rna interference of cofilin in chinese hamster ovary cells improves recombinant protein productivity

ARTICLE

RNA Interference of Cofilin in ChineseHamster Ovary Cells Improves RecombinantProtein Productivity

Stephanie Hammond, Kelvin H. Lee

Department of Chemical Engineering and Delaware Biotechnology Institute,

University of Delaware, Newark, Delaware 19711; telephone: 302-831-0344;

fax: 302-831-4841; e-mail: [email protected]

Received 5 April 2011; revision received 4 August 2011; accepted 31 August 2011

Published online 13 September 2011 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/bit.23322

ABSTRACT: RNA interference (RNAi) has been recentlyapplied to improve the yield and quality of recombinantproteins produced in Chinese hamster ovary (CHO) cells,the most commonly used mammalian cell line for produc-tion of complex biopharmaceuticals. Proteomic profiling ofCHO cells undergoing gene amplification identified cofilin,a key regulatory protein of actin cytoskeletal dynamics, as acellular target for genetic engineering studies. Transientreduction of cofilin by small interfering RNA (siRNA)enhanced specific productivity in recombinant CHO cellsby up to 80%. CHO cell lines expressing cofilin-specificshort hairpin RNA (shRNA) vectors showed up to a 65%increase in specific productivity. These results suggest thatmodulation of cofilin, and its regulatory pathways, may be anew approach to enhance recombinant protein productivityin CHO cells.

Biotechnol. Bioeng. 2012;109: 528–535.

� 2011 Wiley Periodicals, Inc.

KEYWORDS: CHO cells; cofilin; actin cytoskeleton; RNAinterference

Introduction

Chinese hamster ovary (CHO) cells are the most commonlyused mammalian cell line for production of biopharmaceu-tical proteins that require proper folding and glycosylationfor full activity (Wurm, 2004). Generation of hyperpro-ductive CHO cell lines likely involves the coordinatedre-programming of multiple metabolic, secretory, andsignaling pathways (Dinnis and James, 2005). Gene silencingusing RNA interference (RNAi) technology is a recentapproach to alter signaling and metabolic pathways in CHOcells. CHO cell lines with improved viability, enhancedrecombinant protein expression and stability, and increasedefficacy of monoclonal antibodies were recently generatedusing RNAi technology (Wu, 2009).

Transcriptome and proteome profiling of production celllines are commonly used to identify changes in geneexpression and reveal potential genetic targets for metabolicengineering. One of themajor functional classes identified insuch studies are cytoskeletal proteins. The altered expressionof cytoskeletal proteins are thought to impact many cellularprocesses linked to recombinant protein productivityincluding transcription, cell cycle progression, metabolism,and secretory vesicle transport. Differential expression ofcytoskeletal proteins was observed in modified or geneamplified cell lines (Carlage et al., 2009; Kuystermans et al.,2010; Meleady et al., 2008; Smales et al., 2004) and underculture conditions known to enhance cellular productivitysuch as reduced culture temperature and butyrate treatment(Kantardjieff et al., 2010; Kumar et al., 2008). Duringmethotrexate (MTX)-amplification of CHO cells expressinghuman secreted alkaline phosphatase (SEAP), expression ofthe actin-binding protein cofilin was found to decreasenearly 10-fold as specific SEAP productivity increased(Hayduk and Lee, 2005).

Proteins of the actin depolymerizing factor (ADF)/cofilinfamily are ubiquitously expressed and highly conservedactin-binding proteins. Three isoforms are differentiallyexpressed in mammals: cofilin 2 in muscle cells, cofilin 1 innon-muscle cells, and ADF in epithelial and endothelial cells(Vartiainen et al., 2002). While cofilin 1 and ADF are co-expressed in cultured non-muscle mammalian cell lines,cofilin 1 is the more abundant isoform (Hotulainen et al.,2005). Binding of ADF/cofilin to actin filaments acceleratesactin filament turnover by promoting subunit dissociationfrom filament ends and/or by severing actin filaments, whichgenerates free barbed ends essential for efficient actinpolymerization (Andrianantoandro and Pollard, 2006;Hotulainen et al., 2005; Ichetovkin et al., 2002). WhetherADF/cofilin activity increases or decreases net actinpolymerization depends on the relative concentrationsof cofilin, actin, and barbed-end capping proteins(Andrianantoandro and Pollard, 2006). Actin cytoskeletonCorrespondence to: K. H. Lee

528 Biotechnology and Bioengineering, Vol. 109, No. 2, February, 2012 � 2011 Wiley Periodicals, Inc.

dynamics generated by cofilin activity underlie diversecellular processes including directional cell migration(Nishita et al., 2005), cell division and cell cycle progression(Hotulainen et al., 2005; Tsai et al., 2009), response tostimulation (Lee et al., 2000), and intracellular sorting andvesicular trafficking (von Blume et al., 2009).

RNAi provides an attractive approach for silencing genetargets identified from genome-wide expression studies inrational cell line engineering. Here, RNAi is used as a geneticapproach to reduce cofilin levels in CHO cells expressingSEAP and tissue plasminogen activator (tPA) to furtherenhance recombinant protein production. Both smallinterfering RNA (siRNA) and short hairpin RNA(shRNA) enhance the specific productivity of recombinantCHO cell lines.

Materials and Methods

Cell Culture

CHO-K1 cells were maintained as adherent cultures inIscove’s Modified Dulbecco’s Medium (IMDM, HyClone,Logan, UT) supplemented with 10% dialyzed fetal bovineserum (dFBS, Invitrogen, Carlsbad, CA). CHO-SEAP(Hayduk and Lee, 2005) and CHO-tPA cells (ATCCCRL-9606) were maintained as adherent cultures inIMDM supplemented with 10% dFBS and 50 nM metho-trexate (Calbiochem, San Diego, CA). CHO-SEAP cells wereadapted to suspension culture in 125mL shake flasks. Todetermine growth rates of adherent cells, CHO cells wereplated in six-well plates at 0.05� 106 cells and viable cellcounts, determined by trypan blue exclusion, were obtainedevery 2 days over a 10-day culture period. Average growthrates were calculated as previously described (Rasmussenet al., 1998).

RNAi Design and Transfection

CHO-K1 cDNA was prepared using the SuperScript IIICellsDirect cDNA synthesis kit (Invitrogen). Cofilin 1 cDNAwas amplified from CHO-K1 cDNA using the PCR primers50-AAACATGGCCTCTGGTGTG-30 and 50-ACAAAGGCT-TGCCCTCCAG-30, designed against conserved regionsbetween mouse (NM_007687) and rat (NM_017147) cofilin1 sequences.

Two siRNAs (50-GAAGAACAUCAUCCUGGAG-30 and50-CUAACUGCUACGAGGAGGU-30) and a non-specificcontrol (NC) siRNA (siRNA Universal Negative Control #1)were purchased from Sigma–Aldrich (St. Louis, MO).Adherent CHO-SEAP and CHO-tPA cells were transfectedwith 90 nM siRNA using Lipofectamine 2000 (Invitrogen)either once or twice on 2 consecutive days. SuspensionCHO-SEAP cells were transfected in 50mL CultiFlaskbioreactors (Sartorius Stedim Biotech, Gottingen,Germany) with 90 nM siRNA using Lipofectamine 2000.

Transfected cells were first cultured for 48 h to allow siRNA-mediated silencing and then incubated an additional24–48 h before assaying for cofilin protein depletion andrecombinant protein productivity.

shRNA vectors were generated by cloning siRNA codingsequences into the GeneSilencer pGSH1-GFP shRNAexpression vector (Genlantis, San Diego, CA). Briefly,DNA oligos (Integrated DNA Technologies, Coralville, IA)were annealed and inserted into the linearized pGSH1-GFPvector. Oligos used for the pGSH1-GFP-S1 vector were50-GATCCGCTAA CTGCTACGAG GAGGTGAAGCTTGACCTCCT CGTAGCAGTT AGTTTTTTGG AAGC-30 and 50-GGCCGCTTCC AAAAAACAAA CTGCTACGAGGAGGTCAAGC TTCACCTCCT CGTAGCAGTT TGCG-30. Oligos used for the pGSH1-GFP-S2 vector were50-GATCCGAAGA ACATCATCCT GGAGGAAGCTTGCTCCAGGA TGATGTTCTT CTTTTTTGGA AGC-30

and 50-GGCCGCTTCC AAAAAAGAAG AACATCATCCTGGAGCAAGC TTCCTCCAGG ATGATGTTCT TCG-30.An empty pGSH1-GFP vector was used as a negativecontrol. Adherent CHO-SEAP and CHO-tPA cells wereco-transfected with shRNA plasmid vectors and pcDNA3.1/Zeo (Invitrogen) with 4mg total plasmid DNA usingLipofectamine 2000. Positive cells were selected by500mg/mL zeocin (Invitrogen).

Western Analysis

CHO cells were resuspended at 1.0� 106 cells/mL in coldphosphate-buffered saline (PBS), lysed with 5� SDS samplebuffer (50% glycerol, 5% SDS, 0.1% bromophenol blue in0.25M Tris), and heated at 958C for 5min. Samples weresubjected to electrophoresis on 12% T acrylamide SDS gelsand transferred to Immobilon P membrane (Millipore,Bedford, MA). Samples were probed with anti-cofilin(1:1,000, Sigma–Aldrich), anti-ADF (1:500, Sigma–Aldrich), and anti-b-actin (1:2,000, Sigma–Aldrich) fol-lowed by detection with alkaline phosphatase-conjugatedsecondary antibodies (1:33,000, Sigma–Aldrich). Westernblots were developed using enhanced chemifluorescencesubstrate (GE Amersham Biosciences, Piscataway, NJ) andimaged using a FLA-3000 Fujifilm scanner. Quantitativeanalysis was performed with ImageMaster 2D PlatinumSoftware v5.0 (GE Amersham Biosciences).

Recombinant Protein Production

Activity assays were used to monitor protein productionfrom the supernatant of adherent and suspension cells.SEAP production was measured by dispensing 50mL ofCHO-SEAP culture supernatant, after dilution into IMDMand heat-inactivation for 30min at 658C, into a 96-well plateand adding 50mL of alkaline phosphatase yellow liquidsubstrate (Sigma–Aldrich). tPA production was measuredby dispensing 8mL of CHO-tPA culture supernatant into a96-well plate and adding 72mL of Tris buffer (30mM Tris,

Hammond and Lee: Cofilin RNAi in CHO Cells 529

Biotechnology and Bioengineering

30mM imidazole, 130mM NaCl, pH 8.4) and 20mL of tPAchromogenic substrate (Sigma–Aldrich). The activity assayswere monitored by measuring absorbance at 405 nm at 378Cusing a Molecular Devices VersaMax microplate reader.Human placental alkaline phosphatase (Type XXIV, Sigma–Aldrich) and recombinant human tPA (Oxford BiomedicalResearch, Oxford, MI) standards were assayed in paralleland used to construct standard curves. Specific productivitywas calculated by normalizing by time and cell number.

Immunofluorescence

CHO cells cultured in Lab-Tek II Chambers (Nalge NuncInternational, Naperville, IL) were fixed with 4% parafor-maldehyde (Electron Microscopy Supplies, Hatfield, PA) inPBS for 10min at room temperature (RT) and quenchedwith 10mg/mL bovine serum albumin (BSA) in PBS for10min at RT. Fixed cells were permeabilized with 0.1%TritonX-100 (Sigma–Aldrich) and labeled first with eitheranti-ADF or anti-cofilin (Sigma–Aldrich) followed by AlexaFluor 555-conjugated secondary antibody (Invitrogen). Theactin cytoskeleton was labeled with Alexa Fluor 647-phalloidin (Invitrogen) and cell nuclei were counterstainedwith DAPI (Invitrogen). Samples were imaged using a ZeissLSM 510 NLO laser scanning microscope.

Results

Cofilin Expression in CHO Cells

The expression and subcellular localization of ADF/cofilinproteins in CHO cell lines was first examined. All three cell

lines investigated expressed both ADF and cofilin, althoughexpression of these proteins was higher in CHO-K1 cellsthan either recombinant CHO cell line (Fig. 1A). Both ADFand cofilin showed labeling throughout the cytoplasm inaddition to nuclear labeling in CHO-K1 cells and cofilinlocalization was similar in recombinant CHO cell lines(Fig. 1B). This distribution is consistent with previousobservations in CHO-AA8 cells (Grzanka et al., 2010),MTLn3 mammary carcinoma cells (Chan et al., 2000), andfibroblasts (Dawe et al., 2003; Hotulainen et al., 2005).

Transient Silencing of Cofilin Using siRNA

A partial cofilin 1 cDNA sequence was cloned and sequencedfrom CHO-K1 cells and used to design siRNAs targeting twodifferent positions. These siRNA sequences were transfectedindividually (S1 or S2) or co-transfected together (S12) intorecombinant CHO cell lines. Adherent CHO-SEAP andCHO-tPA cells were transfected with cofilin-specific (S1, S2,S12) or non-specific control (NC) siRNAs and assayed foreffects on recombinant protein production 72–96 h post-transfection. In CHO-SEAP cells, a 57% (S2) to 77% (S12)reduction in cofilin expression (Fig. 2A) and a 59% (S2) to81% (S1) increase in specific SEAP productivity (Fig. 2B)was observed in cells treated with cofilin-specific siRNAcompared to a NC siRNA. CHO-tPA cells transfected withan siRNA targeting cofilin showed a 45% (S2) to 62% (S1)reduction in cofilin expression (Fig. 2C) and a 41% (S12)to 49% (S1) enhancement of specific tPA productivity(Fig. 2D) compared to a NC siRNA.

To examine the effects of cofilin reduction in suspensioncells, adherent CHO-SEAP cells were adapted into suspen-sion culture. Suspension CHO-SEAP cells were transfected

Figure 1. Expression and localization of ADF/cofilin in CHO cell lines. A: Expression of ADF/cofilin in CHO cell lines analyzed by Western blotting. b-Actin was used as a

loading control. B: Subcellular distribution of ADF/cofilin proteins in CHO cells. CHO-K1 cells were labeled with anti-ADF and anti-cofilin. CHO-SEAP and CHO-tPA cells were labeled

with anti-cofilin. Nuclei were counterstained with DAPI. Scale bar represents 10mM.

530 Biotechnology and Bioengineering, Vol. 109, No. 2, February, 2012

with cofilin-specific (S1, S2, S12) or NC siRNAs andrecombinant protein production was assayed 72–96 h post-transfection. A 34% (S2) to 47% (S1) reduction in cofilinexpression (Fig. 3A) and an 8% (S2) to 55% (S1) increase inspecific productivity (Fig. 3B) was observed in suspensioncells treated with cofilin-specific siRNA.

Stable Reduction of Cofilin by shRNA

Effective siRNA sequences can be incorporated into shRNAvectors for stable expression as demonstrated in severalstudies of sialidase gene silencing in CHO cells (Ngantunget al., 2006; Zhang et al., 2010). To generate cell lines withlong-term cofilin depletion, siRNA sequences were clonedinto GeneSilencer shRNA expression vectors. These plas-mids allow the continual production of shRNAs, which areprocessed inside the cell into siRNAs, and also express GFPfor the identification of transfected cells.

Adherent CHO cells were co-transfected with individualcofilin shRNA plasmids (S1 and S2), a combination of

cofilin shRNA plasmids (S12), or an empty shRNA vector(NC) along with a vector conferring zeocin resistance forselection of stable cell lines. CHO-SEAP cells expressingcofilin-specific shRNA vectors showed a 36% (S2) to 50%(S12) reduction in cofilin levels (Fig. 4A) and a 28% (S1) to65% (S12) increase in specific SEAP productivity (Fig. 4B)compared to cells expressing an empty shRNA vector.CHO-tPA cells expressing cofilin-specific shRNA vectorsshowed a 32% (S12) to 35% (S1) decrease in cofilinexpression (Fig. 4C) and a 26% (S12) to 47% (S1)enhancement of specific tPA productivity (Fig. 4D) com-pared to control cells.

The effect of cofilin reduction on cell growth wasalso examined. Recombinant CHO cells expressing bothcofilin-specific and control shRNA vectors showed similar,although slightly slower growth rates compared to theparental CHO-SEAP and CHO-tPA cell lines (Table I). Asimilar reduction in growth rate was previously observed inCHO cell lines expressing siRNA expression plasmidstargeting a1,6 fucosyltransferase and was attributed to thestress of antibiotic selection during cell line generation

Figure 2. Transient cofilin reduction in CHO cells by siRNA. Relative cofilin expression in (A) CHO-SEAP and (C) CHO-tPA cells analyzed by Western blotting. b-Actin was

used as a loading control. Relative specific productivity of (B) CHO-SEAP and (D) CHO-tPA cells. CHO cells were treated with cofilin-specific (S1, S2, and S12) or non-specific control

(NC) siRNA. Samples were assayed 72–96 h post-transfection and are normalized to CHO-SEAP or CHO-tPA. The mean and standard error of the mean of four independent

experiments are shown.



Figure 4. Stable cofilin reduction in CHO cells by shRNA. Relative cofilin expression in (A) CHO-SEAP and (C) CHO-tPA cells analyzed by Western blotting. b-Actin was used

as a loading control. Relative specific productivity of (B) CHO-SEAP and (D) CHO-tPA cells. CHO cells expressing cofilin-specific shRNA (S1, S2, and S12) or control (NC) vectors.

Samples are normalized to CHO-SEAP or CHO-tPA. The mean and standard error of the mean of five independent experiments are shown.

Figure 3. Cofilin reduction in suspension CHO cells by siRNA. A: Relative cofilin expression in suspension CHO-SEAP cells analyzed by Western blotting. B: Relative specific

productivity of suspension CHO-SEAP cells. Suspension cells were treated with cofilin-specific (S1, S2, and S12) or non-specific control (NC) siRNA. Samples were assayed 72–96 h

post-transfection and are normalized to CHO-SEAP. The mean and standard error of the mean of six independent experiments are shown.


(Mori et al., 2004). Viability for all CHO cell lines remainedabove 90% during the culture period.

Reduced Cofilin Expression Alters theActin Cytoskeleton

ADF/cofilin proteins are key regulators of actin filamentdynamics. Previously, destabilization of the actin cytoskele-ton was associated with enhanced recombinant proteinproductivity in CHO-SEAP cells (Hayduk and Lee, 2005).Therefore, the effect of cofilin reduction on cytoskeletonstructure was examined in CHO-SEAP cells expressing anindividual shRNA vector (CHO-SEAP-S1) or an emptyshRNA vector control (CHO-SEAP-NC). Cells were labeled

with phalloidin to visualize actin filaments and cellsexpressing vectors were identified by GFP expression.Cofilin depletion by shRNA decreased the number of actinstress fibers in CHO-SEAP-S1 cells compared to control cells(Fig. 5A). Cells were subdivided into three categories andscored visually: cells showing average F-actin labeling, cellsshowing fewer actin filaments, and cells showing greaterlabeling of F-actin stress fibers (Fig. 5B). Approximately80% of CHO-SEAP and CHO-SEAP-NC cells showedaverage F-actin labeling, whereas only 22% of CHO-SEAP-S1 cells displayed normal actin filament structure. Morethan 70% of CHO-SEAP-S1 cells showed fewer actinfilaments and less than 10% showed more prominentlabeling of actin filaments.

The effects of RNAi-mediated cofilin knock-down onactin cytoskeleton structure are dependent on the cell lineand factors including the relative levels of actin-bindingproteins. Formation of more prominent F-actin fibers andlarge F-actin aggregates are observed in some cell types suchas MTLn3 mammary carcinoma cells (Sidani et al., 2007)and fibroblasts (Hotulainen et al., 2005). Here, shRNA-mediated cofilin reduction in CHO-SEAP cells decreasesactin filaments and increases smaller F-actin aggregates. Asimilar decrease in actin filament structure was also reportedin CHO-AA8 cells (Grzanka et al., 2010). CHO-SEAP cellsalso show enhanced expression of CapZ (Hayduk and Lee,2005), a barbed-end capping protein that can bind to

Table I. Average growth rates (doubling time) of CHO cell lines

expressing shRNA vectors.

Cell line

Doubling

time (h) Cell line

Doubling

time (h)

CHO-SEAP 27.6� 1.9 CHO-tPA 25.7� 0.9

CHO-SEAP-S1 29.1� 2.2 CHO-tPA-S1 26.1� 0.5



CHO-SEAP-GSH1 29.1� 1.8 CHO-tPA-GSH1 27.3� 0.4

Figure 5. Actin cytoskeleton changes in CHO cells expressing cofilin-specific shRNA. A: CHO-SEAP cells expressing cofilin-specific shRNA (CHO-SEAP-S1) or an empty

vector (CHO-SEAP-NC) are stained with phalloidin (white). Cells expressing shRNA vectors also express GFP (green). Nuclei were counterstained with DAPI. Scale bar represents

10mM. B: Average percent of cells that show fewer, average, or greater number of actin filaments compared to CHO-SEAP cells. For each cell type, 43–100 cells were evaluated

over five independent experiments. The mean and standard error of the mean are shown.



severed actin filaments and promote filament disassembly(Andrianantoandro and Pollard, 2006), which may contrib-ute to the destabilizing effects of cofilin silencing in thiscell line.

Discussion

The expression of ADF/cofilin proteins and the effect ofcofilin reduction on specific productivity and the actincytoskeleton structure was examined in recombinant CHOcell lines. Cofilin depletion by siRNA and shRNA enhancedspecific productivity by up to 80% in adherent CHO-SEAPand CHO-tPA cells. The enhanced productivity observedupon cofilin knock-down is comparable to the increasedproductivity observed in CHO-SEAP cells after 50 nMmethotrexate selection (Hayduk and Lee, 2005). This studyextends previous observations that destabilizing the actincytoskeleton structure increases recombinant proteinproduction and/or secretion (Hayduk and Lee, 2005),and, to our knowledge, is the first report of a rational cellengineering approach targeting cofilin, a key regulator of theactin cytoskeleton. RNAi-based cellular engineering strate-gies that target the actin cytoskeleton may provide anadditional means to enhance cellular productivity.

While many proteomic and transcriptomic studiesdescribe differential regulation of cytoskeletal and structuralproteins, altered cofilin expression is described in only a fewstudies that compare protein expression in cell linesexhibiting a range of productivity values. Cofilin decreasedwith increasing specific SEAP productivity during MTX-amplification of CHO cells (Hayduk and Lee, 2005). Cofilinincreased with increasing specific antibody productivitywithin the secretory microsomes of GS-NS0 cells (Aleteet al., 2005). Examination of two antibody-producing CHOcell lines over different metabolic phases of fed-batch cultureshowed cofilin to decrease in one cell line but to increase in asecond cell line during the culture (Pascoe et al., 2007).Differences between cell types, cell line generation, andculture conditions may influence changes in proteinexpression observed in these studies.

Cofilin depletion in CHO-SEAP cells diminishes actinstress fibers, consistent with previous work demonstratingthat destabilizing the actin cytoskeleton enhances recombi-nant protein production (Hayduk and Lee, 2005).While thissupports a role for the regulation of actin assembly, severalnew roles for ADF/cofilin have been recently described thatmay also affect productivity. ADF/cofilin may regulatetranscription by mediating actin import and activity in thenucleus (Kandasamy et al., 2010). Cofilin may be involved inthe induction of apoptosis (Chua et al., 2003) and maymediate apoptosis in response to oxidative stress (Klamtet al., 2009). Phosphorylated cofilin, previously thought tobe the inactive form, may directly activate phospholipase D,which functions in regulating vesicular trafficking throughthe secretory pathway (Han et al., 2007). Therefore, theprecise mechanism by which cofilin depletion alters

recombinant protein production in CHO cells requiresfurther investigation.

The effects of cofilin silencing in suspension cells aresimilar, although more modest, than those in adherent cells.Optimizing a cofilin silencing strategy in suspension celllines that stably express cofilin-specific shRNA vectors willallow the selection of highly productive clones to bettercharacterize the effects of cofilin silencing in suspensionculture. The application of this strategy in an antibody-producing CHO cell line with high-specific productivity is ofspecial interest.

Members of the ADF/cofilin protein family are emergingas agents of cellular homeostasis that may regulate geneexpression, apoptosis, and vesicular trafficking (Bernsteinand Bamburg, 2010). These processes are often targeted incell line engineering efforts aiming to increase theproduction and quality of recombinant therapeutics fromCHO cells. Although only cofilin has been identified byproteomic studies as a target for engineering efforts, CHOcells were shown to express multiple ADF/cofilin isoforms.Studies in which ADF/cofilin isoforms were depleted bothindividually and simultaneously show that co-depletionoften results in a more pronounced phenotype thanreduction of the individual isoforms (Bender et al., 2010;Hotulainen et al., 2005). This suggests that co-targeting ofmultiple ADF/cofilin isoforms may enhance the effectsobserved here upon cofilin knock-down in recombinantCHO cells. Altering ADF/cofilin signaling may provide ameans by which to alter multiple signaling and traffickingpathways to enhance protein production.

The authors would like to thank Jeffrey Caplan at the Delaware

Biotechnology Institute Bioimaging Center for assistance with confo-

cal microscopy and Jeff Swanberg and Ben Kremkow for assistance

with suspension cell experiments.

References

Alete DE, Racher AJ, Birch JR, Stansfield SH, James DC, Smales CM. 2005.

Proteomic analysis of enriched microsomal fractions from GS-NS0

murine myeloma cells with varying secreted recombinant monoclonal

antibody productivities. Proteomics 5(18):4689–4704.

Andrianantoandro E, Pollard TD. 2006. Mechanism of actin filament

turnover by severing and nucleation at different concentrations of

ADF/cofilin. Mol Cell 24(1):13–23.

Bender M, Eckly A, Hartwig JH, Elvers M, Pleines I, Gupta S, Krohne G,

Jeanclos E, Gohla A, Gurniak C, et al. 2010. ADF/n-cofilin-dependent

actin turnover determines platelet formation and sizing. Blood

116(10):1767–1775.

Bernstein BW, Bamburg JR. 2010. ADF/Cofilin: A functional node in cell

biology. Trends Cell Biol 20:187–195.

Carlage T, Hincapie M, Zang L, Lyubarskaya Y, Madden H, Mhatre R,

Hancock WS. 2009. Proteomic profiling of a high-producing Chinese

hamster ovary cell culture. Anal Chem 81(17):7357–7362.

Chan AY, Bailly M, Zebda N, Segall JE, Condeelis JS. 2000. Role of cofilin in

epidermal growth factor-stimulated actin polymerization and lamelli-

pod protrusion. J Cell Biol 148(3):531–542.

Chua BT, Volbracht C, Tan KO, Li R, Yu VC, Li P. 2003. Mitochondrial

translocation of cofilin is an early step in apoptosis induction. Nat Cell

Biol 5(12):1083–1089.


Dawe HR, Minamide LS, Bamburg JR, Cramer LP. 2003. ADF/cofilin

controls cell polarity during fibroblast migration. Curr Biol 13(3):

252–257.

Dinnis DM, James DC. 2005. Engineering mammalian cell factories for

improved recombinant monoclonal antibody production: Lessons

from nature? Biotechnol Bioeng 91(2):180–189.

Grzanka D, Marszalek A, Gagat M, Izdebska M, Gackowska L, Grzanka A.

2010. Doxorubicin-induced F-actin reorganization in cofilin-1 (non-

muscle) down-regulated CHO AA8 cells. Folia Histochem Cytobiol

48(3):377–386.

Han L, Stope MB, de Jesus ML, Oude Weernink PA, Urban M, Wieland T,

Rosskopf D, Mizuno K, Jakobs KH, Schmidt M. 2007. Direct stimula-

tion of receptor-controlled phospholipase D1 by phospho-cofilin.

EMBO J 26(19):4189–4202.

Hayduk EJ, Lee KH. 2005. Cytochalasin D can improve heterologous

protein productivity in adherent Chinese hamster ovary cells. Biotech-

nol Bioeng 90(3):354–364.

Hotulainen P, Paunola E, Vartiainen MK, Lappalainen P. 2005. Actin-

depolymerizing factor and cofilin-1 play overlapping roles in promot-

ing rapid F-actin depolymerization in mammalian nonmuscle cells.

Mol Biol Cell 16(2):649–664.

Ichetovkin I, Grant W, Condeelis J. 2002. Cofilin produces newly polymer-

ized actin filaments that are preferred for dendritic nucleation by the

Arp2/3 complex. Curr Biol 12(1):79–84.

Kandasamy MK, McKinney EC, Meagher RB. 2010. Differential subloca-

lization of actin variants within the nucleus. Cytoskeleton 67(11):729–

743.

Kantardjieff A, Jacob NM, Yee JC, Epstein E, Kok YJ, Philp R, Betenbaugh

M, Hu WS. 2010. Transcriptome and proteome analysis of Chinese

hamster ovary cells under low temperature and butyrate treatment.

J Biotechnol 145(2):143–159.

Klamt F, Zdanov S, Levine RL, Pariser A, Zhang Y, Zhang B, Yu LR,

Veenstra TD, Shacter E. 2009. Oxidant-induced apoptosis is mediated

by oxidation of the actin-regulatory protein cofilin. Nat Cell Biol

11(10):1241–1246.

Kumar N, Gammell P, Meleady P, Henry M, Clynes M. 2008. Differential

protein expression following low temperature culture of suspension

CHO-K1 cells. BMC Biotechnol 8:42.

Kuystermans D, Dunn MJ, Al-Rubeai M. 2010. A proteomic study of cMyc

improvement of CHO culture. BMC Biotechnol 10:25.

Lee KH, Meuer SC, Samstag Y. 2000. Cofilin: A missing link between T cell

co-stimulation and rearrangement of the actin cytoskeleton. Eur J

Immunol 30(3):892–899.

Meleady P, Henry M, Gammell P, Doolan P, Sinacore M, Melville M,

Francullo L, Leonard M, Charlebois T, Clynes M. 2008. Proteomic

profiling of CHO cells with enhanced rhBMP-2 productivity following

co-expression of PACEsol. Proteomics 8(13):2611–2624.

Mori K, Kuni-Kamochi R, Yamane-Ohnuki N, Wakitani M, Yamano K,

Imai H, Kanda Y, Niwa R, Iida S, Uchida K, et al. 2004. Engineering

Chinese hamster ovary cells to maximize effector function of

produced antibodies using FUT8 siRNA. Biotechnol Bioeng 88(7):

901–908.

Ngantung FA, Miller PG, Brushett FR, Tang GL, Wang DI. 2006. RNA

interference of sialidase improves glycoprotein sialic acid content

consistency. Biotechnol Bioeng 95(1):106–119.

Nishita M, Tomizawa C, Yamamoto M, Horita Y, Ohashi K, Mizuno K.

2005. Spatial and temporal regulation of cofilin activity by LIM kinase

and Slingshot is critical for directional cell migration. J Cell Biol

171(2):349–359.

Pascoe DE, Arnott D, Papoutsakis ET, Miller WM, Andersen DC. 2007.

Proteome analysis of antibody-producing CHO cell lines with different

metabolic profiles. Biotechnol Bioeng 98(2):391–410.

Rasmussen B, Davis R, Thomas J, Reddy P. 1998. Isolation, characterization

and recombinant protein expression in Veggie-CHO: A serum-free

CHO host cell line. Cytotechnology 28(1–3):31–42.

Sidani M, Wessels D, Mouneimne G, Ghosh M, Goswami S, Sarmiento C,

WangW, Kuhl S, El-Sibai M, Backer JM, et al. 2007. Cofilin determines

the migration behavior and turning frequency of metastatic cancer

cells. J Cell Biol 179(4):777–791.

Smales CM, Dinnis DM, Stansfield SH, Alete D, Sage EA, Birch JR, Racher

AJ, Marshall CT, James DC. 2004. Comparative proteomic analysis

of GS-NS0 murine myeloma cell lines with varying recombinant

monoclonal antibody production rate. Biotechnol Bioeng 88(4):474–

488.

Tsai CH, Chiu SJ, Liu CC, Sheu TJ, Hsieh CH, Keng PC, Lee YJ. 2009.

Regulated expression of cofilin and the consequent regulation of

p27(kip1) are essential for G(1) phase progression. Cell Cycle 8(15):

2365–2374.

Vartiainen MK, Mustonen T, Mattila PK, Ojala PJ, Thesleff I, Partanen J,

Lappalainen P. 2002. The three mouse actin-depolymerizing factor/

cofilins evolved to fulfill cell-type-specific requirements for actin

dynamics. Mol Biol Cell 13(1):183–194.

von Blume J, Duran JM, Forlanelli E, Alleaume AM, Egorov M, Polishchuk

R, Molina H, Malhotra V. 2009. Actin remodeling by ADF/cofilin is

required for cargo sorting at the trans-Golgi network. J Cell Biol

187(7):1055–1069.

Wu SC. 2009. RNA interference technology to improve recombinant

protein production in Chinese hamster ovary cells. Biotechnol Adv

27(4):417–422.

Wurm FM. 2004. Production of recombinant protein therapeutics in

cultivated mammalian cells. Nat Biotechnol 22(11):1393–1398.

Zhang M, Koskie K, Ross JS, Kayser KJ, Caple MV. 2010. Enhancing

glycoprotein sialylation by targeted gene silencing in mammalian cells.

Biotechnol Bioeng 105(6):1094–1105.



rna interference of cofilin in chinese hamster ovary cells improves recombinant protein productivity

Documents