retrograde axon transport of herpes simplex virus and

JOURNAL OF VIROLOGY, Feb. 2010, p. 1504–1512 Vol. 84, No. 30022-538X/10/$12.00 doi:10.1128/JVI.02029-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Retrograde Axon Transport of Herpes Simplex Virus andPseudorabies Virus: a Live-Cell Comparative Analysis�

Sarah Elizabeth Antinone and Gregory Allan Smith*Department of Microbiology-Immunology, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611

Received 25 September 2009/Accepted 9 November 2009

Upon entry, neuroinvasive herpesviruses traffic from axon terminals to the nuclei of neurons resident inperipheral ganglia, where the viral DNA is deposited. A detailed analysis of herpes simplex virus type 1(HSV-1) transport dynamics in axons following entry is currently lacking. Here, time lapse fluorescencemicroscopy was used to compare the postentry viral transport of two neurotropic herpesviruses: HSV-1 andpseudorabies virus (PRV). HSV-1 capsid transport dynamics were indistinguishable from those of PRV and didnot differ in neurons of human, mouse, or avian origin. Simultaneous tracking of capsids and tegumentproteins demonstrated that the composition of actively transporting HSV-1 is remarkably similar to that ofPRV. This quantitative assessment of HSV-1 axon transport following entry demonstrates that HSV-1 and PRVshare a conserved mechanism for postentry retrograde transport in axons and provides the foundation forfurther studies of the retrograde transport process.

Herpes simplex virus type 1 (HSV-1) and the veterinaryherpesvirus pathogen pseudorabies virus (PRV) establish la-tent infections within the peripheral nervous systems (PNS) oftheir hosts. Neurotropic herpesviruses gain access to the PNSat nerve endings present in infected skin or mucosal tissue.Upon entry at the nerve terminal, viral particles are trans-ported in axons toward the neuronal cell body to ultimatelydeposit the viral genome into the nucleus. This process isreferred to as retrograde transport and is critical for the es-tablishment of latency. Following reactivation, progeny viralparticles travel anterogradely from the ganglia toward thenerve terminals, resulting in reinfection of the dermis or otherinnervated tissues. Reactivated infection can manifest in vari-ous forms, including asymptomatic virus shedding or mild focallesions (herpes labialis), or less frequently in more-severe dis-ease (herpes keratitis, encephalitis, and in the case of varicella-zoster virus, shingles).

All herpesviruses consist of an icosahedral capsid that con-tains the viral genome surrounded by a layer of proteins knownas the tegument, which is contained within a membrane enve-lope (33). HSV-1 and PRV capsids disassociate from the viralenvelope (2, 13, 14, 22, 23, 25, 28, 30, 40) and several tegumentproteins (13, 16, 21, 25) upon fusion-mediated entry into cells.However, following entry into epithelial cell lines, the VP1/2and UL37 tegument proteins are detected in association withcytosolic capsids of PRV by immunogold electron microscopy(16) and colocalize with HSV-1 capsids at the nuclear mem-brane by immunofluorescence microscopy (8). In primary sen-sory neurons, VP1/2 and UL37 are observed to be cotrans-ported with PRV capsids during retrograde transport by timelapse fluorescence microscopy (21), and the kinetics of axontransport have been assessed (39).

Although HSV-1 and PRV share similarities in their neuro-tropism in vivo (reviewed in reference 12), studies of axontransport have indicated possible mechanistic differencesrelevant to the underlying cell biology of neural transmis-sion (reviewed in reference 10). As a result, a live-cell anal-ysis comparing PRV and HSV-1 is needed to determine ifaxon transport mechanisms are conserved between the twoneuroinvasive herpesvirus genera: Simplexvirus (HSV-1) andVaricellovirus (PRV). In this study, the retrograde transportprocess that delivers capsids to the nuclei of sensory neuronswas compared for HSV-1 (strains KOS and F) and PRV(strain Becker).

MATERIALS AND METHODS

Plasmid construction. Several plasmids were used as templates for PCR in atwo-step bacterial artificial chromosome (BAC) recombination protocol (46).Plasmids pEP-EGFP-in and pEP-mRFP1-in, a kind gift from Nikolaus Oster-rieder, were used to insert the monomeric fluorescent proteins GFP (greenfluorescent protein) and mRFP1 (monomeric red fluorescent protein 1) intoherpesvirus BAC clones. The pEP-mCherry-in plasmid was derived frompRSET-B/mCherry (35) by duplicating a portion of the mCherry open readingframe (ORF) and inserting the aphAI gene (encoding resistance to kanamycin)and an I-SceI cleavage site between the duplicated sequences. This was achievedby amplifying nucleotides 1 to 472 of the mCherry ORF with primers 5�-GGGGATCCATG-GATTACAAGGATGACGACGATAAGGTGAGCAAGGGCGAGG (BamHI site underlined) and 5�-GGATGCATAGATCTCGGGGTACATCCGCTCG (NsiI and BglII sites underlined). The first primer encodes aFLAG epitope (DYKDDDDK) fused to the amino terminus of mCherry, allow-ing the optional inclusion of the epitope tag when one is inserting mCherry intoBAC plamids. The NsiI site derived from the second primer was used to clonethe PCR product into an endogenous PstI site in the mCherry ORF, producinga 121-nucleotide duplication with a BglII restriction site at the center. The aphAIgene and I-SceI cleavage site cassette from pEP-EGFP-in was subcloned into theBglII site by PCR amplification using primers carrying 5� BglII sites.

Virus construction. PRV-GS847 is a monofluorescent virus that encodesmRFP1 (6) fused to the VP26 capsid protein and has been described previously(39). All HSV-1 recombinants constructed for this study were made using atwo-step recombination protocol (46) performed in the Escherichia coli strainGS1783, which encodes inducible Red and I-SceI activities. GS1783 was trans-formed with either the pKOS37 BAC clone (15) or the pYEbac102 BAC clone(44), and recombination was targeted by homology sequences encoded in the 5�ends of PCR primer pairs. Primers for insertion of the mCherry ORF as atranslational fusion to the 5� end of the HSV-1 UL35 ORF were 5�-CCGACA

* Corresponding author. Mailing address: Department of Microbi-ology-Immunology, Morton Bldg., Rm. 3-603, Northwestern Univer-sity Feinberg School of Medicine, Chicago, IL 60611. Phone: (312)503-3745. Fax: (312) 503-1339. E-mail: [email protected].

� Published ahead of print on 18 November 2009.

