retrogen dna sequencingretrogen.net/.../2019/12/retrogendnasequencing.pdf · sanger sequencing...
TRANSCRIPT
![Page 1: Retrogen DNA Sequencingretrogen.net/.../2019/12/RetrogenDNASequencing.pdf · Sanger Sequencing Services | ABI 3730 XL Capillary Sequencer Our sequencing facility is equipped with](https://reader035.vdocument.in/reader035/viewer/2022081406/5f0f489c7e708231d44364ef/html5/thumbnails/1.jpg)
Sanger Sequencing Services | ABI 3730 XL Capillary SequencerOur sequencing facility is equipped with two different state-of-the-art DNA analysis instruments along with advanced bioinformatics capabili-ties that enable us to provide consistent and accurate sequence data at very competitive prices. The 96-capillary Applied Biosystems 3730xl DNA Analyzer is the ideal instrument for Sanger sequencing. This machine features intermediate throughput with accurate base calling and rapid turnaround times. It is well suited for de novo sequencing, resequencing (mutation profiling), fragment analysis, and SNP genotyping.
PCR Amplification and PurificationOligo Design and SynthesisShotgun Library ConstructionSubcloningAlignment and EditingTransformationFinishing and AssemblyColony Picking 96 wellChromatogram Printout Sent by Mail
Single Stranded DNA Sequencing Double Stranded DNA SequencingFDA Submission SequencingSequencing Primer SynthesisPlasmid DNA Purification96 Well Plate Plasmid PurificationPCR Product Purification96 Well Plate PCR Product Purification384 Well Plate PCR Purification
DNA Sequencing
Fast Turnaround Time, results available Monday-Friday by 10:00 am, Saturday by 12:00 pm
Free pickup for San Diego, Orange County, and much of Los Angeles
Highest quality sequencing data, up to 1,000 bp per reaction (capillary system)
Longest reads allow you to finish your project faster with fewer custom primers
Fully automated sample loading and data tracking
Consistent data from every sequencing run
Less template required
High throughput capacity of more than 20,000 reactions per week
Dedicated & friendly customer service
Professional consultation from our highly experienced genomics staff
Confidentiality
Competitive Pricing
ABI 3730 XL DNA Analyzer
SEQUENCING SERVICESStandard Sequencing ReactionPremixed Sequencing Reaction96 Well Plate Sequencing384 Well Plate SequencingReady to Load Reaction96 Well Ready to Load ReactionBAC, PAC and P1 Ends SequencingcDNA/Est Library SequencingSequencing difficult template (GC, siRNA, and secondary structure)
Retrogen, Inc. 6645 Nancy Ridge Dr. San Diego, CA 92121 (800) RETROGEN (858) 455-8411 www.retrogen.com
360 370 380 390 400 410 420 430 440GAGTTTGGGGAAAAAAGGAAGAATTCTATTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAAATGAAAGTTT