retrogen dna sequencingretrogen.net/.../2019/12/retrogendnasequencing.pdf · sanger sequencing...

1
Sanger Sequencing Services | ABI 3730 XL Capillary Sequencer Our sequencing facility is equipped with two different state-of-the-art DNA analysis instruments along with advanced bioinformacs capabili- es that enable us to provide consistent and accurate sequence data at very compeve prices. The 96-capillary Applied Biosystems 3730xl DNA Analyzer is the ideal instrument for Sanger sequencing. This machine features intermediate throughput with accurate base calling and rapid turnaround mes. It is well suited for de novo sequencing, resequencing (mutaon profiling), fragment analysis, and SNP genotyping. PCR Amplificaon and Purificaon Oligo Design and Synthesis Shotgun Library Construcon Subcloning Alignment and Eding Transformaon Finishing and Assembly Colony Picking 96 well Chromatogram Printout Sent by Mail Single Stranded DNA Sequencing Double Stranded DNA Sequencing FDA Submission Sequencing Sequencing Primer Synthesis Plasmid DNA Purificaon 96 Well Plate Plasmid Purificaon PCR Product Purificaon 96 Well Plate PCR Product Purificaon 384 Well Plate PCR Purificaon DNA Sequencing Fast Turnaround Time, results available Monday-Friday by 10:00 am, Saturday by 12:00 pm Free pickup for San Diego, Orange County, and much of Los Angeles Highest quality sequencing data, up to 1,000 bp per reacon (capillary system) Longest reads allow you to finish your project faster with fewer custom primers Fully automated sample loading and data tracking Consistent data from every sequencing run Less template required High throughput capacity of more than 20,000 reacons per week Dedicated & friendly customer service Professional consultaon from our highly experienced genomics staff Confidenality Compeve Pricing ABI 3730 XL DNA Analyzer SEQUENCING SERVICES Standard Sequencing Reacon Premixed Sequencing Reacon 96 Well Plate Sequencing 384 Well Plate Sequencing Ready to Load Reacon 96 Well Ready to Load Reacon BAC, PAC and P1 Ends Sequencing cDNA/Est Library Sequencing Sequencing difficult template (GC, siRNA, and secondary structure) Retrogen, Inc. 6645 Nancy Ridge Dr. San Diego, CA 92121 (800) RETROGEN (858) 455-8411 www.retrogen.com 360 370 380 390 400 410 420 430 440 GA G TTTGGGGAAAAAA GG AAG AA TT C T A TTC T C AA T CC AAT C AAC TC T A T A CGAAAA TTTTCC A TT GT G C AAAA GA C T CCC TT A C AAA T G AAA G TTT

Upload: others

Post on 27-Jun-2020

1 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Retrogen DNA Sequencingretrogen.net/.../2019/12/RetrogenDNASequencing.pdf · Sanger Sequencing Services | ABI 3730 XL Capillary Sequencer Our sequencing facility is equipped with

Sanger Sequencing Services | ABI 3730 XL Capillary SequencerOur sequencing facility is equipped with two different state-of-the-art DNA analysis instruments along with advanced bioinformatics capabili-ties that enable us to provide consistent and accurate sequence data at very competitive prices. The 96-capillary Applied Biosystems 3730xl DNA Analyzer is the ideal instrument for Sanger sequencing. This machine features intermediate throughput with accurate base calling and rapid turnaround times. It is well suited for de novo sequencing, resequencing (mutation profiling), fragment analysis, and SNP genotyping.

PCR Amplification and PurificationOligo Design and SynthesisShotgun Library ConstructionSubcloningAlignment and EditingTransformationFinishing and AssemblyColony Picking 96 wellChromatogram Printout Sent by Mail

Single Stranded DNA Sequencing Double Stranded DNA SequencingFDA Submission SequencingSequencing Primer SynthesisPlasmid DNA Purification96 Well Plate Plasmid PurificationPCR Product Purification96 Well Plate PCR Product Purification384 Well Plate PCR Purification

DNA Sequencing

Fast Turnaround Time, results available Monday-Friday by 10:00 am, Saturday by 12:00 pm

Free pickup for San Diego, Orange County, and much of Los Angeles

Highest quality sequencing data, up to 1,000 bp per reaction (capillary system)

Longest reads allow you to finish your project faster with fewer custom primers

Fully automated sample loading and data tracking

Consistent data from every sequencing run

Less template required

High throughput capacity of more than 20,000 reactions per week

Dedicated & friendly customer service

Professional consultation from our highly experienced genomics staff

Confidentiality

Competitive Pricing

ABI 3730 XL DNA Analyzer

SEQUENCING SERVICESStandard Sequencing ReactionPremixed Sequencing Reaction96 Well Plate Sequencing384 Well Plate SequencingReady to Load Reaction96 Well Ready to Load ReactionBAC, PAC and P1 Ends SequencingcDNA/Est Library SequencingSequencing difficult template (GC, siRNA, and secondary structure)

Retrogen, Inc. 6645 Nancy Ridge Dr. San Diego, CA 92121 (800) RETROGEN (858) 455-8411 www.retrogen.com

360 370 380 390 400 410 420 430 440GAGTTTGGGGAAAAAAGGAAGAATTCTATTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAAATGAAAGTTT