16, g77043A>T was found to affect amoderately conserved amino acid [GVGD: C0 (GV: 81.04 -GD: 14.30)], to be tolerated according to SIFT score (0.31,median: 3.64), but predicted to be disease causing (MutationTaster: p-value: 0.76). Frequencies and distributions of mis-sense mutations in the RB1 coding sequence in patients withretinoblastoma have been reported from different countries,including France 13 % [40], China 12 % [41] and India 0 %[42]. A SNP A>G at nucleotide 153 of RB1, affecting a Tsprestriction site, has been reported in different populations withdifferent allele frequencies, i.e., Chinese 0.14, Malay 0.13,Japanese 0.10, Thai 0.12, Filipino 0.17, Bangladeshi 0.03,Pakistani 0.11 and Indian 0.02 [43]. Two of the missensemutations reported here overlap with known SNPs. Missensemutation g76474C>T (Arg455Ser), resulting in an arginine toserine substitution, overlaps with a variant at the same position(rs121913302) resulting in a different substitution(Arg455stop) [44]. A second missense mutation observed inthis study, i.e., g76467 G>C, again overlaps with a reportedvariant at this position (rs201285819), but with a differentnucleotide change (G>A). In addition to these missense mu-tations, one frameshift mutation resulting from a 5 bp deletionin exon 12 was detected in the present study. Such deletionmutations in the RB1 coding region have been observed inearlier studies resulting in loss of function and cellular trans-formation [33, 39].

We also performed promoter methylation analyses usingmethylation specific PCR in 72 HNC tumors. Changes inmethylation patterns may play a vital role in aberrant geneexpression which, in turn, may lead to tumorigenesis [45, 46].It has amply been shown that hyper-methylation ofunmethylated CpGs in the promoter regions of tumor suppres-sor genes may correlate with loss of expression [13, 15, 47]. Inthe present study, aberrant methylation was detected at 16 %of the cytosines present in the RB1 promoter region. Further

sequence analysis revealed that this methylation was highlyenriched in CpG-associated cytosines. Similar results havepreviously been reported by others in different study popula-tions [47–49]. Here, hyper-methylation was detected at 3 % ofthe CpGs located near the transcription start site. Previously, ithas been shown that this stretch of nucleotides (from position+13 to +83) is critical for RB1 promoter activity and transcrip-tion regulation, due to the presence of two transcription initi-ation sites within this region [48]. Thus, aberrant CpG meth-ylation in this region may lead to RB1 silencing and, thus, lossof function [46, 47].

Taken together, we conclude that both genetic and epige-netic alterations may play a significant role in the etiology ofHNC in the Pakistani population.

Acknowledgments The authors acknowledge the financial and infra-structural support from the Higher Education Commission (HEC) and theCOMSATS Institute of Information Technology (CIIT), Islamabad. Theauthors are thankful to the patients and the staff of the Nuclear Oncologyand Radiotherapy Institute (NORI), the Pakistan Institute of MedicalSciences (PIMS), the Allied Hospital and the Military Hospital (MH),Islamabad for their contributions to this research.

Conflict of interest The authors declare that they have no conflict ofinterest.

Ethical standards It is declared that experiments in this manuscriptsubmitted for publication comply with the current laws of the country inwhich they were performed. This study was conducted with a priorapproval from ethical committees of the COMSATS Institute of Informa-tion Technology, Islamabad (CIIT) and the affiliated hospitals.

References

1. J.H. Dannenberg, L. Schuijff, M. Dekker, M.V. Valk, H. Riele,Tissue-specific tumor suppressor activity of retinoblastoma genehomologs p107 and p130. Genes & Dev 18, 2952–2962 (2004)

2. S.M. Rubin, A.L. Gall, N. Zheng, N.P. Pavletich, Structure of the RbC-Terminal Domain Bound to E2F1-DP1: A Mechanism forPhosphorylation-Induced E2F. Release Cell 123(6), 1093–1106(2005)

3. E.J. Morris, N.J. Dyson, Retinoblastoma protein partners. Adv CanRes 82, 1–54 (2001)

4. E. Berge, S. Knappskog, S. Geisler, V. Staalesen, M. Pacal, A.Borresen-Dale, P. Puntervoll, J. Lillehaug, P. Lønning,Identification and characterization of retinoblastoma gene mutationsdisturbing apoptosis in human breast cancers. Mol Cancer 9, 173–186 (2010)

5. V. Dalamon, E. Surace, F. Giliberto, V. Ferreiro, C. Fernandez, I.Szijan, Detection of germline mutations in Argentine retinoblastomapatients: low and full penetrance retinoblastoma caused by the samegermline truncating mutation. J Biochem Mol Biol 37(2), 246–253(2004)

6. P.P. Claudio, C.M. Howard, C. Pacilio, C. Cinti, G. Romano, C.Minimo, N.M. Maraldi, J.D. Minna, L. Gelbert, L. Leoncini, G.M.Tosi, P. Hicheli, M. Caputi, G.G. Giordano, A. Giordano, Mutationsin the retinoblastoma-related geneRB2/p130 in lung tumors andsuppression of tumor growth in vivo by retrovirus-mediated genetransfer. Cancer Res 60, 372–382 (2000)

Genetic and epigenetic analysis of RB1 gene in HNC

7. H. Miyamoto, T. Shuin, S. Torigoe, Y. Iwasaki, Y. Kubota,Retinoblastoma gene mutations in primary human bladder cancer.British J Cancer 71, 831–835 (1995)

8. Y. Kubota, K. Fujinami, H. Uemura, Y. Dobashi, H. Miyamoto, Y.Iwasaki, H. Kitamura, T. Shuin, Retinoblastoma gene mutations inprimary human prostate cancer. Prostate 27, 314–320 (1995)

9. N.M. Christopher, L.C. Scott, R.F. Sejal, Rb loss abrogates cell cyclecontrol and genome integrity to promote liver tumorigenesis.Gastroenterology 133, 976–984 (2007)

10. D.J. Venter, K.L. Bevan, R.L. Ludwig, Retinoblastoma gene dele-tions in glioblastomas. Oncogene 6, 445–448 (1991)

11. W.G. Cance, M.F. Brennan, M.E. Dudas, Altered expression of theretinoblastoma gene product in human sarcomas. N Engl J Med 323,1457–1462 (1990)

12. S.M. Komblau, N. Chen, A.D. Giglio, Retinoblastoma protein ex-pression is frequently altered in chronic lymphocytic leukemia.Cancer Res 54, 242–246 (1994)

13. S. Koontongkaew, L. Chareonkitkajorn, L.A. Chanvitan, Alterationsof p53, pRb, cyclinD(1) and cdk4 in human oral and pharyngealsquamous cell carcinomas. Oral Oncol 36, 334–339 (2000)

14. T. Krecicki, R. Smigiel, M. Fraczek, M. Kowalczyk, M.M. Sasiadek,Studies of the cell cycle regulatory proteins P16, cyclin D1 andretinoblastoma protein in laryngeal carcinoma tissue. J Lary&Otology 118, 676–680 (2004)

15. L.L. Gleich, F.N. Salamone, Molecular genetics of head and neckcancer. Cancer Control 9(5), 369–378 (2002)

16. V. Canzonieri, L. Barzan, G. Franchin, E. Vaccher, R. Talamini, S.Sulfaro, G baldassarre, alteration of G1/S transition regulators influ-ences recurrences in head and neck squamous carcinomas. J CellPhysiol 227, 233–238 (2012)

17. Y. Nakahara, S. Shintani,M.Mihara, Alterations of Rb, p16 (INK4A)and cyclin D1 in the tumorigenesis of oral squamous cell carcinomas.Cancer Lett 160, 3–8 (2000)

18. G.M. Sabbir, A. Roy, S. Mandal, Deletion mapping of chromosome13q in head and neck squamous cell carcinoma in Indian patients:correlation with prognosis of the tumour. Int J Exp Path 87, 151–161(2006)

19. V.K. Gupta, A.P. Schmidt, M.E. Pashia, J.B. Sunwoo, S.B.Scholnick, Multiple regions of deletion on chromosome arm 13q inhead-and-neck squamous-cell carcinoma. Int J Cancer 22, 453–457(1999)

20. M.J. Worsham, K.M. Chen, J.K. Stephen, S. Havard, M.S.Benninger, Novel approaches to global mining of aberrantly meth-ylated promoter sites in squamous head and neck cancer.Otolaryngology Head Neck Surg 143(1), 116–121 (2010)

21. E. Taioli, C. Ragin, X. Wang, J. Chen, S.M. Langevin, A.R. Brown,S.M. Gollin, S. Garte, R.W. Sobol, Recurrence in oral and pharyngealcancer is associated with quantitative MGMT promoter methylation.BMC Cancer 9, 354 (2009)

22. P.M. Das, R. Singal, DNA methylation and cancer. J Clin Oncol BiolNeoplasia 22, 4632–4662 (2004)

23. M. Nakamura, T. Watanabe, U. Klangby, C. Asker, K. Wiman, Y.Yonekawa, P. Kleihues, H. Ohgaki, P14arf deletion and methylationin genetic pathways to glioblastomas. Brain Pathol 11, 159–168(2001)

24. S. Demokan, A. Chuang, Y. Suoglu, M. Ulusan, Z. Yalnız, J.A.Califano, N. Dalay, Promoter methylation and loss of p16ink4a geneexpression in head and neck cancer. Head & Neck 34(10), 1470–1475 (2012)

25. P. Gonzalez-Gomez, M.J. Bello, M.E. Alonso, D. Arjona, J. Lomas,J.M. de Campos, J.M. de Campos, A. Isla, J.A. Rey, CpG islandmethylaion status and mutation analysis of the RB1 gene essentialpromoter region and protein-binding pocket domain in nervous sys-tem tumors. Br J Cancer 13(1), 109–114 (2003)

26. D.J. Simpson, N.A. Hibberts, A.M. McNicol, R.N. Clayton, W.E.Farrell, Loss of pRb expression in pituitary adenomas is associated

with methylation of the RB1 CpGisland. Cancer Res 60, 1211–1216(2000)

27. R.M. Baig, I. Mahjabeen, M. Sabir, N. Masood, K. Ali, F.A.Malik, M.A. Kayani, Mutational spectrum of gelsolin and itsdown regulation is associated with breast cancer. DiseaseMark 34, 71–80 (2013)

28. I. Mahjabeen, R.M. Baig, N. Masood, M. Sabir, F.A. Malik, M.A.Kayani, Sequence variations of OGG1 gene in head and neck cancerpatients. Asian Pac J Cancer Prev 12, 2779–2783 (2001)

29. U. Inayat, M.A. Kayani, R. Faryal, Sporadic mutations and expres-sion analysis of spleen tyrosine kinase gene in breast cancer: apreliminary report. Pol J Pathol 63(2), 106–111 (2012)

30. C.S. Chim, C. Tam, R. Liang, Y.L. Kwong, P15 and P16 genemethylation in adult acute leukemia: lack of prognostic significance.Cancer 91, 2222–2229 (2001)

31. J. Alonso, P. García-Miguel, J. Abelairas, M. Mendiola, E. Sarret,M.T. Vendrell, A. Navajas, A. Pestaña, Spectrum of germlineRB1gene mutations in Spanish retinoblastoma patients: phenotypic andmolecular epidemiological implications. Hum Mutat 17(5), 412–422(2001)

32. P.C. Ng, S. Henikoff, SIFT: predicting amino acid changes that affectprotein function. Nucleic Acids Res 31(13), 3812–3814 (2003)

33. F.Y.L. Anna, C.H.L. Alice, T. Shyh-How, L. Wing-Yin, L. Wen-Yih,C. Jeou-Yuan, Alterations in the p16INK4a/Cyclin D1/RB pathway ingastrointestinal tract endocrine tumors. Am J Clinic Pathol 130, 535–542 (2008)

34. B. Joseph, G. Mamatha, G. Raman, M.P. Shanmugam, G.Kumaramanickavel, Methylation status of RB1promotor in Indianretinoblastoma patients. Cancer Biol Ther 3(2), 184–187 (2004)

35. N. Masood, M.A. Kayani, Mutational analysis of xenobiotic metab-olizing genes (CYP1A1 and GSTP) in sporadic head and neck cancerpatients. Genetics and Mol Biol 34(4), 533–538 (2011)

36. C.D. Llewellyn, L.W. Jhonson, K.A.Warnakulasuriya, nd younger: acase–control study in Southern England. J Oral Pathol Med 33(9),525–532 (2004)

37. C.H. Shiboski, S.C. Shiboski, S Silverman S (2000). Trends in oralcancer rates in the United States, 1973–1996. Community Dent OralEpidemiol 28, 249–256 (2000)

38. A. Czech, I. Fedyunin, G. Zhang, Z. Ignatova, Silent mutations insight: co-variations in tRNA abundance as a key to unravel conse-quences of silent mutations. Molecular Biosystems 6(10), 1767–1772(2010)

39. O.V. Babenko, S.V. Saakyan, A.F. Brovkina, V.M. Kozlova, V.V.Strelnikov, D.V. Zaletaev, M.V. Nemtsova, Spectrum and frequenciesof RB1 structural defects in retinoblastoma. Mol Biol 36, 487–492(2002)

40. V. Blanquet, C. Turleau, M.S. Gross-Morand, C. Senamaud-Beaufort, F. Doz, C. Besmond, Spectrum of germline mutations inthe RB1 gene: a study of 232 patients with hereditary and non-hereditary retinoblastoma. Hum Mol Genet 4, 383–388 (1995)

41. K.W. Choy, C.P. Pang, C.B. Yu, H.L. Wong, J.S. Ng, D.S. Fan, K.W.Lo, J.T. Chai, J. Wang, W. Fu, D.S. Lam, Loss of heterogensity andmutations are the major mechanism of Rb1 gene inactivation inChinese patients with sporadic retinoblastoma. Hum Mutat 20,408–417 (2002)

42. M. Ata-ur-Rasheed, G.K. Vemuganti, S.G. Honavar, N. Ahmed, S.E.Hasnain, C. Kannabiran, Mutational analysis of the RB1 gene inIndian patients with retinoblastoma. Ophthal Genet 23, 121–128(2002)

43. P. Kadam-Pai, X.Y. Su, J.J. Miranda, A. Soemantri, N. Saha, C.K.Heng, P.S. Lai, Ethnic variations ofa retinoblastoma susceptibilitygene (RB1) polymorphism in eight Asian populations. J Genet 82(1–2), 33–37 (2003)

44. R.H. Barbosa, F.C. Aguiar, M.F. Silva, R.A. Costa, F.R. Vargas, E.Lucena, L.M. de Almeida, M. de Carvalho Souza, C. Bittar, P.Ashton Prolla, C.R. Bonvicino, H.N. Seuánez, Screening of RB1

M. Sabir et al.

alterations in Brazilian patients with retinoblastoma and relatives withretinoma: phenotypic and genotypic associations. Invest OphthalmolVis Sci 7 54(5), 3184–3194 (2013)

45. C.A. Righini, F. De Fraipont, J.F. Timsit, Tumor specificmethylation in saliva: a promising biomarker for early detec-tion of head and neck recurrence. Clinic Cancer Res 13,1179–1185 (2007)

46. P.K. Ha, J.A. Califano, Promoter methylation and inactivation oftumour-suppressor genes in oral squamous-cell carcinoma. LancetOncol 7(1), 77–82 (2006)

47. D.J. Smiraglia, L.H. Smith, J.C. Lang, Differential targets of CpGisland hypermethylation in primary and metastatic head and necksquamous cell carcinoma (HNSCC). J Med Gene 40, 25–33 (2003)

48. F.D. Hong, H.J. Huang, H. To, L.J. Young, A. Oro, R. Bookstein,E.Y. Lee, W.H. Lee, Structure of the human retinoblastoma gene.Proc Natl Acad Sci U S A 86(14), 5502–5506 (1989)

49. D. Yin, D. Xie, W.K. Hofmann, C.W. Miller, K.L. Black, H.P.Koeffler, Methylation, expression and mutation analysis of the cellcycle control genes in human brain tumors. Oncogene 21(54), 8372–8378 (2002)

Genetic and epigenetic analysis of RB1 gene in HNC