1504

on February 16, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

CCCCCATATCGCTTCCCGACCTCCGGTCCCGATGGTGAGCAAGGGCGAGGAGC and 5�-CGGTGGTAACGGTGCTGGGGCGGTGAAATTGCGGGACGGCCTTGTACAGCTCGTCCATGCCG (the UL35 start methioninecodon is in boldface; the sequence homologous to that of the pEP-mCherry-intemplate is underlined). Primers used to produce the mRFP1-UL35 fusion andthe GFP fusions to tegument genes were based on the same design strategy, andtheir sequences are available upon request.

HSV KOS-GS2323 and HSV F-GS2822 encode monofluorescent red-capsidderivatives of HSV-1 strains KOS and F, respectively. HSV KOS-GS2323 en-codes the mCherry red fluorescent protein (35) fused to the N terminus of VP26.HSV F-GS2822 encodes mRFP1 fused to the N terminus of VP26. Two addi-tional monofluorescent viruses, HSV F-GS3351 (GFP-VP11/12) and HSV F-GS3330 (VP16-GFP), encode GFP translational fusions to the indicated tegu-ment protein in HSV-1 strain F. HSV F dual-fluorescent isolates encodingmRFP1-VP26 and either VP1/2-GFP (HSV F-GS2945), GFP-UL37 (HSV F-GS3245), GFP-VP11/12 (HSV F-GS3179), GFP-VP13/14 (HSV F-GS3011),VP16-GFP (HSV F-GS3013), or GFP-VP22 (HSV F-GS3020) were isolated byrecombining the GFP open reading frame into the pGS2822 infectious clone.The GFP coding sequence was inserted between the ATG start codon and thesecond codon of the target ORF for fusions to UL37, VP11/12 (UL46), VP13/14(UL47), and VP22 (UL49). For the VP1/2 (UL36) fusion, the GFP codingsequence was inserted following codon 3164, prior to the stop codon at position3165. For the VP16 (UL48) fusion, the GFP coding sequence was insertedfollowing codon 490, prior to the stop codon at position 491. The recombinantmono- and dual-fluorescent viruses are summarized in Table 1.

Cells and virus propagation. Recombinant PRV strains were derived from thepBecker3 infectious clone (36) and were isolated following electroporation of theinfectious clones into pig kidney epithelial cells (PK15) as described previously(21). Recombinant HSV-1 KOS strains were derived from the HSV-1 pKOS37infectious clone, and recombinant HSV-1 F strains were derived from the HSV-1pYEbac102 infectious clone (15, 44). All HSV-1 strains were initially isolatedfollowing Lipofectamine 2000 (Invitrogen, Carlsbad, CA) transfection of theinfectious clone DNA into African green monkey kidney cells that were stablyexpressing Cre recombinase (Vero-cre cells) to excise the LoxP-flanked BACbackbone (15). Vero-cre cells were maintained every fifth passage in 400 �g/mlhygromycin B (Calbiochem). HSV-1 isolates harvested from Vero-cre cells weresubsequently propagated on Vero cells. Viral titers were measured by plaqueassays performed on Vero cells as previously described (37). Images of 25plaques from each virus strain were acquired with a Nikon Eclipse invertedmicroscope fitted with a 4� objective. To determine the average plaque diam-eter, two orthogonal diameter measurements were analyzed for each plaqueusing the Metamorph software package (Molecular Devices).

Neuronal culture. Dorsal root ganglion (DRG) sensory neurons were isolatedfrom either embryonic chickens (embryonic day 8 [E8] to E11) or embryonicmice (E13 to E15) and were cultured as previously described (38, 39). DRGexplants were grown on poly-DL-ornithine- and laminin-treated coverslips. Neu-rons were cultured for 2 to 3 days prior to viral infection. Human SK-N-SHneuroblastoma cells were maintained according to previously described methods(41). For SK-N-SH differentiation, cells were seeded on poly-DL-ornithine- andlaminin-treated coverslips and were kept in differentiation medium containingretinoic acid (Fluka) for 12 to 14 days, as previously described (41).

Western blot analysis. Six-well trays were seeded with 4.3 � 105 Vero cells perwell and were subsequently infected with fluorescent derivatives of HSV-1 strain

F at a multiplicity of infection (MOI) of 2.0. Lysates were harvested in 500 �l of2� final sample buffer (10 ml of 625 mM Tris [pH 6.8], 10 ml glycerol, 10 mgbromophenol blue, 20 ml 10% sodium dodecyl sulfate [SDS], 50 �l �-mercap-toethanol) at 1 day postinfection (dpi). Due to the low level of expression of theVP1/2-GFP fusion, 3.5 � 106 Vero cells seeded in a 10-cm-diameter dish wereinfected at an MOI of 0.3 with HSV F-GS2945 and were harvested in 500 �l of2� final sample buffer at 8 dpi. All samples were boiled for 3 min; then 15 �l ofeach was separated by SDS-polyacrylamide gel electrophoresis (PAGE) on a4-to-20% polyacrylamide gel and was subsequently transferred to a polyvinyl-idene fluoride membrane (Pall). The membrane was incubated with mouseanti-GFP antibody B-2 (Santa Cruz Biotechnology) diluted 1:1,000, followed byincubation with a horseradish peroxidase-conjugated goat anti-mouse secondaryantibody (Jackson ImmunoResearch) diluted 1:10,000. The horseradish peroxi-dase signal was detected with luminol-coumaric acid-H2O2 chemiluminescence,and the exposed film was digitized using an EDAS 290 documentation system(Kodak).

Fluorescence microscopy and image analysis. All images were acquired withan inverted wide-field Nikon Eclipse TE2000-U microscope using automatedfluorescence filter wheels (Sutter Instruments, Novato, CA), a Cascade 650camera (Photometrics, Roper Scientific), and a 60� 1.4-numerical-aperture oilobjective (Nikon). The microscope was housed in an environmental box main-tained at 37°C (In Vivo Scientific). The Metamorph software package was usedfor image acquisition and processing (Molecular Devices, Downington, PA).

To image extracellular viral particles, Vero cells were seeded 1:10 onto cov-erslips and were infected the following day with 1 � 105 PFU per coverslip. TheMOI was difficult to calculate, because the cells were sparse at the time ofinfection. Two to three days postinfection, static fluorescence images of viralparticles released from Vero cells onto bare regions of the coverslip were cap-tured with sequential exposures to mRFP1 (1 s) and GFP (4 s). The presence ofGFP-tegument emissions from individual capsid-containing extracellular viralparticles was scored using a custom automated image-processing algorithm thatdetected particles based on RFP emissions and determined the presence orabsence of corresponding GFP emissions from the same diffraction-limited emis-sion source. Typically, 10 to 100 puncta were scored per image, with multipleimages analyzed for each sample.

Live-cell imaging of infected primary sensory neurons or SK-N-SH cells wasperformed in sealed chambers as previously described (38). Viral transport inaxons following entry was captured in either chick or mouse DRG explants or indifferentiated SK-N-SH cells for up to 1 h postinfection. Neurons were infectedwith 6 � 106 PFU per coverslip, and time lapse monofluorescent imaging ofmRFP1 emissions was acquired at 10 frames/s (100-ms streaming exposures).Individual capsid transport velocities and run lengths were calculated by kymo-graph analysis. Runs were defined as uninterrupted diagonal lines and weremeasured for the distance traveled (length) and the average velocity (slope). Thefrequency of viral particle retrograde axonal transport was determined by count-ing the number of red fluorescent capsids entering a fixed field of view perminute.

Tegument composition on actively transporting capsids in axons was moni-tored by continuous sequential imaging of mRFP1 and GFP emissions usingautomated excitation and emission filter wheels (Sutter Instruments, Novato,CA) and 100-ms exposures for each channel. In some experiments, endocyticvesicles were labeled by incubating DRG explants with tetramethylrhodamine(TMR)-dextran as previously described (39). Labeled neurons were infected witha GFP-tegument monofluorescent virus, and time lapse imaging of TMR-dextranand GFP emissions was sequentially captured continuously for the first hourpostinfection.

Nuclei present in the center of chick sensory DRG explants were imaged from2 to 3 h following infection with dual-fluorescent viral strains. Capsid and tegu-ment proteins that had accumulated at the nuclear rim were captured withsequential exposures to mRFP1 (1 s) and GFP (4 s).

RESULTS

Isolation of monofluorescent capsid-tagged virus strains. Tostudy the dynamics of HSV-1 capsids in axons, a red fluo-rescent protein was fused in frame to the 5� end of the geneencoding VP26 (UL35) in two commonly studied strains:HSV-1 KOS (mCherry-capsid) and HSV-1 F (mRFP1-capsid).To directly compare HSV-1 capsid transport with that of PRV,a previously described mRFP1-capsid-encoding strain of PRVBecker was included in the study (39). All viruses were derived

TABLE 1. Virus strains

Virus strain Fusion 1 Fusion 2 Titer (PFU/ml)

PRV-GS847 mRFP1-VP26 3.0 � 108

HSV KOS-37 1.0 � 108

HSV KOS-GS2323 mCh-VP26 1.2 � 107

HSV F-YEbac102 7.5 � 108

HSV F-GS2822 mRFP1-VP26 2.8 � 108

HSV F-GS3351 GFP-VP11/12 2.0 � 108

HSV F-GS3330 VP16-GFP 2.0 � 108

HSV F-GS2945 mRFP1-VP26 VP1/2-GFP 6.5 � 107

HSV F-GS3245 mRFP1-VP26 GFP-UL37 6.0 � 107

HSV F-GS3179 mRFP1-VP26 GFP-VP11/12 7.2 � 107

HSV F-GS3011 mRFP1-VP26 GFP-VP13/14 5.5 � 107

HSV F-GS3013 mRFP1-VP26 VP16-GFP 3.1 � 108

HSV F-GS3020 mRFP1-VP26 GFP-VP22 1.6 � 108

VOL. 84, 2010 HSV RETROGRADE AXON TRANSPORT 1505


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

from bacterial artificial chromosome (BAC) clones of the re-spective viruses (15, 36, 44). The PRV Becker mRFP1-capsidvirus replicates to wild-type titers (39), while the titer of theHSV-1 F mRFP1-capsid strain was reduced 3-fold and that ofthe HSV-1 KOS mCherry-capsid was reduced 8-fold relative tothe respective unmodified strains (Table 1).

Viral capsid transport dynamics following entry into cul-tured neurons. Primary sensory DRG neurons isolated fromE8-to-E10 chick embryos were infected with PRV Becker,HSV-1 F, or HSV-1 KOS encoding red capsids, and individualtransported capsids were tracked at 10 frames/s (100 ms expo-sures) in axons by time lapse fluorescence microscopy duringthe first hour postinfection. Avian neurons were initially usedfor these experiments due to their consistent availability and

ease of isolation, which allowed for routine imaging of trans-port events for the multiple viral isolates. Capsids were readilydetected undergoing retrograde transport in chick sensoryneurons, allowing for the tracking and analysis of more than900 uninterrupted transport events, or runs, for each virus. Aspreviously described for PRV, HSV-1 capsids displayed pre-dominantly retrograde motion that was occasionally inter-rupted by pauses and short reversal events (39). Upon directcomparison, HSV-1 and PRV capsids were determined tomove with strikingly similar dynamics (Fig. 1). The velocities ofretrograde runs ranged from 0.5 to 5.0 �m/s, with averagesbetween 2.1 to 2.6 �m/s for all viruses (Fig. 1A). In previousreports, retrograde capsid transport velocities for PRV werereported to be closer to 1.0 �m/s (1, 7, 39). The reason for the

FIG. 1. Capsid transport dynamics in axons. Neurons were infected with red fluorescent capsid strains, and retrogradely transported capsidswere imaged at 10 frames/s (100-ms exposures) in a 58.5-�m by 78-�m field for as long as 1 h following infection. (A) Histograms of capsidtransport velocities in which each data point is the average velocity of a moving capsid during a single run. Values on the x axis are expressed inmicrometers per second. The solid curve in each panel represents the Gaussian best fit, and the dashed curves represent the 95% confidenceinterval. The goodness of fit is indicated by the R2 value. (B) Histograms of capsid run lengths. Values on the x axis are expressed in micrometers.The solid curve is the best-fit decaying exponential, and the dotted curves represent the 95% confidence interval. The goodness of fit is indicatedby the R2 value. Values below 2 �m, which were underrepresented because our temporal resolution was insufficient to resolve short runs, wereexcluded from histograms and curve-fitting analyses but were included in the average run length (bar graph). Run lengths are underestimates dueto the movement of particles out of the focal plane. Values above 30 �m were infrequent, in part due to the field size, and were not included inthe histogram plots but were included in the average run length (bar graph). All histograms are labeled with the cell type at the top left and theviral strain at the top right. Bar graphs represent average capsid velocities (A) and run lengths (B). Letters above bars indicate the neuronal celltype (C, chick DRG; M, mouse DRG; H, human SK-N-SH).

1506 ANTINONE AND SMITH J. VIROL.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

increase in average velocity in the current study is unclear, butit may be explained by changes in the neuron medium formu-lation and improved neuron health following dissection. Therates reported here are consistent with rates of HSV-1 retro-grade transport observed in squid axons (4).

Consistent with the previous PRV studies, transport velocityprofiles for HSV-1 and PRV were accurately modeled byGaussian distributions (an R2 value of 1 would indicate a per-fect fit), indicating that transport occurred at a single optimalrate (Fig. 1A). The average run lengths of individual capsidtransport events ranged from 7.0 to 8.8 �m, with large standarddeviations and frequency distributions that were well modeledby decaying exponentials (R2 values ranged from 0.96 to 0.99[Fig. 1B]). The rapid velocities and decaying exponential pro-files of run lengths are both consistent with processive micro-tubule-based transport, and the tight Gaussian velocity profilesare indicative of the involvement of a single species of micro-tubule motor, most likely dynein (11, 42). When the data setsfrom PRV Becker, HSV-1 KOS, and HSV-1 F were combinedand reanalyzed as a single data set, the transport velocity re-mained well modeled by a Gaussian distribution (R2, 0.99) andthe run lengths by a decaying exponential (R2, 0.99), consistentwith the equivalence of the retrograde transport dynamics ofthese viruses.

Although chick DRG neurons are productively infected byHSV-1 (17), infections in mammalian neurons were next ex-amined in order to assess if avian neurons accurately modeledHSV-1 retrograde axon transport. HSV-1 F capsid traffickingwas examined in primary DRG sensory neurons isolated frommice and in differentiated neuron-like human SK-N-SH cells.SK-N-SH cultures had fewer neuronal cells than primary ex-plants, resulting in less-frequent capsid transport and fewerruns for analysis (n � 105). HSV-1 transport dynamics, interms of both velocity and run length, were equivalent in avianand mammalian neurons, indicating that chick DRG are agood model of the HSV-1 retrograde trafficking in axons(Fig. 1).

The frequency of capsid retrograde transport events, or flux,was assessed for PRV Becker, HSV-1 KOS, and HSV-1 F inchick sensory DRG. Infected neurons were continually imagedduring the first hour following infection, under the conditionsdescribed above, and the flux was determined by averaging

the number of capsids entering the field of view per minute(Fig. 2). Because retrograde capsid flux is proportional tothe amount of input viral inoculum, a normalized multiplic-ity of infection was maintained for these experiments. TheHSV-1 KOS capsid transport frequency was reduced rela-tive to those of PRV Becker and HSV-1 F, which showedsimilar flux. Whether the reduced HSV-1 KOS flux resultedfrom a defect in transport or a defect in an earlier stage ofinfection, such as entry, could not be differentiated in thisassay.

Isolation and characterization of dual-fluorescent HSV-1strains. In previous studies, simultaneous imaging of PRVcapsids and tegument in axons identified a subset of tegumentproteins that remain associated with the capsid during ret-rograde trafficking in neurons (7, 21). To similarly assesswhich tegument proteins are cotransported with HSV-1capsids in axons, a panel of dual-fluorescent recombinantstrains of HSV-1 F was produced. The coding sequence forGFP was inserted into one of several different tegument-en-coding genes of the HSV-1 F BAC that was previously modi-fied to encode RFP-capsids (mRFP1-VP26). Six of the majortegument proteins were examined: VP1/2 (pUL36), pUL37,VP11/12 (pUL46), VP13/14 (pUL47), VP16 (pUL48), and VP22(pUL49) (Table 1). Dual-fluorescent recombinant strains with�1-log reductions in titer from that of the monofluorescentmRFP1-capsid virus were excluded from the study. Analysis ofplaque size revealed minor reductions in the cell-cell spread ofdual-fluorescent viral strains from that of the wild type, with theexception of VP1/2-GFP (36.7% of the wild type) and GFP-VP22 (55% of the wild type), which had more-significantspreading defects (Fig. 3). These two isolates were never-theless included in the study, with the caveat that the resultsobtained with the VP1/2-GFP and GFP-VP22 viruses wouldbe less conclusive, particularly if these recombinant virusesproved to behave differently than the previously describedPRV equivalents (21).

Several assays were used to ensure that the GFP-tegumentfusions were properly expressed. First, the presence of thefusion proteins in infected cell lysates was assessed by Westernblot analysis using an antibody directed against GFP. Equal

FIG. 2. Frequency of capsid transport in axons. Chick sensoryDRG neurons were infected with mRFP1-capsid strains, and 37 to 40recordings were captured within the first hour postinfection for eachvirus. Time lapse recordings were captured at 10 frames/s (100-msexposures) for 50-s intervals. The frequency of transport is reported asthe average number of capsids entering a 58.5-�m by 78-�m field perminute. Error bars represent the standard errors of the means.

FIG. 3. Viral spread in Vero cells. The diameters of 25 plaquesresulting from infection with each recombinant viral strain were mea-sured. All viruses encode mRFP1-VP26 (red capsid) and GFP fused tothe indicated tegument protein. Plaque diameters are presented rela-tive to that of an unmodified HSV-1 F strain (considered the wild type[WT] and assigned a value of 100%). Error bars represent the standarderrors of the means.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

lysate volumes were loaded onto denaturing polyacrylamidegels with the exception of VP1/2-GFP, which required a moreconcentrated sample to detect the full-length protein. Thepresence of two VP1/2-GFP-reactive bands was consistent withposttranslational modification of VP1/2 (27). Two additionalfaster-migrating bands were also detected for VP1/2-GFP, at�90 kDa and �45 kDa (Fig. 4); these may result from pro-teolytic cleavage (18). The other five viruses had prominentbands at the expected molecular mass for the encoded GFPfusion protein (Fig. 4). Second, the localization of each GFP-tegument protein fusion following infection of Vero cells wasconsistent with the findings of previous immunofluorescenceanalyses (data not shown) (26, 27, 29, 31, 34, 50). Third, struc-tural incorporation of the GFP-tegument fusions was moni-tored by fluorescence imaging of individual extracellular viralparticles in situ on a coverslip that had been released fromnearby infected Vero cells, as described previously (2, 21). Foreach virus strain, red fluorescence from individual capsid-con-taining particles was frequently coincident with GFP fluores-cence emissions, indicating the presence of the GFP-tegumentfusion protein in the extracellular viral particle (Fig. 5). Aminority of particles were observed to emit red fluorescenceonly, reflecting a population in which the GFP-labeled proteinis not present or is incorporated at levels below detection.Consistent with this, GFP-VP1/2, which had the lowest level ofvirion incorporation (76.5% of the total), also had the dimmestGFP emissions of the dual-fluorescent HSV-1 recombinants(data not shown) and the weakest reactivity in infected celllysates (Fig. 4). In addition, several GFP-tegument proteins(GFP-VP11/12, GFP-VP13/14, VP16-GFP, and GFP-VP22)expressed from the dual-fluorescent HSV-1 viruses displayedparticle-to-particle variability in fluorescence emission intensi-ties, similar to the heterogeneity in tegument incorporationpreviously described for PRV (9, 21). Also like PRV, allHSV-1 dual-fluorescent viruses produced a subset of particlesemitting GFP fluorescence only (Fig. 5), which we interpret aslight particles (43).

HSV-1 particle composition following entry into sensoryneurons. To determine if HSV-1 tegument proteins remain

associated with capsids during retrograde axon transport, thedual-fluorescent strains of HSV-1 F were used to infect cul-tured chick DRG sensory neurons. Upon infection, mRFP1-capsids were readily detected moving retrogradely in axons

FIG. 5. Incorporation of fluorescent fusion proteins into extracel-lular viral particles. (A) Imaging of individual fluorescent viral parti-cles released from infected Vero cells at 2 to 3 days postinfection.Examples of mRFP1 and GFP emissions from 30-�m by 30-�m fieldsare shown. Viruses encode mRFP1-VP26 (red capsid) and GFP fusedto the indicated tegument protein. (B) Fractions of mRFP1 particlesthat emit GFP fluorescence, as illustrated in panel A. The encodedGFP fusions are given below the graph. Results shown are averages forthree independent experiments, and error bars represent standarddeviations (n, number of capsids).

FIG. 4. Fluorescent fusion protein expression. Lysates from in-fected Vero cells were probed with an anti-GFP antibody and sub-jected to Western blot analysis. Labels at the top of the gel indicate theencoded GFP fusions. All strains additionally encode mRFP1-VP26(red capsid). All lysates were loaded equally except for the VP1/2-GFPstrain lysate, which was eight times more concentrated.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

with dynamics that were consistent with the monofluorescentviruses described in Fig. 1 (data not shown). Continuous se-quential 100-ms exposures of mRFP1 and GFP emissions re-vealed that both VP1/2-GFP and GFP-pUL37 were cotrans-ported with capsids. The frequencies of cotransport withmRFP1-capsids for VP1/2-GFP (75.5%) and GFP-pUL37(92.2%) were consistent with the proportions of extracellularviral particles that had detectable GFP emissions: 76.5% forextracellular VP1/2-GFP particles and 93.1% for GFP-pUL37particles (Fig. 5 and 6). Therefore, no evidence of dissociationof these two tegument proteins from capsids upon infectionwas obtained. In contrast, the remaining four tegument pro-teins examined were frequently observed in extracellular viri-ons (Fig. 5) but were rarely associated with capsids that werebeing transported in axons (Fig. 6). Therefore, a subset ofHSV-1 tegument proteins that includes VP1/2 and pUL37 re-mained associated with capsids that moved retrogradely inaxons, and these proteins are good candidates for effectors ofcapsid transport. These results are consistent with those pre-viously obtained with PRV, which also specifically retains

VP1/2, pUL37, and US3 on capsids during transport, whilelosing VP11/12, VP13/14, VP16, and VP22 (7, 16, 21).

In contrast to PRV transport, a small subpopulation ofHSV-1 mRFP1-capsids was transported together with GFP-VP11/12 (7.5% of the total) and VP16-GFP (12.2% of thetotal) (Fig. 7A) (21). In the case of VP11/12, the frequency ofcotransport increased to 28.4% when GFP was fused to the Cterminus (data not shown). The VP11/12-GFP dual-fluores-cent virus was, however, excluded from this study due to a125-fold reduction in virus titer from that of the wild type. Inaddition to the infrequent detection of GFP-VP11/12 andVP16-GFP cotransport with capsids, infection with these dual-fluorescent HSV-1 strains occasionally produced GFP signalsthat were moving retrogradely independently of capsids (Fig.7B). This tegument-only retrograde transport was observed atthe greatest frequency in the less-tolerated C-terminal fusion,VP11/12-GFP. To determine if GFP-VP11/12 and VP16-GFPsignals resulted from endocytosis, sensory neurons labeled withthe endosomal marker TMR-dextran were subsequently in-fected with monofluorescent strains of HSV-1 encoding eitherGFP-VP11/12 or VP16-GFP. Although this approach can de-tect endocytosed virus particles (39), no occurrences of TMR-dextran cotransport with GFP emissions from either of theseviruses were observed (Fig. 7C).

To examine capsid and tegument association followingtransport, nuclei located in the cell bodies of chick DRG ex-

FIG. 6. Retrograde capsid and tegument protein transport inaxons. (A) Chick sensory DRG neurons were infected with a virusencoding mRFP1-VP26 (red capsid) and GFP fused to the indicatedtegument protein. Axons were imaged during the first hour followinginfection. Frames of alternating mRFP1 (R) and GFP (G) emissionswere captured with continuous 100-ms exposures. Each montageshows an individual mRFP1-capsid moving upward (toward the cellbody). Frames were 2.3 �m by 20.5 �m. (B) Fractions of mRFP1-capsids that are cotransported with the indicated GFP fusion proteins(n, number of capsids tracked).

FIG. 7. Documentation of low-frequency tegument transport eventsfollowing infection of chick sensory DRG neurons. (A and B) VP16and VP11/12 GFP fusion proteins were infrequently observed movingin association with (A) and independently of (B) transporting capsids.Each montage represents individual fluorescent signals moving towardthe cell body. (C) Sensory DRG neurons were stained with TMR-dextran to label endocytic vesicles. Labeled neurons were infected withthe indicated monofluorescent GFP-tegument virus and were imagedfor the first hour following infection. GFP fusion proteins in transportwere not detected in association with labeled endosomes, althoughendosomes were observed to move retrogradely (an example is seen inthe VP11/12 panel). All frames were 2.3 �m by 20.5 �m.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

plants were imaged from 2 to 3 h following infection withdual-fluorescent strains of HSV-1. At this time point, individ-ual mRFP1-capsid emissions had accumulated at nuclear rims.VP1/2-GFP and GFP-UL37 emissions were coincident withdocked mRFP1-capsid signals at frequencies consistent withtheir incorporation into extracellular viral particles (Fig. 5 and8). The remaining GFP-labeled tegument proteins were notdetected in association with capsids that had accumulated atnuclear rims (Fig. 8).

DISCUSSION

Herpesviruses must deliver their DNA to the host nucleus inorder to establish infection. This process is particularly chal-lenging for neurotropic herpesviruses, which have to travellong distances in axons in order to reach the neuronal cellbody. HSV-1 retrograde transport requires intact microtubulesin neurons as well as in nonneuronal cells (20, 24, 42, 47, 48),suggesting a role for the cellular minus-end-directed motordynein. In nonneuronal cells, newly entering HSV-1 capsidscolocalize with cytoplasmic dynein, and capsid targeting to thenucleus is reduced when dynein function is disrupted by over-expression of the dynamitin component of the dynactin com-plex (11).

In this study, time lapse fluorescence microscopy was used totrack individual translocating HSV-1 capsids following infec-tion in neurons. Direct comparisons between PRV and twocommonly studied strains of HSV-1 (KOS and F) revealed thatretrograde transport properties are conserved between theserepresentatives of the two neuroinvasive herpesvirus genera:Simplexvirus (HSV-1) and Varicellovirus (PRV). In addition,HSV-1 capsids moved with the same velocities and run lengthsin primary sensory neurons from chickens and mice, as well as

in a human neuroblastoma cell line that was differentiated inculture to extend axonal projections. These results indicatethat the retrograde transport mechanism is sufficiently con-served across species to allow for productive interactions be-tween the virus and the cellular transport machinery and thatavian and rodent neurons accurately model the retrogradeaxon transport of HSV-1 that occurs in human cells.

Like PRV capsids, HSV-1 capsids were cotransported withthe VP1/2 and pUL37 tegument proteins, and these complexesremained intact after reaching the nuclear membrane, whilethe VP11/12, VP13/14, VP16, and VP22 tegument componentswere predominantly lost prior to the onset of retrograde move-ment. Consistent with these findings, VP1/2 and pUL37 colo-calize with HSV-1 capsids at the nuclear membranes of epi-thelial cells (8), and VP1/2 is required for DNA deposition intothe nucleus (3, 18, 32). The data presented here complementthese findings and further show that HSV-1 undergoes a dis-assembly process similar to that of PRV, with the resultingtransport complexes conserved between the two viruses (21).However, subtle differences between HSV-1 and PRV werenoted. In contrast to the findings for PRV in previous studies,the dissociation of HSV-1 VP16 and VP11/12 was not com-plete; a minority of HSV-1 capsids were cotransported withthese proteins when they were fused to GFP. Coincidentally,GFP-VP11/12 and VP16-GFP fusions were also seen to movein axons independently of capsid signals.

Although the significance of these observations is unclear,they may be of value for considering the process by whichHSV-1 establishes latency. The presence of a small amount ofcotransported VP16 may help to explain why, upon initialseeding of the nervous system, some neurons establish an acutefeedback loop that sends progeny virions back to peripheralinnervated tissues, while other neurons become latently in-

FIG. 8. Capsid and tegument protein accumulation at the nuclear rims of infected sensory DRG neurons following transport. Chick sensoryDRG neurons were infected with HSV-1 encoding mRFP1-VP26 (red capsid) and GFP fused to the indicated tegument protein. A minimum of13 nuclei present in the center of the DRG explant were imaged from 2 to 3 h postinfection. Differential interference contrast (DIC) andfluorescence images of representative nuclei are shown. The percentages of capsids that also emit green fluorescence are given below the images(n, number of capsids). All images were 14.4 �m by 14.4 �m.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

fected (5, 45). The difference in neuron fate could be attrib-uted to small doses of VP16 delivered to the neural soma byvariable numbers of retrogradely moving capsids. Consistentwith such a model, VP16 was absent from capsids docked atthe nuclear membrane, indicating that this tegument protein isreleased from capsids following axon transport. Additionalstudies will be needed to determine the fate of the input VP16and if, in fact, it is nuclear. However, alternative explanationsof the VP16 and VP11/12 retrograde transport must also beconsidered. The finding that fusing GFP to the opposite end ofVP11/12 both attenuates the propagation of the virus morethan 100-fold and results in a nearly 4-fold increase in GFPemissions from capsids in transport suggests that the disasso-ciation of VP11/12, and possibly that of VP16, can be impairedwhen the protein is fused to GFP.

The source of the transport of VP11/12 and VP16 in axonsindependently from capsids is mysterious. Our initial suspicionwas that L-particles may be endocytosed occasionally at theterminal axon. However, the other tegument proteins exam-ined (UL37, VP1/2, VP13/14, and VP22) are all constituents ofL-particles yet were never observed moving in axons apartfrom capsids, and an endocytic tracer further helped to ruleout this possibility. Whether this phenomenon has biologicalsignificance will require further study. We note that, consistentwith the observations reported here, an earlier study of atruncated HSV-1 VP16-GFP fusion construct saw retrogrademotion following microinjection into squid axons (4).

The conservation of VP1/2 and pUL37 association withHSV-1 and PRV capsids in transport suggests a functional rolefor these proteins in the recruitment of the dynein micro-tubule motor complex. Consistent with this, detergent-ex-tracted HSV-1 virions having exposed VP1/2 and pUL37 binddynein motor components when mixed with cytosolic extractsand show enhanced movement in an in vitro motility assay (49).However, because VP1/2 is required for HSV-1 and PRVpropagation, its role in retrograde transport has not been di-rectly assessed. The pUL37 tegument protein is also requiredfor propagation of HSV-1, but low titers of PRV lackingpUL37 can be obtained and were recently found to delivercapsids to the nuclei of nonneuronal cells poorly, which mayindicate a role for pUL37 in retrograde transport (19).

This study demonstrates that the processes of retrograde axontransport for HSV-1 and PRV are strikingly conserved and hostspecies independent. Whereas the dynamics of HSV-1 retro-grade transport in axons had not been examined in detail priorto this study, our understanding of the mechanism of HSV-1egress from neurons is complicated by incongruous reports(reviewed in reference 10). We are pursuing a follow-up live-cell study comparing HSV-1 and PRV anterograde axon trans-port in order to better understand this late stage of neuroninfection.

ACKNOWLEDGMENTS

We thank Mindy Leelawong, Andrew Karaba, and Jenifer Klabisfor help with the construction of mono- and dual-fluorescent HSV-1strains, Nikolaus Osterrieder for providing the pEP-EGFP-in andpEP-mRFP1-in plasmids, David Leib for providing the pKOS37 infec-tious clone, Yasushi Kawaguchi for providing the pYEbac102 infec-tious clone, and Kevin Bohannon for critical evaluation of the manu-script.

This work was supported by a grant from the Cold Sore ResearchFoundation and NIH grant 2R56 AI056346 (to G.A.S.). S.E.A. wassupported in part by the training program in the Cellular and Molec-ular Basis of Disease from the National Institutes of Health (T32GM08061).

REFERENCES

1. Antinone, S. E., G. T. Shubeita, K. E. Coller, J. I. Lee, S. Haverlock-Moyns,S. P. Gross, and G. A. Smith. 2006. The herpesvirus capsid surface protein,VP26, and the majority of the tegument proteins are dispensable for capsidtransport toward the nucleus. J. Virol. 80:5494–5498.

2. Antinone, S. E., and G. A. Smith. 2006. Two modes of herpesvirus traffickingin neurons: membrane acquisition directs motion. J. Virol. 80:11235–11240.

3. Batterson, W., D. Furlong, and B. Roizman. 1983. Molecular genetics ofherpes simplex virus. VIII. Further characterization of a temperature-sensi-tive mutant defective in release of viral DNA and in other stages of the viralreproductive cycle. J. Virol. 45:397–407.

4. Bearer, E. L., X. O. Breakefield, D. Schuback, T. S. Reese, and J. H. LaVail.2000. Retrograde axonal transport of herpes simplex virus: evidence for asingle mechanism and a role for tegument. Proc. Natl. Acad. Sci. U. S. A.97:8146–8150.

5. Blyth, W. A., D. A. Harbour, and T. J. Hill. 1984. Pathogenesis of zosteriformspread of herpes simplex virus in the mouse. J. Gen. Virol. 65:1477–1486.

6. Campbell, R. E., O. Tour, A. E. Palmer, P. A. Steinbach, G. S. Baird, D. A.Zacharias, and R. Y. Tsien. 2002. A monomeric red fluorescent protein.Proc. Natl. Acad. Sci. U. S. A. 99:7877–7882.

7. Coller, K. E., and G. A. Smith. 2008. Two viral kinases are required forsustained long distance axon transport of a neuroinvasive herpesvirus. Traffic9:1458–1470.

8. Copeland, A. M., W. W. Newcomb, and J. C. Brown. 2009. Herpes simplexvirus replication: roles of viral proteins and nucleoporins in capsid-nucleusattachment. J. Virol. 83:1660–1668.

9. del Rio, T., T. H. Ch’ng, E. A. Flood, S. P. Gross, and L. W. Enquist. 2005.Heterogeneity of a fluorescent tegument component in single pseudorabiesvirus virions and enveloped axonal assemblies. J. Virol. 79:3903–3919.

10. Diefenbach, R. J., M. Miranda-Saksena, M. W. Douglas, and A. L. Cun-ningham. 2008. Transport and egress of herpes simplex virus in neurons.Rev. Med. Virol. 18:35–51.

11. Dohner, K., A. Wolfstein, U. Prank, C. Echeverri, D. Dujardin, R. Vallee,and B. Sodeik. 2002. Function of dynein and dynactin in herpes simplex viruscapsid transport. Mol. Biol. Cell 13:2795–2809.

12. Enquist, L. W., P. J. Husak, B. W. Banfield, and G. A. Smith. 1998. Infectionand spread of alphaherpesviruses in the nervous system. Adv. Virus Res.51:237–347.

13. Fuller, A. O., R. E. Santos, and P. G. Spear. 1989. Neutralizing antibodiesspecific for glycoprotein H of herpes simplex virus permit viral attachment tocells but prevent penetration. J. Virol. 63:3435–3443.

14. Fuller, A. O., and P. G. Spear. 1987. Anti-glycoprotein D antibodies thatpermit adsorption but block infection by herpes simplex virus 1 preventvirion-cell fusion at the cell surface. Proc. Natl. Acad. Sci. U. S. A. 84:5454–5458.

15. Gierasch, W. W., D. L. Zimmerman, S. L. Ward, T. K. Vanheyningen, J. D.Romine, and D. A. Leib. 2006. Construction and characterization of bacterialartificial chromosomes containing HSV-1 strains 17 and KOS. J. Virol.Methods 135:197–206.

16. Granzow, H., B. G. Klupp, and T. C. Mettenleiter. 2005. Entry of pseudo-rabies virus: an immunogold-labeling study. J. Virol. 79:3200–3205.

17. Hill, T. J., and H. J. Field. 1973. The interaction of herpes simplex virus withcultures of peripheral nervous tissue: an electron microscopic study. J. Gen.Virol. 21:123–133.

18. Jovasevic, V., L. Liang, and B. Roizman. 2008. Proteolytic cleavage of VP1-2is required for release of herpes simplex virus 1 DNA into the nucleus.J. Virol. 82:3311–3319.

19. Krautwald, M., W. Fuchs, B. G. Klupp, and T. C. Mettenleiter. 2009. Trans-location of incoming pseudorabies virus capsids to the cell nucleus is delayedin the absence of tegument protein pUL37. J. Virol. 83:3389–3396.

20. Kristensson, K., E. Lycke, M. Roytta, B. Svennerholm, and A. Vahlne. 1986.Neuritic transport of herpes simplex virus in rat sensory neurons in vitro.Effects of substances interacting with microtubular function and axonal flow[nocodazole, taxol and erythro-9-3-(2-hydroxynonyl)adenine]. J. Gen. Virol.67:2023–2028.

21. Luxton, G. W., S. Haverlock, K. E. Coller, S. E. Antinone, A. Pincetic, andG. A. Smith. 2005. Targeting of herpesvirus capsid transport in axons iscoupled to association with specific sets of tegument proteins. Proc. Natl.Acad. Sci. U. S. A. 102:5832–5837.

22. Lycke, E., B. Hamark, M. Johansson, A. Krotochwil, J. Lycke, and B. Sven-nerholm. 1988. Herpes simplex virus infection of the human sensory neuron.An electron microscopy study. Arch. Virol. 101:87–104.

23. Lycke, E., K. Kristensson, B. Svennerholm, A. Vahlne, and R. Ziegler. 1984.Uptake and transport of herpes simplex virus in neurites of rat dorsal rootganglia cells in culture. J. Gen. Virol. 65:55–64.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

24. Mabit, H., M. Y. Nakano, U. Prank, B. Saam, K. Dohner, B. Sodeik, andU. F. Greber. 2002. Intact microtubules support adenovirus and herpessimplex virus infections. J. Virol. 76:9962–9971.

25. Maurer, U. E., B. Sodeik, and K. Grunewald. 2008. Native 3D intermediatesof membrane fusion in herpes simplex virus 1 entry. Proc. Natl. Acad. Sci.U. S. A. 105:10559–10564.

26. McLauchlan, J., K. Liefkens, and N. D. Stow. 1994. The herpes simplex virustype 1 UL37 gene product is a component of virus particles. J. Gen. Virol.75:2047–2052.

27. McNabb, D. S., and R. J. Courtney. 1992. Characterization of the largetegument protein (ICP1/2) of herpes simplex virus type 1. Virology 190:221–232.

28. Morgan, C., H. M. Rose, and B. Mednis. 1968. Electron microscopy ofherpes simplex virus. I. Entry. J. Virol. 2:507–516.

29. Morrison, E. E., A. J. Stevenson, Y. F. Wang, and D. M. Meredith. 1998.Differences in the intracellular localization and fate of herpes simplex virustegument proteins early in the infection of Vero cells. J. Gen. Virol. 79:2517–2528.

30. Nicola, A. V., J. Hou, E. O. Major, and S. E. Straus. 2005. Herpes simplexvirus type 1 enters human epidermal keratinocytes, but not neurons, via apH-dependent endocytic pathway. J. Virol. 79:7609–7616.

31. Pomeranz, L. E., and J. A. Blaho. 1999. Modified VP22 localizes to the cellnucleus during synchronized herpes simplex virus type 1 infection. J. Virol.73:6769–6781.

32. Roberts, A. P., F. Abaitua, P. O’Hare, D. McNab, F. J. Rixon, and D.Pasdeloup. 2009. Differing roles of inner tegument proteins pUL36 andpUL37 during entry of herpes simplex virus type 1. J. Virol. 83:105–116.

33. Roizman, B. N., and A. E. Sears. 1996. Herpes simplex viruses and theirreplication, p. 2231–2295. In B. N. Fields, D. M. Knipe, P. M. Howley, R. M.Chanock, J. L. Melnick, T. P. Monath, B. Roizman, and S. E. Straus (ed.),Fields virology. Lippincott-Raven, Philadelphia, PA.

34. Schmitz, J. B., A. G. Albright, P. R. Kinchington, and F. J. Jenkins. 1995.The UL37 protein of herpes simplex virus type 1 is associated with thetegument of purified virions. Virology 206:1055–1065.

35. Shaner, N. C., R. E. Campbell, P. A. Steinbach, B. N. Giepmans, A. E.Palmer, and R. Y. Tsien. 2004. Improved monomeric red, orange and yellowfluorescent proteins derived from Discosoma sp. red fluorescent protein.Nat. Biotechnol. 22:1567–1572.

36. Smith, G. A., and L. W. Enquist. 2000. A self-recombining bacterial artificialchromosome and its application for analysis of herpesvirus pathogenesis.Proc. Natl. Acad. Sci. U. S. A. 97:4873–4878.

37. Smith, G. A., and L. W. Enquist. 1999. Construction and transposon mu-tagenesis in Escherichia coli of a full-length infectious clone of pseudorabiesvirus, an alphaherpesvirus. J. Virol. 73:6405–6414.

38. Smith, G. A., S. P. Gross, and L. W. Enquist. 2001. Herpesviruses usebidirectional fast-axonal transport to spread in sensory neurons. Proc. Natl.Acad. Sci. U. S. A. 98:3466–3470.

39. Smith, G. A., L. Pomeranz, S. P. Gross, and L. W. Enquist. 2004. Localmodulation of plus-end transport targets herpesvirus entry and egress insensory axons. Proc. Natl. Acad. Sci. U. S. A. 101:16034–16039.

40. Smith, J. D., and E. de Harven. 1974. Herpes simplex virus and humancytomegalovirus replication in WI-38 cells. II. An ultrastructural study ofviral penetration. J. Virol. 14:945–956.

41. Snyder, A., T. W. Wisner, and D. C. Johnson. 2006. Herpes simplex viruscapsids are transported in neuronal axons without an envelope containingthe viral glycoproteins. J. Virol. 80:11165–11177.

42. Sodeik, B., M. W. Ebersold, and A. Helenius. 1997. Microtubule-mediatedtransport of incoming herpes simplex virus 1 capsids to the nucleus. J. CellBiol. 136:1007–1021.

43. Szilagyi, J. F., and C. Cunningham. 1991. Identification and characterizationof a novel non-infectious herpes simplex virus-related particle. J. Gen. Virol.72:661–668.

44. Tanaka, M., H. Kagawa, Y. Yamanashi, T. Sata, and Y. Kawaguchi. 2003.Construction of an excisable bacterial artificial chromosome containing afull-length infectious clone of herpes simplex virus type 1: viruses reconsti-tuted from the clone exhibit wild-type properties in vitro and in vivo. J. Virol.77:1382–1391.

45. Thompson, R. L., C. M. Preston, and N. M. Sawtell. 2009. De novo synthesisof VP16 coordinates the exit from HSV latency in vivo. PLoS Pathog.5:e1000352.

46. Tischer, B. K., J. von Einem, B. Kaufer, and N. Osterrieder. 2006. Two-stepred-mediated recombination for versatile high-efficiency markerless DNAmanipulation in Escherichia coli. Biotechniques 40:191–197.

47. Topp, K. S., K. Bisla, N. D. Saks, and J. H. Lavail. 1996. Centripetaltransport of herpes simplex virus in human retinal pigment epithelial cells invitro. Neuroscience 71:1133–1144.

48. Topp, K. S., L. B. Meade, and J. H. LaVail. 1994. Microtubule polarity in theperipheral processes of trigeminal ganglion cells: relevance for the retro-grade transport of herpes simplex virus. J. Neurosci. 14:318–325.

49. Wolfstein, A., C. H. Nagel, K. Radtke, K. Dohner, V. J. Allan, and B. Sodeik.2006. The inner tegument promotes herpes simplex virus capsid motilityalong microtubules in vitro. Traffic 7:227–237.

50. Yedowitz, J. C., A. Kotsakis, E. F. Schlegel, and J. A. Blaho. 2005. Nuclearlocalizations of the herpes simplex virus type 1 tegument proteins VP13/14,vhs, and VP16 precede VP22-dependent microtubule reorganization andVP22 nuclear import. J. Virol. 79:4730–4743.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

retrograde axon transport of herpes simplex virus and

Documents