role of hetf and patu3 in the regulation of …doctor of philosophy in microbiology august 2014 by...
TRANSCRIPT
ROLE OF HETF AND PATU3 IN THE REGULATION OF HETEROCYST
DEVELOPMENT IN ANABAENA SP. STRAIN PCC 7120
A DISSERTATION SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAWAI‘I AT MĀNOA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
IN
MICROBIOLOGY
AUGUST 2014
By
Sasa K. Tom
Dissertation Committee:
Sean M. Callahan, Chairperson Maqsudul Alam
Hongwei Li Paul Q. Patek
Heinz Gert de Couet
ii
DEDICATION
This dissertation is dedicated to my father.
He silently held the weight of the world in his hands for the benefit of others. His passion for life,
compassion and empathy towards all, humility, kind and generous demeanor remain an
inspiration to me. It is through his sacrifice and strength, his wisdom, encouragement and
unconditional love that I can be me. For this, I am fortunate and forever grateful. Thank you,
Daddy.
iii
ACKNOWLEDGEMENTS
Many people were instrumental in the completion of this body of work. I thank my mentor Dr.
Sean Callahan for the opportunity to pursue my research interests (including the study of my
eponymous gene, sasA (all1758)), and for his guidance and support. I thank my committee
members Dr. Maqsudal Alam, Dr. Gert de Couet, Dr. Hongwei Li, and Dr. Paul Patek for their
time, encouragement and support. I am inspired by their steadfast dedication to scientific
research, teaching and aspiring students.
I am indebted to the kindness, fortitude, and noble sacrifice of my parents and my ancestors.
They remind me to not take anything for granted and to honor our collective past. I thank my
family and friends. My early interest in science is attributed to my Big Brother. I still remember
being in awe of the diverse components of a typical cell. How magical! I still remember
magnificent images of a fluorescing plant. To think that I could engineer cells with fluorescent
proteins one day!
I acknowledge past and current members of the Callahan Lab, including Michael Andonian,
Sylvia Beurmann, Dr. Pritty Borthakur, Andy Burger, Roy Nicholas Chang, Dr. Loralyn Cozy,
Rissa Fedora, Kelly Higa, Kathryn (Katie) Hurd, Tyler Law, Reid Oshiro, Dr. Ramya Rajagopalan,
Dr. Doug Risser, Orion Rivers, Chris Runyon, Amanda Shore-Maggio, Blake Ushijima, Patrick
Videau, Jasmine Young, and Shirley Young-Robbins. I also acknowledge members of the Alam
(Sun Ae Kim, Aaron Young), Donachie (Dr. Jimmy Saw), Douglas (Ami Ishihara-Mulligan), Huang
(Dr. Yun Kang), Li (Kimberley Hammond, Charles Hua, Deborah Lee, Dr. Baojin Yang), and
Patek (Dr. Van Luu, Jayson Masaki) Labs. I am grateful of the friendship and continued support
of fellow UC Berkeley alumnus Dr. Eric Umemoto.
Finally, I acknowledge support from the Microbiology staff. I acknowledge Roland Co, Dr.
Shaobin Hao, Debbie Morito and Dr. Xuehua (Ivy) Wan. I thank Dr. Susan Ayin for her guidance
with the Microbiology labs and our conversations over the years. I acknowledge the Microbiology
and Biology Departments for providing me with teaching assistantships every semester. I have
benefited from the opportunity to teach a diverse range of (six different) lower and upper division
courses in both Departments.
Two difficult life experiences unexpectedly transpired during my graduate career. The journey
back from great loss and pain was made much lighter through the combined support, affection
and patience of a caring group of family and friends. Aloha and mahalo nui loa!
iv
ABSTRACT
A central paradigm in developmental biology concerns the differentiation of cells despite the
fundamental sameness of the genetic complement shared by all cells in the organism. The
filamentous cyanobacterium Anabaena sp. strain PCC 7120 is an ideal model system for the
study of development. In response to nitrogen deprivation, Anabaena differentiates nitrogen-
fixing heterocyst cells in a periodic pattern. Anabaena research has practical applications in
human health, sustainable agriculture, and biofuel production. This study aimed to characterize
novel interactions to refine the current understanding of Anabaena development.
Investigations were performed to elucidate the hetF-dependent activation of differentiation. A
novel genetic regulatory network involving hetF, a CHF class protease, and the negative regulator
patU3 and other developmental genes was identified. A component of the hetZ-patU5-patU3
gene cluster, PatU3 was shown to directly interact with HetZ, another activator of differentiation.
Genetic epistasis analysis determined that PatU3 suppressed positive regulation by HetZ and
HetR. These negative feedback loops explain the elevated HetR-GFP concentrations in hetF-
dependent strains despite the paradoxical absence of heterocysts. The HetF-dependent pathway
may act as a control point prior to commitment to the heterocyst cell fate.
Lateral inhibition by PatS and HetN, which both contain the same RGSGR pentapeptide
sequence, involves regulation by HetR. The unique domains present in the structure of HetR
may relate to its activity as a transcriptional activator. In this study, genetic and cytological
approaches were used to identify residues in HetR necessary for interaction with PatS, HetN and
RGSGR. A related investigation demonstrated that the RGSGR-pentapeptide derived from HetN
directs pattern formation by direct cytoplasmic exchange.
Lastly, protein phosphorylation plays a prominent role in varied biological processes. The PP2C-
type protein phosphatase All1758 was characterized in this study. The corresponding all1758
gene is controlled by the developmental genes ntcA and hetR. All1758 affects later stages of
differentiation and may represent a critical link between cell growth, cell division and
morphogenesis by controlling putative sigma factor regulators (antisigma factors and antisigma
factor agonists) and cell division genes (including FtsZ and MinCE). Taken together, these
findings support additional regulatory mechanisms necessary for proper Anabaena development.
v
TABLE OF CONTENTS
Acknowledgements………………………………………………………………………………………..iii
Abstract……………………………………………………………………………………………………..iv
List of Tables……………………………………………………………………………………………….xii
List of Figures……………………………………………………………………………………………...xv
Chapter 1. Preamble on model systems of developmental biology including heterocyst development in the cyanobacterium Anabaena sp. strain PCC 7120……………………..…….1
Relevance of the regulation of gene expression in developmental biology………………...1
Genetic regulation of pattern formation in the eukaryotic model systems Arabidopsis thaliana and Drosophilia melanogaster...............................................................................1
Arabidopsis thaliana flower organ formation…………………………………………2
Arabidopsis thaliana trichome formation……………………………………………...3
Morphogens affect Drosophilia melanogaster cell fate……………………………..4
Genetic regulation of prokaryotic development in the Caulobacter crescentus model system couples a phosphorelay with the cell cycle…………………………………………...5
General background of heterocyst formation in the cyanobacterium Anabaena sp. strain PCC 7120…………………………………………..………………………………….7
A genetic network controls induction and patterning in Anabaena………………………….8
vi
PatA- and HetF- mediated regulation of heterocyst differentiation………………………...10
Sigma factors and Anabaena development…………………………………………………..11
Specific research aims and summary of study outcomes…………………………………..13
References cited………………………………………………………………………………...14
Chapter 2. Role of hetF and patU3 in the regulation of heterocyst development in Anabaena sp. strain PCC 7120………………………………………………………………………..18
Introduction………………………………………………………………………………………18
Materials and Methods………………………………………………………………………….20
Results……………………………………………………………………………………………39
Mutations in patU3 restore heterocyst formation in hetF and hetF patA backgrounds……………………………………………………………………………39
patU3 negatively regulates heterocyst development and contributes to normal cell size……………………..………………………………………………….40
Inactivation of internal transcription start sites present in hetZ do not affect the hetZ phenotype…………………………………………………………….42
Extra copies of patU5 and patU3 inhibit heterocyst differentiation……………….44
Cis-acting transcriptional and translational elements are important for function of the hetZ-patU5-patU3 gene cluster………………………….………….46
Overexpression of hetZ cannot functionally bypass deletion of either hetR or hetF…………………………………….……………………………………...48
vii
Regulation of heterocyst differentiation by patU3 does not require patS or hetN……………………………………………………………………………49
hetZ and patU3 are required for the timing of pattern formation………………….50
hetF patU3 and hetF patA patU3 genotypes have diminished HetR-GFP fluorescence in comparison to hetF and hetF patA genotypes…………………...52
hetF patU3 and hetF patA patU3 genotypes exhibit reduced hetR expression compared to the wild-type……………………………………………….53
Genetic epistasis analysis suggests hetR acts upstream of patU3 in the regulation of heterocyst differentiation………………………………………………54
Genetic epistasis analysis suggests patU3 acts upstream of hetZ in the regulation of heterocyst differentiation………………………………………………56
Direct interaction detected between HetZ and PatU3 by the bacterial two-hybrid system……………………………………………………………………..56
Discussion………………………………………………………………………………………..61
References cited………………………………………………………………………………...68
Chapter 3. Heterocyst development and the ser/thr protein phosphatase All1758 in the cyanobacterium Anabaena sp. strain PCC 7120…………………………………………………..71
Introduction………………………………………………………………………………………71
Materials and Methods………………………………………………………………………….73
Results……………………………………………………………………………………………98
viii
Mutation of all1758 prevents diazotrophic growth………………………………….98
Pleiotropic phenotype of all1758 null mutants……………………………………...99
Strain UHM184 (∆all1758) was Fix- and lacked the minor heterocyst-
specific glycolipid…………………………..…………………………………………102
all1758 is not required for the timing of pattern formation………………………104
all1758 is constitutively expressed and autoregulates its own expression…….105
NtcA and HetR repress all1758 expression……………………………………….106
Bypass of mutation of all1758 by extra copies of hetR…………………………..108
Genetic epistasis analysis supports role of all1758 in normal cell size and cell growth control……………………………….………………………………108
All1758 is required for proper localization of the cell division protein FtsZ and the cell division regulators MinC and MinE…………………………….110
Conserved aspartate residues of Motifs 2, 8 and 11 are required for PP2C phosphatase activity of All1758…………………………………………………….112
All1758 regulates the antisigma factor Alr3423…………………………………...113
NtcA activates expression of the all1758-dependent anti-antisigma factor all1087…………………………………………………………………………………115
Direct interaction of All1758 with itself and HetR detected by the bacterial two-hybrid system……………………………………………………………………116
Discussion………………………………………………………………………………………119
ix
References cited……………………………………………………………………………….124
Chapter 4. Overactive alleles of hetR in the cyanobacterium Anabaena sp. strain PCC 7120………………………………………………………………………………………………...130
Introduction……………………………………………………………………………………..130
Materials and Methods………………………………………………………………………..131
Results…………………………………………………………………………………………..144
Conservative substitutions at HetR residues 250−256 affect heterocyst formation and sensitivity to PatS-5………………………………………………....144
Conservative substitutions at HetR residues 250−256 affect heterocyst formation and sensitivity to PatS and HetN overexpression…………………….147
Identification of overactive alleles of hetR that bypass HetN function, but require a wild type copy of HetR for activity…………………………………..147
Identification of overactive alleles of hetR that bypass HetN function………….149
Identification of overactive alleles of hetR that bypass PatS and HetN function………………………………………………………………………………..150
Overactive alleles of hetR affect sensitivity to PatS and HetN overexpression……………………………………………………………………….151
HetR(mutant)-GFP localization predicts role in HetR turnover………………….152
Overactive alleles of hetR fail to complement hetF- and patA-deficient strains………………………………………………………………………………....157
x
alr9018, a gene that complemented a mutant of a PpetE-hetN ∆patS strain, is not essential for heterocyst differentiation………….…………………………..157
Discussion………………………………………………………………………………………158
References cited……………………………………………………………………………….160
Chapter 5. The intercellular signaling protein, hetN, in Anabaena sp. strain PCC 7120……………………………………………………………………………………………………….162
Introduction……………………………………………………………………………………..162
Materials and Methods………………………………………………………………………..164
Results…………………………………………………………………………………………..168
HetN-YFP localizes to heterocysts in stains expressing overactive
alleles of hetR………………………………….……………………………………..168
Localization of HetN-YFP to the cell periphery……………………………………169
hetN mutagenesis studies to identify necessary sites for function…………….. 172
Discussion………………………………………………………………………………………172
References cited……………………………………………………………………………….177
xi
Appendices: Peer-reviewed publications
A. The putative phosphatase All1758 is necessary for normal growth, cell size and synthesis of the minor heterocyst-specific glycolipid in the cyanobacterium Anabaena sp. strain PCC 7120………………………...……..………….180
B. Evidence for direct binding between HetR from Anabaena sp. PCC 7120 and PatS-5……………………………...………………………………………………………203
C. The RGSGR amino acid motif of the intercellular signaling protein, HetN, is required for patterning of heterocysts in Anabaena sp. strain PCC 7120…………….....234
xii
LIST OF TABLES
Table Page
1.1 The twelve sigma factors annotated in the Anabaena genome……………………………12
1.2 Description of the role of characterized sigma factors in the Anabaena genome………..12
2.1 Strains used in Chapter 2………………………………………………………………………31
2.2 Plasmids used in Chapter 2……………………………………………………………………33
2.3 Oligonucleotides used in Chapter 2…………………………………………………………...36
2.4 Location of spontaneous mutations isolated within the 258-amino acid protein PatU3 found to restore the ability of hetF and hetF patA background strains to form heterocysts……………………………………………………………………………………....40
2.5 Anabaena patU3 strains and strain description……………………………………………...42
2.6 Anabaena hetZ strains and strain description………………………………………………..43
2.7 Summary of plasmids used to test truncations of genes within the hetZ-patU5-patU3 gene cluster and effect on heterocyst development in wild-type and in ∆patA backgrounds……………………………………………………………………………………..45
2.8 Summary of plasmids used to overexpress individual genes or combinations of genes within the hetZ-patU5-patU3 gene cluster and effect on heterocyst development and cell size in wild-type and ∆patA backgrounds………………….…….....47
2.9 Summary of plasmids used to determine the role of tsp I and tsp II in patU5-patU3 expression and effect on heterocyst development in wild-type and ∆patA backgrounds……………………………………………………………………………………..48
xiii
2.10 Plasmids used for quantification of β-galactosidase activity (Figure 2.16) of positive
bacterial two-hybrid interactions, and average Miller units (with standard deviation) of three independent replicates……………………………………...………………………...61
3.1 Strains used in Chapter 3………………………………………………………………………88
3.2 Plasmids used in Chapter 3……………………………………………………………………90
3.3 Oligonucleotides used in Chapter 3…………………………………………………………...94
3.4 Plasmids used for quantification of β-galactosidase activity (Figure 3.14) of positive bacterial two-hybrid interactions, and average Miller units (with standard deviation) of three independent replicates………………………………...…………………………….118
4.1 Bacterial strains used in Chapter 4…………………………………………………………..137
4.2 Plasmids used in Chapter 4…………………………………………………………………..139
4.3 Oligonucleotides used in Chapter 4………………………………………………………….142
4.4 Summary of sensitivity of seven alleles of hetR (driven by PhetR) encoded on plasmids to PatS and HetN…………………………………………………………………...151
4.5 Summary of sensitivity to different allelic replacements of hetR in the chromosome to overexpression of PatS and HetN……………………………………...…………………152
4.6 Location of the overactive alleles described in this study within the domains of the 299-residue protein HetR………………………………………….……………………..158
5.1 Bacterial strains used in Chapter 5…………………………………………………………..166
5.2 Plasmids used in Chapter 5…………………………………………………………………..167
xv
LIST OF FIGURES
Figure Page
1.1 Schematic of the activator-inhibitor model of pattern formation proposed by Gierer and Meinhardt in 1972………………………………………………………………..………….4
1.2 Anabaena grown with nitrate in the medium or without a source of combined nitrogen…………………………………………………………………………………………….7
1.3 Working model for the genetic network involved in the regulation and patterning of heterocyst differentiation in Anabaena…………………………………………………………8
1.4 HetR, PatA and HetF are positive regulators of heterocyst development.........................10
2.1 The hetZ-patU5-patU3 gene cluster in Anabaena and locations of transcripts I and II…………………………………………………………………………………………….18
2.2 ∆hetF ∆patA strain with an additional mutation in patU3 restores the ability of ∆hetF ∆patA to form heterocysts………………………………………………………………………39
2.3 A model for the HetF-dependent regulation of PatU3……………………………………….40
2.4 Locations of putative tsps related to patU3 and sites of mutations isolated in the genetic screen described in this study…………………………………………....................40
2.5 Phenotype of patU3∆42-729 compared to the wild-type after 24 h in nitrate-deficient media……………………………………………………………………………………………..41
2.6 Locations of putative tsps (arrows) related to hetZ and site of the transposon insertion in mutant 1801…………………………………………..........................................43
2.7 Phenotype of ∆hetZ mutant after 24 h in nitrate-deficient media.………………………….44
xvi 2.8 Regions present on plasmids used to determine the role of tsp I and tsp II in
patU5-patU3 expression………………………………………………………………………..48
2.9 hetZ and patU3 are required for pattern formation…………………………………………..51
2.10 HetR-GFP is not detected in hetF patA patU3 genotypes…..……………………………...52
2.11 Expression of hetR is not detected in the hetF patA patU3 genotype……………………..53
2.12 Two proposed models of genetic interaction between hetR and patU3 in the control of heterocyst development……………………………………………………………………..54
2.13 Heterocyst formation is abrogated in ∆patU3 ∆hetR and ∆patU3 ∆hetZ double mutant strains……………………………………...………………………………………….…55
2.14 Two proposed models of genetic interaction between hetZ and patU3 in the control of heterocyst development……………………………………………………………………..56
2.15 Bacterial two-hybrid results indicate HetZ interacts with PatU3……………………………59
2.16 Average β-galactosidase activity of positive protein-protein interactions between HetR, HetF, HetF(C246A), HetZ, PatU3, PatA………………………………………………60
2.17 A preliminary model for genetic regulation of heterocyst differentiation in Anabaena involving the conversion of HetR to HetR* by developmental proteins…………….……...63
3.1 Phenotype of the all1758 deletion strain, UHM184 under varying conditions…………..101
3.2 Heterocyst-specific exopolysaccharide of UHM184………………………………………..102
3.3 Heterocyst-specific glycolipids of UHM184…………………………………………………103
xvii 3.4 Acetylene reduction assay for nitrogenase activity indicates strain UHM18
(∆all1758) is Fix-…………………………………….………………………………………….104
3.5 A functional all1758 gene is required for expression of all1758 but not for patterned expression of patS…………………..…………………………………………………………105
3.6 The global transcription factor NtcA negatively regulates all1758 expression………….106
3.7 The heterocyst differentiation gene HetR negatively regulates all1758 expression……107
3.8 All1758 is required for normal cell size and growth in Anabaena………………………...109
3.9 All1758 is involved in the proper localization of the cell division machinery components FtsZ, MinC and MinE…………………………………………………………..111
3.10 Schematic of the domains present in the 463-residue All1758 protein…………………..112
3.11 Overexpression of the antisigma factor Alr3423 in the wild type strain mimics the ∆all1758 phenotype at 24 hours……………………………………………………………...114
3.12 NtcA is required for the localized expression of the anti-antisigma factor All1087 in developing heterocysts……………..…………………………………………………………116
3.13 Bacterial two-hybrid results indicate All758 interacts with HetR and dimerizes with itself………………………………………………………….…………………………………..117
3.14 Average β-galactosidase activity of positive protein-protein interactions between All1758 and HetR and itself…………………………………………………………………..118
3.15 Partner-switch model of sigma factor activation……………………………………………122
3.16 A preliminary model for the regulation of heterocyst development by a modified partner-switch mechanism……………………………………………………………………123
xviii 4.1 Sensitivity to PatS-5 of strains with mutant alleles of hetR………………………………..146
4.2 Heterocyst frequencies of strains UHM170 to UHM182 and the wild-type……………...148
4.3 Localization of representative HetR(mutant)-GFP fusions………………………………..155
4.4 Localization of HetR(mutant)-GFP corresponding to the R250-D256 region……………156
5.1 Schematic of the domains present in the HetN protein……………………………………168
5.2 Localization of HetN-YFP……………………………………………………………………..169
5.3 Localization of HetN-YFP using confocal microscopy……………………………………..171
1
CHAPTER 1. PREAMBLE ON MODEL SYSTEMS OF DEVELOPMENTAL BIOLOGY
INCLUDING HETEROCYST DEVELOPMENT IN THE CYANOBACTERIUM ANABAENA SP.
STRAIN PCC 7120
Relevance of the regulation of gene expression in developmental biology
Multicellularity in nature arises through the elegant coordination of disparate cell types and a
dynamic interplay between the macromolecules of life. The developmental process encompasses
growth, differentiation into specialized cells, morphological modifications, and proper organization
of the differentiated cells. Over the course of evolutionary time, prokaryotic and eukaryotic
organisms have adapted common mechanisms to regulate development.
All development requires differential gene expression. Living organisms continually execute the
process of DNA replication. Yet while each cell of an organism contains the same genomic
content upon faithful partitioning of the chromosome during cellular division, cells nonetheless
express individual genes at different levels. This variance in gene expression is induced in
response to cellular requirements and environmental conditions, and can differ both temporally
and spatially. As a result of the products of these genes, organisms across all three domains of
life can adapt, grow and survive. Understanding the complexities of the regulation of gene
expression, processes underlying the control of the activation and inhibition of genes, is important
in the study of biological systems and evolution. The study of gene regulation not only extends
the knowledge of basic principles of biology. The understanding of when genes are switched on
or off also has implications for developmental impairment and disease pathologies in humans.
Further applications in cancer, cellular aging and senescence, birth defects and growth
abnormalities, pluripotent stem cell research, and pharmaceutical targets may ensue from these
studies.
Several eukaryotic and prokaryotic model systems are used for the study of developmental
biology including Arabidopsis thaliana, Drosophilia melanogaster, Caulobacter crescentus and
Anabaena sp. strain PCC 7120. Common themes that arise in developmental regulation involve
asymmetry (protein concentrations, cell division), cis- and trans-regulatory elements, and post-
translational modifications (proteolysis, phosphorylation).
Genetic regulation of pattern formation in the eukaryotic model systems Arabidopsis
thaliana and Drosophilia melanogaster
While differentiation into multiple cell types is important in the development of an organism,
subsequent organization of cell types, or pattern formation, is also a necessary component of
development. Examples of patterns abound in the biological world [1] and can manifest as
organizing regions or gradients (polyp hydra, Spemann organizer), segments (vertebrae, somite
2
formation), symmetry (left-right polarity, starfishes, anemones, flower petals), stripes (zebras,
zebrafishes), branching (bird feathers, leaf venations, insect trachea, vascularization), oscillations
(seashell pigmentation), periodicity (fly bristles, epidermal extensions, cilia, avian feathers) and
spots (leopards, cheetahs, giraffes, butterfly eyespots). Repeating patterns also frequently arise
in the natural environment: waves, sand dunes, cumulus clouds, honeycombs.
How cell fates are initially determined and the ongoing regulation of the process is a fundamental
question in developmental biology. Two eukaryotic model systems offer insight into this process.
With repeating flower and leaf units and tractable genetics, Arabidopsis thaliana is used as a
model organism for the study of plant development. Additionally, early segmentation studies
based on the invertebrate model organism Drosophilia melanogaster were later found to be
applicable to vertebrate systems.
Arabidopsis thaliana flower organ formation
In the model organism Arabidopsis thaliana, four cell types emerge from an undifferentiated
progenitor cell (the floral meristem) in response to seasonal changes. Together, these
differentiated cells form flower organs (sepals, petals, stamens and carpals) that exhibit
concentric growth in organized patterns called whorls. A genetic network of floral meristem-
identity genes establishes the cell fate of undifferentiated cells. Many of these regulatory genes
show similarity to the MADS domain of transcription factors, which share a conserved function in
yeast and mammalian muscle cells[2]. These transcription factors can dimerize and/or complex
with more than one protein. Among them, the master regulator AP1 (APETALA1) initiates flower
development. It primarily acts as a transcriptional repressor that downregulates genes normally
expressed in the floral meristem. Three pathways appear to upregulate AP1 expression. One
mechanism involves the binding of LFY, another main regulator of floral meristem identity, to the
AP1 promoter. Another involves a FD-dependent protein complex that also binds the AP1
promoter. Lastly, binding of the SPL family of transcription factors to the regulatory region of AP1
also mediates AP1 activation.
Multiple feedback loops positively and negatively regulate the master regulator of flower
development, AP1. Floral repressors inhibit the (repressive) activity of AP1. These repressors
include TEM1 and TEM2 (both are also transcription factors), AP2, TOE1-3, SMZ, SNZ, TLF1
and FLC (the central regulator of the vernalization pathway of flower initiation in response to cold
temperatures)[2]. AP1 repression may involve direct inhibition (SMZ), binding to the regulatory
region of AP1 (AP2), or competitively binding the activators of AP1 (TLF1). To counteract the
activity of floral repressors and begin floral initiation, AP1 represses floral meristem genes
(including SVP and the aforementioned TFL1, TEM1, TEM2, TOE1, TOE3, SNZ) and floral
transition genes (some of which are also activators of AP1; SOC1, AGL24, SPL9, FD, FDP).
3
Coupling of cellular events is another common biological theme. In addition to a key role in flower
development, other functions are associated with AP1. Upon interaction with SEP3 (a
component of different transcription factor complexes), the repressive function of AP1 is reversed.
In this context, AP1 acts as a genetic switch: the reversal of AP1 activity may allow for the
transition from the floral induction stage to the flower formation stage of development.
Furthermore, in addition to specifying organ identity during early flower development, AP1
appears to regulate additional cellular processes including hormone responses and meristem
pattern formation[2].
Arabidopsis thaliana trichome formation
Leaf trichomes represent another developmental model system to understand the regulation of
cell-fate determination, pattern formation and control of cellular morphology and polarity (during
cellular branching)[3, 4]. Trichomes, shoot-derived hair extensions of epidermal origin, are found
in most plants. They function to defend against insects, protect against UV irradiation, and
decrease the effects of transpiration and freezing temperatures. In Arabidopsis thaliana, trichome
spacing is nonrandom and occurs at an average interval of three cells. Four positive regulators of
patterning, GL1, TTGI, GL3 and EGL3, form a transcriptional-activation complex. The
transcriptional-activation domains present in GL1 and GL3 appear to mediate this activation.
Furthermore, these regulators, with the exception of TTG1, share sequence similarity to
transcription factors. TRY, CPC and ETC1 are negative regulators of trichome formation. The
redundant function exhibited by these three negative regulators led to proposal of a mutual-
inhibition mechanism of pattern formation. CPC appears to diffuse across cells. TRY competition
with the transcriptional activation complex, particularly by interacting with GL1 and GL3, is
sufficient to inactivate the complex. Finally, the trichome differentiation gene GL2 functions
downstream of these patterning genes; trichome-specific expression of GL2 is dependent on the
transcriptional-activation complex.
The trichome regulators exhibit additional functions, and may link different stages of development
and/or different cell types. For example, GL3 and TRY also positively and negatively control the
endoduplication stage of the trichome cell cycle, respectively. In this stage of development, DNA
replication continues without cell division to increase the ploidy of trichome cells. Additionally,
patterning of root-hairs involves a subset of the trichome patterning genes, as well as homologs
of these genes. A genetic regulatory network was demonstrated between the positive root-hair
patterning gene WER (WEREWOLF, a homolog of GL1) and the (trichome and root-hair)
negative regulator CPC[5].
Trichome formation conforms to the Gierer and Meinhardt activator-inhibitor model. Gierer and
Meinhardt coupled lateral inhibition with autocatalytic positive feedback loops into a mathematical
4
model to explain primary
pattern formation (Fig. 1.1)
[1, 6, 7]. Prior to Gierer and
Meinhardt, Turing’s
molecular reaction-diffusion
system demonstrated that
the interaction of two
components with differing
rates of diffusion resulted in
pattern formation[8].
However according to the
activator-inhibitor model, local and sustained self-activation (by an activator) is also necessary to
(i) drive differentiation in the presence of inhibitory factors (mutual-inhibition mechanism), and (ii)
introduce instability into a homogeneous system to incite pattern formation[1]. Another criterion
relates to the difference in diffusion rates of the autocatalytic activator and its cognate antagonist
(the inhibitor). The activator acts within in a short-range, while the lateral inhibitor has a longer-
range activity and more rapid turnover. This allows for localization of activator activity, which is
necessary to perturb the system towards an active or “on” state, followed by autocatalysis to
sustain signals for activation.
Trichome development involves activators and inhibitors. The transcriptional-activation complex
(consisting of GL1, TTGI, GL3 and EGL3) fulfil the requirements of an activator. Although
expressed initially in all epidermal cells, activator expression is increased in cells that commit to
the trichome cell fate. In addition, the negative regulators TRY, CPC and ETC1 fit the role of
inhibitors. CPC-GFP diffusion across trichoblasts has been observed. Because CPC is not
expressed in activator-deficient mutants, activator-dependent induction of the inhibitor CPC is
inferred, and consistent with the activator-inhibitor model.
Morphogens affect Drosophilia melanogaster cell fate
Cellular communication is a fundamental concept in biological systems. For example, hormones,
molecules that control varied physiological and behavioral processes over long distances in
plants and animals, represent one form of cell signaling. Examples in bacteria include quorum
sensing and biofilm production. In the context of morphogenesis, morphogens function as
diffusible signaling molecules that govern pattern formation during development. Morphogens
exhibit medium-range activity. Diffusion of morphogens from a source cell establishes a
concentration gradient among neighboring cells. Because levels of the morphogen are inversely
related to distance from the source cell, cells further away from the source cell are subjected to
Figure 1.1. Schematic of the activator-inhibitor model of
pattern formation proposed by Gierer and Meinhardt in 1972.
Inhibitors of the pathway represented with bars, activators
represented with arrows.
5
lower morphogen concentrations. Graded signals derived from morphogens therefore transmit
spatial information among neighboring cells. Furthermore due to the graded nature of the signal,
one signal can potentially induce the formation of multiple cell types due to different threshold
responses. Superposition of a diffusible morphogen under the regulation of an activator is one
criterion of the activator-inhibitor model.
Diffusion of signaling factors in Arabidopsis thaliana, including FT and CPC, influence flower
development and trichome formation respectively. In Drosophilia melanogaster, the Hedgehog
(Hh) morphogen gradient controls patterning of embryonic cuticles and adult appendages.
Vertebrate homologs to Hh have similar roles in development and cell fate specification. In
humans, Hh signaling is implicated in limb, neural tube and internal organ formation; height
determination; cell growth control; neural and hematopoetic stem cell maintenance; neuropathies,
cancer and neonatal abnormalities[9]. Hh signaling converges on the Gli family of zinc-finger
transcription factors [9]. The seven-span transmembrane protein Patched (Ptc) functions as the
Hh receptor. In the absence of Hh, Ptc inhibits the signaling pathway by targeting the G-coupled
protein receptor Smoothened (Smo) for endocytosis and subsequent degradation. Hh binding to
Ptc targets Ptc for lysosome degradation. Subsequent activation of Smo transduces the Hh
signal to the cytoplasm to generate the activator form of Gli.
The tight regulation of the process of Hh secretion relates to the intercellular transduction of the
Hh signal. Post-translational processing of Hh contributes to the activity of Hh as a morphogen.
After cleavage of the Hh signal sequence, the Hh C-terminal domain catalyzes the intramolecular
transfer of cholesterol to the N-terminal Hh signaling domain (HhN). The covalent attachment of
cholesterol increases the affinity of Hh for the plasma membrane and facilitates the addition of a
palmitic acid moiety at the N-terminus of HhN (to generate dually modified HhNp). These
modifications appear to allow for interaction with lipid rafts to target the Hh to the plasma
membrane. Stabilization of HhNp by heparin sulfate proteoglycans (HSPGs), some of which are
localized to lipid rafts, appears to facilitate HhNp diffusion[10]. HhNp secretion is further
facilitated by the 12-pass transmembrane protein Dispatched (Disp). Mechanisms also exist to
regulate gradient size[11]. Levels of Hh above a certain threshold can induce Hh expression.
Expression of Hh also leads to tandem expression of the Hh receptor, Ptc, thus forming a
negative feedback loop that restricts further transduction of the Hh signal.
Genetic regulation of prokaryotic development in the Caulobacter crescentus model
system couples a phosphorelay with the cell cycle
Development in the aquatic bacterium Caulobacter crescentus is intimately coordinated with cell
cycle events[12]. Asymmetric cell division of a progenitor stalked cell yields two morphologically
distinct daughter cells: another sessile stalked cell that can initiate DNA replication, and a motile
6
(flagellated) swarmer cell incapable of DNA replication. Swarmer cell differentiation involves loss
of the flagellum and subsequent stalk construction. Moreover, the developmental process
addresses common themes in biology. First, asymmetry in cell growth is a ubiquitous means to
alter the physiology of cells, and is observed in another model system of development, Bacillus
subtilis during spore formation. Outcomes of asymmetry also appear to influence cellular
senescence and population genetics[13]. Second, the stalked-to-swarmer cell transition
integrates phosphorylation and proteolysis, two mechanisms commonly used to regulate
biological systems, with progression of cell cycle events.
The DNA binding protein CtrA functions as the master regulator of Caulobacter crescentus cell
development. After initiation of DNA replication in late stalked and predivisional cells, ctrA is
expressed from the native P1 promoter. A phosphorelay involving the bifuncational kinase (and
phosphatase) CckA leads to CtrA phosphorylation at a conserved aspartate residue. CtrA
homodimerization coupled with phosphorylation leads to an active form of CtrA. Active CtrA
exhibits increased affinity for regions that contain or are adjacent to DnaA binding sites at the
origin of replication, thereby physically inhibiting DNA replication in swarmer cells. Accumulation
of phosphorylated CtrA activates the stronger P2 promoter, and represses expression from the
weaker P1 promoter. These positive autoregulatory loops rapidly enhance CtrA activity to
activate transcriptional events for transition to a predivisonal cell. Because CtrA concentrations
are in flux at this stage, varying promoter affinities for CtrA may be a means to regulate the timing
of CtrA-regulated gene expression. Approximately a hundred genes are regulated by CtrA,
mainly required for polar morphogenesis and cell division (initiation factors, topoisomerases, etc,).
For DNA replication to ensue, the physical inhibition of CtrA must be alleviated. Proteolysis of
CtrA occurs at the swarmer-to-stalked cell transitional stage upon cleavage by the ClpXP
protease, initiating swarmer cell differentiation. ClpXP localization to the stalked pole is facilitated
by the output domain deficient response regulator, CpdR. CpdR is active when
dephosphorylated. In another regulatory circuit, the CckA phosphorelay that activates CtrA by
phosphorylation also inhibits CpdR upon phosphorylation. CckA and CtrA are both active during
the mid- to late-predivisional stage. During replication initiation, CckA deactivation leads to the
non-phosphorylated states of CtrA (resulting in the non-active form of CtrA) and CpdR (active
form). Furthermore, CpdR activity involves the second messenger c-di-GMP. Induction of the
swarmer cell differentiation is induced by unphosphorylated CpdR-dependent degradation of the
c-di-GMP phosphodiesterase PdeA.
Regulation of the bifunctional (histidine kinase and phosphatase) protein CckA by phosphatases
(PleC) and kinases (DivK, DivJ, DivL) is necessary for the generation of a concentration gradient
of phosphorylated CtrA. During the swarmer-to-stalked cell transition, the bifunctional (histidine
7
kinase and phosphatase) protein CckA exhibits phosphatase activity at the stalked pole of the
predivisional cell. The phosphatase function contrasts with activation of kinase activity of CcKA
at the swarmer pole. Because concentrations of phosphorylated CtrA are thus elevated at the
swarmer pole compared to the stalker pole, a gradient of active CtrA is generated in the
predivisional cell[14]. Thus the CtrA gradient has consequences for development, and resembles
the diffusion properties of the morphogen Hedgehog in Drosophilia development localized to one
cell type.
General background of heterocyst formation in the cyanobacterium Anabaena sp. strain
PCC 7120
The proper orchestration of differentiation is fundamental to the development of multicellular
organisms. The transition to a specialized cell type, or differentiation, allows multicellular
organisms to carry out processes that are not accessible to a single cell. The filamentous
photoautotrophic cyanobacterium Anabaena sp. strain PCC 7120 (herein Anabaena) represents
another ideal model system for the study of differentiation. Anabaena represents one of the
simplest and most ancient examples of a multicellular organism. Anabaena filaments are
composed of vegetative cells and heterocyst cells. Heterocyst formation follows the stages of
development commonly used to describe more complex developmental systems: (1) induction of
differentiation, (2) specification of the cells in a pattern, (3) terminal commitment to the
differentiation process, and finally, (4) morphological and physiological alterations.
During conditions of combined
nitrogen availability, Anabaena
exists as linear filaments
composed of only vegetative
cells, often hundreds of cells in
length (Fig. 1.2A). After 24
hours of combined nitrogen
limitation (nitrogen step-down),
Anabaena filaments develop
heterocysts, which are
specialized cells capable of
molecular nitrogen fixation (Fig.
1.2B). Heterocyst development
occurs at regularly spaced
intervals; heterocysts total approximately 10% of the population. Within the heterocyst,
intracellular levels of oxygen are decreased through the physical elaboration of external glycolipid
Figure 1.2. Anabaena grown with nitrate in the medium (A)
or without a source of combined nitrogen (B). Carets
indicate heterocysts. Bar=10 µM.
8
and polysaccharide layers, deactivation of the oxygen-producing complex of photosystem II, and
enhancement of the respiratory rate to scavenge residual molecular oxygen[15, 16]. The ensuing
microoxic heterocyst provides the conditions necessary for the oxygen-labile nitrogenase
complex to reduce dinitrogen gas to ammonium, despite the continued oxygen evolution in
adjacent photosynthetic vegetative cells. Metabolite exchange occurs between these two cell
types. A bioactive, fixed form of nitrogen is supplied from heterocysts to vegetative cells, which in
turn provide a source of carbon and reductant to heterocysts.
A genetic regulatory network controls induction and patterning in Anabaena
A diverse array of signals governs the developmental program of heterocyst formation and
coordinates the subsequent periodic pattern of one heterocyst forming every tenth cell along a
filament (Fig. 1.3 and 1.2B). Proper regulation of heterocyst differentiation is critical to the
survival of the population because the heterocyst represents an endpoint in development due to
its terminally differentiated and non-dividing state.
Figure 1.3. Working model for the genetic network involved in the regulation and patterning
of heterocyst differentiation in Anabaena. The RGSGR pentapeptide motif is present in the
protein sequence of both PatS and HetN. Inhibitors of the pathway represented with bars,
activators represented with arrows. Figure adapted with permission from Dr. Sean M.
Callahan.
9
Induction occurs in response to nitrogen deprivation. Following limitation of combined nitrogen
(the “inducing factor”), levels of 2-oxoglutarate accumulate[17], ultimately triggering the induction
of heterocyst development upon binding to NtcA[18]. NtcA is a global transcriptional regulator of
the CAP family that regulates nitrogen metabolism in cyanobacteria. NtcA-mediated regulation
involves the consensus sequence GTAN8TAC[19, 20]. One of the genes activated by NtcA, the
nitrogen-dependent response regulator nrrA, produces a gene product that activates expression
of hetR[21]. Considered the master regulator of heterocyst differentiation, the DNA-binding
protein HetR is necessary for both heterocyst differentiation and patterning, largely through
positive regulation of other developmental genes. HetR has been shown to directly up-regulate
the developmental genes ntcA, patA, hepA, patS, hetP, hetZ as well as hetR itself[22-28]. Among
the developmental genes up-regulated by HetR, the protein also has been shown to directly bind
to the promoter regions of patS, hepA, hetP, hetZ, pknE and hetR[23, 25, 26, 29, 30], suggesting
that HetR may primarily function as the transcriptional regulator of developmental genes.
Inhibitory mechanisms are a central component of the regulatory network responsible for
patterning of heterocyst development. The unregulated differentiation of heterocysts would be
detrimental to the organism, as these cells represent a specialized cell type that no longer divides
and cannot fix carbon. Two proteins containing the pentapeptide RGSGR motif negatively
regulate the differentiation process. Exogenous addition of the pentapeptide alone is sufficient to
prevent differentiation of heterocysts [31] and moreover functionally inhibits binding of HetR to its
target sequence[23, 32, 33]. Thus HetR and the two RGSGR-containing inhibitory proteins fulfill
feedback loops in a manner consistent with the activator-inhibitor model (Fig.1.3). Furthermore,
the lateral diffusion patterns and consequence on heterocyst formation appears to follow the
properties of vertebrate morphogens.
Containing RGSGR at its C-terminus, the small (17 amino acid[34]) peptide PatS controls the
initial pattern of differentiation. Although dependent on HetR for up-regulation, PatS inhibits the
DNA-binding activity of HetR. A patS-null mutant exhibits a shorter interval between heterocysts
as well as a multiple contiguous heterocyst (“Mch”) phenotype due to increased differentiation
among adjacent cells. However, the Mch phenotype is resolved after additional rounds of cell
division, resulting in the restoration of the wild-type pattern to the mutant over time[35].
Pattern resolution in the patS-null mutant results from a second inhibitory protein containing an
internal RGSGR motif, HetN. This negative-acting regulator functions as a patterning protein
responsible for maintenance of the pattern initiated by PatS. The hetN-null mutant does not
exhibit perturbation of the wild-type pattern until 48 h after nitrogen step-down, at which point it
exhibits the Mch phenotype[36]. In a patS-null mutant conditionally lacking expression of hetN,
10
the Mch phenotype observed in the patS-null mutant fails to resolve over time, suggesting that
HetN is responsible for preserving the wild-type pattern[37].
PatA and HetF positively regulate heterocyst differentiation
Developmental checkpoints have evolved to control the genetic network of heterocyst formation.
PatS and HetN are regulated in part by patA. PatA contains a PATAN domain (“PatA N-terminus”)
present in many ligand signaling domains, a disrupted helix-turn-helix domain, and C-terminal
sequence similarity to the response regulator CheY[38]. PatA may attenuate the negative
inhibition of PatS and HetN[39]. PatA may also promote HetR activity. Inactivation of patA
results in the accumulation of HetR protein in filaments[40], but paradoxically, differentiation is
significantly reduced in the mutant as heterocyst formation is confined to filament termini (Fig.
1.4B) [41].
PatA-mediated promotion of
HetR activity appears to be
dependent upon HetF,
another positive regulator of
differentiation. As in the patA-
null mutant, inactivation of
hetF results in an accrual of
HetR,[40], but heterocysts do
not form in this strain (Fig.
1.3C) [42]. Excess levels of
HetR thus do not suffice to
induce the normal pattern of
heterocyst formation in the
absence of either PatA or
HetF. Although the effect of
gene inactivation and
presence in multicopy of hetF
closely mimics the effect of
hetR, irregularities in cell
morphology are associated
with the genetic manipulation of hetF. Both mutants no longer differentiate heterocysts, but the
hetF-null mutant grows poorly and exhibits aberrantly enlarged cells irrespective of nitrogen
status (Fig. 1.4A and 1.4C). This altered cell morphology is dependent on both PatA and HetR,
as evidenced by the restoration of normal cell size in the two double-deletion mutants, hetF patA
Figure 1.4. HetR, PatA and HetF are positive regulators of
heterocyst development. Light micrographs of background
strains deficient in (A) hetR, (B) patA, and (C) hetF 48 hours
after nitrogen removal. Carets indicate heterocysts.
11
and hetF hetR[40]. Additionally, overexpression of patA in the wild-type strain leads to enlarged
cells, similar to the hetF deletion phenotype[27]. The presence of the hetF gene in multicopy
results in increased heterocyst differentiation in the wild-type strain, similar to the multicopy effect
of hetR, but filaments with extra copies of hetF have a significant reduction in cell size[40].
A putative transmembrane domain and a conserved caspase-hemoglobinase fold (CHF) domain
are present in the protein sequence of HetF. CHF domains are responsible for the proteolytic
activity of cysteine-dependent endopeptidases that cleave after aspartate residues, including the
caspase family of apoptotic effector proteins. Cysteine proteases also share homology to
eukaryotic separases, universal mitotic regulatory proteins responsible for cleaving the cohesion
between sister chromatids to allow partitioning of chromosomes to daughter cells[43].
Metacaspases, the ancient family of caspase-like prokaryotic proteins, are particularly abundant
in Cyanobacteria and other bacteria that undergo complex developmental pathways[44]. This
observation may relate to the unique requirement for programmed cell death imposed upon
developmental systems that achieve a multicellular state.
Sigma factors and Anabaena development
Because the progression from gene to gene product to gene function involves many stages,
genes (and the output of genes) are controlled at multiple stages, allowing for diverse levels of
control. A common theme in biology concerns regulation of the first step in any multi-step
process. In bacteria, sigma subunits target and position RNA polymerase at specific promoter
sequences during transcription initiation. Because levels of RNA polymerase and sigma factors
are limited in the cell, promoters must compete for transcription initiation. Regulatory
mechanisms of this process include promoter DNA sequences, sigma factor availability (related
to sigma factor regulators), small ligands (i.e. ppGpp), transcription factors (activators and
repressors), and chromosomal conformation[45]. These diverse mechanisms modulate the level
of individual gene expression commensurate with changing cellular demands.
Complex responses and cellular processes are often globally organized by sigma factors in
mechanisms involving phosphorylation. Sigma factors regulate development (Bacillus subtilis
spore formation), control stress responses (Bacillus subtilis, Staphylococcus aureus), and
contribute to biofilm production (Pseudomonas aeruginosa). Sigma factors also regulate
heterocyst development and nitrogen fixation in Anabaena. Twelve sigma factors have been
annotated (Table 1.1), but not all sigma factors have been characterized. Mutant characterization
of individual sigma factors is hampered by the apparent redundancy in function shared among the
sigma factors. Nonetheless, sigma factors function at different stages of heterocyst development
(early, middle, late; Table 1.2), and moreover control stress responses (SigJ; Table 1.2) in
Anabaena. Orchestration of the progression of differentiation by distinct and/or overlapping
12
sigma factors would present an efficient means of developmental regulation in Anabaena, but
mechanisms of this process remain obscure.
Table 1.1. The twelve sigma factors annotated in the Anabaena genome. Characterized sigma
factors are described in Table 1.2.
σ70
family Sigma factor (gene annotation)
Genomic location
Group 1 sigA (all5263) chromosome
Group 2 sig B (all7615) β plasmid
sig B3 (all7608) β plasmid
sigB4 (all7179) α plasmid
sigB2 (alr3800) chromosome
sigC (all1692) chromosome
sigE (alr4219) chromosome
Group 3 sigF (all3853) chromosome
sigJ (alr0277) chromosome
Group 4 sigG (alr3280) chromosome
sigI (all2193) chromosome
Table 1.2. Description of the role of characterized sigma factors in the Anabaena genome.
‘Stages’ in selected cells of the far left column refers to the timing of heterocyst development
(separated into early, middle, and late stages).
Sigma factor Role in Anabaena development Reference
sigA Constitutively expressed, but transcription induced upon nitrogen limitation.
[46]
sigB Upregulated expression at 12 h, not essential for heterocyst differentiation or diazotrophic growth.
[47]
sigB2, sigD, sigF Not essential for heterocyst formation nor diazotrophic growth and not developmentally regulated. A sigB2 sigD double mutant only forms proheterocysts, cannot grow diazotrophically, and fragments extensively.
[48]
sigC (early-stage)
Expression induced upon nitrogen and sulfur limitation; upregulated by 4 h in differentiating cells. Not essential for heterocyst differentiation nor diazotrophic growth.
[47, 49]
sigG (middle-stage)
Expressed in vegetative cells grown in nitrate-replete conditions. Expression decreases after nitrogen removal, but by 10 h, individual differentiating cells increase expression
[49]
sigE (late-stage)
NtcA-dependent expression in differentiating cells by 16 h, required for expression of heterocyst-specific genes (nifH, fdxH, hglE2); mutant showed delayed heterocyst formation (at 32 h).
[48-50]
sigJ Key global regulator of desiccation tolerance; upregulated by drought stress. Regulates synthesis of extracellular heterocyst polysaccharides.
[51]
13
Specific research aims and summary of study outcomes
The synergistic relationship between the two cell types in Anabaena represents multiple levels of
genetic control involving elegant integration of positive- and negative-acting factors. The goal of
this research is to understand the genetic regulatory network governing different stages of
heterocyst development in Anabaena. The implications for these fundamental studies extend
beyond understanding the dynamic interplay of nitrogen fixation and cellular differentiation.
Anabaena research has practical applications in human health, sustainable agriculture, and
biofuel production. The objectives of this study and summary of research outcomes are outlined
below.
1. (Chapter 2) Investigate the interaction of hetF, a positive regulatory factor of heterocyst
development, with other developmental genes. A regulatory network involving the
negative regulator patU3 and hetF was identified through these studies, and extended to
include additional developmental genes (the positive regulators hetR and hetZ). These
studies characterize a regulatory mechanism involving a non-RGSGR containing inhibitor
during heterocyst patterning in Anabaena.
2. (Chapter 3) Characterize the role of the PP2C phosphatase All1758 in heterocyst
differentiation[52]. Phosphorylation is a common mechanism used to control a wide
range of biological processes. In addition to a function in nitrogen fixation, this novel
phosphatase was found to have a role in normal cellular processes including cell growth,
cell division, morphology and development. This aim targets understanding interactions
at advanced stages of heterocyst development including commitment and
morphogenesis (Fig. 1.3).
3. (Chapters 4 and 5) Characterize regions in HetR necessary for interaction with inhibitors
of heterocyst differentiation containing the RGSGR pentapeptide sequence (PatS,
HetN)[32], and investigate the intercellular signaling of HetN[53]. PatS and HetN regulate
the gradient size of HetR in the control of heterocyst development, in a manner
resembling vertebrate morphogens. This aim targets understanding interactions at the
pattern formation stage of heterocyst development (Fig. 1.3).
14
REFERENCES CITED
1. Gierer, A. and H. Meinhardt, A theory of biological pattern formation. Kybernetik, 1972.
12: p. 30-39.
2. Wellmer, F. and J.L. Riechmann, Gene networks controlling the initiation of flower
development. Trends Genet, 2010. 26(12): p. 519-27.
3. Schellmann, S. and M. Hulskamp, Epidermal differentiation: trichomes in Arabidopsis as
a model system. Int J Dev Biol, 2005. 49(5-6): p. 579-84.
4. Hulskamp, M., Plant trichomes: a model for cell differentiation. Nat Rev Mol Cell Biol,
2004. 5(6): p. 471-80.
5. Lee, M.M. and J. Schiefelbein, Cell pattern in the Arabidopsis root epidermis determined
by lateral inhibition with feedback. Plant Cell, 2002. 14(3): p. 611-8.
6. Meinhardt, H., Models of biological pattern formation: from elementary steps to the
organization of embryonic axes. Curr. Top. Dev. Biol., 2008. 81: p. 1-63.
7. Meinhardt, H. and A. Gierer, Pattern formation by local self-activation and lateral
inhibition. Bioessays, 2000. 22(8): p. 753-60.
8. Turing, A., The chemical basis of morphogenesis. Phil. Trans. R. Soc. Ser. B, 1952. 237:
p. 37-72.
9. Jiang, J. and C.C. Hui, Hedgehog signaling in development and cancer. Dev Cell, 2008.
15(6): p. 801-12.
10. Gallet, A., Hedgehog morphogen: from secretion to reception. Trends Cell Biol, 2011.
21(4): p. 238-46.
11. Varjosalo, M. and J. Taipale, Hedgehog: functions and mechanisms. Genes Dev, 2008.
22(18): p. 2454-72.
12. Curtis, P.D. and Y.V. Brun, Getting in the loop: regulation of development in Caulobacter
crescentus. Microbiol Mol Biol Rev, 2010. 74(1): p. 13-41.
13. Kysela, D.T., et al., Biological consequences and advantages of asymmetric bacterial
growth. Annu Rev Microbiol, 2013. 67: p. 417-35.
14. Tsokos, C.G. and M.T. Laub, Polarity and cell fate asymmetry in Caulobacter crescentus.
Curr Opin Microbiol, 2012. 15(6): p. 744-50.
15. Wolk, C.P., A. Ernst, and J. Elhai, Heterocyst metabolism and development, in The
Molecular Biology of Cyanobacteria, D.A. Bryant, Editor. 1994, Kluwer Academic
Publishers: Dordrecht, The Netherlands. p. 769-823.
16. Flores, E. and A. Herrero, Compartmentalized function through cell differentiation in
filamentous cyanobacteria. Nat Rev Microbiol, 2010. 8(1): p. 39-50.
17. Laurent, S., et al., Nonmetabolizable analogue of 2-oxoglutarate elicits heterocyst
differentiation under repressive conditions in Anabaena sp. PCC 7120. Proc. Natl. Acad.
Sci. U.S.A., 2005. 102: p. 9907-9912.
15
18. Vazquez-Bermudez, M.F., A. Herrero, and E. Flores, 2-Oxoglutarate increases the
binding affinity of the NtcA (nitrogen control) transcription factor for the Synechococcus
glnA promoter. FEBS letters, 2002. 512(1-3): p. 71-4.
19. Herrero, A., A.M. Muro-Pastor, and E. Flores, Nitrogen control in cyanobacteria. J.
Bacteriol., 2001. 183: p. 411-425.
20. Luque, I., E. Flores, and A. Herrero, Molecular mechanism for the operation of nitrogen
control in cyanobacteria. Embo J, 1994. 13(23): p. 2862.
21. Ehira, S. and M. Ohmori, NrrA, a nitrogen-responsive response regulator facilitates
heterocyst development in the cyanobacterium Anabaena sp. strain PCC 7120. Mol.
Microbiol., 2006. 59: p. 1692-1703.
22. Muro-Pastor, A.M., et al., Mutual dependence of the expression of the cell differentiation
regulatory protein HetR and the global nitrogen regulator NtcA during heterocyst
development. Mol. Microbiol., 2002. 44: p. 1377-1385.
23. Huang, X., Y. Dong, and J. Zhao, HetR homodimer is a DNA-binding protein required for
heterocyst differentiation, and the DNA-binding activity is inhibited by PatS. Proc. Natl.
Acad. Sci. U.S.A., 2004. 101(14): p. 4848-4853.
24. Black, T.A., Y. Cai, and C.P. Wolk, Spatial expression and autoregulation of hetR, a gene
involved in the control of heterocyst development in Anabaena. Mol. Microbiol., 1993. 9: p.
77-84.
25. Du, Y., et al., Identification of the HetR recognition sequence upstream of hetZ in
Anabaena sp. strain PCC 7120. J. Bacteriol., 2012. 194: p. 2297-2306.
26. Higa, K.C. and S.M. Callahan, Ectopic expression of hetP can partially bypass the need
for hetR in heterocyst differentiation by Anabaena sp strain PCC 7120. Mol. Microbiol.,
2010. 77: p. 562-574.
27. Young-Robbins, S.S., et al., Transcriptional regulation of the heterocyst patterning gene
patA from Anabaena sp. strain PCC 7120. J. Bacteriol., 2010. 192: p. 4732-4740.
28. Ramasubramanian, T.S., T.F. Wei, and J.W. Golden, Two Anabaena sp. strain PCC
7120 DNA-binding factors interact with vegetative cell- and heterocyst-specific genes. J.
Bacteriol., 1994. 176(5): p. 1214-1223.
29. Saha, S.K. and J.W. Golden, Overexpression of pknE blocks heterocyst development in
Anabaena sp. strain PCC 7120. Journal of bacteriology, 2011. 193(10): p. 2619-29.
30. Risser, D.D. and S.M. Callahan, Mutagenesis of hetR reveals amino acids necessary for
HetR function in the heterocystous cyanobacterium Anabaena sp. strain PCC 7120. J.
Bacteriol., 2007. 189: p. 2460-2467.
31. Yoon, H.-S. and J.W. Golden, Heterocyst pattern formation controlled by a diffusible
peptide. Science, 1998. 282: p. 935-938.
16
32. Feldman, E.A., et al., Evidence for direct binding between HetR from Anabaena sp. PCC
7120 and PatS-5. Biochmistry, 2011. 50: p. 9212-9224.
33. Feldman, E.A., et al., Differential binding between PatS C-terminal peptide fragments and
HetR from Anabaena sp. PCC 7120. Biochemistry, 2012. 51: p. 2436-2442.
34. Corrales-Guerrero, L., et al., Functional dissection and evidence for intercellular transfer
of the heterocyst-differentiation PatS morphogen. Mol Microbiol, 2013. 88(6): p. 1093-105.
35. Yoon, H.-S. and J.W. Golden, PatS and products of nitrogen fixation control heterocyst
pattern. J. Bacteriol., 2001. 183: p. 2605-2613.
36. Callahan, S.M. and W.J. Buikema, The role of HetN in maintenance of the heterocyst
pattern in Anabaena sp. PCC 7120. Mol. Microbiol., 2001. 40: p. 941-950.
37. Borthakur, P.B., et al., Inactivation of patS and hetN causes lethal levels of heterocyst
differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol.
Microbiol., 2005. 57: p. 111-123.
38. Makarova, K.S., et al., Cyanobacterial response regulator PatA contains a conserved N-
terminal domain (PATAN) with an alpha-helical insertion. Bioinformatics, 2006. 22(11): p.
1297-1301.
39. Orozco, C.C., D.D. Risser, and S.M. Callahan, Epistasis analysis of four genes from
Anabaena sp. strain PCC 7120 suggests a connection between PatA and PatS in
heterocyst pattern formation. J. Bacteriol., 2006. 188(5): p. 1808-1816.
40. Risser, D.D. and S.M. Callahan, HetF and PatA control levels of HetR in Anabaena sp.
strain PCC 7120. J. Bacteriol., 2008. 190: p. 7645-7654.
41. Liang, J., L. Scappino, and R. Haselkorn, The patA gene product, which contains a
region similar to CheY of Escherichia coli, controls heterocyst pattern formation in the
cyanobacterium Anabaena 7120. Proc. Natl. Acad. Sci, USA, 1992. 89: p. 5655-5659.
42. Wong, F.C.Y. and J.C. Meeks, The hetF gene product is essential to heterocyst
differentiation and affects HetR function in the cyanobacterium Nostoc punctiforme. J.
Bacteriol., 2001. 183: p. 2654-2661.
43. Aravind, L. and E.V. Koonin, Classification of the caspase-hemoglobinase fold: detection
of new families and implications for the origin of the eukaryotic separins. Proteins, 2002.
46: p. 355-367.
44. Uren, A.G., et al., Identification of paracaspases and metacaspases: two ancient families
of caspase-like proteins, one of which plays a key role in MALT lymphoma. Mol Cell,
2000. 6(4): p. 961-7.
45. Browning, D.F. and S.J. Busby, The regulation of bacterial transcription initiation. Nat Rev
Microbiol, 2004. 2(1): p. 57-65.
17
46. Brahamsha, B. and R. Haselkorn, Isolation and characterization of the gene encoding the
principal sigma factor of the vegetative cell RNA polymerase from the cyanobacterium
Anabaena sp. strain PCC 7120. J. Bacteriol., 1991. 173(8): p. 2442-2450.
47. Brahamsha, B. and R. Haselkorn, Identification of multiple RNA polymerase sigma factor
homologs in the cyanobacterium Anabaena sp. strain PCC 7120: Cloning, expression,
and inactivation of the sigB and sigC genes. J. Bacteriol., 1992. 174: p. 7273-7282.
48. Khudyakov, I. and J.W. Golden, Identification and inactivation of three group 2 sigma
factor genes in Anabaena sp. strain PCC 7120. J. Bacteriol., 2001. 183: p. 6667-6675.
49. Aldea, M.R., R.A. Mella-Herrera, and J.W. Golden, Sigma factor genes sigC, sigE and
sigG are upregulated in heterocysts of the cyanobacterium Anabaena sp. strain PCC
7120. J. Bacteriol., 2007. 189: p. 8392-8396.
50. Mella-Herrera, R.A., et al., The sigE gene is required for normal expression of heterocyst-
specific genes in Anabaena sp. strain PCC 7120. J Bacteriol, 2011. 193(8): p. 1823-32.
51. Yoshimura, H., et al., Group 3 sigma factor gene, sigJ, a key regulator of desiccation
tolerance, regulates the synthesis of extracellular polysaccharide in cyanobacterium
Anabaena sp. strain PCC 7120. DNA Res, 2007. 14(1): p. 13-24.
52. Tom, S.K. and S.M. Callahan, The putative phosphatase all1758 is necessary for normal
growth, cell size, and synthesis of the minor heterocyst-specific glycolipid in the
cyanobacterium Anabaena sp. strain PCC 7120. Microbiology, 2012. 158: p. 380-389.
53. Higa, K.C., et al., The RGSGR amino acid motif of the intercellular signaling protein,
HetN, is required for patterning of heterocysts in Anabaena sp. strain PCC 7120. Mol.
Microbiol., 2012. 83: p. 682-693.
18
CHAPTER 2. ROLE OF HETF AND PATU3 IN THE REGULATION OF HETEROCYST
DEVELOPMENT IN ANABAENA SP. STRAIN PCC 7120
INTRODUCTION
During development in multicellular organisms, the stages of growth, cell division and
morphogenesis occur in a tightly orchestrated manner. Programmed responses properly execute
the intricate progression of cellular differentiation. To this end, regulation of genes and the
products of genes are temporally and spatially coordinated. This regulation allows for the
generation of diverse cell types despite the fundamental sameness of the genetic complement
shared by all cells in the organism. Furthermore, regulation at the single cell level can both
promote and respond to extracellular signals or environmental cues. How this complex interplay
results in a pattern of diverse cell types remains a central question in developmental biology.
Cyanobacteria are key contributors of biologically fixed nitrogen in the environment, an essential
component of the macromolecules of life. Cellular differentiation of a periodic pattern of
specialized nitrogen-fixing cells in the cyanobacterium Anabaena sp. strain PCC 7120 (herein,
Anabaena) is a simple model system for the study of developmental biology. Proper control of
the genetic regulatory network governing heterocyst formation is critical to the development of
Anabaena. Maintenance of the periodicity of cellular differentiation, which results in
approximately one heterocyst separating every ten undifferentiated vegetative cells, is crucial for
the supply of fixed nitrogen to vegetative cells and reductant to heterocysts that supports robust
growth under fixing conditions. Populations of filaments genetically manipulated to give an
increased distribution of terminally differentiated heterocyst cells that no longer divide have a
slower growth rate than the wild-type. Likewise, filaments that elaborate a reduced number of
heterocysts have reduced growth under fixing conditions.
Developmental genes have been identified that regulate heterocyst differentiation and the pattern
of heterocyst formation (Chapter 1). In addition to the heterocyst differentiation genes hetR, hetF
and patA, the gene hetZ [1] also appears to positively regulate heterocyst differentiation.
Located in a gene cluster consisting of three genes, hetZ, patU5 and patU3, together these genes
Figure 2.1. The hetZ-patU5-patU3 gene cluster in Anabaena and locations of transcripts I
and II (tsp I and tsp II). The gene patU5 overlaps hetZ by eight base pairs.
19
coordinate heterocyst differentiation and pattern formation (Fig. 2.1). Deletion of the hetZ gene
abrogates heterocyst development. HetZ appears to regulate heterocyst differentiation by
promoting the expression of other heterocyst development genes such as patS, a negative
regulator of heterocyst formation containing the RGSGR pentapeptide sequence (“PatS-5”;
Chapter 1), and hetC, a predicted ABC transporter required for transition to the non-dividing,
terminally differentiated state of the heterocyst [1, 2]. Regulation of hetZ is connected to the
regulatory network that includes HetR and the RGSGR pentapeptide. HetR binds to a recognition
sequence upstream of the only transcriptional start site of hetZ to regulate hetZ expression[3].
The up-regulation of hetZ is induced within six hours of nitrogen step-down. Although expressed
in both cell types, transcription appears more pronounced in cells that will differentiate. In
addition to the dependence on HetR, expression of hetZ is enhanced by patU3 and repressed by
both hetZ itself as well as through exogenous addition of the RGSGR pentapeptide[3].
Arrangement of the hetZ-patU5-patU3 operon (annotated as alr0099, asr0100 and alr001
respectively) presumably facilitates co-transcription of these genes to coordinate some aspect of
heterocyst development and pattern formation. Two major transcripts, transcript I and transcript II
were originally described to be associated with the gene cluster[1]. Additional transcriptional start
points (tsps) have since been identified in this gene cluster[4] and are described as appropriate in
the Results section. The transcriptional start point for transcript I (“tsp I”) lies 425 bp upstream of
hetZ. A -10 element and a non-canonical NtcA binding site are located upstream of the -425
transcriptional start point. The tsp for transcript II (“tsp II”) lies upstream of patU5, at a site within
hetZ. This clustering of hetZ, patU5 and patU3 may facilitate both the concerted as well as
independent expression of the two major transcripts in order to coordinate heterocyst
development and patterning in Anabaena.
In Nostoc punctiforme, where this genetic locus was discovered, patU5 and patU3 form two parts
of the single patU gene, suggesting that these two gene products may work together in Anabaena.
The patU5 gene, the middle gene in the hetZ-patU5-patU3 gene cluster, is not well characterized.
Because it overlaps the upstream hetZ gene by eight base pairs, this genomic arrangement may
indicate the possibility for coordinated expression of hetZ-patU5. The phenotype of a strain with
patU5 inactivated has not been described. PatU5, and the gene product of the third gene in this
gene cluster, PatU3, do not exhibit homology to protein motifs of known biological function.
However the Mch (multiple contiguous heterocyst) phenotype observed upon inactivation of
patU3 in both the wild-type and patA mutant backgrounds suggests a role for PatU3 in the control
of heterocyst patterning. Overexpression of patU3 from an inducible promoter has been shown to
block the formation of terminal heterocysts in a patA-deletion mutant. Since the patU3 mutant
Mch phenotype parallels that of a patS mutant, PatU3 and PatS may interact through mutual
regulatory pathways. Both patU3 and patS are expressed during early heterocyst development.
20
In gfp reporter strains, patU3 is strongly expressed in developing heterocysts (“proheterocysts”)
and heterocysts, in a spatio-temporal manner that resembles that of patS expression. Unlike
hetZ, patU3 is only very weakly transcribed in vegetative cells, but up-regulation is also evident at
six hours and HetR-dependent[1].
Homologs of hetR, patS and the hetZ-patU5-patU3 gene cluster are found in both heterocyst-
forming and non-heterocyst forming cyanobacteria. These genes represent components of the
minimal gene set shared among filamentous cyanobacteria. As such, homologs of this minimal
gene set may have a more general role other than the control of differentiation and patterning.
In contrast, hetF-like genes are found only in heterocyst-forming strains. A relationship between
hetF and patU3 was identified in this study and integrated into a novel genetic regulatory network
along with other known developmental genes. The goal of this study is to understand how hetF
and patU3 function together as cellular differentiation regulatory factors in the filamentous
cyanobacterium Anabaena.
MATERIALS AND METHODS
Bacterial strains and growth conditions. Descriptions of strains constructed in this study are
summarized in Table 2.1. Growth of Escherichia coli and Anabaena sp. strain PCC 7120 and its
derivatives, concentrations of antibiotics; induction of heterocyst formation in BG-110 medium,
which lacks a combined-nitrogen source; regulation of PpetE and Pnir expression; and conditions
for photomicroscopy were as previously described[5]. Images were processed in Adobe
Photoshop CS2.
Construction of plasmids. Descriptions of plasmids constructed in this study are summarized
in Table 2.2 and oligonucleotides relevant to this study are summarized in Table 2.3. Constructs
derived by PCR were sequenced to verify the integrity of the sequence.
Suicide plasmids
Plasmid pST214 was used to replace most of the coding region of patU3 with an Ω interposon.
An 842 bp region containing the first 42-bp of the patU3 coding region and upstream DNA was
amplified from the chromosome (with primers patU3 up F and patU3 up R) and fused to an 855-
bp region containing the last 49-bp of the patU3 coding region and downstream DNA (using
primers patU3 down F and patU3 down R) via overlap extension PCR. The 1697-bp fragment
(containing patU3∆42-729) was moved into the EcoRV site of pBluescript SK+ (Stratagene) to
generate pST215. The 1697-bp fragment was moved from pST215 into the suicide vector
pRL278 as a BglII-SacI fragment using restriction sites introduced on the primers to create
21
pST213. To generate pST214, the 2082-bp Ω interposon, which confers resistance to
spectinomycin and streptinomycin [6], was introduced into pST213 at a SmaI site introduced on
the primers used for overlap extension PCR.
Plasmid pST373 was used to delete most of the coding region of patU3. The 1697-bp fragment
(containing patU3∆42-729) was moved from pST215 into pRL277 as a BglII-SacI fragment to
create pST373.
Plasmid pST502 was used to delete the coding region of patU3. An 836-bp region containing the
first 36-bp of the patU3 coding region and upstream DNA was amplified from the chromosome
(with primers patU3 up F and patU3 up R DHRB1156) and fused to an 943-bp region containing
the last 136-bp of the patU3 coding region and downstream DNA (using primers patU3 down F
DHRB1156 and patU3 down R) via overlap extension PCR. The 1779-bp fragment (containing
patU3∆36-641) was moved into the EcoRV site of pBluescript SK+ to generate pST501. The
1779-bp fragment was moved from pST501 into pRL277 as a BglII-SacI fragment using
restriction sites introduced on the primers to create pST502.
Plasmid pST504 was used to replace the coding region of patU3 with a Ω interposon, recreating
DHRB1156[1]. The 1779-bp fragment (containing patU3∆36-641) was moved from pST501 into
pRL278 as a BglII-SacI fragment using restriction sites introduced on the primers to create
pST503. To generate pST504, the 2082-bp Ω interposon was introduced into pST503 at a SmaI
site introduced on the primers used for overlap extension PCR.
Plasmid pST518 was used to construct patU3(E69stop). An 1010-bp region containing the first
210 bp of the patU3 coding region and upstream DNA was amplified from the chromosome (with
primers patU3 up F and patU3 glu69stop up R) and fused to an 1377-bp region containing the
last 570-bp of the patU3 coding region and downstream DNA (using primers patU3 glu69stop
down F and patU3 down R) via overlap extension PCR. The 2387-bp fragment was moved into
the EcoRV site of pBluescript SK+ to generate pST519. The 2387-bp fragment was moved from
pST519 into pRL277 as a BglII-SacI fragment using restriction sites introduced on the primers to
create pST518.
Plasmid pST370 was used to delete most of the coding region of hetZ. An 853-bp region
containing the first 33-bp of the hetZ coding region and upstream DNA was amplified from the
chromosome (with primers hetZ up F and hetZ up R) and fused to an 863-bp region containing
the last 48-bp of the hetZ coding region and downstream DNA (using primers hetZ down F and
hetZ down R) via overlap extension PCR. The 1716-bp fragment (containing hetZ∆33-1155) was
22
moved into the EcoRV site of pBluescript SK+ to generate pST369. The 1716-bp fragment was
moved from pST369 into pRL277 as a BglII-SacI fragment to create pST370.
Plasmid pST422 was used to delete the coding region of hetZ. An 1174-bp region containing the
first 354-bp of the hetZ coding region and upstream DNA was amplified from the chromosome
(with primers hetZ up F and hetZ +tsp up R) and fused to an 1259-bp region containing the last
444-bp of the hetZ coding region and downstream DNA (using primers hetZ +tsp II U5U3 down F
1 and hetZ down R) via overlap extension PCR. The 2243-bp fragment (containing hetZ∆354-
762) was moved into the EcoRV site of pBluescript SK+ to generate pST434. The 2243-bp
fragment was moved from pST421 into pRL277 as a BglII-SacI fragment to create pST422.
Plasmid pST424 was used to replace the coding region of hetZ with a Ω interposon. The 2243-
bp fragment was moved from pST434 into pRL278 as a BglII-SacI fragment using restriction sites
introduced on the primers to create pST423. To generate pST424, the 2082-bp Ω interposon
was introduced into pST423 at a SmaI site introduced on the primers used for overlap extension
PCR.
Plasmid pST594 was used to construct patU5(L12stop). An 938-bp region containing the first 36-
bp of the patU5 coding region and upstream DNA was amplified from the chromosome (with
primers patU5 up F and patU5 L12stop up R) and fused to an 975-bp region containing the last
144-bp of the patU5 coding region and downstream DNA (using primers patU5 L12stop down F
and patU5 down R) via overlap extension PCR. The 1917 bp fragment was moved into pRL277
as a BglII-SacI fragment using restriction sites introduced on the primers to create pST594.
Multicopy plasmids
The mobilizable shuttle vector, plasmid pST352 was created using primers alr0101 BamHI F and
asr0098 SacI R to amplify PhetZ-asr0098 from the chromosome. The 614-bp fragment was moved
as a BamHI-SacI fragment into the EcoRV site of pBluescript SK+ to generate pST348. To
create pST352, the fragment was subsequently moved with the same restriction sites into the
replicating plasmid pAM504.
Plasmid pST353 was created using primers alr0101 BamHI F and hetZ SacI R to amplify PhetZ-
hetZ from the chromosome. The 1683-bp fragment was moved as a BamHI-SacI fragment into
the EcoRV site of pBluescript SK+ to generate pST349. To create pST353, the fragment was
subsequently moved with the same restriction sites into pAM504.
23
Plasmid pST354 was created using primers alr0101 BamHI F and patU5 SacI R to amplify PhetZ-
patU5 from the chromosome. The 1851-bp fragment was moved as a BamHI-SacI fragment into
the EcoRV site of pBluescript SK+ to generate pST350. To create pST354 (containing PhetZ-hetZ-
patU5), the fragment was subsequently moved with the same restriction sites into pAM504.
Plasmid pST590 is a derivative of pST354, and bears a truncation in hetZ. The internal primers
hetZ up R SmaI and hetZ down F SmaI were used to amplify plasmid pST354 without the
hetZ∆354-762 region (to “knock out” hetZ). To give plasmid pST590 (carrying PhetZ-hetZ∆354-
762-patU5), the PCR product was moved into pAM504 using the SmaI restriction sites introduced
on the primers.
Plasmid pST355 was created using primers alr0101 BamHI F and patU3 SacI R to amplify PhetZ-
patU3 from the chromosome. The 2647 bp fragment was moved as a BamHI-SacI fragment into
the EcoRV site of pBluescript SK+ to generate pST351. To create pST355 (containing PhetZ-hetZ-
patU5-patU3), the fragment was subsequently moved with the same restriction sites into pAM504.
Plasmids pST429, pST430, pST431, pST587, pST589, pST591 and pST592 are derivatives of
plasmid pST355, carrying truncations in either one or two of the genes (hetZ, patU5 and/or patU3)
present on pST355. Plasmid pST429 carries a truncation in the hetZ coding region. The internal
primers hetZ up R SmaI and hetZ down F SmaI were used to amplify plasmid pST355 without the
hetZ∆354-762 region (to “knock out” hetZ). To give plasmid pST429 (carrying PhetZ-hetZ∆354-
762-patU5-patU3), the PCR product was moved into pAM504 using the SmaI restriction sites
introduced on the primers.
Plasmid pST430 carries a truncation in the patU5 coding region. The internal primers patU5 up R
SmaI and patU5 down F SmaI were used to amplify plasmid pST355 without the patU5∆45-126
region (to “knock out” patU5). To give plasmid pST430 (carrying PhetZ-hetZ-patU5∆45-126-patU3),
the PCR product was moved into pAM504 using the SmaI sites introduced on the primers.
A stop codon engineered at patU5(L12) is carried on plasmid pST596. A fragment containing the
first 36-bp of the patU5 coding region and upstream DNA was amplified from the chromosome
(with primers alr0101 BamHI F and patU5 L12stop up R) and fused to a fragment containing the
last 144-bp of the patU5 coding region and downstream DNA (using primers patU5 L12stop down
F and patU3 SacI R) via overlap extension PCR. The fragment was moved into pAM504 as a
BamHI-SacI fragment using restriction sites introduced on the primers to create pST596 (carrying
PhetZ-hetZ-patU5 L12stop-patU3).
24
Plasmid pST431 carries a truncation in the patU3 coding region. The internal primers patU3 up R
SmaI and patU3 down F SmaI were used to amplify plasmid pST355 without the patU3∆42-729
region (to “knock out” patU3). To give plasmid pST431 (carrying PhetZ-hetZ-patU5-patU3∆42-729),
the PCR product was moved into pAM504 using the SmaI sites introduced on the primers.
Plasmid pST591 carries truncations in the coding regions of hetZ and patU3. The internal
primers patU3 up R SmaI and patU3 down F SmaI were used to amplify plasmid pST429 without
the patU3∆42-729 region (to “knock out” patU3 from plasmid pST429). To give plasmid pST591
(carrying PhetZ-hetZ∆354-762-patU5-patU3∆42-729), the PCR product was moved into pAM504
using the SmaI sites introduced on the primers.
Plasmid pST592 carries truncations in the coding regions of hetZ and patU5. The internal
primers hetZ up R SmaI and hetZ down F SmaI were used to amplify plasmid pST430 without the
patU3∆42-729 region (to “knock out” hetZ from plasmid pST430). To give plasmid pST592
(carrying PhetZ-hetZ∆354-762-patU5∆45-126-patU3), the PCR product was moved into pAM504
using the SmaI sites introduced on the primers.
Plasmid pST586 carries patU5-patU3 under the control of tsp I. The internal primers PI hetZ up
R SmaI and PI hetZ down F SmaI were used to amplify plasmid pST355 without the hetZ∆33-
1155 region (to remove tsp II from pST355). To give plasmid pST596 (carrying hetZ∆33-1155-
patU5-patU3), the PCR product was moved into pAM504 using the SmaI sites introduced on the
primers.
Plasmid pST587 carries patU5-patU3 under the control of tsp I and tsp II. The internal primers PI
hetZ up R SmaI and hetZ down F SmaI were used to amplify plasmid pST355 without the
hetZ∆33-762 region. To give plasmid pST596 (carrying hetZ∆33-762-patU5-patU3), the PCR
product was moved into pAM504 using the SmaI sites introduced on the primers.
Plasmid pST589, carrying patU5-patU3 under the control of tsp II, was created using the primers
PII hetZ down F BamHI and patU3 SacI R and chromosomal DNA as template. To give plasmid
pST596 (carrying hetZ∆1-762-patU5-patU3), the PCR product was moved into pAM504 as a
BamHI-SacI fragment using the same sites introduced on the primers.
Overexpression vectors
Plasmids pST216 and pST255 carry a transcriptional fusion between the petE promoter and
patU3. The coding region of patU3 was amplified from the chromosome using primers patU3 OE-
25
EcoRI-F and patU3 OE-BamHI-R and ligated into the EcoRV site of pBluescript SK+ to generate
pST227. The fragment was moved from pST227 as an EcoRI-BamHI fragment into pKH256,
designed to create transcriptional fusions to PpetE [7], to generate pST216.
Plasmid pST255 differs from pST216 in the engineered ribosome-binding site that was introduced
by using primer patU3-EcoRI-rbs-F in place of patU3 OE-EcoRI-F to amplify patU3 from the
chromosome. The PCR fragment was moved into the EcoRV site of pBluescript SK+ to generate
pST256, and subsequently moved from pST256 as an EcoRI-BamHI fragment into pKH256 to
generate pST255.
Plasmid pST315 bears a transcriptional fusion between the petE promoter and patU5 and patU3.
The region containing patU5 and patU3 was amplified from the chromosome using primers patU5
EcoRI F (containing a ribosome-binding site) and patU3 OE-BamHI-R and ligated into the EcoRV
site of pBluescript SK+ to generate pST322. The fragment was moved from pST322 as an
EcoRI-BamHI fragment into pKH256 to generate pST315.
Plasmids pST414, pST415, pST416, pST417, pST418, pST419 and pST420 bear transcriptional
fusions to the nirA promoter. The coding region of hetZ was amplified from the chromosome
using primers hetZ SmaI F and hetZ KpnI R and ligated into the EcoRV site of pBluescript SK+ to
generate pST407. To make pST414, the fragment was moved from pST407 as a SmaI-KpnI
fragment into pDR311 (bearing a Pnir-lacZ transcriptional fusion[8]) digested with the same
enzymes to exchange lacZ for hetZ.
Primers hetZ SmaI F and patU5 KpnI R were used to amplify hetZ and patU5 from the
chromosome, and ligated into the EcoRV site of pBluescript SK+ to make pST408. To yield
pST415, the fragment was moved from pST408 as a SmaI-KpnI fragment into pDR311 digested
with the same enzymes.
Primers hetZ SmaI F and patU3 KpnI R were used to amplify hetZ and patU3 from the
chromosome, and ligated into the EcoRV site of pBluescript SK+ to make pST409. To yield
pST416, the fragment was moved from pST409 as a SmaI-KpnI fragment into pDR311 digested
with the same enzymes.
Primers hetZ SmaI F and patU3 KpnI R were used to amplify hetZ and patU3 from the
chromosome, and ligated into the EcoRV site of pBluescript SK+ to make pST409. To yield
pST416, the fragment was moved from pST409 as a SmaI-KpnI fragment into pDR311 digested
with the same enzymes.
26
Primers patU5 SmaI F and patU3 KpnI R were used to amplify patU5 and patU3 and the
intergenic region between these genes from the chromosome, and ligated into the EcoRV site of
pBluescript SK+ to make pST410. To yield pST417, the fragment was moved from pST410 as a
SmaI-KpnI fragment into pDR311 digested with the same enzymes.
Primers patU5 SmaI F and patU5 KpnI R were used to amplify patU5 from the chromosome, and
ligated into the EcoRV site of pBluescript SK+ to make pST411. To yield pST418, the fragment
was moved from pST411 as a SmaI-KpnI fragment into pDR311 digested with the same enzymes.
Primers patU3 SmaI F and patU3 KpnI R were used to amplify patU3 from the chromosome, and
ligated into the EcoRV site of pBluescript SK+ to make pST412. To yield pST419, the fragment
was moved from pST412 as a SmaI-KpnI fragment into pDR311 digested with the same enzymes.
Primers patU3 SmaI F and patU3 KpnI R were used to amplify patU3 from the chromosome, and
ligated into the EcoRV site of pBluescript SK+ to make pST412. To yield pST419, the fragment
was moved from pST412 as a SmaI-KpnI fragment into pDR311 digested with the same enzymes.
A fragment containing hetZ (amplified using primers hetZ SmaI F and hetZ patU3 up R) was
fused to a fragment containing patU3 (amplified using primers hetZ patU3 down F and patU3
KpnI R) via overlap extension PCR, and cloned into the EcoRV site of pBluescript SK+ to make
pST413. To yield pST420 (bearing Pnir-hetZ-patU3), the fragment was moved from pST413 as a
SmaI-KpnI fragment into pDR311 digested with the same enzymes.
Bacterial two-hybrid constructs
For each construct, a 32- or 33-bp linker domain was introduced between the adenylate cyclase
fragment and the protein of interest on either the forward or reverse primer.
The hetR coding region was amplified from the chromosome using the primers hetR BamHI F A
and hetR EcoRI R A, and cloned into the EcoRV site of pBluescript SK+ to make pST544. To
make pST558, the 900 bp fragment was moved as a BamHI-EcoRI fragment from pST544 into
pKT25. To make pST565, the fragment was moved as a BamHI-EcoRI fragment directly into
pUT18C.
The hetR coding region was amplified from the chromosome using the primers hetR BamHI F B
and hetR EcoRI R B, and cloned into the EcoRV site of pBluescript SK+ to make pST551. To
27
make pST572 and pST579, the 900 bp fragment was moved as a BamHI-EcoRI fragment from
pST551 into pKNT25 and pUT18 respectively.
The hetF coding region was amplified from the chromosome using the primers hetF BamHI F
GTG1 A and hetF EcoRI R A, and cloned into the EcoRV site of pBluescript SK+ to make
pST545. To make pST559, the 2487 bp fragment was moved as a BamHI-EcoRI fragment from
pST544 into pKT25. To make pST566, the fragment was moved as a BamHI-EcoRI fragment
directly into pUT18C.
Primers hetF BamHI F GTG1 A and hetF EcoRI R A were used to amplify hetF(C246A) from
pDR284[8]. To yield pST597 and pST598, the 2487 bp fragment was moved as a BamHI-EcoRI
fragment directly into pKT25 and pUT18C respectively.
The hetF coding region was amplified from the chromosome using the primers hetF BamHI F
GTG1 B and hetF EcoRI R B, and cloned into the EcoRV site of pBluescript SK+ to make
pST552. To make pST573 and pST580, the 2487 bp fragment was moved as a BamHI-EcoRI
fragment from pST552 into pKNT25 and pUT18 respectively.
Primers hetF BamHI F GTG1 B and hetF EcoRI R B were used to amplify hetF(C246A) from
pDR284. To yield pST599 and pST600, the 2487 bp fragment was moved as a BamHI-EcoRI
fragment directly into pKNT25 and pUT18 respectively.
The hetZ coding region was amplified from the chromosome using the primers hetZ BamHI F A
and hetZ EcoRI R A. To make pST560 and pST567, the 1206 bp fragment was moved as a
BamHI-EcoRI fragment directly into pKT25 and pUT18C respectively.
The hetZ coding region was amplified from the chromosome using the primers hetZ BamHI F B
and hetZ EcoRI R B. To make pST574 and pST581, the 1206 bp fragment was moved as a
BamHI-EcoRI fragment directly into pKNT25 and pUT18 respectively.
The patU5 coding region was amplified from the chromosome using the primers patU5 BamHI F
A and patU5 EcoRI R A. To make pST561 and pST568, the 177 bp fragment was moved as a
BamHI-EcoRI fragment into directly into pKT25 and pUT18C respectively.
The patU5 coding region was amplified from the chromosome using the primers patU5 BamHI F
B and patU5 EcoRI R B. To make pST575 and pST582, the 177 bp fragment was moved as a
BamHI-EcoRI fragment into directly into pKNT25 and pUT18 respectively.
28
The patU3 coding region was amplified from the chromosome using the primers patU3 BamHI F
A and patU3 EcoRI R A, and cloned into the EcoRV site of pBluescript SK+ to make pST548. To
make pST562, the 777 bp fragment was moved as a BamHI-EcoRI fragment from pST548 into
pKT25. To make pST569, the fragment was moved as a BamHI-EcoRI fragment directly into
pUT18C.
The patU3 coding region was amplified from the chromosome using the primers patU3 BamHI F
B and patU3 EcoRI R B, and cloned into the EcoRV site of pBluescript SK+ to make pST555. To
make pST576 and pST583, the 777 bp fragment was moved as a BamHI-EcoRI fragment from
pST555 into pKNT25 and pUT18 respectively.
The patA coding region was amplified from the chromosome using the primers patA BamHI F A
and patA EcoRI R A, and cloned into the EcoRV site of pBluescript SK+ to make pST550. To
make pST564, the 177 bp fragment was moved as a BamHI-EcoRI fragment from pST550 into
pKT25. To make pST571, the fragment was moved as a BamHI-EcoRI fragment directly into
pUT18C.
The patA coding region was amplified from the chromosome using the primers patA BamHI F B
and patA EcoRI R B, and cloned into the EcoRV site of pBluescript SK+ to make pST557. To
make pST578 and pST585, the 177 bp fragment was moved as a BamHI-EcoRI fragment from
pST557 into pKTN25 and pUT18 respectively.
Translational fusion constructs
The translational patU3-gfp reporter fusion under the control of the hetZ promoter was created
using primers alr0101 BamHI F and alr0101 SmaI R to amplify the 2624-bp fragment from the
chromosome. The fragment was ligated into the EcoRV site of pBluescript SK+ to make pST290.
The fragment was subsequently moved as a BamHI-EcoRI fragment into pSMC232, a replicating
plasmid used to generate translational fusions to gfp[8], to give pST291.
The translational patU3-gfp reporter fusion under the control of the hetZ promoter was created
using primers PpetE-BamHI-F and alr0101 SmaI R to amplify a 1119-bp fragment containing
PpetE-patU3 from pST216. The fragment was ligated into the EcoRV site of pBluescript SK+ to
make pST292. The fragment was subsequently moved as a BamHI-EcoRI fragment into
pSMC232 to give pST293.
29
Strain construction. Descriptions of strains constructed in this study are summarized in Table
2.1. Deletions and replacements of chromosomal DNA was performed as previously described [9].
All strains were screened via colony PCR with primers annealing outside of the chromosomal
region introduced on the suicide plasmids used for strain construction and tested for sensitivity
and resistance to the appropriate antibiotics. Additionally, strains with engineered stop codons in
patU5 and patU3 were sequenced to verify the presence of the mutation. For strains with
mutations in more than one gene, mutations were introduced in the order indicated in the strain
description.
Plasmid pST370 was used to cleanly delete nucleotides +33 to +1155 relative to the ATG
translational initiation codon of hetZ (denoted as hetZ∆33-1155) from strains PCC 7120, ∆hetF,
∆patA ∆hetF and ∆hetR ∆patA ∆hetF to create strains hetZ∆33-1155, ∆hetF hetZ∆33-1155,
∆patA ∆hetF hetZ∆33-1155 and ∆hetR ∆patA ∆hetF hetZ∆33-1155.
Strain patU3∆42-729 hetZ∆33-1155 was constructed by introduction of pST370 into strain
patU3∆42-729. Colonies representing single recombinants did not arise after repeated attempts
to introduce pST373 into hetZ∆33-1155 to generate hetZ∆33-1155 patU3∆42-729.
Plasmid pST422 was used to cleanly delete nucleotides +354 to +762 relative to the ATG
translational initiation codon of hetZ (denoted as hetZ∆354-762) from strains PCC 7120 and
∆hetF to create strains hetZ∆354-762 and ∆hetF hetZ∆354-762.
Plasmid pST424 was used to replace nucleotides +354 to +762 relative to the ATG translational
initiation codon of hetZ (denoted as hetZ∆354-762) with an Ω cassette. Plasmid pST424 was
introduced into strains ∆hetF, ∆patA ∆hetF and ∆hetR ∆patA ∆hetF to create strains ∆hetF
hetZ∆354-762 with Ω cassette, ∆patA ∆hetF hetZ∆354-762 with Ω cassette and ∆hetR ∆patA
∆hetF hetZ∆354-762 with Ω cassette.
Plasmid pST373 was used to cleanly delete nucleotides +42 to +729 relative to the ATG
translational initiation codon of patU3 (denoted as patU3∆42-729) from strains PCC 7120, ∆hetF,
∆patA ∆hetF and ∆hetR ∆patA ∆hetF to generate strains patU3∆42-72, ∆hetF patU3∆42-729,
∆patA ∆hetF patU3∆42-729 and ∆hetR ∆patA ∆hetF patU3∆42-729.
Strain patU3∆42-729 ∆hetR was constructed by introduction of pSMC104 into strain patU3∆42-
729. Colonies representing single recombinants did not arise after repeated attempts to
introduce pST373 into ∆hetR to generate ∆hetR patU3∆42-729.
30
Plasmid pST214 was used to replace nucleotides +42 to +729 relative to the ATG translational
initiation codon of patU3 (denoted as patU3∆42-729) with an Ω cassette. Plasmid pST214 was
introduced into strains PCC 7120, ∆hetF and ∆patA ∆hetF to generate strains patU3∆42-729 with
Ω cassette, ∆hetF patU3∆42-729 with Ω cassette and ∆patA ∆hetF patU3∆42-729 with Ω
cassette.
Plasmid pST502 was used to cleanly delete nucleotides +36 to +641 relative to the ATG
translational initiation codon of patU3 (denoted as patU3∆36-641) from strain PCC 7120 to
generate strain patU3∆36-641.
Plasmid pST504 was used to replace nucleotides +36 to +641 relative to the ATG translational
initiation codon of patU3 (denoted as patU3∆36-641) with an Ω cassette. Plasmid pST502 was
introduced into strain PCC 7120 to generate strain patU3∆36-641 with Ω cassette.
Plasmid pST518 was used to engineer a stop codon at residue E69 of the translated product of
patU3 (denoted as patU3(E69stop)) from strains PCC 7120, ∆hetF and ∆patA ∆hetF to generate
strains patU3(E69stop), ∆hetF patU3(E69stop), and ∆patA ∆hetF patU3(E69stop). All double
recombinants tested in the latter two parental strains did not have the E69stop mutation.
Plasmid pST594 was used to engineer a stop codon at residue L12 of the translated product of
patU5 (denoted as patU5(L12stop)) from strains PCC 7120, ∆hetF and ∆patA ∆hetF to generate
strains patU5(L12stop), ∆hetF patU5(L12stop), and ∆patA ∆hetF patU5(L12stop). All double
recombinants tested did not have the mutation irrespective of the parental strain that was used.
Genetic screens. To isolate spontaneous suppressor bypass mutants of parent strains ∆hetF
and ∆patA ∆hetF, 1 µL of plasmid pDR138 containing PhetR-hetR was introduced into the
hypermutator E. coli strain XL1-RED (Stratagene). The resulting library of mutations in PhetR-hetR
was subsequently introduced into both hetF and hetF patA background strains and plated directly
onto media lacking a source of combined nitrogen (BG-11˳) and antibiotics. Mutants that arose
were sequenced at specific sites in the chromosome (PhetR-hetR, asr0098, and PhetZ-hetZ-patU5-
patU3) to search for mutations in these regions. In addition, the absence of either or both hetF
and patA in these mutants as appropriate was verified by colony PCR.
Bacterial two-hybrid and β-galactosidase assays. Bacterial two-hybrid assays were
performed as previously described [10-12]. The average β-galactosidase-specific activity (three
replicates) of each positive protein-protein interaction was determined as previously described
[12].
31
Table 2.1. Strains used in Chapter 2
Anabaena sp. strain
Relevant characteristic(s) Source or reference (UHM designation)
PCC 7120 Wild-type Pasteur culture collection
∆hetF hetF-deletion strain [8] (UHM130)
∆patA ∆hetF patA-, hetF-deletion strain [8] (UHM135)
∆hetR ∆patA ∆hetF
hetR-, patA-, hetF-deletion strain [8] (UHM 134)
∆patS patS-deletion strain [9] (UHM114)
∆hetN with Ω cassette
hetN-deletion strain with Ω cassette [9] (UHM115)
∆hetN hetN-deletion strain [13] (UHM150)
hetZ∆33-1155 hetZ∆33-1155-deletion strain This study (UHM309)
∆hetF hetZ∆33-1155
hetF-, hetZ∆33-1155-deletion strain This study (UHM310)
∆patA ∆hetF hetZ∆33-1155
patA-, hetF-, hetZ∆33-1155-deletion strain This study (UHM311)
∆hetR ∆patA ∆hetF hetZ∆33-1155
hetR-, patA-, hetF-, hetZ∆33-1155-deletion strain This study (UHM312)
hetZ∆354-762 hetZ∆354-762-deletion strain This study (UHM313)
∆hetF hetZ∆354-762
hetF-, hetZ∆354-762-deletion strain This study (UHM314)
∆hetF hetZ∆354-762 with Ω cassette
hetF-, hetZ-strain with hetZ bp 354-762 replaced with Ω cassette
This study (UHM315)
∆patA ∆hetF hetZ∆354-762
with Ω cassette
patA-, hetF-, hetZ-strain with hetZ bp 354-762 replaced with Ω cassette
This study (UHM316)
∆hetR ∆patA ∆hetF hetZ∆354-762 with Ω cassette
hetR-, patA-, hetF-, hetZ-strain with hetZ bp 354-762 replaced with Ω cassette
This study (UHM317)
patU3∆42-729 patU3∆42-729-deletion strain This study (UHM319)
∆hetF patU3∆42-729
hetF-, patU3∆42-729-deletion strain This study (UHM320)
∆patA ∆hetF patU3∆42-729
patA-, hetF-, patU3∆42-729-deletion strain This study (UHM321)
∆hetR ∆patA ∆hetF patU3∆42-729
hetR-, patA-, hetF-, patU3∆42-729-deletion strain This study (UHM322)
patU3∆42-729 with Ω cassette
patU3-deletion strain with patU3 bp 42-729 replaced with Ω cassette
This study (UHM221)
∆hetF patU3∆42-729 with Ω cassette
hetF-, patU3-deletion strain with patU3 bp 42-729 replaced with Ω cassette
This study (UHM226)
32
Table 2.1. (Continued) Strains used in Chapter 2
Anabaena sp. strain
Relevant characteristic(s) Source or reference (UHM designation)
∆patA ∆hetF patU3∆42-729 with Ω cassette
patA-, hetF-, patU3-deletion strain with patU3 bp 42-729 replaced with Ω cassette
This study (UHM222)
patU3∆36-641 patU3∆36-641-deletion strain This study (UHM323)
patU3∆36-641 with Ω cassette
patU3-deletion strain with patU3 bp 36-641 replaced with Ω cassette
This study (UHM324)
patU3(E69stop) patU3 strain with an engineered stop codon at E69 This study (UHM332)
patU3∆42-729 ∆hetR
patU3∆42-729-, hetR-deletion strain This study (UHM338)
patU3∆42-729 hetZ∆33-1155
patU3∆42-729-, hetZ∆33-1155-deletion strain This study (UHM339)
33
Table 2.2. Plasmids used in Chapter 2
Plasmids Relevant characteristic(s) Source or reference
pAM504 Mobilizable shuttle vector for replication in E. coli and Anabaena; Km
r Neo
r [14]
pAM1951 pAM505 with PpatS-gfp [15]
pRL277 Suicide vector; Smr Sp
r [16]
pRL278 Suicide vector; Neor [16]
pROEX-1 Expression vector for generating polyhistidine epitope-tagged proteins; Ap
r
Life Technologies
pDR138 pAM504 carrying PhetR-hetR [17]
pDR211 pAM504 carrying PpetE-patS [18]
pDR320 pAM504 carrying PpetE-hetN [18]
pDR292 pAM504 carrying PhetR-hetR-gfp [18]
pDR293 pAM504 carrying PpetE-hetR-gfp [19]
pDR311 pAM504 carrying Pnir-lacZ [8]
pDR350 pAM504 carrying PpetE-lacZ [8]
pDR336 pET21a carrying hetFGTG1H6 [19]
pKH256 pAM504 bearing PpetE for transcriptional fusions [7]
pSMC104 Suicide vector used to delete hetR [9]
pSMC127 pAM504 carrying PhetR-gfp [20]
pSMC232 pAM504 bearing promotorless gfp for translational fusions [8]
pSMC257 pPROEX-1 carrying patU3 [19]
pSMC258 pPROEX-1 carrying hetZ [19]
pKT25 Plasmid carrying the T25 fragment of CyaA for C-terminal protein fusions
[10]
pKNT25 Plasmid carrying the T25 fragment of CyaA for N-terminal protein fusions
[10]
pUT18C Plasmid carrying the T18 fragment of CyaA for C-terminal protein fusions
[10]
pUT18 Plasmid carrying the T18 fragment of CyaA for N-terminal protein fusions
[10]
pST291 pAM504 carrying PhetZ-hetZ-patU5-patU3-gfp This study
pST293 pAM504 carrying PpetE-patU3-gfp This study
pST352 pAM504 carrying PhetZ-asr0098 This study
pST353 pAM504 carrying PhetZ-hetZ This study
pST354 pAM504 carrying PhetZ-hetZ-patU5 This study
pST355 pAM504 carrying PhetZ-hetZ-patU5-patU3 This study
pST429 pAM504 carrying PhetZ-hetZ∆354-762-patU5-patU3 This study
pST430 pAM504 carrying PhetZ-hetZ-patU5∆45-126-patU3 This study
pST431 pAM504 carrying PhetZ-hetZ-patU5-patU3∆42-729 This study
pST216 pAM504 carrying PpetE-patU3 This study
pST255 pAM504 carrying strong ribosomal binding site and PpetE-patU3
This study
pST315 pAM504 carrying PpetE-patU5-patU3 This study
34
Table 2.2. (Continued) Plasmids used in Chapter 2
Plasmids Relevant characteristic(s) Source or reference
pST414 pAM504 carrying Pnir-hetZ This study
pST415 pAM504 carrying Pnir-hetZ-patU5 This study
pST416 pAM504 carrying Pnir-hetZ-patU5-patU3 This study
pST417 pAM504 carrying Pnir-patU5-patU3 This study
pST418 pAM504 carrying Pnir-patU5 This study
pST419 pAM504 carrying Pnir-patU3 This study
pST420 pAM504 carrying Pnir-hetZ-patU3 This study
pST596 pAM504 carrying PhetZ-hetZ-patU5(L12stop)-patU3 This study
pST590 pAM504 carrying PhetZ-hetZ∆354-762-patU5 This study
pST591 pAM504 carrying PhetZ-hetZ∆354-762-patU5-patU3∆42-729 This study
pST592 pAM504 carrying PhetZ-hetZ∆354-762-patU5∆45-126-patU3 This study
pST586 pAM504 carrying tsp I-patU5-patU3 (hetZ∆33-1155) This study
pST587 pAM504 carrying tsp I-tsp II-patU5-patU3 (hetZ∆33-762) This study
pST589 pAM504 carrying tsp II-patU5-patU3 (hetZ∆1-762) This study
pST291 pSMC232 carrying PhetZ-patU3 This study
pST293 pSMC232 carrying PpetE-patU3 This study
pST370 Suicide plasmid used to delete hetZ∆33-1155 This study
pST422 Suicide plasmid used to delete hetZ∆354-762 This study
pST424 Suicide plasmid used to replace hetZ∆354-762 with an Ω interposon
This study
pST214 Suicide plasmid used to replace patU3∆42-729 with an Ω interposon
This study
pST502 Suicide plasmid used to delete patU3∆36-641 This study
pST504 Suicide plasmid used to replace patU3∆36-641 with an Ω interposon
This study
pST518 Suicide plasmid used to construct patU3(E69stop) This study
pST594 Suicide plasmid used to construct patU5(L12stop) This study
pST558 pKT25 carrying hetR This study
pST559 pKT25 carrying hetF This study
pST560 pKT25 carrying hetZ This study
pST561 pKT25 carrying patU5 This study
pST562 pKT25 carrying patU3 This study
pST564 pKT25 carrying patA This study
pST597 pKT25 carrying hetF(C246A) This study
pST565 pUT18C carrying hetR This study
pST566 pUT18C carrying hetF This study
pST567 pUT18C carrying hetZ This study
pST568 pUT18C carrying patU5 This study
pST569 pUT18C carrying patU3 This study
pST571 pUT18C carrying patA This study
pST598 pUT18C carrying hetF(C246A) This study
pJP42 pKNT25 carrying divIVA (Bacillus subtilis) [12]
35
Table 2.2. (Continued) Plasmids used in Chapter 2
Plasmids Relevant characteristic(s) Source or reference
pST572 pKNT25 carrying hetR This study
pST573 pKNT25 carrying hetF This study
pST574 pKNT25 carrying hetZ This study
pST575 pKNT25 carrying patU5 This study
pST576 pKNT25 carrying patU3 This study
pST578 pKNT25 carrying patA This study
pST599 pKNT25 carrying hetF(C246A) This study
pJP41 pUT18 carrying divIVA (Bacillus subtilis) [12]
pST579 pUT18 carrying hetR This study
pST580 pUT18 carrying hetF This study
pST581 pUT18 carrying hetZ This study
pST582 pUT18 carrying patU5 This study
pST583 pUT18 carrying patU3 This study
pST585 pUT18 carrying patA This study
pST600 pUT18 carrying hetF(C246A) This study
36
Table 2.3. Oligonucleotides used in Chapter 2
Primer no.
Primer name Sequence (5’ to 3’)
1 patU3 up F ATAAGATCTACCACCAGAAACCAACGTCGATATCG
2 patU3 up R ATCGAGTTCGCCCGGGCTGTAAACGACGCTTGATTACGGC
3 patU3 down F TCGTTTACAGCCCGGGCGAACTCGATCAGCAACCATTGC
4 patU3 down R ATAGAGCTCAGGTGCGAATGCCAGAGTTTGGC
5 patU3 up R DHRB1156 TGACTGGGCGCCCGGGACGACGCTTGATTACGGCTTG
6 patU3 down F DHRB1156 CAAGCGTCGTCCCGGGCGCCCAGTCATCAAGCCCAGGATG
7 patU3 glu69stop up R CTTTTCCAATATTTATTGGAAAACTCTTTCTGGTAG
8 patU3 glu69stop down F GAGTTTTCCAATAAATATTGGAAAAGTGTCAGCAG
9 hetZ up F ATAAGATCTGCACTGATCAAGATAGCTGAATATGC
10 hetZ up R GAATTACGAACCCGGGGGTTGGAATAGTTGCTGTTG
11 hetZ down F TATTCCAACCCCCGGGTTCGTAATTCCCTAGTGTCC
12 hetZ down R ATAGAGCTCCATTACCTTGCAGTGTCAAGATTCC
13 hetZ +tsp up R GAGTCAAACCCCCGGGGCGCTGAGGGGGATTAATGTA
14 hetZ +tspII U5U3 down F 1 TATTCCAACCCCCGGGATGGACTATCTGGAGCAGAAAC
15 patU5 up F ATAAGATCTAGTCGAACTACACAGTACACTCAGC
16 patU5 L12stop up R CAACAAACCGAGTCAGTACTGTTGCAAAGATTCTG AGTCAC
17 patU5 L12stop down F GACTCAGAATCTTTGCAACAGTACTGACTCGGTTTGTTGGCATCCACTGTCAACAAACG
18 hetZ flank up F CACCAAGTTAGCAATTGAGC
19 hetZ flank down R CTCTACACTCAGACATCCTG
20 patU3 flank up F CCAGGAAGACAACAACAGTTG
21 patU3 flank down R GATAACTAAAGTGGGAATGG
22 patU5 U3-1F GATTTTAGAACAAGCTTGG
23 patU5 U3-1R GCTTCTTTCTACCTTCATC
24 PI hetZ up R SmaI TATATCCCGGGGGTTGGAATAGTTGCTGTTG
25 PI hetZ down F SmaI ATATACCCGGGTTCGTAATTCCCTAGTGTCC
26 PII hetZ down F BamHI ATATAGGATCCATGGACTATCTGGAGCAGAAA
27 patU5 down R ATAGAGCTCCTACCTTCATCTCTATTGTGCTAGCAG
28 alr0101 BamHI F TATATGGATCCGGGATTAGAGAAACATCCTG
29 asr0098 SacI R TATATGAGCTCTAGTGATACGATTTGCTACATC
30 hetZ SacI R TATATGAGCTCGTTGCAAAGATTCTGAGTCA
37
Table 2.3. (Continued) Oligonucleotides used in Chapter 2
Primer no.
Primer name Sequence (5’ to 3’)
31 patU5 SacI R TATATGAGCTCCAGTAGGAATTTCTCCTAATC
32 patU3 SacI R TATATGAGCTCGCTAGCAGTGGTAATTTCAG
33 hetZ up R SmaI TATATCCCGGGGCGCTGAGGGGGATTAATGTA
34 hetZ down F SmaI ATATACCCGGGATGGACTATCTGGAGCAGAAA
35 patU5 up R SmaI TATATCCCGGGCAACAAACCGAGTAAGTACTG
36 patU5 down F SmaI ATATACCCGGGGCTACTTCACAAAGAGGTCAG
37 patU3 up R SmaI TATATCCCGGGCTGTAAACGACGCTTGATTACGGC
38 patU3 down F SmaI ATATACCCGGGGAACTCGATCAGCAACCATTGC
39 patU3 OE-EcoRI-F TATATGAATTCATGTGCAAGAACGTTTTCAAGC
40 patU3 OE-BamHI-R TATATGGATCCGCTAGCAGTGGTAATTTCAG
41 patU3-EcoRI-rbs-F TATATGAATTCAGGAGGTGATTGTGCAAGAACGTTTTCAAGC
42 patU5 EcoRI F TATATAAGGAGGAATTCATATGAATAGTGACTCAGAATC
43 hetZ SmaI F ATATACCCGGGAGGAAACAGCTATGAATTCAGCCGCAACAGC
44 hetZ KpnI R TATATGGTACCGTTGCAAAGATTCTGAGTCA
45 patU5 SmaI F ATATACCCGGGAGGAAACAGCTATGAATAGTGACTCAGAATC
46 patU5 KpnI R TATATGGTACCCAGTAGGAATTTCTCCTAATC
47 patU3 SmaI F ATATACCCGGGAGGAAACAGCTGTGCAAGAACGTTTTCAAGC
48 patU3 KpnI R TATATGGTACCGCTAGCAGTGGTAATTTCAG
49 hetZ patU3 up R GTTCTTGCACCTATTCATGAGTGGATGCACTT
50 hetZ patU3 down F TCATGAATAGGTGCAAGAAC GTTTTCAAGCC
51 hetR BamHI F A AGGAGGGATCCGGGTTCCGCTGGCTCCGCTGCTGGTTCTGGCAGTAACGACATCGATCTGATCAAG
52 hetR EcoRI R A CTCCTGAATTCTTAATCTTCTTTTCTACCAAACACCATTTGTAAAATC
53 hetR BamHI F B AGGAGGGATCCGAGTAACGACATCGATCTGATC
54 hetR EcoRI R B CTCCTGAATTCCCGCCAGAACCAGCAGCGGAGCCAGCGGAACCATCTTCTTTTCTACCAAACACCATTTGTAAAATC
55 hetF BamHI F GTG1 A AGGAGGGATCCGGGTTCCGCTGGCTCCGCTGCTGGTTCTGGC TCCCAGGAAT TTCACATTTC TGTAAC
56 hetF EcoRI R A CTCCTGAATTCCTACTTGGGGCTTTTTTGTTGC
57 hetF BamHI F GTG1 B AGGAGGGATCCGTCCCAGGAA TTTCACATTT CTG
58 hetF EcoRI R B CTCCTGAATTCCCGCCAGAACCAGCAGCGGAGCCAGCGGAACCCTTGGGGCTTTTTTGTTGCAG
59 hetZ BamHI F A AGGAGGGATCCGGGTTCCGCTGGCTCCGCTGCTGGTTCTGGCAATTCAGCCGCAACAGCAACTATTC
38
Table 2.3. (Continued) Oligonucleotides used in Chapter 2
Primer no.
Primer name Sequence (5’ to 3’)
60 hetZ MunI R A CTCCTCAATTGCTATTCATGAGTGGATGCACTTG
61 hetZ BamHI F B AGGAGGGATCCGAATTCAGCCGCAACAGCAAC
62 hetZ MunI R B CTCCTCAATTGCCGCCAGAACCAGCAGCGGAGCCAGCGGAACCTTCATGAGTGGATGCACTTGATC
63 patU5 BamHI F A AGGAGGGATCCGGGTTCCGCTGGCTCCGCTGCTGGTTCTGGCAATAGGACTCAGAATCTTTGCAACAG
64 patU5 EcoRI R A CTCCTGAATTCTCAAAAGGTTTGGGGCTGCCTTTTC
65 patU5 BamHI F B AGGAGGGATCCGAATAGTGACTCAGAATCTTTGCAAC
66 patU5 EcoRI R B CTCCTGAATTCCCGCCAGAACCAGCAGCGGAGCCAGCGGAACCAAAGGTTTGGGGCTGCCTTTTC
67 patU3 BamHI F A AGGAGGGATCCGGGTTCCGCTGGCTCCGCTGCTGGTTCTGGCCAAGAACGTTTTCAAGCCGTAATC
68 patU3 EcoRI R A CTCCTGAATTC CTATGTTGCGGGATTAATGAC
69 patU3 BamHI F B AGGAGGGATCCGCAAGAACGTTTTCAAGCCGTAATC
70 patU3 EcoRI R B CTCCTGAATTCCCGCCAGAACCAGCAGCGGAGCCAGCGGAACCTGTTGCGGGATTAATGACAAATAGC
71 patA BamHI F A AGGAGGGATCCGGGTTCCGCTGGCTCCGCTGCTGGTTCTGGCAAAACACTTCCGATTACTAGATACAG
72 patA EcoRI R A CTCCTGAATTCTTACGTAATGTGTTTAAAAATTACTTTTCAAATCACC
73 patA BamHI F B AGGAGGGATCCGAAAACACTTCCGATTACTAGATACAG
74 patA EcoRI R B CTCCTGAATTCCCGCCAGAACCAGCAGCGGAGCCAGCGGAACCCGTAATGTGTTTAAAAATTACTTTTAGCAAATCACC
75 alr0101 SmaI R ATATACCCGGGATGTTGCGGGATTAATGACAAATAGC
76 PpetE-BamHI-F ATATAGGATCCCTGAGGTACTGAGTACACAG
77 hetZ up R CTTTCTACAGCACCAGAAGC
78 hetZ-F TCATGATGTAGCAAATCG
79 hetZ-R GCGTTTGTTGACAGTGGATG
39
RESULTS
Mutations in patU3 restore heterocyst formation in hetF and hetF patA backgrounds
As one of the key regulators of heterocyst differentiation, hetF promotes heterocyst development.
In an effort to elucidate the mechanism of HetF in the formation of heterocysts, a genetic screen
was performed to isolate spontaneous mutants that bypass the hetF-dependent regulation of
heterocyst development. Mutants arising from this screen may represent components of the
regulatory network controlling differentiation in heterocystous cyanobacteria.
hetF and hetF patA deficient strains both are incapable of forming heterocysts (Fig. 2.2A), but the
phenotypes of these strains differ dramatically. Because the hetF strain exhibits aberrant cell
morphology and growth impairment, it was unclear whether this phenotype would complicate the
screen. HetF and PatA work in the same pathway responsible for regulation of HetR turnover[8].
The hetF patA strain does not exhibit the characteristic morphological changes observed in the
hetF deficient strain. For this reason, the hetF patA deficient strain was also used in this screen.
Colonies that arose on N- medium (lacking a source of combined nitrogen) represented
spontaneous bypass mutants of hetF and hetF patA that can fix nitrogen. Colonies from bypass
of each background strain were subsequently screened for the presence of heterocysts in N-
medium. Approximately half of these colonies could form heterocysts in N- media, in a pattern
similar to that of the wild-type, although the timing of differentiation appeared to be delayed for
some mutants (Fig. 2.2B).
Mutants that fixed
nitrogen in both the hetF
as well as the hetF patA
mutant backgrounds
were isolated in this
screen. Ten mutants
were sequenced at
candidate regions in the
chromosome in an effort
to determine the identity
of mutations. As
summarized in Table 2.4,
mutations were not
found in the hetR promoter nor hetR coding frame, asr0098 (the gene annotated immediately
upstream of hetZ), the hetZ promoter nor hetZ coding frame, nor within patU5. Five of the ten
mutants isolated were found to have deletions or nonsense mutations in the coding frame of
Figure 2.2. ∆hetF ∆patA strain (A) with an additional mutation in
patU3 (B) restores the ability of ∆hetF ∆patA to form heterocysts in
nitrate-deficient media. Carets indicate heterocysts.
40
patU3. Thus in addition to patU3, other unidentified genes are involved in the observed bypass
phenotype.
Because mutations
in patU3 were
discovered to
restore the inability
of these
background strains to form functional heterocysts (Fig. 2.2), a genetic association may exist
between hetF and patA and patU3. The relationship between HetF and PatU3 suggested by the
suppression results is depicted in Figure 2.3.
Table 2.4. Location of spontaneous mutations isolated within the 258-amino acid protein PatU3
found to restore the ability of hetF and hetF patA background strains to form heterocysts.
Background strain Name of isolate Consequence of mutation in PatU3
∆hetF F 2 ∆61-66 (VNLPER)
∆hetF F 5 W170stop
∆hetF ∆patA F 10 R113stop
∆hetF ∆patA FA 2 E69stop
∆hetF ∆patA FA 3 S144stop
patU3 negatively regulates heterocyst development and contributes to normal cell size
The gene responsible for restoring heterocyst formation in hetF-deficient strains, patU3, is located
in a gene cluster along with hetZ and patU5 (Fig. 2.1). DRHB1156, the original patU3 mutant,
was described as having a Mch phenotype[1]. In this mutant, the first 36 and last 136 nucleotides
Figure 2.3. A model for the HetF-dependent regulation of PatU3.
Inhibitors of the interaction represented with bars.
Figure 2.4. Locations of putative tsps (arrows) related to patU3 and sites of mutations
(delta, stars) isolated in the genetic screen described in this study. Lines refer to regions
deleted (dash) or mutated (star) from the Anabaena chromosome in this study.
41
of patU3 flank a kanamycin-resistance cassette (C.K4), deleting all but one putative
transcriptional start point (tsp) located in patU3. The original DHRB1156 mutant was recreated in
our hands using the Ω interposon conferring spectinomycin and streptomycin resistance (strain
patU3∆36-641; Fig. 2.4). In addition, the same region was also cleanly deleted from the
chromosome. Both mutant strains exhibited the same Mch phenotype as originally described
(Table 2.5).
To assess the phenotype of
a patU3 mutant strain that
deleted all four putative tsps,
nucleotides 42-729 of
patU3 were cleanly deleted
(and also replaced with the
Ω interposon) from the
chromosome of different
genotypes (Table 2.5). The
corresponding strains,
patU3∆42-729, encode the
first 14 and last 16 residues
of the 259-residue patU3
gene product. Unlike
patU3∆36-641, this version
deleted all of the internal
tsps defined within patU3 (Fig. 2.4) [4]. In hetF and patA hetF backgrounds, the formation of
heterocysts was restored upon deletion patU3∆36-641 and patU3∆42-729 (Table 2.5, Figure 2.5),
consistent with the screen results.
However, deletions in targeted genes containing internal tsps or antisense tsps may potentially
also disrupt the expression of adjacent genes, leading to misinterpretation of the phenotype of
mutant knock-outs. The mutations described previously did not preserve the four internal tsps
found in patU3 (Fig. 2.4) [4]. To evaluate the inactivation of patU3 function without inactivation of
the internal tsps, one of the five mutant forms of patU3 originally isolated in the screen for bypass
mutants (Table 2.4, Figure 2.2), patU3(E69stop), was recreated in the wild-type strain. The
patU3(E69stop) mutation was chosen because it was not expected to influence any of the tsps in
patU3 while also inactivating patU3. Strain patU3(E69stop) exhibited the same phenotype as
patU3∆42-729 and patU3∆42-729 (Table 2.5) suggesting that the Mch phenotype is due to
inactivation of patU3 alone.
Figure 2.5. Phenotype of patU3∆42-729 (UHM318) (B)
compared to the wild-type (A) after 24 h in nitrate-deficient
media. The diminutive cell size and Mch phenotype is
observed for all other ∆patU3 mutations constructed (Table
2.5). Carets indicate heterocysts.
42
Interestingly, deletion of patU3 results in a diminutive cell phenotype that was not previously
described, and suggests a role in cell division (Fig. 2.5). Smaller filaments have been reported to
occur upon overexpression of hetF from an inducible promoter[8], again suggesting a relationship
between hetF and patU3.
Table 2.5. Anabaena patU3 strains and strain description. For strains with deletions in multiple
genes, mutations are listed in the order the deletions were made. Mch, multiple contiguous
heterocysts.
Name of strain
Strain description Strain characteristics
UHM221 patU3∆42-729 with Ω cassette Mch, small cell phenotype
UHM223 ∆hetF patU3∆42-729 with Ω cassette Mch, small cell phenotype
UHM222 ∆patA ∆hetF patU3∆42-729 with Ω cassette Mch, small cell phenotype
UHM318 patU3∆42-729 Mch, small cell phenotype
UHM319 ∆hetF patU3∆42-729 Mch, small cell phenotype
UHM320 ∆patA ∆hetF patU3∆42-729 Mch, small cell phenotype
UHM321 ∆hetR ∆patA ∆hetF patU3∆42-729 No heterocysts, small cell phenotype
UHM323 patU3∆36-641 Mch, small cell phenotype
UHM324 patU3∆36-641 with Ω cassette Mch, small cell phenotype
UHM332 patU3(E69stop) Mch, small cell phenotype
UHM338 patU3∆42-729 ∆hetR No heterocysts, small cell phenotype
UHM339 patU3∆42-729 hetZ∆33-1155 No heterocysts, small cell phenotype
Inactivation of internal transcription start sites present in hetZ do not affect the hetZ
phenotype
More is known about hetZ than patU5 and patU3; however available descriptions of the hetZ
phenotype are inconsistent and may not reflect inactivation of hetZ alone. Four mutant strains
with hetZ inactivated by a transposon insertion or interrupted by an antibiotic cassette have been
described, but only the transposon-derived mutant named 1801 was incapable of forming
heterocysts[1]. The other three hetZ mutants formed between 3% and 9% heterocysts within 24
hours of nitrogen step-down[1]. This difference in phenotypes may be explained by the presence
of internal transcriptional start sites. Using a differential RNA-seq approach, a genome-wide map
of >10,000 putative internal tsps has been defined[4]. Five internal tsps were found within hetZ
(Fig. 2.6, black arrows). None of these internal tsps correspond to the originally described tsp II
(Fig. 2.6, green arrow)[1].
43
In this study, different mutants were constructed to reflect the inactivation of HetZ function alone,
rather than deletion of regions containing internal tsps or antisense tsps. Using RNA-seq data
and the position of tsp II, different regions (Table 2.6) of hetZ were deleted based on the revised
annotated hetZ sequence [1]. Construction of hetZ strains both with and without the region
corresponding to the six internal tsps allowed for analysis of the function of this region.
Table 2.6. Anabaena hetZ strains and strain description. WT, wild-type.
Name of strain
Strain description Strain characteristics
UHM309 hetZ∆33-1155 No heterocysts; WT size and morphology
UHM310 ∆hetF hetZ∆33-1155 No heterocysts, small cell phenotype
UHM311 ∆patA ∆hetF hetZ∆33-1155 No heterocysts; WT size and morphology
UHM312 ∆hetR ∆patA ∆hetF hetZ∆33-1155 No heterocysts; WT size and morphology
UHM313 hetZ∆354-762 No heterocysts; WT size and morphology
UHM314 ∆hetF hetZ∆354-762 No heterocysts; WT size and morphology
UHM315 ∆hetF hetZ∆354-762 with Ω cassette No heterocysts; WT size and morphology
UHM316 ∆patA ∆hetF hetZ∆354-762 with Ω cassette No heterocysts; WT size and morphology
UHM317 ∆hetR ∆patA ∆hetF hetZ∆354-762 with Ω cassette
No heterocysts; WT size and morphology
Figure 2.6. Locations of putative tsps (arrows) related to hetZ and site of the transposon
insertion (Tn, green inverted triangle) in mutant 1801. Tsp I and tsp II are represented
with green arrows. Additional internal tsps represented with black arrows. Horizontal
dashed lines refer to regions deleted from the Anabaena chromosome in this study.
44
Nucleotides +33 to +1155 relative to the ATG translational initiation codon of hetZ were cleanly
deleted from the wild-type strain. The resulting in-frame deletion mutant, strain hetZ∆33-1155,
contained the first 11 and last 17 residues of the hetZ gene product, eliminating 375 residues of
the 402 residue gene product. Mutant hetZ∆33-1155 was incapable of forming heterocysts (UHM
309, Fig. 2.7) like the previously described mutant 1801. Deletion of the sequence removed all
five putative tsps in addition to tsp II (Fig. 2.6). For this reason, it was unclear whether the
phenotype of the resulting mutant was due solely to the absence of hetZ or polar effects that lead
to the loss of function of either or both downstream genes in the gene cluster, patU5 and patU3.
Strain hetZ∆354-762 deleted
nucleotides +354 to +762 from
the chromosome. Only 408-bp
of hetZ was removed in this
mutant to preserve all putative
tsps in the coding region of hetZ.
In addition, 321-bp upstream of
transcript II was left intact to
allow for interaction with any
unknown regulatory factors.
The resulting mutant contained
the first 118 and last 148 residues of the gene product of hetZ, and eliminated 136 residues of
HetZ from the chromosome. As with mutant 1801, strain hetZ∆354-762 was also incapable of
forming heterocysts. Since both strains hetZ∆354-762 and hetZ∆33-1155 exhibited the same
heterocyst-deficient phenotype, deletion of the tsps did not appear to disrupt the downstream
genes patU5 and patU3. However removal of the tsps from a ∆hetF (but not ∆patA ∆hetF) parent
strain resulted in the small cell phenotype observed in patU3 mutant strains (Table 2.6). The
relationship between these tsps and HetF remains unclear. Taken together, the hetZ ORF alone
appears to be required for coordinating the formation of heterocysts.
Extra copies of patU5 and patU3 inhibit heterocyst differentiation
HetZ and PatU3 regulate heterocyst development in a positive and negative manner, respectively.
In an effort to elucidate the role of the hetZ-patU5-patU3 operon in the coordination of heterocyst
formation, contributions of genes within the gene cluster were tested for their ability to inhibit or
stimulate heterocyst development in the wild-type and ∆patA strains. Genes within the hetZ-
patU5-patU3 gene cluster were introduced in multicopy in different combinations on plasmids
driven by the native promoter PhetZ (Table 2.7; tsp I in Fig. 2.1). As a result of these plasmid-
based studies of the hetZ-patU5-patU3 gene cluster, it was discovered that plasmid pST355
Figure 2.7. Phenotype of ∆hetZ mutant after 24 h in nitrate-
deficient media. hetZ∆33-1155 (UHM309; refer to Table
2.6) no longer differentiates heterocysts. The same
heterocyst-deficient phenotype is observed in the
hetZ∆354-762 mutants (data not shown).
45
carrying the entire gene cluster (PhetZ-hetZ-patU5-patU3) abrogated heterocyst development in all
background strains tested (Table 2.7; additional strains tested not listed). Because HetZ and
PatU3 have contrasting roles in heterocyst differentiation, it was unclear whether the internal start
sites present in hetZ (and thus PatU5 and PatU3) rather than HetZ function influenced the
inhibition results. A truncated version of hetZ was constructed on plasmid pST429 (carrying PhetZ-
hetZ∆354-762-patU5-patU3; Table 2.7) to preserve the internal start sites present in hetZ. The
region truncated corresponded to the same region of hetZ deleted from the chromosome (Table
2.6). Like plasmid pST355, plasmid pST429 also inhibited heterocyst formation in the wild-type
and patA strains. This suggests that the tsps present in hetZ rather than HetZ function are
necessary for inhibition of differentiation by extra copies of patU5 and patU3 on a plasmid.
Table 2.7. Summary of plasmids used to test truncations of genes within the hetZ-patU5-patU3
gene cluster and effect on heterocyst development in wild-type and in ∆patA backgrounds.
Regions deleted (“knocked-out”) in hetZ and patU3 correspond to the same regions deleted in the
chromosome (Fig. 2.4 and 2.6). Truncations in hetZ (hetZ∆354-762) preserved the internal tsps
within hetZ. The native promoter PhetZ was used.
Plasmid description wild-type ∆patA
pST352 PhetZ-asr0098 Unchanged Unchanged
pST353 PhetZ-hetZ Unchanged Unchanged
pST354 PhetZ-hetZ-patU5 Unchanged Unchanged
pST355 PhetZ-hetZ-patU5-patU3 No heterocysts No heterocysts
pST429 PhetZ-hetZ∆354-762-patU5-patU3 (knock-out hetZ)
No heterocysts No heterocysts
pST430 PhetZ-hetZ-patU5∆45-126-patU3 (knock-out patU5)
No heterocysts (rare heterocyst at 48 h)
Occasional terminal heterocyst
pST431 PhetZ-hetZ-patU5- patU3∆42-729 (knock-out patU3)
Wild-type at 72 h Unchanged
pST590 PhetZ-hetZ∆354-762-patU5 (knock out hetZ; PhetZ-patU5)
Unchanged Unchanged
pST591 PhetZ-hetZ∆354-762-patU5-patU3∆42-729 (knock-out hetZ and patU3; PhetZ-patU5)
Unchanged Unchanged
pST592 PhetZ-hetZ∆354-762-patU5∆45-126-patU3 (knock-out hetZ and patU5; PhetZ-patU3)
Terminal heterocysts at 48 h, wild-type at 72 h
Unchanged
pST596 PhetZ-hetZ-patU5(L12stop)-patU3 No heterocysts No heterocysts
The filamentous nitrogen-fixing cyanobacterium Nostoc punctiforme PCC 73102 (herein, “Nostoc”)
is genotypically related to Anabaena. Genes related to heterocyst development are shared
between the two species. In Nostoc however, a single gene patU corresponds to the two genes in
Anabaena, patU5 and patU3 (alluding to the 5’ and 3’ fragments of patU) [21]. Additional studies
were done to further determine if the plasmid-based inhibition results was due to the function of
46
PatU5, PatU3, or both PatU5 and PatU3. To ascertain if both patU5 and patU3 are required to
negatively regulate heterocyst development, plasmids containing either patU5 (pST590, pST591)
or patU3 (pST592) were introduced into wild-type and patA strains (Table 2.7). Inhibition of
heterocyst differentiation by either group of plasmid(s) would suggest that only the corresponding
portion of PatU is required. Either gene alone was not sufficient to inhibit heterocyst formation in
either strain. Thus both patU5 and patU3 in multicopy (driven by the native promoter) are
required for full inhibition of heterocyst development. However, PatU3 by itself appears to lower
the number of heterocysts when present in multicopy (pST592). These results are consistent
with the Mch phenotype of patU3 mutant strains (Table 2.5).
Cis-acting transcriptional and/or translational elements are important for function of the
hetZ-patU5-patU3 gene cluster
Overexpression studies attempted to discern the role of genes within the hetZ-patU5-patU3 gene
cluster, individually and in different combinations. The native promoter (PhetZ) was replaced by
two different inducible promoters (PpetE and Pnir). Despite contrasting positive and negative
regulatory roles for hetZ and patU3 respectfully, overexpression of either gene resulted in the
same phenotype. Excess hetZ or patU3 from the stronger Pnir promoter (plasmids pST414 and
pST419 respectively; Table 2.8) increased heterocyst frequency but also reduced cell size in a
wild-type background. An excess of both hetZ and patU3 on the same plasmid (plasmid pST420)
had no effect on heterocyst development or cell size. Taken together, the location, timing, and/or
level of expression appear to be important as indicated by the varying phenotypes observed.
47
Table 2.8. Summary of plasmids used to overexpress individual genes or combinations of genes
within the hetZ-patU5-patU3 gene cluster and effect on heterocyst development and cell size in
wild-type and ∆patA backgrounds. The inducible promoters PpetE and Pnir were used.
“Unchanged” indicates that the parent phenotype was observed; “↑ heterocysts” indicates that
supernumerary heterocysts were observed; “↓ cell size” indicates that cells had a smaller cell size
compared to the wild-type.
Plasmid description wild-type ∆patA
pST216 PpetE-patU3 Unchanged Unchanged
pST255 Strong ribosomal binding site and PpetE-patU3
Unchanged Unchanged
pST315 PpetE-patU5-patU3 Unchanged Unchanged
pST414 Pnir-hetZ ↑ heterocysts, ↓ cell size
Unchanged
pST415 Pnir-hetZ-patU5 ↑ heterocysts, ↓ cell size
Unchanged
pST416 Pnir-hetZ-patU5-patU3 No heterocysts No heterocysts
pST417 Pnir-patU5-patU3 Unchanged Unchanged
pST418 Pnir-patU5 Unchanged Unchanged
pST419 Pnir-patU3 ↑ heterocysts, ↓ cell size
Unchanged
pST420 Pnir-hetZ-patU3 Unchanged Unchanged
In Caulobacter crescentus two promoters, P1 and P2 are developmentally regulated by the DNA
binding protein CtrA (Chapter 1; [22]). Similarly, the tsps associated with the hetZ-patU5-patU3
gene cluster may control transcription of this region. Two tsps, located upstream and within hetZ
(tsp I and tsp II, respectively; Fig. 2.8, green arrows), were originally identified [1] prior to
identification of internal tsps within the hetZ-patU5-patU3 gene cluster[4, 23]. Plasmids carrying
regions corresponding to all tsps was necessary to drive expression of patU5 and patU3 (pST355
and pST429; Table 2.8), but the role of tsp I and tsp II in heterocyst formation has not been
explored. To evaluate the contribution of tsp I and tsp II towards the function of PatU5 and PatU3,
tsp I and tsp II were introduced separately and coordinately in front of patU5-patU3 on plasmids
(pST586, pST589 and pST587 respectively; Fig. 2.9, Table 2.9). The effect on heterocyst
differentiation was assessed in wild-type and patA backgrounds (Table 2.9). Heterocyst
formation in the wild-type and patA backgrounds was fully inhibited with plasmids that left all tsps
in the gene cluster intact (plasmids pST355, pST429). Plasmids bearing tsp I, tsp II or both tsp I
and tsp II (pST586, pST589, pST587) suppressed heterocyst formation at 24 hours after nitrogen
deprivation in the wild-type. However this inhibitory effect was lost after 48 hours of nitrogen
starvation, as heterocysts were observed in a regular pattern after this timepoint.
48
Table 2.9. Summary of plasmids used to determine the role of tsp I and tsp II in patU5-patU3
expression and effect on heterocyst development in wild-type and ∆patA backgrounds.
Parentheses indicate the truncated region of hetZ that corresponds to tsp I and/or tsp II and
depicted in Figure 2.9 (in the same order from top to bottom of Figure).
Plasmid description wild-type ∆patA
pST586 tsp I-patU5-patU3 (hetZ∆33-1155) Wild-type at 48h
No heterocysts
pST587 tsp I-tsp II-patU5-patU3 (hetZ∆33-762) Wild-type at 48h
No heterocysts
pST589 tsp II-patU5-patU3 (hetZ∆1-762) Wild-type at 48h
No heterocysts
pST429 PhetZ-hetZ∆354-762-patU5-patU3 No heterocysts No heterocysts
pST355 PhetZ-hetZ-patU5-patU3 No heterocysts No heterocysts
Overexpression of hetZ cannot functionally bypass deletion of either hetR or hetF
The developmental genes hetZ, hetR, and hetF positively regulate heterocyst formation. In
strains deficient in these genes, heterocyst formation is abrogated. Accordingly, overexpression
Figure 2.8. Regions present on plasmids used to determine the role of tsp I and tsp II in
patU5-patU3 expression. Putative tsps (arrows; tsp I and tsp II in green) carried on
plasmids described in Table 2.9. The hetZ ORF (1206 nucleotides) is denoted by green
text. Horizontal dashed lines refer to truncated regions upstream or within hetZ not
present on plasmids; these regions also correspond to regions deleted from the
Anabaena chromosome in this study (Table 2.6). Horizontal filled lines refer to the region
of PhetZ -hetZ-patU5-patU3 carried on plasmids (Table 2.9).
49
of these genes from inducible promoters induced increased heterocyst frequencies in the wild-
type. However, overexpression of hetR does not functionally bypass deletion of hetF [8] (nor
hetZ, data not shown) since HetF is required for transcription from the -271 (autoregulatory) start
point of the hetR promoter and proper modulation of HetR protein levels[8]. Additionally,
overexpression of hetF does not functionally bypass deletion of hetR [8] (nor hetZ, data not
shown).
To determine if overexpression of hetZ can functionally bypass deletion of either hetR or hetF, a
plasmid carrying Pnir-hetZ (plasmid pST414; Table 2.8) was introduced into both a hetR-deficient
strain and a hetF-deficient strain. Heterocyst formation was not restored to either background
strain carrying plasmid pST414 (data not shown). Thus in the absence of the normal
transcriptional regulation of hetZ (through use of the Pnir promoter in lieu of the native promoter of
hetZ), hetZ cannot functionally bypass the deletion of hetR or hetF. In addition, heterocyst
formation was not restored upon introduction of a plasmid carrying PhetZ-hetZ (plasmid pST353)
into the same strains (data not shown).
The enlarged cell morphology that results upon the inactivation of hetF is correlated with elevated
levels of HetR[8]. The aberrant phenotype is resolved upon exogenous addition of the
pentapeptide RGSGR (a motif present in PatS and HetN, negative regulators that work at the
level of HetR) and in the double mutants ∆hetR ∆hetF and ∆patA ∆hetF[8]. The hetZ gene
appears to also contribute to this phenotype because the ∆hetF ∆hetZ (as well as ∆patA ∆hetF
∆hetZ and ∆hetR ∆patA ∆hetF ∆hetZ; Table 2.6) strains also do not exhibit the aberrant
morphology associated with the inactivation of hetF alone.
Regulation of heterocyst differentiation by patU3 does not require patS or hetN
The multiple contiguous heterocyst (Mch) phenotype observed upon inactivation of patU3 has
been observed in strains deficient in two genes containing the RGSGR motif, patS and hetN.
Strains with deletions in either patS or hetN also result in a similar Mch phenotype, although the
phenotype is delayed in the hetN-deficient strain[20]. Due to the similar inhibitory effect on
heterocyst development by patU3, patS and hetN, it is unclear whether these three regulatory
genes are associated with the same regulatory circuit. To determine if a patU3 background strain
is sensitive to either inhibitor of differentiation, plasmids overexpressing patS or hetN (carried on
plasmids pDR211 and pDR320, respectively), were introduced into a patU3-deficient strain, and
the effect on heterocyst formation was assessed. Heterocyst formation was abrogated in the
patU3-deficient strain overexpressing either plasmid (data not shown). In the converse
experiment, a plasmid carrying PhetZ-hetZ-patU5-patU3 (plasmid pST355) was introduced into
strains deficient in either patS or hetN. Heterocyst formation was abrogated in both strains with
extra copies of the hetZ-patU5-patU3 gene cluster (data not shown). Thus, patS- and hetN-
50
dependent inhibition of heterocyst formation does not require patU3 for activity. In addition,
patU3-dependent inhibition of heterocyst formation does not require patS or hetN for activity.
Therefore PatU3 and PatS/HetN appear to regulate heterocyst differentiation independent of one
another.
hetZ and patU3 are required for the timing of pattern formation
Because deletions in hetZ and patU3 affect heterocyst frequencies, both genes would appear to
have a role in the patterned formation of heterocysts. Transcription of the developmental genes
hetR and patS are up-regulated in cells in a periodic pattern prior to morphological changes to
differentiating cells. Thus fluorescence emanating from fusions of the native promoters of hetR or
patS to gfp allows visualization of patterning approximately 3-8 hours after removal of combined
nitrogen even in strains that do not form heterocyts[17]. To investigate the role of hetZ and patU3
in pattern formation, plasmids carrying PhetR-gfp and PpatS-gfp (pSMC127 and pAM1951,
respectively) were individually introduced into the wild type (Fig. 2.9A, 2.9D), and into strains
deficient in either gene.
Transcription from the hetR promoter was below the level of detection in both the hetZ-deletion
strain and the patU3-deletion strain, suggesting that hetR expression is dependent on these
genes (Fig 2.9B, 2.9C, respectively). Transcription from the patS promoter was delayed in the
hetZ strain. Fluorescence was only weakly detected after 24 hours after nitrogen removal, but
the spacing of GFP appeared patterned (Fig. 2.9E). Similarly, transcription from the patS
promoter was also delayed in the patU3 strain, but the spacing of fluorescence appeared irregular.
Unlike transcription of patS in the wild-type (Fig. 2.9D), fluorescence corresponding to PpatS-gfp
did not eventually resolve only to differentiated cells. At 48 hours after nitrogen removal, PpatS-gfp
was observed in both vegetative cells and heterocysts (Fig. 2.9F). These results suggest that
both genes are involved in proper temporal and spatial control of pattern formation.
51
Figure 2.9. hetZ and patU3 are required for pattern formation. Visualization of a
transcriptional PhetR-gfp fusion carried on plasmid pSMC127 (A-C) and a transcriptional
PpatS-gfp fusion (D-F) carried on plasmid pAM1951 in the wild-type (A, D), hetZ (B, E),
and patU3 (C, F) genotypes. Micrographs show bright-field (left panels) and GFP
fluorescence images (right panels) images captured using identical microscope and
camera settings 24 h (A-C) and 48 h (D-F) after removal of combined nitrogen. Carets
indicate heterocysts.
52
hetF patU3 and hetF patA patU3 genotypes have diminished HetR-GFP fluorescence in
comparison to hetF and hetF patA genotypes
Inactivation of HetF
and PatA results in a
decrease in
heterocyst frequency,
despite the
concomitant
accumulation of
HetR protein [8].
Mutations in patU3
were found to restore
heterocyst
development in
∆hetF and ∆hetF
∆patA strains. In
order to observe the
fate of HetR protein
within these strains,
HetR-GFP
translational fusions
present on plasmids
pDR292 (bearing PhetR-hetR-gfp) and pDR293 (bearing PpetE-hetR-gfp) were used. Fluorescence
corresponding to HetR-GFP from both plasmids was markedly elevated in strains lacking HetF
and/or PatA (Fig. 2.10B), consistent with elevated levels of HetR in these parent strains.
In the wild-type background, extra heterocysts are observed due to multiple copies of hetR, but
fluorescence is below the level of detection (Fig. 2.10A). Fluorescence was also below the level
of detection for hetF patA patU3 (Fig. 2.10C) backgrounds in marked contrast to the robust
fluorescence seen with the hetF patA parent strain (Fig. 2.10B). Thus, inactivation of patU3
returned the HetR-GFP fluorescence intensity in hetF patA to levels comparable wild-type levels.
This suggests that PatU3 is required for increased levels of HetR in the absence of either or both
hetF and patA.
Figure 2.10. HetR-GFP is not detected in hetF patA patU3 genotypes.
Visualization of a translational PpetE-hetR-gfp fusion on plasmid
pDR293 in the wild-type (A), hetF patA (B), and hetF patA patU3 (C)
genotypes. Micrographs show bright-field (left panels) and
fluorescence images (right panels) images captured using identical
microscope and camera settings 24 h after removal of combined
nitrogen. Carets indicate heterocysts.
53
hetF patU3 and hetF patA patU3 genotypes exhibit reduced hetR expression compared to
the wild-type
The reduction of HetR-GFP in patU3-mutant strains may be explained by either a decrease in
transcription or increased protein turnover. The simplest explanation for decreased HetR-GFP is
decreased expression of hetR. Alternatively, the HetR protein may be rapidly degraded (for
example, perhaps in a hetF-dependent manner), thus resulting in the lack of observable HetR-
GFP fluorescence.
In the wild-type, a
pattern of hetR
expression can be
detected prior to
morphological
modifications to the cell.
Transcription of hetR,
initially up-regulated in
clusters of cells,
resolves to single cells
in a pattern reflecting
the eventual periodic
interval of heterocysts
(Fig 2.11A). To further
understand the
relationship between
hetR and patU3,
transcription of hetR
was observed through
use of plasmid pSMC127 bearing PhetR-gfp.
In the hetF and hetF patA deletion strains, transcription from the hetR promoter is weak (Fig.
2.11B), even though HetR protein is abundant in these strains (Fig. 2.10B). The level of
fluorescence is similar to that detected in vegetative cells of the wild-type (Fig. 2.11A). In mutant
strains lacking both hetF and patU3, there is a loss of HetR-GFP fluorescence altogether (Fig.
2.10C) and transcription is below the level of detection afforded by the GFP transcriptional fusion
(Fig. 2.11C). The question of how strains with hetF patU3 and hetF patA patU3 genotypes form
heterocysts seemingly in the absence of hetR transcription is enigmatic.
Figure 2.11. Expression of hetR is not detected in the hetF patA
patU3 genotype. Visualization of a transcriptional PhetR-gfp fusion on
plasmid pSMC127 in the wild-type (A), hetF patA (B), and hetF patA
patU3 (C) genotypes. Micrographs show bright-field (left panels) and
fluorescence images (right panels) images captured using identical
microscope and camera settings 24 h after removal of combined
nitrogen. Carets indicate heterocysts.
54
Genetic epistasis analysis suggests hetR acts upstream of patU3 in the regulation of
heterocyst differentiation
Despite the absence of PhetR-gfp and PpetE-hetR-gfp in hetF patA patU3 parent strains,
heterocysts form at a frequency far greater than observed in the wild-type (Fig. 2.10, 2.11). This
may suggest that the patU3 mutation in a hetF patA background bypasses the need for hetR in
heterocyst development. To determine if hetR was no longer required for the formation of
heterocysts in a strain without the genes hetF, patA or patU3, the quadruple mutant UHM321 was
constructed by creating an in-frame deletion of the patU3 gene (patU3∆42-729) from the ∆hetR
∆hetF ∆patA parent strain. The resultant ∆hetR ∆hetF ∆patA ∆patU3 (UHM321) strain did not
exhibit heterocyst formation (data not shown), indicating that mutations in patU3 cannot bypass
the requirement for hetR in a hetF patA background. The small cell phenotype of patU3 strains
was also observed (Table 2.5). Because some level of HetR appears to be required for
heterocyst to form in this quadruple mutant strain, deletion of hetR is epistatic to that of patU3.
To understand the relationship of hetR in the patU3-dependent regulation of heterocyst
development and allow placement of patU3 into the working model of genetic interactions
involved in heterocyst differentiation (Chapter 1; Fig. 1.3), the double mutant patU3∆42-729
∆hetR was constructed. Epistasis of mutations in PatU3 and HetR was used to discriminate
between the two models proposed in Figure 2.12. The absence of heterocysts in this strain
would support the model depicted in Figure 2.12A, whereas the presence of heterocysts would
support the model shown in Figure 2.12B.
Inactivation of patU3 did not restore heterocysts to a hetR mutant (Fig. 2.13E). The Mch
phenotype observed in patU3 background strains (Fig. 2.13D) was abrogated upon inactivation of
hetR in the double mutant. But the diminutive cell size characteristic of patU3 strains remained
(Fig. 2.13D; Table 2.5). Consistent with the heterocyst-deficient phenotype of the quadruple
mutant strain ∆hetR ∆hetF ∆patA ∆patU3, the model presented in Figure 2.12A is supported. The
patU3 gene acts upstream of hetR to inhibit heterocyst formation (Fig. 2.17).
Figure 2.12. Two proposed models of genetic interaction between hetR and patU3 in the
control of heterocyst development. Inhibitors of the interaction represented with bars,
activators represented with arrows.
55
Figure 2.13. Heterocyst formation is abrogated in ∆patU3 ∆hetR and ∆patU3 ∆hetZ
double mutant strains. The double mutant strains (E) patU3∆42-729∆hetR and (F)
patU3∆42-729hetZ∆33-1155 no longer exhibit the Mch phenotype of (D) strain
patU3∆42-729. Strains with patU3 inactivated (D-F) exhibit a small cell phenotype
compared to the (A) wild-type, (B) ∆hetR and (C) hetZ∆33-1155. Micrographs captured
after 48 h in nitrate-deficient media using identical microscope and camera settings.
Carets indicate heterocysts.
56
Genetic epistasis analysis suggests patU3 acts upstream of hetZ in the control of
heterocyst differentiation
The developmental genes hetZ and patU3 coordinate heterocyst development. However, the
interaction between them is not understood. To determine which mutation, ∆hetZ or ∆patU3 is
epistatic, double mutants of hetZ and patU3 were constructed. The resultant strain, patU3∆42-
729 hetZ∆33-1155, allowed for discrimination between the two models of genetic interactions
between hetZ and patU3 depicted in Figure 2.14. The presence of heterocysts in this strain would
support the model in Figure 2.14A, whereas the absence of heterocysts would support the model
in Figure 2.14B.
The patU3∆42-729 hetZ∆33-1155 double mutant was incapable of forming heterocysts (Fig.
2.13F), similar to the phenotype upon inactivation of hetZ (Fig. 2.13C), and exhibited the small
cell phenotype observed upon deletions in patU3 (Fig. 2.13D). This result supports the model
depicted in Figure 2.14B. Thus patU3 acts upstream of hetZ in the working model of genetic
interactions involved in heterocyst differentiation (Chapter 1, Fig. 1.3; Fig. 2.17).
Direct interaction detected between HetZ and PatU3 by the bacterial two-hybrid system
In this study a genetic relationship between hetF, patA, hetR and the hetZ-patU5-patU3 gene
cluster was discovered, but direct interactions between their protein products are unknown. To
investigate direct protein-protein interactions between HetZ, PatU5, PatU3, HetR, HetF,
HetF(C246A) and PatA, a bacterial two-hybrid system was employed. Previous bacterial two-
hybrid assays have reportedly failed to demonstrate the interaction of PatU3 with either PatA or
HetR, however a different two-hybrid reporter system than that proposed here was used[1]. In
the genetic assay performed in this study[10], fusion of proteins to two complementary fragments
of the Bordetella pertussis adenylate cyclase catalytic domain, T25 and T18, allowed for putative
protein-protein interactions to be tested (Table 2.2). Physical association between the two
proteins fused to T25 and T18 results in functional complementation of adenylate cyclase in an
Figure 2.14. Two proposed models of genetic interaction between hetZ and
patU3 in the control of heterocyst development. Inhibitors of the interaction
represented with bars, activators represented with arrows.
57
Escherichia coli cya strain. Subsequent synthesis of cAMP by the reconstituted adenylate
cyclase yields a distinctive blue-colored colony phenotype that signals the presence of a direct
interaction between the two proteins under investigation. The Bacillus subtilus cell division
protein DivIVA, shown in different reports to interact with itself[11, 12], was utilized as a positive
control for this study. Additionally, HetR was expected to interact with itself due to the reported
homodimer activity of HetR[24]. Consistent with these reports, the dimerization of HetR was
demonstrated with all four pairings of HetR to the N- and C-termini of T25 and T18 in this study
(Fig. 2.15, 2.16). The strength of the association between monomers of HetR was equivalent to
the robust interaction between DivIVA-DivIVA (Fig. 2.16).
A direct interaction between HetF and PatU3 was not identified in this assay. HetF, however, is
closely related to the CHF class of cysteine proteases[8], a family that includes caspases.
Proteolysis by initiator caspases leads to activation of effector caspases, ultimately leading to
apoptotic cell death. A C246A substitution in HetF fails to complement the heterocyst deficiency
of a hetF-deficient strain[8]. This inactive form of HetF, like the native (non-mutated) form of HetF,
dimerized with itself as well as native HetF. HetF(C246A) also interacted weakly with PatA.
These interactions are consistent with the dimer state of caspases, and the HetF-PatA regulatory
pathway, respectively. Although HetF was not shown to interact with PatU3, HetF(C246A)
interacted weakly with PatU3, as this interaction was barely above detection (Fig. 2.15, 2.16). No
interactions were observed with PatU5 in combination with all other proteins tested. It remains
unclear whether these results represent a limitation of the assay.
However, a robust interaction was observed between HetZ and PatU3 that was more pronounced
than the homodimer interactions between DivIVA-DivIVA and HetR-HetR (Fig 2.15, 2.16).
Positive interactions between HetZ and PatU3 are shown (Fig. 2.16), representing six of the eight
possible pairings between N- and C-terminal fusions to T25 and T18. While the molecular
mechanism remains unknown, a physical interaction between HetZ and PatU3 is supported, and
may represent a critical control point in the coordination of heterocyst development.
Of the 196 interactions tested between the cell division proteins HetZ, PatU5, PatU3, HetR, HetF,
HetF(C246A) and PatA in this study, only 22 (11.2%) demonstrated a significant level of
interaction (Fig. 2.16, Table 2.10). These 22 interactions generally exhibited three different
levels of interaction: weak, intermediate, and strong (Fig. 2.16; also assigned W, I, S in the left-
most column of Table 2.10), although some overlap is observed between a few interactions. The
weak interaction category represents results that appear statistically significant, but require
additional analysis to support the interactions listed. The PatU3-HetF(C246A) and PatA-
HetF(C246A) interactions in this grouping are predicted in the model shown in Figure 2.17.
Protein interactions with an intermediate level of interaction include interactions between all
58
combinations of HetF and HetF(C246A). Finally, strong interactions comparable or exceeding the
DivIVA-DivIVA interaction include the physical interaction between HetR and itself and HetZ-
PatU3. Evidence from biochemical or biophysical studies, including immunoprecipitation assays,
would further support the HetZ-PatU3 interaction.
59
Figure 2.15. Bacterial two-hybrid results indicate HetZ interacts with PatU3. Additional
interactions (HetR/HetR, HetF/HetF, HetF(C246A)/HetF, PatA/PatA, HetF(C246A)/PatA,
HetF/HetF(C246A), PatU3/HetF(C246A), PatA/HetF(C246A), and
HetF(C246A)/HetF(C246A)) also depicted. No interactions were observed with PatU5.
Colonies of E. coli cells expressing the indicated protein fusions to fragments of adenylate
cyclase carried on derivatives of plasmids pKT25 and pUT18C. Plus signs (lower right
corner) indicate a positive interaction indicated by the blue-colony phenotype.
60
Figure 2.16. Average β-galactosidase activity of positive protein-protein interactions between
HetR, HetF, HetF(C246A), HetZ, PatU3, PatA. Negative controls for the assay (empty vector
interactions) shown on the far left (first four bars in blue). Dashed vertical lines separate the
bar graph into three different levels of interaction as described in the Results section. A
“weak” level of interaction is represented in green (PatU3-HetF(C246A) and PatA-
HetF(C246A). An “intermediate” level of interaction is represented in purple (combinations of
HetF and HetF(C246A) interactions). Some HetR/HetR and HetZ/PatU3 interactions (far right;
red bars) have greater activity than the positive control for the assay (Bacillus subtilis
DivIVA/DivIVA interaction; blue bar towards right of graph) and are interpreted as “strong”.
Average activity of three replicates plotted in ascending order from left to right. Plasmid
identity for tested interactions detailed in Table 2.10 in the same order (interactions from left to
right of Figure corresponds to interactions listed from top to bottom of Table).
61
Table 2.10. Plasmids used for quantification of β-galactosidase activity (Figure 2.16) of positive
bacterial two-hybrid interactions, and average Miller units (with standard deviation) of three
independent replicates. Rows (top to bottom) correspond to ascending order (left to right) of
activity depicted in Figure 2.16. The first four bars (left side of bar graph) relating to empty vector
negative controls in Figure 2.16 are listed at the top of the Table. The positive control for the
assay (Bacillus subtilis DivIVA/DivIVA interaction) is identified in bold font. “W”, “I”, “S” in the left-
most column refers to an assigned level of interaction (“weak”, “intermediate”, and “strong”,
respectively) as described in the Results section. “NA” indicates “not applicable”.
Level Protein-protein interaction (T25 fragment/T18 fragment)
Plasmid (T25 fragment)
Plasmid (T18 fragment)
Average Miller Units (MU)
Standard deviation
NA None (negative control) pKNT25 pUT18C 56 12.6
NA None (negative control) pKNT25 pUT18 57 4.1
NA None (negative control) pKT25 pUT18 61 9.2
NA None (negative control) pKT25 pUT18C 61 3.8
W PatA/PatA pST564 pST571 81 7.4
W PatU3/HetF(C246A) pST562 pST598 91 7.0
W HetR/PatA pST558 pST571 94 22.4
W HetR/PatA pST578 pST579 125 14.5
W HetR/HetF pST572 pST580 128 21.2
W HetZ/PatU3 pST574 pST569 133 34.9
I PatA/HetF(C246A) pST564 pST598 139 28.4
I HetF/HetF pST573 pST580 145 12.9
I HetF(C246A)/PatA pST597 pST571 282 49.4
I HetF(C246A)/HetF pST597 pST566 405 145.5
I HetF/HetF pST559 pST566 408 47.6
I HetF(C246A)/HetF(C246A) pST597 pST598 461 123.6
I HetF/HetF(C246A) pST559 pST598 499 93.0
S HetR/HetR pST572 pST579 589 19.5
S PatU3/HetZ pST562 pST581 636 232.5
S HetR/HetR pST572 pSST565 1145 342.1
S PatU3/HetZ pST576 pST567 1354 93.2
S HetR/HetR pST558 pST565 1565 94.9
S DivIVA/DivIVA (positive control)
pJP42 pJP41 1579 109.6
S HetR/HetR pST558 pST579 1899 181.4
S PatU3/HetZ pST562 pST567 2164 192.1
S HetZ/PatU3 pST560 pST583 2301 69.4
S HetZ/PatU3 pST560 pST569 2347 55.6
DISCUSSION
Organisms orchestrate the differentiation of a subset of cells in often intricate patterns despite the
fundamental sameness of the genetic complement of all cells. How one cell type diverges into
different cell types during development remains a central question in biology. There is extensive
evidence for the roles of temporal and spatial variations in gene expression and environmental
62
cues that result in the morphological heterogeneity observed within a single multicellular
organism. The molecular mechanisms behind development involve trans-acting factors
(transcription factors, signal transduction systems, morphogens, etc.), cis-acting factors (non-
coding sequences; promoters, RNA elements), and stochasticity[25, 26]. Additionally, molecular
memory is imposed on the cellular infrastructure allowing for another layer of information
transmission across the generations. Together, these genetic programs facilitate organism
survival and have directed evolution over time.
Differentiation of heterocyst cells in Anabaena offers a unique opportunity to explore the
mechanisms of multicellularity and the organization of two cell types into a nonrandom, one-
dimensional arrangement. Several key players of heterocyst development have been identified.
Among them the positive regulator hetF is essential for differentiation, but aside from a
relationship with two positive regulators (hetR, patA)[8], a regulatory network encompassing hetF
has not been clearly defined. To investigate a HetF-dependent regulatory network, a genetic
screen utilizing hetF-deficient backgrounds was performed in this study. Mutations in patU3
repeatedly arose from these screens, suggesting that PatU3 and the gene cluster containing
patU3 represent components of a regulatory network involving hetF.
Mutations in HetF and PatU3 affect cell morphology. The enlarged cell morphology of hetF-
deficient strains is related to abundant HetR levels[8]. The diminutive cell phenotype of patU3-
deficient strains suggests another relationship to hetF. Due to the perturbations in morphology
associated with hetF and patU3, these genes may have additional roles in cell division. Coupling
of cell growth and cell division to the later stages of heterocyst development efficiently
coordinates biological processes in response to changes in the concentration of fixed nitrogen. In
Anabaena, cell division is required for heterocyst differentiation[27] and linked to cell cycle events,
including DNA synthesis[28]. However, the heterocyst represents an end point in development.
Cell division, while required for differentiation, ceases before the morphological changes are
complete. The key cell division gene FtsZ and its inhibitor MinC regulate cell size and
morphology in Anabaena[29]. Analysis of GFP translational fusions to these and other cell
division genes in patU3 and hetF backgrounds or bacterial two-hybrid assays between PatU3,
HetF and cell division proteins may elucidate a role for the hetF-patU3 regulatory circuit in cell
division.
63
The preliminary genetic network depicted in Figure 2.17 describes our current understanding of
the regulation of heterocyst development as described in this study. Although the PatA-HetF
interaction is inferred through previous studies[8] and only weakly shown in this study (Fig. 2.15,
2.16), a direct interaction between HetR and PatS has been demonstrated [30]. The additional
interactions shown are consistent with the (i) hetF and patU3, (ii) patU3 and hetZ, and (iii) hetR
and patU3 double mutant phenotypes. They represent the simplest explanation for the double
mutant phenotypes observed. Bacterial two-hybrid assays were used to further corroborate these
interactions as well as the other interactions shown in Fig. 2.17. A strong interaction was not
observed between (i) PatA and HetF, (ii) HetF and PatU3, nor (iii) HetZ and HetR, perhaps due to
additional requirements for the interaction not addressed owing to the limitations of the assay. It
is unclear whether the weak level of interaction between these proteins is biologically significant
in the control of heterocyst differentiation. However, a robust interaction was demonstrated
between PatU3 and HetZ, consistent with the model depicted. Currently the mechanism for the
PatU3-HetZ interaction remains unknown. Further characterization is necessary to identify the
Figure 2.17. A preliminary model for genetic regulation of heterocyst differentiation in
Anabaena involving the conversion of HetR to HetR* by regulatory factors. Inhibition of
the pathway represented with bars, activation represented with arrows. “T” indicates
transcriptional regulation; “P” represents post-transcriptional regulation; “P?” represents
putative post-transcriptional regulation.
64
specific residues or domains involved in the protein-protein interaction and to understand the
consequences of the interaction.
The relationship between hetF, patA and patU3 was extended to include the transcriptional
regulator hetR. The dramatic absence of HetR-GFP fluorescence and lack of hetR expression in
hetF patU3 and hetF patA patU3 genotypes is enigmatic due to the restored ability to form
heterocysts in these mutant strains. Despite the inability to detect both hetR expression and
translated product in these background strains, hetR appears to be required for heterocyst
formation: the quadruple mutant ∆hetR ∆hetF ∆patA patU3∆42-729 and the double mutant
patU3∆42-729 ∆hetR were both incapable of forming heterocysts. Based on these and other
observations, placement of HetR into the HetF-regulatory circuit is postulated (Fig. 2.17). In the
model as shown, HetR exists in two forms: HetR represents a stable inactive form and HetR*
represents the unstable but active form that is necessary for heterocyst formation. Conversion to
the active (HetR*) form involves the central components of the HetF-dependent pathway, HetZ
and PatU3. HetF (positively regulated by PatA) controls the level of PatU3. PatU3 negatively
regulates levels of (the activator) HetZ by direct physical interaction. HetZ is proposed to act late
in the pattern formation stage of development. Positive regulation of the activity of HetR* by HetZ
is necessary to commit the cell to the heterocyst cell fate during the later stages of pattern
formation. Multiple, integrated feedback loops exist to fine-tune the system and allow for many
potential points of regulation by additional unknown factors. Some putative factors may include
phosphorus, carbon, and cellular energy levels. Ultimately HetZ levels increase enough to
overcome the negative effects of PatU3 to allow conversion of HetR to HetR* and drive
heterocyst formation.
Localization of PatU3 currently remains elusive. Florescence from gfp translational fusions to
patU3 driven by the native promoter or an inducible promoter (plasmids pST291 and pST293,
respectively) was below the level of detection in the wild-type (data not shown). However, the
fusion was functional because a plasmid containing PhetZ-hetZ-patU5-patU3-gfp (like the plasmid
bearing PhetZ-hetZ-patU5-patU3) inhibited heterocysts in the wild-type. In addition, PatU3 (and
HetZ) appears to affect the patterned expression of hetR, consistent with the heterocyst
frequencies observed upon inactivation of patU3 (and hetZ). Additionally, plasmids pST291 and
pST293 (along with other combinations of the hetZ-patU5-patU3 gene cluster in multicopy or in
excess; plasmids pST255, pST315, pST355, pST429, pST430 and pST431) did not alter levels of
HetR-GFP when introduced into PhetR-hetR-gfp and PpetE-hetR-gfp strains (data not shown).
Levels of PatU3-GFP fluorescence are presumably below the levels of detection of our assay.
One universal mechanism used to control development involves asymmetry in concentrations of
positively acting factors (Chapter 1). The lateral inhibition of two RGSGR-based inhibitory
65
proteins (PatS and HetN) operates to guide a gradient of HetR formation in a manner consistent
with the activator-inhibitor model [18, 31]. The resultant asymmetry in the protein concentration
of HetR drives commitment to a particular cell fate. The model explaining the HetF-dependent
role in heterocyst development includes the HetR-PatS-dependent pathway (Fig. 2.17). It is
unclear whether the HetZ-PatU3-dependent pathway also conforms to the activator-inhibitor
model. The activator HetZ appears to autoregulate its own expression [1] but it is unknown if
HetZ leads to the production of the inhibitor PatU3. Rather, PatU3 has been shown to upregulate
the expression of hetZ[1]. Also, a gradient of PhetZ-gfp expression correlates to HetR
concentrations, and can be abolished by exogenous addition of the RGSGR pentapeptide [1], but
patU3 has not been examined under similar conditions. Furthermore, diffusion (nor localization)
of the inhibitor PatU3 has not been demonstrated. While both hetZ and patU3 are expressed in
heterocysts, expression of patU3 also occurs at a lower level in vegetative cells[3]. It remains
unclear whether this differential expression pattern affects the regulatory circuitry.
In this study, an additional regulatory pathway controlling the heterocyst cell fate decision was
characterized. The HetR-RGSGR and HetZ-PatU3 pathways can function in the absence of the
other, suggesting that these pathways act independently. Two independent pathways may
indicate that they act at different times during differentiation or they may allow for greater control
of the developmental process by overcoming background noise in the other system. The HetZ-
PatU3 pathway functions as another control point in the Anabaena cell fate decision. In this
context, the HetZ-PatU3 pathway may relate to the concept of a biological checkpoint[32]. In
eukaryotes, the cell cycle refers to an ordered four-stage process (G1, S, G2, M) that ultimately
generates two daughter cells upon cell division. A series of regulatory mechanisms known as
checkpoints ensures cell cycle progression in a unidirectional manner. One example is the intra-
S checkpoint responsible for inhibition of entry into mitosis (M-phase) until DNA replication is
completed. In Xenopus laevis, the kinase activity of ATR is activated upon association with
replication forks. Initiation of a signaling cascade upon ATR binding to the cell replication
machinery results in the inactivation of the Cdc25 phosphatase necessary for activating M-phase
events. Because events from earlier stages (DNA replication; S-phase) negatively regulate
events of a later stage (mitosis), mutations involved in checkpoints are identified by a “relief of
inhibition” [32]. Inactivation of PatU3 in the chromosome presumably relieved the PatU3-
dependent negative inhibition of the downstream activator HetZ, resulting in inappropriate levels
of differentiation (assessed as the Mch phenotype in patU3-deficient strains). These results fulfill
the minimal requirement (“relief of inhibition”) for a checkpoint regulatory mechanism. Additional
studies are necessary to characterize the HetZ-PatU3 regulatory mechanism as a checkpoint of
Anabaena development.
66
In the model as shown, commitment to the heterocyst cell fate is not executed until PatU3 and
HetZ detect and report on HetR-RGSGR concentrations. Integrated feedback mechanisms
between the two pathways presumably exist to ensure that inappropriate differentiation does not
occur. The HetZ-PatU3 pathway may act at the pattern formation stage of development,
controlling the transition to the commitment stage. In addition to controlling development, the
dual mechanisms may impose a biological timer on the heterocyst formation process. Heterocyst
commitment takes approximately 10 hours. The pattern of cells marked for differentiation is
established early in development (as early as 2 hours[33]). Presumably heterocyst commitment
can be completed in less than 10 hours. One explanation for the temporal restriction on the
process may relate to the cell fate decision: control points in Anabaena restrict development until
the last possible moment to allow for termination of the process if a sourced of fixed nitrogen
suddenly becomes available. Because heterocyst cells represent an energetically-expensive
developmental endpoint, feedback loops increase the robustness of the system by decreasing
sensitivity to noise. This delay or timing mechanism may be attributable to concentrations of
HetR. HetR levels must overcome inhibition by PatS, and furthermore inhibit PatU3 before HetZ
(and consequently HetR conversion to HetR*) can be activated. Because progression of
heterocyst development continues only after these threshold levels of HetR are met, the time
necessary for commitment of differentiation may be established by the regulatory circuitry
proposed in Figure 2.17. This allows for a delay mechanism governing heterocyst formation.
The genetic arrangement of the hetZ-patU5-patU3 gene cluster may also correspond to a role in
regulating heterocyst development. In prokaryotes, genes related in function are often efficiently
organized into genetic regions known as operons. Control of the lactose operon in Escherichia
coli by trans-acting repressors, for example, remains a seminal model for gene regulation[34].
Genetic dissection of the hetZ-patU5-patU3 operon, however, is nontrivial. Genetic inactivation
required preservation of the series of transcriptional start points (tsps) present within each gene
of the gene cluster in order to examine the representative function of hetZ, patU5 and patU3. In
addition, the overlap of the ORFs of hetZ and patU5 in the chromosome may be significant in
establishing cellular levels of hetZ, patU5 and/or patU3. Individual mutations in the downstream
genes asr0102, alr0103 and asr0104 did not affect the wild-type phenotype[1], suggesting that
these genes are not directly under the control of tsps present in the hetZ-patU5-patU3 operon.
However in plasmid-based studies, the tsps present at the 3’ end of hetZ (rather than the gene
product of hetZ), appeared to be required for the full inhibitory function of patU5-patU3 (plasmids
pST355, pST429). When the normal transcriptional regulation of the gene cluster was replaced
by an inducible promoter, patU5-patU3 no longer functionally inhibited heterocysts (plasmid
pST417). Incorporation of hetZ to the same plasmid backbone containing patU5-patU3 (driven by
the same inducible promoter; plasmid pST416) was necessary to restore the inhibition of
67
heterocyst formation. This effect was presumably due to incorporation of internal tsps within hetZ
in the latter plasmid. This requirement of the internal hetZ tsps for function of patU3 on plasmids
are consistent with studies aimed at deciphering the contribution of tsp I and tsp II in expression
of the gene cluster. In the tsp I-tsp II (plasmid-based) studies, the tsps present at the 3’ end of
hetZ appear to regulate the gene cluster. Plasmids without the 3’ tsps (plasmids pST586,
pST587 and pST589) upstream of patU5-patU3 no longer inhibited heterocyst formation in the
wild-type. Because of the inverse orientation of the 3’ tsps, antisense transcription or activation of
the gene all0097 directly upstream but in the opposite direction of hetZ may explain the
mechanism of control by these tsps. Taken together, combined chromosomal and plasmid-based
studies of the hetZ-patU5-patU3 gene cluster reveal the significance of location, timing, and/or
level of transcription of the operon in heterocyst differentiation. These and other findings support
the presence of additional levels of regulation superimposed on current models of Anabaena
development, and merits further investigation.
68
REFERENCES CITED
1. Zhang, W., et al., A gene cluster that regulates both heterocyst differentiation and pattern
formation in Anabaena sp. strain PCC 7120. Mol. Microbiol., 2007. 66: p. 1429-1443.
2. Xu, X. and C.P. Wolk, Role for hetC in the transition to a nondividing state during
heterocyst differentiation in Anabaena sp. J. Bacteriol., 2001. 183: p. 393-396.
3. Du, Y., et al., Identification of the HetR recognition sequence upstream of hetZ in
Anabaena sp. strain PCC 7120. J. Bacteriol., 2012. 194: p. 2297-2306.
4. Mitschke, J., et al., Dynamics of transcriptional start site selection during nitrogen stress-
induced cell differentiation in Anabaena sp. PCC7120. Proc Natl Acad Sci U S A, 2011.
108(50): p. 20130-5.
5. Risser, D.D. and S.M. Callahan, Mutagenesis of hetR reveals amino acids necessary for
HetR function in the heterocystous cyanobacterium Anabaena sp. strain PCC 7120. J.
Bacteriol., 2007. 189: p. 2460-2467.
6. Fellay, R., J. Frey, and H. Krisch, Interposon mutagenesis of soil and water bacteria: a
family of DNA fragments designed for in vitro insertional mutagenesis of Gram-negative
bacteria. Gene, 1987. 52: p. 147-154.
7. Higa, K.C. and S.M. Callahan, Ectopic expression of hetP can partially bypass the need
for hetR in heterocyst differentiation by Anabaena sp strain PCC 7120. Mol. Microbiol.,
2010. 77: p. 562-574.
8. Risser, D.D. and S.M. Callahan, HetF and PatA control levels of HetR in Anabaena sp.
strain PCC 7120. J. Bacteriol., 2008. 190: p. 7645-7654.
9. Borthakur, P.B., et al., Inactivation of patS and hetN causes lethal levels of heterocyst
differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol.
Microbiol., 2005. 57: p. 111-123.
10. Karimova, G., et al., A bacterial two-hybrid system based on a reconstituted signal
transduction pathway. Proc Natl Acad Sci U S A, 1998. 95(10): p. 5752-6.
11. van den Ent, F., et al., Dimeric structure of the cell shape protein MreC and its functional
implications. Mol Microbiol, 2006. 62(6): p. 1631-42.
12. Patrick, J.E. and D.B. Kearns, MinJ (YvjD) is a topological determinant of cell division in
Bacillus subtilis. Mol Microbiol, 2008. 70(5): p. 1166-79.
13. Higa, K.C., et al., The RGSGR amino acid motif of the intercellular signaling protein,
HetN, is required for patterning of heterocysts in Anabaena sp. strain PCC 7120. Mol.
Microbiol., 2012. 83: p. 682-693.
14. Wei, T.-F., R. Ramasubramanian, and J.W. Golden, Anabaena sp. strain PCC 7120 ntcA
gene required for growth on nitrate and heterocyst development. J. Bacteriol., 1994. 176:
p. 4473-4482.
69
15. Yoon, H.-S. and J.W. Golden, PatS and products of nitrogen fixation control heterocyst
pattern. J. Bacteriol., 2001. 183: p. 2605-2613.
16. Black, T.A., Y. Cai, and C.P. Wolk, Spatial expression and autoregulation of hetR, a gene
involved in the control of heterocyst development in Anabaena. Mol. Microbiol., 1993. 9: p.
77-84.
17. Nayar, A.S., et al., FraG is necessary for filament integrity and heterocyst maturation in
the cyanobacterium Anabaena sp. strain PCC 7120. Microbiology, 2007. 153: p. 601-607.
18. Risser, D.D. and S.M. Callahan, Genetic and cytological evidence that heterocyst
patterning is regulated by inhibitor gradients that promote activator decay. Proc Natl Acad
Sci U S A, 2009. 106(47): p. 19884-8.
19. Callahan, S.M., unpublished.
20. Callahan, S.M. and W.J. Buikema, The role of HetN in maintenance of the heterocyst
pattern in Anabaena sp. PCC 7120. Mol. Microbiol., 2001. 40: p. 941-950.
21. Meeks, J.C., et al., Cellular differentiation in the cyanobacterium Nostoc punctiforme.
Arch Microbiol, 2002. 178(6): p. 395-403.
22. Spencer, W., et al., CtrA, a global response regulator, uses a distinct second category of
weak DNA binding sites for cell cycle transcription control in Caulobacter crescentus. J
Bacteriol, 2009. 191(17): p. 5458-70.
23. Flaherty, B.L., et al., Directional RNA deep sequencing sheds new light on the
transcriptional response of Anabaena sp. strain PCC 7120 to combined-nitrogen
deprivation. BMC Genomics, 2011. 12: p. 332.
24. Huang, X., Y. Dong, and J. Zhao, HetR homodimer is a DNA-binding protein required for
heterocyst differentiation, and the DNA-binding activity is inhibited by PatS. Proc. Natl.
Acad. Sci. U.S.A., 2004. 101(14): p. 4848-4853.
25. Mattick, J.S., A new paradigm for developmental biology. J Exp Biol, 2007. 210(Pt 9): p.
1526-47.
26. Kaern, M., et al., Stochasticity in gene expression: from theories to phenotypes. Nat Rev
Genet, 2005. 6(6): p. 451-64.
27. Sakr, S., et al., Inhibition of cell division suppresses heterocyst development in Anabaena
sp. strain PCC 7120. J Bacteriol, 2006. 188(4): p. 1396-404.
28. Sakr, S., et al., Inhibition of cell division suppresses heterocyst development in Anabaena
sp. strain PCC 7120. J. Bacteriol., 2006. 188: p. 1396-1404.
29. Sakr, S., et al., Relationship among several key cell cycle events in the developmental
cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol., 2006. 188: p. 5958-5965.
30. Feldman, E.A., et al., Evidence for direct binding between HetR from Anabaena sp. PCC
7120 and PatS-5. Biochmistry, 2011. 50: p. 9212-9224.
70
31. Gierer, A. and H. Meinhardt, A theory of biological pattern formation. Kybernetik, 1972.
12: p. 30-39.
32. Hartwell, L.H. and T.A. Weinert, Checkpoints: controls that ensure the order of cell cycle
events. Science, 1989. 246(4930): p. 629-34.
33. Ionescu, D., et al., Heterocyst-specific transcription of NsiR1, a non-coding RNA encoded
in a tandem array of direct repeats in cyanobacteria. J Mol Biol, 2010. 398(2): p. 177-88.
34. Jacob, F. and J. Monod, Genetic regulatory mechanisms in the synthesis of proteins. J
Mol Biol, 1961. 3: p. 318-56.
71
CHAPTER 3. HETEROCYST DEVELOPMENT AND THE SER/THR PROTEIN
PHOSPHATASE ALL1758 IN THE CYANOBACTERIUM ANABAENA SP. STRAIN PCC 7120
INTRODUCTION
Heterocysts are terminally differentiated, non-dividing cells that allow the simultaneous execution
of two incompatible processes, fixation of nitrogen and oxygen-evolving photosynthesis, in some
filamentous cyanobacteria. They maintain a micro-oxic environment where oxygen-labile
nitrogenase can function. The envelope of heterocysts includes a layer of distinct glycolipid that
reduces the diffusion of molecular oxygen into cells, an outer layer of heterocyst-specific
exopolysaccharides that protect the integrity of the glycolipid layer, and increased respiration
reduces the level of molecular oxygen that does enter heterocysts [1]. Fixed nitrogen from
heterocysts supports the growth of vegetative cells in the filament, which in turn supply
heterocysts with fixed carbon [2, 3]. In the cyanobacterium Anabaena sp. PCC 7120 (herein,
Anabaena) heterocysts are arranged in a periodic pattern at intervals of approximately 10 cells
along unbranched filaments under conditions that require fixation of nitrogen for growth of the
organism [4].
Activation of the heterocyst differentiation signaling pathway in response to nitrogen limitation
leads to an accumulation of the metabolite 2-oxoglutarate (2-OG) in cells [5]. Binding of 2-OG
stimulates the DNA-binding activity of the global transcriptional regulator of nitrogen and carbon
metabolism in cyanobacteria, NtcA [6]. NtcA indirectly leads to upregulation of the master
regulator of heterocyst differentiation, hetR. Whereas heterocysts cannot develop in hetR-
deficient strains, in our hands, heterocysts occasionally arise in ntcA backgrounds.
Overexpression of hetR in the latter strain can also restore heterocyst formation to a wild-type
pattern. HetR feeds back on the regulation of transcription of ntcA [7], and together with NtcA,
directly or indirectly activates genes involved in the patterning and morphogenesis of heterocysts
[8]. Induction of differentiation, pattern formation, and morphogenesis involves the transcription of
hundreds of genes specific for the formation of heterocysts.
The reversibility of protein phosphorylation mediated by kinases and phosphatases is an
essential part of many signaling cascades and regulatory networks. Protein phosphatases (PPs)
are divided into three superfamilies. These include (i) protein aspartate phosphatases, (ii) protein
tyrosine phosphatases (divided into the conventional or class I family and the low molecular
weight or class II family), and (iii) protein serine/threonine phosphatases. Protein
serine/threonine phosphatases are subdivided into PPP or PPM (also referred to as PP2Cs)
families based on the dependence on divalent metal cations in the latter group [9, 10]. Although
structurally homologous to each other, PPPs and PP2Cs differ at the primary sequence level.
The approximately 290-residue catalytic domain of PPMs consists of eleven conserved motifs
72
that contain eight “absolutely” conserved amino acids [11, 12]. At the catalytic site of PP2Cs, four
invariant aspartate residues (in Motifs 1, 2, 8, 11) coordinate two metal ions. The metal ions have
been proposed to activate the nucleophilic activity of water molecules to catalyze
dephosphorylation of phosphoserine and phosphothreonine residues [13].
In Anabaena an estimated 4.2% of the annotated genome encodes two-component systems,
kinases, and phosphatases, suggesting increased signaling capability as compared to other
prokaryotes[14]. Genes with homology to signaling components have been reported to influence
nitrogen metabolism and the early regulatory stages of heterocyst development in Anabaena.
NrrA which encodes a response regulator of the OmpR family, acts early in the differentiation
process by directly upregulating hetR expression [15]. The PP2C-type protein phosphatases
PrpJ1 and PrpJ2 are also involved in the initiation of heterocyst development through mutual
regulation of both ntcA and hetR [16]. The protein kinases Pkn41 and Pkn42, which contain
Ser/Thr-kinase and His-kinase domains respectively, are cotranscribed specifically under iron
deficient conditions and regulated by NtcA [17]. The nitrogen regulatory protein PII encoded by
glnB, is differentially modified in the two cell types. It goes from a phosphorylated to non-
phosphorylated state during transition from vegetative cell to heterocyst [18]. The pknE gene lies
301 bp downstream from the protein phosphatase 1/2A/2B homolog encoded by prpA. Both
pknE and prpA inactivation mutants produce aberrant heterocysts [19]. Overexpression of the
putative Ser/Thr kinase encoded by pknE from its native promoter inhibited heterocyst
development, possibly through inhibition of HetR [20]. Another protein that appears to affect HetR,
PatA, contains a phosphoacceptor domain with homology to the response regulator CheY,
although a corresponding histidine kinase has not been isolated. It appears to attenuate the
negative regulation of heterocyst differentiation by PatS and HetN [21], while promoting the
activity, and limiting the accumulation, of HetR [22].
In addition, protein phosphorylation has also been implicated in the later stages of development,
particularly during the process of heterocyst maturation. Formation of the minor heterocyst
glycolipid involves two protein kinases of the hstK family, Pkn30 and Pkn44, which contain both
an N-terminal Ser/Thr kinase domain and a C-terminal His-kinase domain [23]. PrpJ1 has been
shown to regulate the synthesis of the major heterocyst glycolipid [24]. Alr0117 and HepK
(All4496) both encode putative two-component system sensory histidine kinases that appear to
be involved in the induction of hepA, one of the genes responsible for synthesis of the heterocyst
polysaccharide layer [25-27]. The manganese-dependent Ser/Thr protein phosphatase of the
PPP family DevT (Alr4674) accumulates in mature heterocysts, is not regulated by NtcA, and
appears to have a role in the later steps of heterocyst differentiation [28].
73
The coordination of development and other complex cellular processes is often regulated at the
level of transcription. In prokaryotes, transcription initiation is controlled by sigma factors. Sigma
factor association with RNA polymerase at specific promoters activates transcription from a
subset of genes. This allows for the rapid reprogramming of gene expression in response to
intracellular and extracellular signals.
One common mechanism for control of sigma factor activity involves reversible phosphorylation
of sigma factor regulators [29]. A sigma factor can oscillate between RNA polymerase (activating
transcription) and its cognate antisigma factor (inactivating transcription). Similarly, the antisigma
factor can also oscillate between its cognate sigma factor and anti-antisigma factor (or “antisigma
factor agonist”). Dephosphorylation of anti-antisigma factors by phosphatases is a central
component to the ‘partner-switch’ mechanism. This signaling network has been described in
other prokaryotes. In Bacillus subtilis the PP2Cs SpoIIE, RsbU and RsbP dephosphorylate their
cognate anti-antisigma factors (SpoIIAA and RsbV) in the control of sigma factors regulating cell
division and stress response, respectively [30-32]. In this study, the isolation and characterization
of a gene encoding a putative PP2C-type protein phosphatase all1758 is described.
MATERIALS AND METHODS
Bacterial strains and growth conditions. Strains used in this study are described in Table 3.1.
The growth of Escherichia coli and Anabaena sp. strain PCC 7120 and its derivatives;
concentrations of antibiotics; and induction of heterocyst formation in BG-110, which lacks a
combined-nitrogen source; regulation of PpetE and Pnir expression; and conditions for
photomicroscopy were as previously described [33]. Images were processed in Adobe
Photoshop CS2. To avoid complications from the vacuolization phenotype observed with strains
UHM183 and UHM184 upon growth in BG-11 liquid medium, which contains a source of
combined nitrogen, these strains were transferred from solid BG-11 medium to liquid BG-110
medium for induction of heterocyst differentiation. Plasmids were conjugated from E. coli into
Anabaena strains as previously described [34].
Construction of plasmids used in this study. Plasmids used in this study are described in
Table 3.2. Oligonucleotides used in this study are described in Table 3.3. Constructs derived by
PCR were sequenced to verify the integrity of the sequence.
Suicide plasmids
Plasmid pST112 was used to delete most of the coding region of all1758. An 852-bp region
containing the first 30-bp of the all1758 coding region and upstream DNA was amplified from the
chromosome (with primers 1758 up F and 1758 up R) and fused to an 848-bp region containing
the last 30-bp of the all1758 coding region and downstream DNA (using primers 1758 down F
74
and 1758 down R) via overlap extension PCR. The 1700-bp fragment was cloned into pRL277
as a BglII-SacI fragment using restriction sites introduced on the primers to generate pST112.
Plasmid pST114 was used to replace most of the coding region of all1758 with an Ω interposon.
The 1700-bp fragment used for construction of pST112 was moved into the EcoRV site of
pBluescript SK+ (Stratagene) to generate pST110. The 1700-bp fragment was moved from
pST110 into pRL278 as a BlgII-SacI fragment to create pST113. To generate pST114, the 2082-
bp Ω interposon, which confers resistance to Sp and Sm [35], was introduced into pST113 at a
SmaI site generated during overlap extension PCR.
Plasmid pST426 was used to delete most of the coding region of all1087. An 815 bp region
containing the first 33-bp of the all1087 coding region and upstream DNA was amplified from the
chromosome (with primers alr1087-up-BamHI-F and alr1087-upR) and fused to a 799-bp region
containing the last 30-bp of the all1087 coding region and downstream DNA (using primers
alr1087-down-F and alr1087-down-SacI-R) via overlap extension PCR. The 1614-bp fragment
was ligated into the EcoRV site of pBluescript SK+ (Stratagene) to generate pST425 and
subsequently moved from pST426 into pRL277 as a BglII-SacI fragment using restriction sites
introduced on the primers to generate pST426.
Plasmid pST428 was used to replace most of the coding region of all1087 with an Ω interposon.
A 1614-bp fragment was moved from pST425 into pRL278 as a BglII-SacI fragment to create
pST427. To generate pST428, the 2082-bp Ω interposon was introduced into pST427 at a SmaI
site introduced on the primers used for overlap extension PCR.
Plasmid pST448 was used to delete most of the coding region of alr3758. An 880-bp region
containing the first 34-bp of the alr3758 coding region and upstream DNA was amplified from the
chromosome (with primers alr3758 up F and alr3758 up R) and fused to an 886-bp region
containing the last 35-bp of the alr3758 coding region and downstream DNA (using primers
alr3758 down F and alr3758 down R) via overlap extension PCR. The 1766-bp fragment was
ligated into the EcoRV site of pBluescript SK+ (Stratagene) to generate pST447 and
subsequently moved from pST447 into pRL277 as a BglII-SacI fragment using restriction sites
introduced on the primers to generate pST448.
Plasmid pST450 was used to replace most of the coding region of alr3758 with an Ω interposon.
A 1766-bp fragment was moved from pST447 into pRL278 as a BglII-SacI fragment to create
pST449. To generate pST450, the 2082-bp Ω interposon was introduced into pST449 at a SmaI
site introduced on the primers used for overlap extension PCR.
Plasmid pST452 was used to delete most of the coding region of all0648. An 845-bp region
containing the first 30-bp of the all0648 coding region and upstream DNA was amplified from the
75
chromosome (with primers all0648 up F and all0648 up R) and fused to an 837-bp region
containing the last 42-bp of the all0648 coding region and downstream DNA (using primers
all0648 down F and all0648 down R) via overlap extension PCR. The 1682-bp fragment was
ligated into the EcoRV site of pBluescript SK+ (Stratagene) to generate pST451 and
subsequently moved from pST451 into pRL277 as a BglII-SacI fragment using restriction sites
introduced on the primers to generate pST448.
Plasmid pST454 was used to replace most of the coding region of all0648 with an Ω interposon.
A 1682-bp fragment was moved from pST451 into pRL278 as a BglII-SacI fragment to create
pST453. To generate pST454, the 2082-bp Ω interposon was introduced into pST453 at a SmaI
site introduced on the primers used for overlap extension PCR.
Plasmid pST520 was used to delete most of the coding region of alr3243. An 847-bp region
containing the first 27-bp of the alr3423 coding region and upstream DNA was amplified from the
chromosome (with primers alr3423 up F and alr3423 up R) and fused to an 826-bp region
containing the last 30-bp of the alr3423 coding region and downstream DNA (using primers
alr3423 down F and alr3423 down R) via overlap extension PCR. The 1763-bp fragment was
ligated into the EcoRV site of pBluescript SK+ (Stratagene) to generate pST519 and
subsequently moved from pST519 into pRL277 as a BglII-SacI fragment using restriction sites
introduced on the primers to generate pST520.
Plasmid pST522 was used to replace most of the coding region of alr3423 with an Ω interposon.
A 1763-bp fragment was moved from pST519 into pRL278 as a BglII-SacI fragment to create
pST521. To generate pST522, the 2082-bp Ω interposon was introduced into pST521 at a SmaI
site introduced on the primers used for overlap extension PCR.
Multicopy plasmids
Plasmid pST141 is a mobilizable shuttle vector containing the putative promoter and coding
regions of all1758. An 1866-bp fragment was amplified from the chromosome (using primers
Pall1758 BamHI F and all1758 SacI R) and cloned into pAM504 as a BamHI-SacI fragment using
the same restriction sites engineered on the primers to generate pST141.
Plasmid pST494 is a mobilizable shuttle vector containing the putative promoter and coding
regions of all1087. A 1209-bp fragment was amplified from the chromosome (using primers
Pall1087 BamHI F and all1087 SacI R) and ligated into the EcoRV site of pBluescript SK+
(Stratagene) to generate pST491. To make pST494, the fragment was moved into pAM504 as a
BamHI-SacI fragment using restriction sites engineered on the primers.
76
pST530 is a mobilizable shuttle vector containing the putative promoter and coding regions of
alr3758. A 673-bp fragment was amplified from the chromosome (using primers Palr3758 BamHI
F and alr3758 SacI R) and ligated into the EcoRV site of pBluescript SK+ (Stratagene) to
generate pST529. To make pST530, the fragment was moved into pAM504 as a BamHI-SacI
fragment using the same restriction sites engineered on the primers.
Plasmid pST496 is a mobilizable shuttle vector containing the putative promoter and coding
regions of alr0648. A 783-bp fragment was amplified from the chromosome (using primers
Pall0648 BamHI F and all0648 SacI R) and cloned into pAM504 as a BamHI-SacI fragment using
the same restriction sites engineered on the primers to generate pST496.
Plasmid pST524 is a mobilizable shuttle vector containing the putative promoter and coding
regions of alr3423. A 414-bp fragment was amplified from the chromosome (using primers
Palr3423 BamHI F and alr3423 SacI R) and ligated into the EcoRV site of pBluescript SK+
(Stratagene) to generate pST523. To make pST524, the fragment was moved into pAM504 as a
BamHI-SacI fragment using the same restriction sites engineered on the primers.
Plasmids with nucleotide substitutions in all1758
Plasmid pST399 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution D267A. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 D267A-R) was fused to downstream fragment (amplified using primers all1758
D267A-F and all1758 Sac I-R) via overlap extension PCR. To yield pST399, the 1868-bp
fragment was cloned as a BamHI-SacI fragment into pAM504 using same restriction sites
engineered on the primers.
Plasmid pST400 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution D277A. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 D277A-R) was fused to downstream fragment (amplified using primers all1758
D277A-F and all1758 Sac I-R) via overlap extension PCR. To yield pST400, the 1868-bp
fragment was cloned as a BamHI-SacI fragment into pAM504 using same restriction sites
engineered on the primers.
Plasmid pST401 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution A348G. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 A348G-R) was fused to downstream fragment (amplified using primers all1758
A348G-F and all1758 Sac I-R) via overlap extension PCR, and ligated into the EcoRV site of
pBluescript SK+ to make pST396. To yield pST401, the 1868-bp fragment was moved from
77
pST395 as a BamHI-SacI fragment into pAM504 using same restriction sites engineered on the
primers.
Plasmid pST402 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution D398A. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 D398A-R) was fused to downstream fragment (amplified using primers all1758
D398A-F and all1758 Sac I-R) via overlap extension PCR. To yield pST402, the 1868-bp
fragment was cloned as a BamHI-SacI fragment into pAM504 using same restriction sites
engineered on the primers.
Plasmid pST403 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution D453E. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 D453E-R) was fused to downstream fragment (amplified using primers all1758
D453E-F and all1758 Sac I-R) via overlap extension PCR, and ligated into the EcoRV site of
pBluescript SK+ to make pST398. To yield pST403, the 1868-bp fragment was moved from
pST398 as a BamHI-SacI fragment into pAM504 using same restriction sites engineered on the
primers.
Plasmid pST443 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution D267E. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 D267E-R) was fused to downstream fragment (amplified using primers all1758
D267E-F and all1758 Sac I-R) via overlap extension PCR and ligated into the EcoRV site of
pBluescript SK+ to make pST439. To yield pST443, the 1868-bp fragment was moved from
pST439 as a BamHI-SacI fragment into pAM504 using same restriction sites engineered on the
primers.
Plasmid pST444 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution D277E. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 D277E-R) was fused to downstream fragment (amplified using primers all1758
D277E-F and all1758 Sac I-R) via overlap extension PCR and ligated into the EcoRV site of
pBluescript SK+ to make pST440. To yield pST444, the 1868-bp fragment was moved from
pST440 as a BamHI-SacI fragment into pAM504 using same restriction sites engineered on the
primers.
Plasmid pST445 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution D398E. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 D398E-R) was fused to downstream fragment (amplified using primers all1758
78
D398E-F and all1758 Sac I-R) via overlap extension PCR and ligated into the EcoRV site of
pBluescript SK+ to make pST441. To yield pST445, the 1868-bp fragment was moved from
pST441 as a BamHI-SacI fragment into pAM504 using same restriction sites engineered on the
primers.
Plasmid pST446 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution D453E. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 D453E-R) was fused to downstream fragment (amplified using primers all1758
D453E-F and all1758 Sac I-R) via overlap extension PCR, and ligated into the EcoRV site of
pBluescript SK+ to make pST442. To yield pST446, the 1868-bp fragment was moved from
pST442 as a BamHI-SacI fragment into pAM504 using same restriction sites engineered on the
primers.
Plasmid pST469 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution T329S. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 T329-R) was fused to downstream fragment (amplified using primers all1758 T329-F
and all1758 Sac I-R) via overlap extension PCR and ligated into the EcoRV site of pBluescript
SK+ to make pST466. To yield pST469, the 1868-bp fragment was moved from pST466 as a
BamHI-SacI fragment into pAM504 using same restriction sites engineered on the primers.
Plasmid pST470 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution G373A. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 G373A-R) was fused to downstream fragment (amplified using primers all1758
G373A-F and all1758 Sac I-R) via overlap extension PCR and ligated into the EcoRV site of
pBluescript SK+ to make pST467. To yield pST470, the 1868-bp fragment was moved from
pST467 as a BamHI-SacI fragment into pAM504 using same restriction sites engineered on the
primers.
Plasmid pST471 is a mobilizable shuttle vector containing the all1758 promoter and coding region
with the substitution G399A. An upstream fragment (amplified using primers Pall1758-Bam HI-F
and all1758 G399A-R) was fused to downstream fragment (amplified using primers all1758
G399A-F and all1758 Sac I-R) via overlap extension PCR and ligated into the EcoRV site of
pBluescript SK+ to make pST468. To yield pST471, the 1868-bp fragment was moved from
pST468 as a BamHI-SacI fragment into pAM504 using same restriction sites engineered on the
primers.
79
Overexpression plasmids
Two plasmids carrying a PpetE-all1758 transcriptional fusion were constructed. Plasmid pST156 is
a mobilizable shuttle vector carrying a transcriptional fusion between the petE promoter and
all1758. The 1392-bp coding region of all1758 was amplified from the chromosome using
primers all1758 OE EcoRI F and all1758 OE BamHI R and ligated into the EcoRV site of
pBluescript SK+ to create pST184. The fragment was moved from pST184 as an EcoRI-BamHI
fragment into pKH256 [36], which is designed to create transcriptional fusions to the petE
promoter, to generate pST156. Plasmid pST367 differs from pST156 in the engineered
ribosomal binding site that was introduced by using primer all1758 EcoRI rbs F in place of all1758
OE EcoRI F to amplify all1758 from the chromosome. The PCR fragment was moved into the
EcoRV site of pBluescript SK+ to generate pST365, and subsequently moved from pST365 as a
EcoRI-BamHI fragment into pKH256 to generate pST367.
The transcriptional fusion Pnir-all1758 present on plasmid pST368 was created using the primers
all1758 rbs EcoRI F and all1758 OE BamHI R to amplify all1758 from the chromosome. The
fragment was ligated into the EcoRV site of pBluescript SK+ to generate pST366. To create
pST368, the fragment was moved as a EcoRI-BamHI fragment into pSMC188, a replicating
plasmid used to generate transcriptional fusions to the nirA promoter [33]
Plasmids pST460 and pST463 carry transcriptional fusions between all1087 and the petE
promoter and the nirA promoter respectively. The 390-bp coding region of all1087 was amplified
from the chromosome using primers all1087 SmaI F and all1087 KpnI R and ligated into the
EcoRV site of pBluescript SK+ to generate pST457. To make pST460, the fragment was moved
from pST457 as a SmaI-KpnI fragment into pDR311 (bearing a PpetE-lacZ transcriptional
fusion[22]) digested with the same enzymes to exchange lacZ for all1087. To make pST463, the
fragment was moved from pST457 as a SmaI-KpnI fragment into pDR311 (bearing a Pnir-lacZ
transcriptional fusion[22]) digested with the same enzymes to exchange lacZ for all1087.
Plasmids pST461 and pST464 carry transcriptional fusions between alr3758 and the petE
promoter and the nirA promoter respectively. The coding region of alr3758 was amplified from
the chromosome using primers alr3758 SmaI F and alr3758 KpnI R and ligated into the EcoRV
site of pBluescript SK+ to generate pST458. The 339-bp fragment was moved from pST458 as a
SmaI-KpnI fragment into pDR350 to yield pST461, and into pDR311 to yield pST464.
Plasmids pST462 and pST465 carry transcriptional fusions between all0648 and the petE
promoter and the nirA promoter respectively. The coding region of all0648 was amplified from
the chromosome using primers all0648 SmaI F and all0648 KpnI R and ligated into the EcoRV
80
site of pBluescript SK+ to generate pST459. The 369-bp fragment was moved from pST459 as a
SmaI-KpnI fragment into pDR350 to yield pST462, and into pDR311 to yield pST465.
Plasmids pST475 and pST478 carry transcriptional fusions between alr3423 and the petE
promoter and the nirA promoter respectively. The coding region of alr3423 was amplified from
the chromosome using primers alr3423 SmaI F and alr3423 KpnI R and ligated into the EcoRV
site of pBluescript SK+ to generate pST472. The 444-bp fragment was moved from pST472 as a
SmaI-KpnI fragment into pDR350 to yield pST475, and into pDR311 to yield pST478.
Plasmids pST476 and pST479 carry transcriptional fusions between all1702 and the petE
promoter and the nirA promoter respectively. The coding region of all1702 was amplified from
the chromosome using primers all1702 SmaI F and all1702 KpnI R and ligated into the EcoRV
site of pBluescript SK+ to generate pST473. The 429-bp fragment was moved from pST473 as a
SmaI-KpnI fragment into pDR350 to yield pST476, and into pDR311 to yield pST479.
Plasmids pST477 and pST480 carry transcriptional fusions between sigB (all7615) and the petE
promoter and the nirA promoter respectively. The coding region of sigB was amplified from the
chromosome using primers sigB SmaI F and sigB KpnI R and ligated into the EcoRV site of
pBluescript SK+ to generate pST474. The 999-bp fragment was moved from pST474 as a SmaI-
KpnI fragment into pDR350 to yield pST477, and into pDR311 to yield pST480.
Plasmids pST536 and pST537 carry transcriptional fusions between sigE (alr4259) and the petE
promoter and the nirA promoter respectively. The coding region of sigE was amplified from the
chromosome using primers sigE SmaI F and sigE KpnI R and ligated into the EcoRV site of
pBluescript SK+ to generate pST535. The 1194-bp fragment was moved from pST535 as a
SmaI-KpnI fragment into pDR350 to yield pST536, and into pDR311 to yield pST537.
Plasmids pST437 and pST456 are a mobilizable shuttle vectors carrying a transcriptional fusion
between the petE promoter and sigE (alr4249). The 1194-bp coding region of sigE was
amplified from the chromosome using primers sigE OE EcoRI F (PpetE) and sigE BamHI R and
ligated into the EcoRV site of pBluescript SK+ to create pST435. To yield pST437, the fragment
was moved from pST435 as an EcoRI-BamHI fragment into pKH256. To yield pST456, the
fragment was moved from pST435 as an EcoRI-BamHI fragment into pPAV213, another plasmid
designed to create transcriptional fusions to the petE promoter.
Plasmid pST438 is a mobilizable shuttle vector carrying a transcriptional fusion between the nir
promoter and sigE (alr4249). The 1194-bp coding region of sigE was amplified from the
chromosome using primers sigE OE EcoRI F (Pnir) and sigE BamHI R and ligated into the
EcoRV site of pBluescript SK+ to create pST436. To yield pST438, the fragment was moved
from pST435 as an EcoRI-BamHI fragment into pSMC188.
81
Transcriptional and translational fusion constructs
To create the gfp transcriptional reporter for all1758, a 474-bp region upstream of all1758 was
amplified from the chromosome with primers Pall1758 SacI F and all1758 15 bp up SmaI R and
cloned into pAM1956 as a SacI-SmaI fragment to create pST151.
The region cloned into plasmid pST151 was amplified using the same primers Pall1758 SacI F
and all1758 15 bp up SmaI R (used to clone pST151) and ligated into the EcoRV site of
pBluescript SK+ to generate pST374. To make pST375, the 474-bp fragment was subsequently
cloned into pAM504 as a SacI-SmaI fragment to generate pST375.
To create the gfp transcriptional reporter for all1759, a 304-bp region upstream of all1759 was
amplified from the chromosome using primers Pall1759-SacI-F and Pall1759-SmaI-R and moved
into the EcoRV site of pBluescript SK+ to generate pST252. The fragment was moved from
pST252 as a SacI-SmaI fragment into pAM1956 to create pST249.
To create the gfp transcriptional reporter for all1758 with a mutation at the putative -203 NtcA-
binding site, an upstream fragment of Pall1758 (amplified from pST151 with primers Pall1758 SacI F
and Pall1758 mut NtcA up R) was fused to a downstream fragment of Pall1758 (amplified from
pST151 with primers Pall1758 mut NtcA down F and all1758 15 bp up SmaI R) and ligated into
the EcoRV site of pBluescript SK+ to generate pST489. To make pST490, the 474-bp fragment
was subsequently cloned into pAM1956 as a SacI-SmaI fragment.
To create the gfp transcriptional reporter for all1758 with a mutation at the putative -128 NtcA-
binding site, an upstream fragment of Pall1758 (amplified from pST151 with primers Pall1758 SacI F
and Pall1758 mut NtcA up R -128) was fused to a downstream fragment of Pall1758 (amplified from
pST151 with primers Pall1758 mut NtcA down F -128 and all1758 15 bp up SmaI R) and ligated
into the EcoRV site of pBluescript SK+ to generate pST538. To make pST540, the 474-bp
fragment was subsequently cloned into pAM1956 as a SacI-SmaI fragment.
To create the gfp transcriptional reporter for all1758 with a mutation at the putative -323 NtcA-
binding site, an upstream fragment of Pall1758 (amplified from pST151 with primers Pall1758 SacI F
and Pall1758 mut NtcA up R -323) was fused to a downstream fragment of Pall1758 (amplified from
pST151 with primers Pall1758 mut NtcA down F -323 and all1758 15 bp up SmaI R) and ligated
into the EcoRV site of pBluescript SK+ to generate pST539. To make pST541, the 474-bp
fragment was subsequently cloned into pAM1956 as a SacI-SmaI fragment.
To create the gfp transcriptional reporter for all1087, an 820-bp region upstream of all1087 was
amplified from the chromosome with primers Pall1087 SacI F and Pall1087 SmaI R and ligated
82
into the EcoRV site of pBluescript SK+ to generate pST497. To make pST499, the fragment was
subsequently cloned into pAM1956 as a SacI-SmaI fragment.
To create the gfp transcriptional reporter for all1087 with a mutation at the putative NtcA-binding
site, an upstream fragment of Pall1087 (amplified from the chromosome with primers Pall1087 SacI
F and Palr1087-dNtcA-OEX-R) was fused to a downstream fragment of Pall1087 (amplified from the
chromosome with primers Palr1087-dNtcA-OEX-F and Pall1087 SmaI R) and ligated into the
EcoRV site of pBluescript SK+ to generate pST498. To make pST500, the 820-bp fragment was
subsequently cloned into pAM1956 as a SacI-SmaI fragment.
To create the gfp transcriptional reporter for alr3758, a 334-bp region upstream of all1087 was
amplified from the chromosome with primers Palr3758 SacI F and Palr3758 SmaI R 1 and ligated
into the EcoRV site of pBluescript SK+ to generate pST483. To make pST487, the fragment was
subsequently cloned into pAM1956 as a SacI-SmaI fragment.
To create the gfp transcriptional reporter for alr3758 with a mutation at the putative NtcA-binding
site, an upstream fragment of Palr3758 (amplified from the chromosome with primers Palr3758 SacI
F and Palr358 mut ntcA R) was fused to a downstream fragment of Pall1087 (amplified from the
chromosome with primers Palr3758 mut ntcA F and Palr3758 SmaI R 1) and ligated into the
EcoRV site of pBluescript SK+ to generate pST482. To make pST486, the 820-bp fragment was
subsequently cloned into pAM1956 as a SacI-SmaI fragment.
To create the gfp transcriptional reporter for all3423, a 325-bp region upstream of all3423 was
amplified from the chromosome with primers Pall3423 SacI F and Pall3423 SmaI R and ligated
into the EcoRV site of pBluescript SK+ to generate pST484. To make pST488, the fragment was
subsequently cloned into pAM1956 as a SacI-SmaI fragment.
To create the gfp transcriptional reporter for all0648, a 414-bp region upstream of all1087 was
amplified from the chromosome with primers Pall0648 SacI F and Pall0648 SmaI R and ligated
into the EcoRV site of pBluescript SK+ to generate pST481. To make pST485, the fragment was
subsequently cloned into pAM1956 as a SacI-SmaI fragment.
The translational all1758-gfp reporter fusion under the control of the all1758 promoter was
created using primers Pall1758 BamHI F and all1758 SmaI R to amplify the 1866-bp fragment
from the chromosome. The fragment was moved as a BamHI-SmaI fragment into pSMC232, a
replicating plasmid used generate translational fusions to gfp [22], to give pST150.
To make plasmid pST533, an upstream fragment of Pall1758 (amplified from the chromosome with
primers Pall1758 SacI F and Pall1758 mut ntcA R) was fused to a downstream fragment of Pall1087
(amplified from the chromosome with primers Pall1758 mut ntcA F and Pall1758 SmaI R) and
83
ligated into the EcoRV site of pBluescript SK+ to generate pST533. To make pST534, the 1866-
bp fragment was subsequently cloned into pSMC232 as a BamHI-SmaI fragment.
The translational all1087-gfp reporter fusion under the control of the all1087 promoter (amplified
from the chromosome using primers Pall1087 BamHI F and all1087 SmaI R) was ligated into the
EcoRV site of pBluescript SK+ to generate pST505. The 1209-bp fragment was subsequently
moved as a BamHI-SmaI fragment into pSMC232 to give pST511.
To make plasmid pST512, an upstream fragment of Pall1087 (amplified from the chromosome with
primers Pall1087 SacI F and Palr1087-dNtcA-OEX-R) was fused to a downstream fragment of
Pall1087 (amplified from the chromosome with primers Palr1087-dNtcA-OEX-F and Pall1087 SmaI
R) and ligated into the EcoRV site of pBluescript SK+ to generate pST506. To make pST512, the
1209-bp fragment was subsequently cloned into pSMC232 as a BamHI-SmaI fragment.
The translational alr3758-gfp reporter fusion under the control of the alr3758 promoter (amplified
from the chromosome using primers Palr3758 BamHI F and alr3758 SmaI R) was ligated into the
EcoRV site of pBluescript SK+ to generate pST531. The 673-bp fragment was subsequently
moved as a BamHI-SmaI fragment into pSMC232 to give pST513.
To make plasmid pST514, an upstream fragment of Palr3758 (amplified from the chromosome with
primers Palr3758 SacI F and Palr3758 mut ntcA R) was fused to a downstream fragment of
Palr3758 (amplified from the chromosome with primers Palr3758 mut ntcA F and Palr3758 SmaI R)
and ligated into the EcoRV site of pBluescript SK+ to generate pST532. To make pST514, the
673-bp fragment was subsequently cloned into pSMC232 as a BamHI-SmaI fragment.
The translational all0648-gfp reporter fusion under the control of the all0648 promoter (amplified
from the chromosome using primers Pall0648 BamHI F and all0648 SmaI R) was ligated into the
EcoRV site of pBluescript SK+ to generate pST510. The 783-bp fragment was subsequently
moved as a BamHI-SmaI fragment into pSMC232 to give pST516.
The translational alr3423-gfp reporter fusion under the control of the alr3423 promoter (amplified
from the chromosome using primers Palr3423 BamHI F and alr3423 SmaI R) was ligated into the
EcoRV site of pBluescript SK+ to generate pST509. The 769-bp fragment was subsequently
moved as a BamHI-SmaI fragment into pSMC232 to give pST515.
Protein expression vector
The pPROEX-1 (Life Technologies) derivative, pST188 was used to overexpress all1758 in E.
coli and facilitate protein purification. A 1392-bp region containing the coding region for all1758
was amplified from the chromosome using primers all1758-NdeI-F and all1758-NH6-NotIR, and
84
moved into the EcoRV site of pBluescript SK+ to create pST192. To generate pST188, the
fragment was moved as a NdeI-NotI fragment into the pPROEX-1 backbone derived from
pSMC148 [22] digested with NdeI-NotI. The resulting open reading frame, designated
all1758(H6), encodes a glycine, then six histidine codons preceding sixteen codons
(DYDIPTTENLYFQGAHAH, which contains a sequence recognized by the Tobacco Etch Virus
protease) fused to all1758 followed by a stop codon after the last codon of all1758.
Bacterial two-hybrid constructs
For each construct, a 32- or 33-bp linker domain was introduced between the adenylate cyclase
fragment and the protein of interest on either the forward or reverse primer. Details concerning
the construction of plasmids pST558-562, pST564, pST597, pST565-pST571, pST598, pST572-
pST576, pST578, pST599, pST579-pST583, pST585, pST600 for fusions to hetR, hetF, hetZ,
patU5, patU3, patA, hetF(C246A) are described in the Materials and Methods section of Chapter
2.
The all1758 coding region was amplified from the chromosome using the primers all1758 BamHI
F A and all1758 EcoRI R A, and cloned into the EcoRV site of pBluescript SK+ to make pST549.
To make pST563 and pST570, the 1392 bp fragment was moved as a BamHI-EcoRI fragment
from pST556 into pKT25 and pUT18C respectively.
The all1758 coding region was amplified from the chromosome using the primers all1758 BamHI
F B and all1758 EcoRI R B, and cloned into the EcoRV site of pBluescript SK+ to make pST556.
To make pST577 and pST584, the 1392 bp fragment was moved as a BamHI-EcoRI fragment
from pST556 into pKNT25 and pUT18 respectively.
Strain construction. Descriptions of strains constructed in this study are summarized in Table
3.1. Deletions and replacements of chromosomal DNA was performed as previously described
[37]. All strains were screened via colony PCR with primers annealing outside of the
chromosomal region introduced on the suicide plasmids used for strain construction and tested
for sensitivity and resistance to the appropriate antibiotics. For strains with mutations in more
than one gene, mutations were introduced in the order indicated in the strain description.
Deletion of the all1758 coding region was performed using plasmids pST112 and pST114 and
Anabaena sp. strain PCC 7120 to yield strains Δall1758 (UHM183) and Δall1758 with Ω cassette
(UHM184), respectively. The resultant strains were screened via colony PCR with primers
all1758 flank up F and all1758 flank down R, which anneal outside the chromosomal region
85
introduced onto pST112 and pST114 for deletion of all1758, and tested for sensitivity and
resistance to the appropriate antibiotics. PCR with primers all1758 3’ F and all1757 5’ R were
used to test if recombination between plasmid pST141, with harbors Pall1758-all1758, and the
chromosomal locus of all1758 of strain UHM183 had occurred.
Plasmid pST112 was introduced into the following parent strains to create unmarked deletions in
the all1758 coding region: (1) ΔhetR for construction of ΔhetR Δall1758, (2) ∆patA for
construction of ∆patA Δall1758, (3) ΔhetF for construction of ΔhetF Δall1758, (4) PhetR-hetR-gfp
for construction of PhetR-hetR-gfp Δall1758, (5) PpetE-hetR-gfp for construction of PpetE-hetR-gfp
Δall1758, (6) ∆patA PpetE-hetR-gfp for construction of ∆patA PpetE-hetR-gfp Δall1758, (7) PpetE-
hetR-cfp for construction of PpetE-hetR-cfp Δall1758 and (8) ∆patA PpetE-hetR-cfp for construction
of ∆patA PpetE-hetR-cfp Δall1758.
Strain ∆ntcA with Ω cassette was constructed by introduction of pSMC205 into Anabaena sp.
strain PCC 7120.
Deletion of the all1087 coding region was performed using plasmids pST426 and pST428 and
Anabaena sp. strain PCC 7120 to yield strains Δall1087 (UHM325) and Δall1087 with Ω cassette
(UHM301), respectively. The resultant strains were screened via colony PCR with primers
all1087 flank up F and all1087 flank down R, which anneal outside the chromosomal region
introduced onto pST426 and pST428 for deletion of all1087, and tested for sensitivity and
resistance to the appropriate antibiotics.
Deletion of the alr3758 coding region was performed using plasmid pST448 and Anabaena sp.
strain PCC 7120 to yield strain Δalr3758 (UHM302). The resultant strain was screened via
colony PCR with primers alr3758 flank up F and alr3758 flank down R, which anneal outside the
chromosomal region introduced onto pST448 for deletion of alr3758, and tested for sensitivity and
resistance to the appropriate antibiotics.
Deletion of the all0648 coding region was performed using plasmid pST452 and Anabaena sp.
strain PCC 7120 to yield strain Δall0648 (UHM303). The resultant strain was screened via colony
PCR with primers all0648 flank up F and all0648 flank down R, which anneal outside the
chromosomal region introduced onto pST452 for deletion of all0648, and tested for sensitivity and
resistance to the appropriate antibiotics.
Deletion of the alr3423 coding region was performed using plasmids pST520 and pST522 and
Anabaena sp. strain PCC 7120 to yield strains Δalr3423 (UHM326) and Δalr3423 with Ω cassette
(UHM327), respectively. The resultant strains were screened via colony PCR with primers
alr3423 flank up F and alr3423 flank down R, which anneal outside the chromosomal region
86
introduced onto pST520 and pST522 for deletion of alr3423, and tested for sensitivity and
resistance to the appropriate antibiotics.
Overexpression and purification of recombinant all1758 and phosphatase assays.
Recombinant All1758 was produced from E. coli BL21 (DE3) transformed with pST188 using Ni-
nitrilotriacetic acid affinity chromatography (Qiagen) as described previously [33] with the
following exception: 4 mL of wash buffer (50 mM NNaH2PO4, 300 mM NaCl, 20 mM imidazole,
20% glycerol) was added to the column twice, followed by four 500 µL volumes of elution buffer
(50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, 20% glycerol), each diluted four-fold directly
into a total volume of 1.5 mL of capture buffer (50 mM NaH2PO4, 300 mM NaCl) upon elution
from the column.
Assays for phosphatase activity were conducted as described by previously [38]. The substrate,
4-nitrophenol phosphate (pNPP), was dissolved in pNPP buffer containing 10 mM Tris-HCl, pH
8.5, 1 mM DDT, and 50 mM NaCl with addition of either 2 mM MnCl2 or 5 mM MgCl2 and
supplemented with either 10 or 100 µM cAMP or cGMP. As a test of hydrolysis of pNPP by the
putative phosphatase activity of All1758, 2 µg of the recombinant protein was added to the
cocktail at a final reaction volume of 1 mL. Absorbance at 400 nm was monitored as a
measurement of hydrolysis of pNPP at 25 °C every thirty seconds for the first thirty minutes after
addition of protein to the cocktail, then at 45 minutes, 1 hour, 2 hours, 5 hours, and 24 hours.
Measurement of cell size. Reported values for cell sizes were obtained by measuring the
“height” of one hundred randomly distributed cells of Anabaena sp. strains PCC 7120 and
UHM184. Height refers to the dimension perpendicular to the longitudinal axis of the filament
halfway between cell poles. Significance of height distributions was established using an
unpaired t-test with a two-tailed P value of less than 0.0001. Approximate cell volumes were
calculated by treating cells as spheres using the average cell height as the radius in the formula,
Volumesphere=4/3πr3.
Confocal microscopy. Cells were routinely viewed and imaged as described previously [37].
Confocal microscopy was performed using an Olympus Fluoview 1000 laser scanning confocal
mounted on an IX81 motorized inverted microscope. Fluorescence from Turbo-YFP was
detected with an excitation of 525 nm and an emission of 538 nm. All images were processed in
Adobe Photoshop CS2.
RNA isolation and RT-PCR. Total RNA was extracted as previously described [22]. For
reverse-transcription PCR (RT-PCR), 0.5 µg of total RNA was used for the synthesis of cDNA
with reverse transcriptase and the corresponding reverse primers for subsequent use in PCR
carried out for 27 cycles using primers 22 to 31 in a manner as previously described [22].
87
Acetylene reduction, glycolipid and exopolysaccharide assays. Acetylene reduction assays
measured from three independent cultures were performed as previously described [37].
Glycolipid extraction for thin layer chromatography and staining of exopolysaccharides also were
conducted as previously described [39].
Bacterial two-hybrid and β-galactosidase assays. Bacterial two-hybrid assays were
performed as previously described [40-42]. The average β-galactosidase-specific activity (three
replicates) of each positive protein-protein interaction was determined as previously described
[42].
88
Table 3.1. Strains used in Chapter 3
Anabaena sp. strain
Relevant characteristic(s) Source or reference (UHM designation)
PCC 7120 Wild-type Pasteur culture collection
ΔhetR hetR-deletion strain [43] (UHM103)
Δpbp6 pbp6-deletion strain [44] (UHM128)
PhetR-hetR-gfp PCC 7120 with chromosomal PhetR-hetR replaced by PhetR-hetR-gfp
[45] (UHM148)
PpetE-hetR-gfp PCC 7120 with chromosomal PhetR-hetR replaced by PpetE-hetR-gfp
[46] (UHM139)
∆patA PpetE-hetR-gfp
patA-deletion strain with chromosomal PhetR-hetR replaced by PpetE-hetR-gfp
[46] (UHM136)
PpetE-hetR-cfp PCC 7120 with chromosomal PhetR-hetR replaced by PpetE-hetR-cfp
[45](UHM217)
∆patA ∆hetF PpetE-hetR-cfp
patA-, hetF-deletion strain with chromosomal PhetR-hetR replaced by PpetE-hetR-cfp
[45] (UHM191)
Δall1758 all1758-deletion strain This study (UHM183)
Δall1758 with Ω cassette
all1758 replaced by Ω cassette This study (UHM184)
ΔhetR Δall1758 hetR-, all1758-deletion strain This study (UHM220)
∆patA Δall1758 patA-, all1758-deletion strain This study (UHM219)
∆hetF Δall1758 hetF-, all1758-deletion strain This study (UHM298)
PhetR-hetR-gfp Δall1758
PhetR-hetR-gfp-, all1758-deletion strain This study (UHM230)
PpetE-hetR-gfp Δall1758
PpetE-hetR-gfp-, all1758-deletion strain This study (UHM299)
∆patA PpetE-hetR-gfp Δall1758
patA-, PpetE-hetR-gfp-, all1758-deletion strain This study (UHM300)
PpetE-hetR-cfp Δall1758
PpetE-hetR-cfp-, all1758-deletion strain This study (UHM228)
∆patA ∆hetF PpetE-hetR-cfp Δall1758
patA-, hetF-, PpetE-hetR-cfp-, all1758-deletion strain
This study (UHM229)
ΔntcA with Ω cassette
ntcA replaced by Ω cassette
This study (UHM230)
Δall1087 all1087-deletion strain This study (UHM325)
Δall1087 with Ω cassette
all1087 replaced by Ω cassette This study (UHM301)
Δalr3758 alr3758-deletion strain This study (UHM302)
Δall0648 all0648-deletion strain This study (UHM303)
Δall3423 all3423-deletion strain This study (UHM326)
89
Table 3.1. (Continued) Strains used in Chapter 3
Anabaena sp. strain
Relevant characteristic(s) Source or reference (UHM designation)
Δall3423 with Ω cassette
all3423 replaced by Ω cassette This study (UHM327)
90
Table 3. 2. Plasmids used in Chapter 3
Plasmids Relevant characteristic(s) Source or reference
pAM504 Mobilizable shuttle vector for replication in E. coli and Anabaena; Km
r Neo
r
[47]
pAM505 Shuttle vector pAM504 with inverted multiple cloning site [47]
pAM1951 pAM505 with PpatS-gfp [48]
pAM1956 pAM505 bearing promoterless gfp for transcriptional fusions [48]
pDR138 pAM504 carrying PhetR-hetR [44]
pDR120 pAM504 carrying PpetE-hetR [21]
pDR211 pAM504 carrying PpetE-patS [46]
pDR320 pAM504 carrying PpetE-hetN [46]
pDR267 pAM505 with PhetF-hetF [22]
pDR329 pAM505 with PpetE-hetFGTG1 [45]
pDR370 pSMC232 with PpetE-patA [49]
pDR350 pAM504 carrying PpetE-lacZ [22]
pDR311 pAM504 carrying Pnir-lacZ [22]
pDR292 pAM504 carrying PhetR-hetR-gfp [46]
pDR293 pAM504 carrying PpetE-hetR-gfp [45]
pKH256 pAM504 bearing PpetE for transcriptional fusions [50]
pKT25 Plasmid carrying the T25 fragment of CyaA for C-terminal protein fusions
[40]
pKNT25 Plasmid carrying the T25 fragment of CyaA for N-terminal protein fusions
[40]
pUT18C Plasmid carrying the T18 fragment of CyaA for C-terminal protein fusions
[40]
pUT18 Plasmid carrying the T18 fragment of CyaA for N-terminal protein fusions
[40]
pLMC115 pAM504 bearing ftsZ-yfp [45]
pLMC117 pAM504 bearing minC-yfp [45]
pLMC119 pAM504 bearing minE-yfp [45]
pROEX-1 Expression vector for generating polyhistidine epitope-tagged proteins; Ap
r
Life Technologies
pRL277 Suicide vector; Smr Sp
r [51]
pRL278 Suicide vector; Neor [51]
pSMC127 pAM504 carrying PhetR-gfp [39]
pSMC148 pPROEX-1 carrying hetR [22]
pSMC188 pAM504 bearing Pnir for transcriptional fusions [33]
pSMC232 pAM504 bearing promotorless gfp for translational fusions [22]
pSSY125 pAM505 with PpetE-patA [49]
pST112 Suicide plasmid used to delete all1758 This study
pST114 Suicide plasmid used to replace all1758 with an interposon
This study
pSMC202 Suicide plasmid used to delete ntcA [45]
pSMC205 Suicide plasmid used to replace ntcA with an interposon [45]
91
Table 3.2. (Continued) Plasmids used in Chapter 3
Plasmids Relevant characteristic(s) Source or reference
pST141 pAM504 carrying Pall1758-all1758 This study
pST150 pSMC232 with Pall1758-all1758 This study
pST534 pSMC232 with with Pall1758(mutated ntcA binding site)-all1758 This study
pST151 pAM1956 with Pall1758 fused to gfp This study
pST375 pAM505 with Pall1758 This study
pST490 pAM1956 with Pall1758(mutated -189 Ntc-binding site) fused to gfp This study
pST540 pAM1956 with Pall1758(mutated -116 NtcA-binding site) fused to gfp This study
pST541 pAM1956 with Pall1758(mutated -321 NtcA-binding site) fused to gfp This study
pST249 pAM1956 with Pall1759 fused to gfp This study
pST188 pPROEX-1 carrying all1758 This study
pST156 pKH256 bearing PpetE-all1758 This study
pST367 pKH256 bearing strong ribosomal binding site and PpetE-all1758
This study
pST368 pSMC188 bearing Pnir-all1758 This study
pST399 pAM504 carrying all1758(D267A) This study
pST443 pAM504 carrying all1758(D267E) This study
pST400 pAM504 carrying all1758(D277A) This study
pST444 pAM504 carrying all1758(D277E) This study
pST469 pAM504 carrying all1758(T329S) This study
pST401 pAM504 carrying all1758(A348G) This study
pST470 pAM504 carrying all1758(G373A) This study
pST402 pAM504 carrying all1758(D398A) This study
pST445 pAM504 carrying all1758(D398E) This study
pST471 pAM504 carrying all1758(G399A) This study
pST403 pAM504 carrying all1758(D453A) This study
pST446 pAM504 carrying all1758(D453E) This study
pST426 Suicide plasmid used to delete all1087 This study
pST428 Suicide plasmid used to replace all1087 with an interposon
This study
pST448 Suicide plasmid used to delete alr3758 This study
pST450 Suicide plasmid used to replace alr3758 with an interposon
This study
pST452 Suicide plasmid used to delete all0648 This study
pST454 Suicide plasmid used to replace all0648 with an interposon
This study
pST520 Suicide plasmid used to delete alr3423 This study
pST521 Suicide plasmid used to replace alr3243 with an interposon
This study
pST494 pAM504 carrying Pall1087-all1087 This study
pST530 pAM504 carrying Palr3758-alr3758 This study
pST496 pAM504 carrying Pall0648-all0648 This study
pST524 pAM504 carrying Palr3423-alr3423 This study
92
Table 3.2. (Continued) Plasmids used in Chapter 3
Plasmids Relevant characteristic(s) Source or reference
pST460 pDR350 carrying all1087 This study
pST461 pDR350 carrying alr3758 This study
pST462 pDR350 carrying all0648 This study
pST475 pDR350 carrying alr3423 This study
pST476 pDR350 carrying all1702 This study
pST537 pDR350 carrying sigE (alr4249) This study
pST437 pKH256 bearing sigE This study
pST456 pPJAV213 bearing sigE This study
pST477 pDR350 carrying sigB (all7615) This study
pST463 pDR311 carrying all1087 This study
pST464 pDR311 carrying alr3758 This study
pST465 pDR311 carrying all0648 This study
pST478 pDR311 carrying alr3423 This study
pST479 pDR311 carrying all1702 This study
pST536 pDR311 carrying sigE (alr4249) This study
pST438 pSMC188 bearing sigE This study
pST480 pDR311 carrying sigB (all7615) This study
pST499 pAM1956 with Pall1087 fused to gfp This study
pST500 pAM1956 with Pall1087(mutated NtcA-binding site) fused to gfp This study
pST528 pAM1956 Palr3758 fused to gfp This study
pST527 pAM1956 with Palr3758(mutated NtcA-binding site) fused to gfp This study
pST488 pAM1956 Palr3423 fused to gfp This study
pST485 pAM1956 with Pall0648 fused to gfp This study
pST511 pSMC232 with Pall1087-all1087 This study
pST512 pSMC232 with with Pall1087(mutated NtcA-binding site)-all1087 This study
pST513 pSMC232 with Palr3758-alr3758 This study
pST514 pSMC232 with Palr3758(mutated NtcA-binding site)-alr3758 This study
pST515 pSMC232 with Palr3243-alr3243 This study
pST558 pKT25 carrying hetR Chapter 2
pST559 pKT25 carrying hetF Chapter 2
pST560 pKT25 carrying hetZ Chapter 2
pST561 pKT25 carrying patU5 Chapter 2
pST562 pKT25 carrying patU3 Chapter 2
pST563 pKT25 carrying all1758 This study
pST564 pKT25 carrying patA Chapter 2
pST597 pKT25 carrying hetF(C246A) Chapter 2
pST565 pUT18C carrying hetR Chapter 2
pST566 pUT18C carrying hetF Chapter 2
pST567 pUT18C carrying hetZ Chapter 2
93
Table 3.2. (Continued) Plasmids used in Chapter 3
Plasmids Relevant characteristic(s) Source or reference
pST568 pUT18C carrying patU5 Chapter 2
pST569 pUT18C carrying patU3 Chapter 2
pST570 pUT18C carrying all1758 This study
pST571 pUT18C carrying patA Chapter 2
pST598 pUT18C carrying hetF(C246A) Chapter 2
pJP42 pKNT25 carrying divIVA (Bacillus subtilis) [42]
pST572 pKNT25 carrying hetR Chapter 2
pST573 pKNT25 carrying hetF Chapter 2
pST574 pKNT25 carrying hetZ Chapter 2
pST575 pKNT25 carrying patU5 Chapter 2
pST576 pKNT25 carrying patU3 Chapter 2
pST577 pKNT25 carrying all1758 This study
pST578 pKNT25 carrying patA Chapter 2
pST599 pKNT25 carrying hetF(C246A) Chapter 2
pJP41 pUT18 carrying divIVA (Bacillus subtilis) [42]
pST579 pUT18 carrying hetR Chapter 2
pST580 pUT18 carrying hetF Chapter 2
pST581 pUT18 carrying hetZ Chapter 2
pST582 pUT18 carrying patU5 Chapter 2
pST583 pUT18 carrying patU3 Chapter 2
pST584 pUT18 carrying all1758 This study
pST585 pUT18 carrying patA Chapter 2
pST600 pUT18 carrying hetF(C246A) Chapter 2
94
Table 3.3. Oligonucleotides used in Chapter 3
Primer no.
Primer name Sequence (5’ to 3’)
1 1758 up F AGATCTGGTGGTGCGATCGCTTGGAG
2 1758 up R GCCACGACTGTCCCCGGGTGCCTGTTGTTATTATCACG
3 1758 down F ACGGACAACAATAATCCCGGGCGGTGCTGACAG
4 1758 down R GAGGCTCGCAGCCGCCCAGCTGTATCTAC
5 all1758 flank up F GCCCAAGCACGAAATACAG
6 all1758 flank down R CTTCCCGGTAAACTGTTGG
7 all1758 3’ F GCTAGAACCTGGTGATACAG
8 all1757 5’ R ACAGACTGAGAGTTACGTGC
9 Pall 1758 BamHI F TATATGGATCCTAGAAGCTCTCTTGAGTGGC
10 all1758 SacI R ATATAGAGCTCCCCAGTCCCTTTTATACTCG
11 all1758 SmaI R ATATACCCGGGATTCGATCTGTAAGACCAC
12 Pall1758 SacI F TATATGAGCTCTAGAAGCTCTCTTGAGTGGC
13 all1758 15bp up SmaI R ATATACCCGGGAAAGGGGTTAATTTTAGATTGAC
14 Pall1759-SacI-F TATATGAGCTCCCAAAAAAAGGCGCTGAGTG
15 Pall1759-SmaI-R ATATACCCGGGTAGTTGTTACGAGTTATGAG
16 all1758 OE EcoRI F TATATGAATCCATGTGCCTGTGC CTCCATTTTC
17 all1758 OE BamHI R TATATGGATCCCCCAGTCCCTTTTATACTCG
18 all1758-NdeI-F ATATACATATGCCTGTGCCTCCATTTTCCTCTCAAC
19 all1758-NH6-NotIR TTACTGCGGCCGCTTTTCGATCTGTAAGACCACTAAAGTC
20 all1758 EcoRI rbs F TATATGAATTCAGGAGGTGATTGTGCCTGTGCCTCCATTTTC
21 all1758 rbs EcoRI F TATATAAGGAGGAATTCTGTGCCTGTGCCTCCATTTTC
22 asr5349 RT F AACTAAATCTAGTGAGCATGG
23 asr5349 RT R AAGCATATAAAAGGTGATGGT
24 asr5350 RT F ATGGCATTCATCAAGATACAG
25 asr5350 RT R AACGCTTGACTCTTGATATTG
26 all1757 RT F CTGCCGTCAGTACTGTTAC
27 all1757 RT R AGTCCAGGCTTGCTCTTTAG
28 all1759 RT F GGTTCCGTCGTCAAACTAACG
29 all1759 RT R CACGCCAGTTGTTTGTACTG
30 rnpB RT F ATAGTGCCACAGAAAAATACCG
31 rnpB RT R AAGCCGGGTTCTGTTCTCTG
32 alr1087-up-BamHI-F ATATAGGATCCTGTTGTGTACCCTTGTGTTTAAGCAAGTG
33 alr1087-up-R TGATTAAATTCCCCGGGACTAAATTTGCCAATATTATATAGCAACACACACAATTTTAG
95
Table 3.3. (Continued) Oligonucleotides used in Chapter 3
Primer no.
Primer name Sequence (5’ to 3’)
35 alr1087-down-SacI-R ATATAGAGCTCGGATTGCGACTGCATCAATTAAGTCGAG
36 all1087 flank up F 1 TCATCGACTAAGTAGAACAGG
37 all1087 flank down R 1 GAGATGCAAGCAAGGGTTAG
38 alr3758 up F TATATAGATCTGTTATTTTTCCGGTTTTGCTACGC
39 alr3758 up R AGTACTTGCCCCCGGGCCGATACTTCTATGACTTG
40 alr3758 down F AAGTATCGGCCCGGGGGCAAGTACTGACAGCCAC
41 alr3758 down R ATATAGAGCTCGACTCAGGTTACATCAGCTCAATC
42 alr3758 flank up F CACGTTTTGGCAACGTCTGC
43 alr3758 flank down R TGGATGCTGGAGCTGATGAG
44 all0648 up F TATATAGATCTGCGAAGCAGCCAATTATAGTAATC
45 all0648 up R GGTACACCTTCCCGGGACCGTCTTGGGTTGTATATG
46 all0648 down F CCAAGACGGTCCCGGGAAGGTGTACCTCGTAGCATG
47 all0648 down R ATATAGAGCTCGCATATTTGCTATTGTGCCTCACAC
48 all0648 flank up F CGATTATCAAGATGGACAAGGTG
49 all0648 flank down R TATCCAGCCAAGGTGCAATG
50 alr3423 up F ATAAGATCTCGCATTCAAAAATGGCTACACAC
51 alr3423 up R CATACTTAACCCCGGGGATGGTCGTGCTGCATTATG
52 alr3423 down F CACGACCATCCCCGGGGTTAAGTATGCCAAGGAAGGAC
53 alr3423 down R ATAGAGCTCGTGTAACTTTGCTGCTGCGTAG
54 alr3423 flank up F CTAGTATCTGAAACTCAACGCTGTC
55 alr3423 flank down R CCACTACAGGCAAATAGACC
56 Pall1087 BamHI F TATATGGATCCAGGAAATAAGATTCATCGACTAAGTAGAAC
57 all1087 SacI R ATATAGAGCTCCTAACTATTCGCTAGTATAATTTG
58 Palr3758 BamHI F 1 TATATGGATCCATATTATTTATTGGTCGTTATTTTACAAAC AAAATTGATG TCC
59 alr3758 SacI R ATATAGAGCTCTTAGGAAATAACCCTTGTGGCTG
60 Pall0648 BamHI F TATATGGATCCTTCTGTAAATGTGGGGTTATTGATGTC
61 all0648 SacI R ATATAGAGCTC CTAGCTAGCCATGCTACGAG
62 Palr3423 BamHI F TATATGGA TCCGCTAGTCACCTAGAAGCTTC
63 alr3423 SacI R TATATGAGCTCCTAATATTGTCCTTCCTTGG
64 all1758 D267A-F AACTTGGTCAAGCTTCGGGTCGTTGGGGTTTGGTGATTG
96
Table 3.3. (Continued) Oligonucleotides used in Chapter 3
Primer no.
Primer name Sequence (5’ to 3’)
65 all1758 D267A-R CAACGACCCGAAGCTTGACCAAGTTTGGTGTATG
66 all1758 D267E-F AACTTGGTCAAGAGTCGGGTCGTTGGGGTTTGGTGATTG
67 all1758 D267E-R CAACGACCCGACTCTTGACCAAGTTTGGTGTATG
68 all1758 D277A-F TGGTGATTGGTGCTGTCATGGGTAAGGGTGTTCCTGC
69 all1758 D277A-R TTACCCATGACAGCACCAATCACCAAACCCCAACG
70 all1758 D277E-F TGGTGATTGGTGAGGTCATGGGTAAGGGTGTTCCTGC
71 all1758 D277E-R TTACCCATGACCTCACCAATCACCAAACCCCAACG
72 all1758 T329S-F CCGCTTCATCTCGCTATTTTATTCTGAATATAATCC
73 all1758 T329S-R GAATAAAATAGCGAGATGAAGCGGTGAGAATTTTCC
74 all1758 A348G-F ATAGTAATGCAGGACATAATCCCCCTTTGTGGTGGC
75 all1758 A348G-R GGGGGATTATGTCCTGCATTACTATAGGACAAAATTC
76 all1758 G373A-F GATGTTAATTGCGCTGGATGCTAATAGCCAATACG
77 all1758 G373A-R CTATTAGCATCCAGCGCAATTAACATCCCCAGAGTATC
78 all1758 D398E-F TTATTATACGGAGGGTTTGACCGATGCGGCTGCG
79 all1758 D398E-R TCGGTCAAACCCTCCGTATAATAAATAACTGTATC
80 all1758 G399A-F TTATACGGATGCTTTGACCGATGCGGCTGCGG
81 all1758 G399A-R CATCGGTCAA AGCATCCGTATAATAAATAACTG
82 all1758 D453A-F GACAAAATAATGCTGATATGACTTTAGTGGTCTTAC
83 all1758 D453A-R AAAGTCATATCAGCATTATTTTGTCTGTCAGCACC
84 all1758 D453E-F GACAAAATAATGAGGATATGACTTTAGTGGTCTTAC
85 all1758 D453E-R AAAGTCATATCCTCATTATTTTGTCTGTCAGCACC
86 all1087 SmaI F ATATACCCGGGAGGAAACAGCTGTGTTGCTATATAATATTGGC
87 all1087 KpnI R TATATGGTACCCTAACTATTC GCTAGTATAA TTTG
88 alr3758 SmaI F ATATACCCGGGAGGAAACAGCTATGAATACAAACTTTCAAGTCATAG
89 alr3758 KpnI R TATATGGTACCTTAGGAAATAACCCTTGTGGCTG
90 all0648 SmaI F ATATACCCGGGAGGAAACAGCTGTGATTCAAA TAGAACAAAATTC
97
Table 3.3. (Continued) Oligonucleotides used in Chapter 3
Primer no.
Primer name Sequence (5’ to 3’)
91 all0648 KpnI R TATATGGTACCCTAGCTAGCCATGCTACGAG
92 alr3423 SmaI F ATATACCCGGGAGGAAACAGCTATGCTTGGCATAATGCAGCAC
93 alr3423 KpnI R TATATGGTACCCTAATATTGT CCTTCCTTGG
94 all1702 SmaI F ATATACCCGGGAGGAAACAGCTATGAAAAGTGAGCTTCACGTACC
95 all1702 KpnI R TATATGGTACCGCTTTAATTATTA GCTAATTCC
96 sigB SmaI F ATATACCCGGGAGGAAACAGCTATGCCTAATTCAACATCCCAAG
97 sigB KpnI R TATATGGTACCTCAGTCAGCTAGATAGCTGC
98 sigE SmaI F ATATACCCGGGAGGAAACAGCTATGTACCAAACAAAGCATGAATCC
99 sigE KpnI R TATATGGTACCCTCTAATCCCTAATTCCTAGC
100 sigE EcoRI F (PpetE) TATATGAATTCAGGAGGTGATTATGTACCAAACAAAGCATGAATCC
101 sigE EcoRI F (Pnir) TATATAAGGAGGAATTCTATGTACCAAACAAAGCATGAATCC
102 sigE BamHI R ATATAGGATCCCTCTAATCCCTAATTCCTAGC
103 Pall1758 mut NtcA up R GAATTTCCATTAATTGCCTTCAATTTCATGATAATACATGAAGTTTTC
104 Pall1758 mut NtcA down F CATGTATTATCATGAAATTGAAGGCAATTAATGGAAATTCCTCTCC
105 Pall1758 mut NtcA up R -128
CAAGAGTATAAAGACTGCAGACTTAATCAAACATAAGTATTACATTTGC
106 Pall1758 mut NtcA down F -128
GTAATACTTATGTTTGATTAAGTCTGCAGTCTTTATACTCTTGCAAAA GC
107 Pall1758 mut NtcA up R -323 CAACTTCCTTTGTGCGCTATTAATCAGGCATTAGATTGAAATTTTA GC
108 Pall1758 mut NtcA 2 down F -323
CAATCTAATGCCTGATTAATAGCGCACAAAGGAAGTTGTTTAGATG C
109 Pall1087 SacI F TATATGAG CTC AGGAAATAAGATTCATCGAC TAAGTAGAAC
110 Palr1087-dNtcA-OEX-R TTTGCTATCTTGTCAACAAAAGACTAATTTTTTCGTAAATTTATCAAAC
111 Palr1087-dNtcA-OEX-F TGTTGACAAGATAGCAAAAATAATATTGAGGAATTAGGCTATC
112 Pall1087 SmaI R ATATACCCGGGAAGAGGCTTACTTATTGCTTATAGACTC
113 Palr3758 SacI F TATATGAGCTCATATTATTTATTGGTCGTTATTTTACAAACAAAATTGATGTCC
114 Palr3758 mut ntcA R TCTCGAATCATGCTTTTTTCATCAAAATAAAATTTAATTATTGG
115 Palr3758 mut ntcA F AATTTTATTTTGATGAAAAAAGCATGATTCGAGAAATTCTATAG
116 Palr3758 SmaI R 1 ATATACCCGGGTAAATAAATTGTTAGATTACTATCGGTTTG CTATTTAATT
117 Pall0648 SacI F TATATGAGCTCTTCTGTAAATGTGGGGTTAT TGATGTC
98
Table 3.3. (Continued) Oligonucleotides used in Chapter 3
Primer no.
Primer name Sequence (5’ to 3’)
118 Pall0648 SmaI R ATATACCCGGGCACTGATCTCAAGATTGACTG
119 Pall3423 SacI F TATATGAGCTCGCTAGTCACCTAGAAGCTTC
120 Pall3423 SmaI R ATATACCCGGGTGTAATTATGAGTAAGAATTTTATGTAATCTATCG
121 all1087 SmaI R ATATACCCGGGAACTATTCGCTAGTATAATTTG
122 alr3758 SmaI R ATATACCCGGGAGGAAATA ACCCTTGTGG CTG
123 all0648 SmaI R ATATACCCGGGAGCTAGCCATGCTACGAG
124 alr3423 SmaI R ATATACCCGGGAATATTGTCCTTCCTTGG
125 all1758 BamHI F A AGGAGGGATCCGGGTTCCGCTGGCTCCGCTGCTGGTTCTGGCCCTGTGCCTCCATTTTCCTCTC
126 all1758 EcoRI R A CTCCTGAATTCTTATTCGATCTGTAAGACCACTAAAGTC
127 all1758 BamHI F B AGGAGGGATCCGCCTGTGCCTCCATTTTCCTC
128 all1758 EcoRI R B CTCCTGAATTCCCGCCAGAACCAGCAGCGGAGCCAGCGGAACCTTCGATCTGTAAGACCACTAAAGTC
RESULTS
Mutation of all1758 prevents diazotrophic growth
In an effort to identify genes necessary for diazotrophic growth of Anabaena sp. strain PCC 7120,
a genetic screen using transposon mutagenesis to both increase and mark the sites of mutations
was conducted as previously described [44]. In one mutant the transposon had disrupted open
reading frame all1758 in the annotated genome sequence, suggesting that all1758 was
necessary for diazotrophic growth. To verify a cause-and-effect relationship between inactivation
of all1758 and the phenotype of the mutant, an Ω interposon conferring spectinomycin and
streptomycin resistance was used to replace nucleotides +31 to +1358 relative to the GTG
translational initiation codon of all1758 in the wild-type strain. The resulting mutant, UHM184,
contained the first and last thirty nucleotides of all1758 flanking the Ω interposon and exhibited
impaired diazotrophic growth similar to that of the isolated transposon mutant. Complementation
of UHM184 with a plasmid bearing all1758 preceded by 497 bp upstream of all1758, including the
474 bp intergenic region between the end of upstream gene all1759 and the start of all1758,
restored diazotrophic growth to the mutant and suggested that inactivation of all1758 and not
polar effects of the transposon insertion was the cause of the mutant phenotype. The all1758
gene is located between two genes transcribed in the same orientation and predicted to have a
role in cell division, ftsX (all1757) and ftsY (all1759). To verify that inactivation of all1758 was
solely responsible for the phenotypes of the mutants, nucleotides +31 to +1358 were cleanly
deleted from the chromosome of the wild-type. The resulting strain, UHM183, had an in-frame
99
deletion of all1758 and differed from UHM184 only by the absence of the Ω interposon. The
phenotype of this strain was similar to that of UHM184. Strain UHM183 was complemented in
the same manner as for UHM184, and there was no evidence for recombination between the
plasmid and the chromosomal locus of all1758 as indicated by the lack of a PCR product using
primers corresponding to the region of all1758 that is deleted from the mutant chromosome and
the coding region of all1757. Lastly, transcripts of all1757 and all1759 were detected by RT-PCR
in RNA isolated from strains UHM184 and the wild-type (data not shown). Taken together, these
results indicated that a functional copy of all1758 was required for diazotrophic growth of
Anabaena sp. strain PCC 7120.
Pleiotropic phenotype of all1758 null mutants
Although all1758 was discovered in a genetic screen designed to isolate mutants incapable of
growth on nitrogen-deficient media, disruption of all1758 also affected viability on nitrogen-replete
media. Colonies of the mutant were pale green rather than the vibrant green of the wild-type,
and after about three weeks of growth on BG-11 solid media with either 17 mM nitrate or 2 mM
ammonia as a source of fixed nitrogen, growth appeared to cease, and the strain could not be
revived by subculturing onto fresh medium. In comparison, the wild-type strain remained viable
under the same conditions in excess of three months. However, the strain could apparently be
maintained indefinitely if repeatedly subcultured onto BG-11 solid medium every two weeks.
Despite the severity of the growth defect observed in strain UHM184, suppressor mutations could
not be isolated. To test if loss of viability was the result of a change in the medium over time,
non-viable filaments of UHM184 were scraped from a plate culture 3 weeks after its inoculation,
and the resulting “conditioned” solid medium was streaked with PCC 7120. Growth of the wild-
type strain was indistinguishable from that on unconditioned medium. Cells of UHM184 filaments
cultured on BG-11 solid medium were markedly smaller than those of the wild-type grown under
the same conditions. The average vegetative cell height (measured perpendicular to the
longitudinal axis of the filament) of mutant cells was 2.88 ± 0.25 m, compared to 4.34 ± 0.23 m
for cells of the wild-type, which corresponded to a more than 3-fold reduction in cell volume for
the mutant (Fig. 3.1A, 3.1B). This diminutive phenotype persisted until loss of viability and when
cells were transferred to liquid medium lacking fixed nitrogen.
Growth of the mutant in liquid BG-11 containing nitrate or ammonium as a source of fixed
nitrogen was different from that on solid medium. Within 24 hours of inoculation into liquid
medium, the cytoplasm was found on one side of the cell, and the majority of the cell volume was
occupied by what appears to be a single, large vacuole (Fig. 3.1C). Alternatively, the plasma
membrane may have pulled away from the cell wall in a manner resembling plasmolysis in plant
cells. The process was unlikely to be attributable to the formation of a large gas vesicle because
100
mutant cells settled more readily than those of the wild-type to the bottom of growth vessels.
Vacuole formation was accompanied by enlargement of cells and resulted in cell lysis within 48
hours. To test if cell lysis and/or vacuolization of cells was in response to a substance excreted
into the medium by the mutant, conditioned medium separated from cellular debris by
centrifugation was inoculated with PCC 7120. Growth of PCC 7120 in medium conditioned by
UHM184 was similar to that in unconditioned medium, indicating that lysis of UHM184 was not
caused by amendment of the medium by the mutant so as to make it unfit for growth of PCC
7120. The pH of medium conditioned by growth of UHM184 was similar to that conditioned by
the wild-type and unconditioned medium. In addition, the inverse experiment, growing UHM184 in
spent medium of the strain PCC 7120 did not rescue any of the mutant phenotypes. Finally strain
UHM184 was incapable of growth in the absence of fixed nitrogen, and morphologically distinct
heterocysts were not observed until 48 h after removal of fixed nitrogen, about twice the time for
the wild-type (Fig. 3.1D, 3.1E, 3.1F). Although delayed, the periodic pattern of heterocyts along
filaments was similar to that of the wild-type. Heterocysts of UHM184 had characteristic reduced
levels of auto-fluorescence, indicative of degradation of phycobiliproteins, and polar cyanophycin
granules associated with mature heterocysts. Note that all mutant phenotypes as described
above were complemented by introduction of all1758 on a plasmid to strain UHM184.
101
Figure 3.1. Phenotype of the all1758 deletion strain, UHM184 under varying conditions. The
diminutive cell size of UHM184 (B) as compared to the wild type strain Anabaena sp. strain
PCC 7120 (A) cultured on solid BG-11 medium. At 24 h after culturing in liquid BG-11 medium,
UHM184 develops intracellular vacuoles among all cells of a filament (C). At 24 h after transfer
from solid BG-11 medium to liquid BG-110 medium, which lacks a source of combined nitrogen,
heterocysts form in PCC 7120 (D) but not in UHM184 (E). After 48 h of nitrogen starvation,
UHM 184 exhibits heterocyst patterning among cells of diminutive size (F). Carets indicate
heterocysts. Bars = 10 µM.
102
Strain UHM184 (∆all1758) was Fix
- and lacked the minor heterocyst-specific glycolipid
During the late stages of heterocyst
development, deposition of
heterocyst-specific polysaccharides
contributes to the creation of the
microoxic environment necessary
for the function of nitrogenase, an
oxygen-labile enzyme. Heterocysts
of strain UHM184 were readily
stained by Alcian blue, indicative of
the presence of heterocyst
envelope exopolysaccharides (Fig.
3.2). Thus, polysaccharide
synthesis and deposition appears
unimpaired in the mutant.
Just interior to the layer of
exopolysaccharide, a layer of heterocyst-specific glycolipid also contributes to the microoxic
interior of a heterocyst. To determine if heterocyst-specific glycolipids (HGLs) were present in
mutant strain UHM184, lipids from strains PCC 7120, UHM184, and UHM103, a hetR mutant that
served as a negative control, were extracted after 72 hours of combined nitrogen deprivation, and
separated by thin-layer chromatography for visualization (Fig. 3.3). Two HGLs have been
characterized in the wild-type [52-54]. Although the more abundant, slower-migrating species
corresponding to 1-(0-a-D-glucopyranosyl)-3,25-hexacosanediol was present in strains UHM184
and PCC 7120 (the major HGL), the less abundant, faster migrating glycolipid, 1-(0-a-D-
glycopyranosyl)-3-keto-25-hexacosanol (the minor HGL) was absent from UHM184. As expected,
both HGLs were absent from strain UHM103, which does not make heterocysts. The absence of
the minor HGL, which is necessary for a functional heterocyst, could account for the inability of
UHM184 to grow under diazotrophic conditions. Typically strains affected in HGL synthesis lack
both the minor and major HGL, with one exception. A double kinase mutant was shown by RT-
PCR to lack expression of two glycolipid synthesis genes, asr5349 and asr5350 [23]. Conversely,
transcripts of asr5349 and asr5350 were detected by RT-PCR in RNA isolated from strain
UHM184 (data not shown).
Strains that lack one or both of the heterocyst specific glycolipids cannot fix nitrogen in the
presence of molecular oxygen (Fox- phenotype) but can in its absence. Other strains that are
Figure 3.2. Heterocyst-specific exopolysaccharide of
UHM184. Bright-field images of heterocyst-specific
exopolysaccharides stained by Alcian Blue in (A) PCC
7120 and (B) UHM184 at 48 h after removal of combined
nitrogen. Carets indicate heterocysts. Bars = 10 µM.
103
deficient in more than just the creation of microoxic heterocysts cannot fix under either condition
(Fix- phenotype). The nitrogenase activity of strain UHM184 at 48 h post-induction was assessed
Figure 3.3. Heterocyst-specific glycolipids of UHM184. The numbers 1, 2, 3 (top
horizontal header) denote lane numbers. Lane 1, lipid extract from the all1758 mutant,
UHM184, which lacks the minor heterocyst glycolipid (HGL); lane 2, PCC 7120; and lane
3, the ∆hetR mutant, UHM103, which lacks both the minor and major HGLs separated by
thin-layer chromatography 72 h after removal of combined nitrogen. The minor (1-(0-a-D-
glycopyranosyl)-3-keto-25-hexacosanol), and the major (1-(0-a-D-glucopyranosyl)-3,25-
hexacosanediol) heterocyst-specific glycolipids are indicated by the top and bottom
arrows, respectively. Lipid extracts were deposited at the origin, denoted by ‘*’.
104
by acetylene reduction assays under both oxic and anoxic conditions (Fig. 3.4) to determine if it
was a Fox- or Fix
- strain. Under oxic conditions, rates of acetylene reduction were 0.350 ± 0.064
nmol ethylene h-1
ml -1
(OD750 unit)-1
for PCC 7120 and undetectable for strains UHM184, UHM103
(∆hetR), a Fix- strain and UHM128 (∆pbp6), a previously characterized Fox
- strain [44, 55].
Under anoxic conditions rates of acetylene reduction were 0.073 ± 0.038 nmol ethylene h-1
ml-
1(OD750 unit)
-1 for strain UHM128 and undetectable for strains UHM184 and UHM103. Thus, the
phenotype of UHM184 was Fix-, suggesting that lack of a functional copy of all1758 disrupted
more than just the creation of microoxic conditions in heterocysts. For this reason, All1758 may
have a role in heterocyst development that extends beyond nitrogen fixation.
all1758 is not required for the timing of pattern formation
A null mutation in all1758 delays morphological differentiation of heterocysts. Prior to changes in
the morphology of differentiating cells, the cells of filaments that will differentiate are specified by
the generation of a pattern of gene expression. This pattern can be visualized using fusions of
the promoters of hetR or patS to gfp [48, 56]. Strain UHM184 carrying a plasmid with the
promoter of either hetR or patS fused to gfp exhibited a pattern of GFP-dependent fluorescence
Figure 3.4. Acetylene reduction assay for nitrogenase activity indicates strain UHM184
(∆all1758) is Fix-. The heterocysts that form in UHM184 are non-functional under oxic (left
panel) and anoxic (right panel) conditions. (+) and (-) indicates the positive and negative
controls for the assay, respectively.
105
that was similar to that observed in the wild-type carrying the same plasmid (Fig. 3.5C, 3.5D).
Both the number of cells between fluorescing cells and the timing of the appearance of
fluorescence were similar. The only noticeable difference was the smaller size of the cells in
filaments of UHM184. Thus, all1758 was not required for formation of the pattern that specifies
which cells will differentiate into heterocysts.
all1758 is constitutively expressed and autoregulates its own expression
Expression of all1758 was
assessed both temporally and
spatially using the gene for
green fluorescence protein
(GFP) as a reporter. A
uniform level of florescence
was observed in vegetative
cells and heterocysts when a
shuttle vector carrying the
putative promoter region of
all1758 fused to gfp (plasmid
pST151) was introduced into
the wild-type strain. Similar
levels of expression were seen
with and without nitrate in the
medium (Fig. 3.5A). However,
no GFP-dependent
fluorescence was observed
when the same plasmid was
introduced into strain UHM184,
which has all1758 deleted
from the chromosome (Fig.
3.5B).
No GFP-dependent
fluorescence was observed
from the wild-type strain
harboring a plasmid bearing
all1758 translationally fused to gfp under the control of its native promoter in the presence or
absence of nitrate (data not shown). UHM184 bearing the same plasmid also remained dim,
Figure 3.5. A functional all1758 gene is required for
expression of all1758 but not for patterned expression of
patS. Expression of all1758 as visualized with a
transcriptional Pall1758-gfp fusion on plasmid pST151 in strains
(A) PCC 7120 or (B) UHM184 at 24 h after removal of
combined nitrogen. Expression of patS in PCC 7120 (C) and
UHM184 (D) as visualized using the transcriptional fusion
patS-gfp on plasmid pAM1951 at 14 h after induction of
heterocyst formation. Micrographs show bright-field (left
panels) and fluorescence (right panels) images recorded
using identical microscope and camera settings. Carets
indicate heterocysts. Bars = 10 µM.
106
similar to the wild-type, although the cell size had returned to the wild-type dimensions,
apparently due to complementation by the fusion protein encoded on the plasmid. In addition,
overexpression of all1758 from the copper-inducible petE promoter in the wild-type strain had no
apparent effect on heterocyst differentiation or cell size, whereas extra copies of patS or hetN
(and patU3) expressed from the petE promoter on a plasmid in strain UHM184 prevented
heterocyst differentiation, but the diminutive cell phenotype remained (data not shown). Also,
patU3-deficient strains exhibit the diminutive cell morphology common to all1758-deficient strains
(Chapter 2). Overexpression of patU3 alone from the petE promoter on a plasmid was sufficient
to inhibit heterocysts in strain UHM184 (data not shown), but not the wild-type nor patA-deficient
strain. PatU3-GFP was occasionally detected in a few vegetative cells of strain UHM184 (data
not shown) at 30 hours post-induction, and not in the wild-type, perhaps due to spontaneous
mutations that arose under the conditions of this experiment. Overexpression of all1758 from the
nirA promoter, which is induced under both nitrate-replete conditions or conditions of nitrogen-
starvation [57], yielded the same results in the wild-type as those observed with use of the petE
promoter (data not shown).
NtcA and HetR negatively regulates all1758 expression
To understand the role of the heterocyst differentiation genes ntcA and hetR in the regulation of
the expression of all1758, a reporter plasmid carrying Pall1758-gfp was introduced into both mutant
backgrounds. Fluorescence in a ∆ntcA strain was increased in comparison to the wild-type (data
not shown) suggesting that the global transcription factor NtcA exhibits an inhibitory role on
all1758.
Figure 3.6. The global transcription factor NtcA negatively regulates all1758 expression. (A)
Expression of all1758 as visualized with a transcriptional Pall1758-gfp fusion on plasmid pST151
in strain UHM184. (B) Expression of all1758 as visualized with a transcriptional Pall1758-gfp
fusion with a mutated putative -189 binding site (on plasmid pST490) in strain UHM184.
Micrographs show bright-field (left panels) and fluorescence (right panels) images recorded
using identical microscope and camera settings at 24 h after removal of combined nitrogen.
107
To further support the regulatory role of NtcA in all1758 expression, three putative NtcA-binding
sites present in the promoter of all1758 were examined. Plasmids with mutations in the
consensus NtcA-binding site GTA-N8-TAC [58]starting at positions -189, -116 and -321 relative to
the putative translational start site of all1758 were individually introduced into all1758-deficient
strains. Whereas fluorescence was below the limit of detection when a plasmid bearing Pall1758-
gfp was examined in strain UHM184, fluorescence was restored to wild-type levels upon mutation
of the putative NtcA-binding site at position -189 in UHM184 (Fig. 3.6). This result supports a
negative role for NtcA in all1758 expression. However, only the putative -189 binding site
appears to be important for NtcA-directed regulation of all1758, because mutations in the
potential binding sites at positions -116 and -321 did not restore fluorescence from the Pall1758-gfp
construct in strain UHM184 (data not shown). Fluorescence was not detected upon introduction
of plasmids carrying mutations at -189, -116 and -321 potential binding sites into ntcA-deficient
strains (data not shown).
Like NtcA, HetR also has a negative role in all1758 expression. The Pall1758-gfp reporter plasmid
(without mutations in NtcA-binding sites) was lethal in a hetR background. No colonies arose
upon conjugation. However, the same region corresponding to Pall1758 carried on a plasmid could
be introduced into a hetR-deficient strain. Since the two plasmids differed only by fusion to the
gfp reporter gene, the level of gfp expression, rather than the promoter region, may account for
the lethality observed. To test this hypothesis, the Pall1758-gfp reporter plasmid was introduced
into a very small subset of cells along a filament of ∆hetR to create a genetic mosaic filament [22].
The mosaic filaments were examined at 24 hours and 48 hours after the conjugation event, to
limit the number of cell divisions. At 0 hours after nitrogen step-down, the mosaic filaments were
Figure 3.7. The heterocyst differentiation gene HetR negatively regulates all1758
expression. (A) Expression of all1758 as visualized with a transcriptional Pall1758-gfp fusion
carried on plasmid pST151 in a hetR-deficient strain. (B) The empty vector (plasmid
pAM1956) negative control in the same genetic background. Micrographs of genetic
mosaic filaments show bright-field (left panels) and fluorescence (right panels) images
recorded using identical microscope and camera settings at 48 h after removal of
combined nitrogen (48 hours after the conjugation event).
108
bright, and fluorescence intensified significantly over time (Fig. 3.7). These findings suggest that
in the absence of hetR, expression of all1758 increased dramatically. These findings imply that
NtcA as well as HetR negatively regulate all1758.
The regulatory role of the three NtcA binding sites was also explored in a ∆hetR background.
Plasmids carrying the mutated -116 and -321 binding sites did not result in detectable
fluorescence under the same conditions (data not shown). These sites appear to contribute to
the elevated levels of fluorescence observed in a hetR-deficient strain. However, expression of
all1758 with the mutated -189 binding site was observed without the need for mosaic filaments in
∆hetR (data not shown), unlike the case for plasmids bearing the non-mutated (normal) promoter.
It remains unclear why the -189 binding site appeared to lower expression in a ∆hetR background
but increase expression in a ∆all1758 background. But taken together, All1758 appears to have
a role in heterocyst development since two key developmental genes, NtcA and HetR, are
involved in the regulation of All1758.
Bypass of mutation of all1758 by extra copies of hetR
In an attempt to ascertain where in the regulatory network controlling heterocyst differentiation
all1758 may have been acting, plasmid-borne copies of hetR were put into UHM184 and the
resulting strain was examined for phenotypic differences. The strain with extra copies of hetR
had multiple contiguous heterocysts and reduced spacing between groups of heterocysts in
media with or without nitrate as a fixed nitrogen source (data not shown). The same Mch
phenotype was observed when the plasmid was introduced into the wild-type strain. Extra copies
of hetR bypassed the delay in morphological differentiation of heterocysts, but the diminutive cell
phenotype and other associated phenotypes remained.
Genetic epistasis analysis supports the role of all1758 in normal cell size and cell growth
control
Genes controlling heterocyst differentiation also have been shown to affect cell morphology.
Overexpression of hetF results in supernumerary heterocyst formation in the wild-type, but cells
are reduced in size. Heterocysts no longer form in a hetF-deficient strain, which also exhibits
aberrantly enlarged cells[22]. Similarly, overexpression in the wild-type of another positive
regulator of differentiation, patA, results in enlarged cell morphology[49].
Strain UHM184 overexpressing either hetF or patA was examined individually to determine if the
diminutive cell morphology of all1758 could be controlled by hetF and/or patA. UHM184 filaments
overexpressing hetF appeared smaller than the same strain without hetF overexpressed,
consistent with overexpression results in the wild-type. However, unlike the effect of patA in the
wild-type, no change in morphology was observed when patA was overexpressed in UHM184.
109
The all1758 gene appears to be necessary for the effect of overexpression of patA on cell
morphology.
In strain UHM184, GFP fluorescence from translational fusions to either hetF or patA was below
the level of detection, similar to levels of fluorescence in the wild-type without the use of confocal
microscopy[22, 49]. HetF-GFP was occasionally detected in 1-8 cells of strain UHM184 (data not
shown) at 24 hours post-induction, most likely due to spontaneous mutations that arose under the
conditions of this experiment.
The double-deletion mutants hetF all1758 and patA all1758 were created by deleting all1758 from
hetF or patA parent strains, respectively, to determine which gene is epistatic. In these strains
(and the six other all1758 double-deletion or replacement strains listed in Table 3.1), the
diminutive cell morphology and cell growth defect was observed, but the parental strain timing
and patterning of heterocyst development was unaffected (Fig. 3.8). Because the small cell and
growth defect phenotype is characteristic of ∆all1758 rather than the parent strain, all1758 is
epistatic with respect to cell size and growth. The results from epistasis analysis suggest that
all1758 is required for normal cell size and cell growth.
Figure 3.8. All1758 is required for normal cell size and growth in Anabaena. Parent
genetic background strains (left panels) deficient in (A) hetF, (C) patA, and (E) hetR.
The double-deletion mutants (B) ∆hetF ∆all1758, (D) ∆patA ∆all1758, and (F) ∆hetR
∆all1758, created by an additional in-frame deletion in all1758 (right panels) of parental
strains depicted in A, C, and E, respectively, exhibits the diminutive cell size and growth
defect common to UHM184. Micrographs were recorded using identical microscope and
camera settings 48 hours after nitrogen removal. Carets indicate heterocysts.
110
All1758 is required for proper localization of the cell division protein FtsZ and the cell
division regulators MinC and MinE
The diminutive cell morphology of strain UHM184 may relate to a cell division defect, particularly
because the all1758 gene is located in the same orientation between ftsX (all1757) and ftsY
(all1759), two predicted cell division genes. A similar genomic arrangement is observed in the
genome of Escherichia coli. In this organism, the cell division gene ftsE (b3463) lies between
ftsX (b3462) and ftsY (b3464). Another relationship involves SpoIIE phosphatase of Bacillus
subtilis. Similar in sequence to All1758, SpoIIE contributes to asymmetric cell division in Bacillus
subtilis by interacting with FtsZ[59].
The GTPase FtsZ initiates cell division in bacteria. It provides a scaffold, termed the ‘Z-ring’, at
the midpoint of a cell. Other division proteins, including FtsX and FtsY, are recruited to the
cytoskeletal scaffold, forming a division septum where cytokinesis eventually occurs[60]. In E.
coli, the localization of FtsZ at the cell midpoint is regulated by the min genes. MinC and MinD
oscillate between cell poles to inhibit FtsZ localization at the poles[61-64]. MinE directs the MinC-
MinD inhibitor complex away from the cell midpoint [65]. Translational fusions to YFP (yellow
fluorescent protein) were used to examine the relationship between the all1758-dependent
control of cell morphology and the cell division machinery. Plasmids containing ftsZ-yfp, minC-yfp
and minE-yfp driven by the PpetE promoter were introduced individually into strain UHM184 and
the wild-type and subsequently examined by confocal microscopy. Fusion of the cell division
genes to the inducible PpetE promoter rather than the native promoters removed any effects on
transcription from this study.
Deletion of the PP2C phosphatase spoIIE has been correlated with a significant reduction of FtsZ
rings in Bacillus subtilis cells [66]. Similarly, fluorescence corresponding to FtsZ-YFP was very
dim in strain UHM184 compared to the wild-type (Fig. 3.9A, 3.9D). Also, fewer cells in strain
UHM184 exhibited FtsZ rings. In a population of 500 cells, concentrated localization of FtsZ-YFP
to a mid-cell ring was observed for 49.0% of cells in the wild-type compared to 13.6% cells in
strain UHM184.
One simple explanation for decreased ftsZ-yfp in strain UHM184 would be increased levels of
MinC and/or MinE, the negative regulators of FtsZ. MinC-YFP is typically concentrated at the
poles of cells in the wild-type (Fig. 3.9B, 3.9E). However, fluorescence corresponding to minC
was barely detected in strain UHM184 (and when present, at a concentration that did not “cap”
the poles as fully as in the wild-type; Fig. 3.9C, 3.9F). Fluorescence corresponding to minE was
very dim in the wild-type, but not detected in strain UHM184 (data not shown). These results
suggest that All1758 is involved in the proper localization of the cell division machinery
components, FtsZ, MinC and MinE.
111
Figure 3.9. All1758 is involved in the proper localization of the cell division machinery
components FtsZ, MinC and MinE. (A-C) PCC 7120 and (D-E) UHM 184 with
plasmids carrying (A, D) PpetE-ftsZ-yfp, (B, E) PpetE-minC-yfp and (C, F) PpetE-minE-yfp.
Confocal micrographs show bright-field (left panels) and YFP fluorescence (right
panels) images recorded using identical microscope and camera settings at 48 hours
after nitrogen removal. Carets indicate heterocysts.
112
Conserved aspartate residues in the active sites of Motifs 2, 8 and 11 are required for
PP2C phosphatase activity of All1758
The predicted 463-
amino acid sequence
encoded by all1758
has similarities to
sequences of other
proteins in the Protein
Database maintained
by NCBI (Fig. 3.10).
Residues 57 to 191 appear to comprise a GAF domain, which is named after the types of proteins
containing the domain (cGMP-specific phosphodiesterases, adenylyl cyclases and FhlA). Many
of these proteins bind cyclic nucleotides. Residues 84 to 463 were similar in sequence to
serine/threonine protein phosphatases of the PP2C superfamily, which is comprised of metallo-
phosphatases that employ two metal ions in the catalytic site. PP2C proteins generally have a
catalytic domain of approximately 290 amino acids that includes eight “absolutely conserved”
residues within eleven conserved motifs [23, 67]. However, the predicted protein sequence of
All1758 lacked the invariant glycine present in Motif 5 and, instead, had an alanine in its place.
In an attempt to demonstrate phosphatase activity of All1758 using a biochemical approach, the
52 kD protein with an N-terminal polyhistidine epitope tag was purified from E. coli strain BL21 by
affinity chromatography. Attempts to characterize phosphatase activity using p-nitrophenol
(pNPP) as a substrate were unsuccessful even after addition of either 10 or 100 µM cAMP or
cGMP separately with the pNPP substrate, in an effort to support the potential role of the GAF
domain in phosphatase function.
A genetic approach was subsequently utilized to demonstrate the PP2C phosphatase function of
All1758. Conservative and non-conservative substitutions of the eight absolutely conserved
residues of PP2C phosphatases were cloned into plasmids pST399, pST443, pST400, pST444,
pST469, pST401, pST470, pST402, pST445, pST471, pST403 and pST446 corresponding to
all1758(D267A), all1758(D267E), all1758(D277A), all1758(D277E), all1758(T329S),
all1758(A348G), all1758(G373A) all1758(D398A), all1758(D398E), all1758(G399A),
all1758(D453A) and all1758(D453E). These alleles of all1758, representing mutations in
conserved motifs essential for PP2C phosphatase activity, were introduced into strain UHM184
and the wild-type. Lack of complementation of strain UHM184 to the wild-type phenotype was
observed for the D277 (pST400, pST444), D398 (pST402, pST445), and D453 (pST403, pST446)
substitutions corresponding to Motifs 2, 8, and 11. Because the aspartates in the active sites of
Figure 3.10. Schematic of the domains present in the 463-residue
All1758 protein.
113
Motifs 2, 8, and 11 are required for restoration of All1758 function, All1758 appears to act as a
PP2C phosphatase.
All1758 regulates the antisigma factor Alr3423
The sigma factor subunit of prokaryotic RNA polymerases is required for promoter sequence
recognition and transcription initiation. Partner-switch mechanisms that modulate the activity of
sigma factors are dependent upon phosphorylation activity. In particular, the phosphatase activity
of the PP2C phosphatases SpoIIE, RsbU, RsbP of Bacills subtilis [31, 32, 68] and RsbU of
Staphylococcus aureus [69] directly control sigma factors involved in sporulation or stress
response. The dual-function protein SpoIIE controls gene expression and morphogenesis.
SpoIIE promotes polar division by interacting with the cytokinetic machinery and directly activates
σE
(SigE) during sporulation[70]. Similarly, induction of the stress response by σB
(SigB) is
positively regulated by RsbU in Bacillus subtilis and Staphyloccus aureus [31, 69]. All1758
displays sequence homology to SpoIIE and RsbU (Fig. 3.10). For this reason, the possible role
of the PP2C phosphatase All1758 in a similar partner-switch mechanism was investigated.
Interactions of all1758 were strongly predicted in silico (STRING 9.1 database at http://string-
db.org) to antisigma factors (all1087, alr3758, all0648), and anti-antisigma factors (alr3423,
all1702).
In addition to sigma factor regulators, sigma factors (SigB and SigE) were investigated in relation
to All1758 The alternative sigma factor SigB is the master regulator of a large stress response
regulon in Bacillus subtilis and Staphylococcus aureus [71, 72]. Alr3423 and All1702 were
predicted to regulate SigB. Of the twelve sigma factor genes annotated in the Anabaena genome,
sigE appears to control the expression of genes involved in late-stage heterocyst
development[73]. The absence of the minor heterocyst glycolipid in ∆all1758, controlled by
heterocyst-development genes, may relate to sigE. The overlapping promoter specificities of
sigma factors in Anabaena have made it difficult to separate the role of sigma factors in gene
expression[74], but in this study, an All1758-dependent sigma factor controlling a developmental
regulon is proposed.
Individual deletions of sigma factor regulator genes (all1087, alr3758, all0648, alr3423) from the
chromosome were constructed in an effort to address the role of each gene. The resultant strains
(UHM325, UHM301, UHM302, UHM303, UHM326, UHM327) did not differ from in phenotype
from the wild-type with respect to cell morphology, cell growth, or heterocyst development.
Overexpression studies were done to address the role of sigma factors, antisigma factors and
antiantisigma factors in relationship to the phosphatase function of All1758. The phenotype of
114
each regulatory gene, fused to two different inducible promoters (PpetE and Pnir, Table 3.2), was
investigated upon introduction into strain UHM184 and the wild-type.
Overexpression of the sigma factor genes sigE and sigB did not result in any change to the
parent phenotypes tested. However this result may not be unexpected given reports that sigma
factor concentrations in E. coli generally exceed the number of RNA polymerase molecules [75].
In fact, gene expression is influenced by this competition between sigma factors for RNA
polymerase.
When sigma factor regulators (anti-antisigma factors and antisigma factors) were present in
multicopy under the control of native promoters, no phenotypic effect was observed in either
background. Overexpression of the anti-antisigma factors all1087, alr3758 and all0648 also did
not affect the phenotype of strain UHM184. However, in the wild-type, overexpression of anti-
antisigma factors disrupted cell growth to a greater extent than normally observed in strain
UHM184, but heterocyst formation and patterning was unimpaired (data not shown). This may
very weakly correlate the growth
defect of UHM184 to increased
anti-antisigma factor concentrations
in the absence of the phosphatase
activity of all1758.
The effect of overexpression of
antisigma factors (all1702, alr3423)
was investigated in the wild-type
and strain UHM184. The antisigma
factor all1702 when overexpressed
(carried on plasmid pST479) did
not affect the phenotype of the
wild-type or strain UHM184.
However overexpression of the
antisigma factor alr3423 (carried on
plasmid pST478) in the wild-type
mimics the phenotype of strain
UHM184. While no change was
observed in strain UHM184 (Fig.
3.11A), overexpression of alr3423
in the wild-type induced phenotypic
changes that resemble strain
Figure 3.11. Overexpression of the antisigma factor
Alr3423 in the wild type strain mimics the ∆all1758
phenotype at 24 hours. Plasmid bearing Pnir-alr3423 in
(A) UHM184, (B) wild type. The empty vector control in
the wild-type is shown in (C). Micrographs were recorded
using identical microscope and camera settings 24 hours
after nitrogen removal. Carets indicate heterocysts.
Bars = 10 µM.
115
UHM184. Like strain UHM184 at 24 hours post-induction, the cell growth defect, reduced cell
size, and deficiency in heterocyst development was observed (Fig. 3.11B). Heterocysts did not
form in this strain even after one week in nitrate-depleted conditions; however this may be due to
the severe growth defect observed before nitrogen step-down. Regulation of Alr3423 by All1758
could potentially account for the observed results.
NtcA activates expression of the all1758-dependent anti-antisigma factor all1087
Overexpression of anti-antisigma and antisigma factors in all1758-deficient strains did not alter
the growth defect phenotype normally associated with these strains. However, sigma factor
regulators impaired growth upon overexpression in the wild-type. The transcriptional control of
the sigma factor regulators was investigated to determine the relationship to All1758. Plasmids
containing transcriptional gfp fusions to antisigma factors (alr3423, all1702) and anti-antisigma
factors (all1087, alr3758, all0648) were introduced into strain UHM184 and the wild-type.
Additionally, the regulatory role of the global transcriptional regulator NtcA was also examined by
mutation of putative NtcA-binding sites found in the promoters of all1087 and alr3758.
In both strain UHM184 and the wild-type, GFP fluorescence was below the level of detection for
all antisigma factors and anti-antisigma factors tested, with the exception of the anti-antisigma
factor all1087. Expression of All1087 (carried on plasmid pST499) was heterocyst-specific in
both the wild-type and in strain UHM184 (Fig. 3.12A, 3.12B). Fluorescence was concentrated in
developing heterocysts and heterocysts by 24 hours of nitrogen step-down. In addition, NtcA was
required for this localized expression of All1087. Mutation of the putative NtcA-binding site in
Pall1087 on a plasmid (pST500) resulted in non-detectable levels of fluorescence in both strains
(Fig. 3.12C, 3.12D). This result implies that the heterocyst-specific expression of all1087 is NtcA-
dependent. To examine the spatial and temporal localization of sigma factor regulators within
filaments of strain UHM184 and the wild-type, translational fusions driven by the native promoters
for each regulator were examined. GFP fluorescence was below the level of detection for all
antisigma factors and anti-antisigma factors tested (data not shown), with the exception of the
anti-antisigma factors all1087 and all0648.Fluorescence from the translational fusion for all1087
to gfp was consistent with results from the transcriptional gfp reporter. Cells carrying All1087-
GFP were dimly fluorescent at 0 hour post-induction, but fluorescence eventually concentrated in
proheterocysts and heterocysts by 24 hours.
Localization of All0648 differed from that of All1087. Vegetative cells and proheterocysts in strain
UHM184 and the wild-type carrying All0648-GFP were fluorescent at 0 hour post-induction, but
the fluorescence dimmed in developed heterocysts at 24 hours. The dissimilar temporal and
spatial localization of All0648 and All1087 may relate to their respective roles in Anabaena.
116
Direct interaction of All1758 with itself and HetR detected by the bacterial two-hybrid
system
Dimerization of SpoIIE, a PP2C protein phosphatase with homology to All1758, has been shown
through a yeast two-hybrid system [76]. To determine if All1758 also interacts with itself and
other developmental proteins (HetR, HetF, HetF(C246A), HetZ, PatU5, PatU3, PatA), a bacterial
two-hybrid assay was performed (refer to Chapter 2 for more details). Putative protein-protein
interactions were tested by fusion of these proteins at the N- or C- termini of two complementary
fragments derived from the Bordetella pertussis adenylate cyclase catalytic domain, T25 and T18.
In this genetic assay, physical association of the two tested proteins result in the functional
complementation of adenylate cyclase in an Escherichia coli cya strain[40]. Subsequent
synthesis of cAMP by the reconstituted adenylate cyclase yields a distinctive blue cell phenotype
that serves to signal the presence of a direct interaction between the two proteins under
Figure 3.12. NtcA is required for the localized expression of the anti-antisigma factor All1087
in developing heterocysts. A plasmid bearing Pall1087-gfp in the (A) wild type, (B) UHM184. A
plasmid bearing Pall1087-gfp with a mutated putative NtcA binding site in the (C) wild type, (D)
UHM184. Bright-field (left panels) and fluorescent (right panels) micrographs were recorded
using identical microscope and camera settings 48 hours after nitrogen removal. Carets
indicate heterocysts. Bars = 10 µM.
117
investigation. The Bacillus subtilus cell division protein DivIVA, shown in different reports to
interact with itself[41, 42], was utilized as a positive control for this study.
Of the 60 interactions tested, four interactions (6%) were discovered (Fig. 3.14, Table 3.4). The
dimerization between All1758 and itself and a less robust interaction with HetR was detected.
Both interactions were not as strong as interactions between HetR-HetR or Bacillus subtilis
DivIVA-DivIVA but significantly greater than the negative (empty vector) controls. The E. coli
colonies that represent positive interactions from the assay pairing derivatives of plasmids
pKNT25 and pUT18 (Table 3.2) are depicted in Figure 3.13. Figure 3.13 summarizes
quantification of the β-galactosidase activity. The three positive interactions between All1758 and
All1758 are shown, representing three of the four possible pairings between N- and C-terminal
fusions to T25 and T18. Interaction of All1758 with the developmental protein HetR further
supports the role of the PP2C phosphatase All1758 in heterocyst differentiation.
Figure 3.13. Bacterial two-hybrid results indicate All758 interacts with (A) HetR and (B)
dimerizes with itself. Colonies of E. coli cells expressing the indicated protein fusions to
fragments of adenylate cyclase carried on derivatives of plasmids pKNT25 and pUT18. Plus
signs (lower right corner) indicate a positive interaction. Positive interactions for the assay
include dimerization of (D) Anabaena HetR and HetR and (E) Bacillus subtilis DivIVA and
DivIVA. The negative control for the assay (empty vector interactions) is depicted in (C).
118
Table 3.4. Plasmids used for quantification of β-galactosidase activity (Figure 3.14) of positive
bacterial two-hybrid interactions, and average Miller units (with standard deviation) of three
independent replicates. Rows (top to bottom) correspond to ascending order (left to right) of
activity depicted in Figure 3.14. The first four bars (left side of bar graph) relating to empty vector
negative controls in Figure 3.14 are listed at the top of the Table. The positive control for the
assay (Bacillus subtilis DivIVA/DivIVA interaction) is identified in bold font.
Protein-protein interaction (T25 fragment/T18 fragment)
Plasmid (T25 fragment)
Plasmid (T18 fragment)
Average Miller Units (MU)
Standard deviation
None (negative control) pKNT25 pUT18C 56 12.6
None (negative control) pKNT25 pUT18 57 4.2
None (negative control) pKT25 pUT18 61 9.2
None (negative control) pKT25 pUT18C 56 12.6
All1758/HetR pST577 pST579 133 24.0
All1758/All1758 pST577 pST570 262 38.5
All1758/All1758 pST577 pST584 291 36.2
All1758/All1758 pST563 pST570 466 14.9
DivIVA/DivIVA (positive control)
pJP42 pJP41 1579 109.6
HetR/HetR pST572 pST579 1565 94.9
Figure 3.14. Average β-galactosidase activity of positive protein-protein interactions between
All1758 and HetR and itself. Negative controls for the assay (empty vector interactions)
shown on the far left (first four bars) and positive controls shown on the far right (last two
bars; dimerization of Bacillus subtilis DivIVA and DivIVA and Anabaena HetR and HetR).
Average activity of three replicates plotted in ascending order from left to right. Plasmid
identity for tested interactions detailed in Table 3.4 in the same order (top to bottom of Table).
119
DISCUSSION
Phosphorylation of proteins is widely used in the post-translational regulation of various cellular
processes. All1758 is predicted to be a PP2C phosphatase, which is a member of the PPM
family of serine/threonine phosphatases that are dependent on the presence of the divalent
cation Mg2+
for catalytic function. However, repeated attempts to support the role of All1758 as a
phosphatase were unsuccessful. The simplest explanation for the lack of discernable
phosphatase activity in a biochemical assay relates to the absence of one of the eight absolutely
conserved residues in the protein sequence of all1758. PP2C proteins generally have a catalytic
domain of approximately 290 amino acids that includes eight absolutely conserved residues
within eleven conserved motifs [23, 67]. All1758 harbors an alanine residue, a conservative
substitution, in lieu of the glycine residue reported as invariant in Motif 5. Alternatively,
phosphatase activity of the protein encoded by all1758 may not be measurable under the
conditions of our assay due, for instance, to substrate specificity, lack of a cofactor, or improper
folding of the recombinant protein. Site-directed mutagenesis was used instead to support the
function of All1758 as a phosphatase. Conservative and non-conservative mutations were made
at eight residues important for PP2C function, and tested for complementation of the pleiotropic
phenotype of ∆all1758. Mutations at three of the four ‘invariant’ aspartate mutations failed to
complement the all1758 mutant strain, demonstrating that these residues are essential for
All1758 function as a PP2C phosphatase. Furthermore, like the PP2C phosphatase SpoIIE [76],
All1758 was shown to dimerize with itself in a bacterial two-hybrid assay.
The minor heterocyst glycolipid, which is essential for provision of microaerobic conditions
necessary for the activity of nitrogenase within the heterocyst, was absent in a strain lacking
all1758. However, the absence of nitrogen fixation in the mutant strain even under anoxic
conditions suggests that all1758 is required for some cellular process(es) related to fixation of
nitrogen not related to diminution of molecular oxygen in heterocysts. Indeed, a diverse and
seemingly unrelated range of phenotypes resulted from mutation of all1758. For instance, the
delay in heterocyst formation in UHM184 may suggest the involvement of all1758 in the timing of
heterocyst morphology development. The diminutive cell size and associated decrease in cell
volume apparent upon mutation of all1758 may be indicative of a change in the timing of cell
division in the mutant, which would prevent the cell from attaining a normal and/or enlarged cell
size. Inhibition of cell division has been shown to prevent differentiation of heterocysts, and
heterocysts have twice the DNA content of vegetative cells [77, 78]. The increased rate of cell
division in strains lacking all1758 may account for the defect in heterocyst differentiation in the
mutant. The location of all1758 between the cell division genes ftsX and ftsY may implicate
all1758 as a cell division gene as well. In Escherichia coli, for example, the cell division gene ftsE
(b3463) lies between ftsX (b3462) and ftsY (b3464). Or All1758 may have a role in activating the
120
cell division machinery. Levels of YFP corresponding to FtsZ, and the inhibitors of FtsZ (the
proteins MinC and MinD) were very low in all1758-deficient strains, despite the contrasting roles
of these proteins. Additionally, in Bacillus subtilis, localization of SpoIIE at the midcell (referred to
as the ‘E ring’; the E ring colocalizes with the Z-ring) is controlled by FtsZ[59, 79]. While this
phenomenon was not tested in Anabaena, it may be fruitful to determine if FtsZ regulates All1758,
and explore the direct interaction between these proteins by bacterial two-hybrid assays.
Alternatively, a defect in a process specific to heterocyst differentiation may influence cell division.
Also, the decrease in cell volume may have perturbed the concentration of specific intracellular
components, resulting in the observed phenotypes. This explanation has been used to describe
the process of sporulation in Bacillus. Despite localization of SpoIIE to both faces of the
sporulation septum, the smaller volume of the forespore leads to a higher concentration of
phosphatase activity in this structure[80]. The relationship between cell division and heterocyst
differentiation remains enigmatic.
Unpatterned expression of all1758 in all cells was evident under both nitrate-replete and depleted
conditions using a GFP transcriptional reporter fusion, suggesting that the gene is constitutively
expressed. In contrast, GFP-dependent fluorescence was not observed from an all1758
translational fusion in all background strains tested. However, the fusion protein did appear to
complement strain UHM184, suggesting the fusion protein was functional. The lack of detectable
fluorescence may indicate that levels of All1758 are very low in cells, and the associated
fluorescence from the fusion protein was below the level of detection, or the GFP portion of the
protein may have been non-functional. This phenomenon is not new. In our hands, plasmid
constructs bearing hetR-gfp and hetF-gfp translational fusions in hetR and hetF backgrounds,
respectively, also complement the inactivated gene, yet visible fluorescence is lacking[22]. Also,
plasmids bearing PhetZ-hetZ-patU5-patU3 and PhetZ-hetZ-patU5-patU3-gfp functionally inhibit
heterocyst formation in the wild-type, but GFP fluorescence is below the level of detection with
the latter plasmid (Chapter 2).
To understand the relationship between All1758 and HetR, post-translational control of All1758 by
HetR was investigated. HetR-GFP (and HetR-CFP; cerulean fluorescent protein) translational
fusions carried on a plasmid in the wild-type results in fluorescence below the level of detection.
Plasmid-borne copies of hetR-gfp in ∆all1758 strains result in punctate fluorescence, but the cells
aggregate, making it difficult to interpret the results (data not shown). To separate the roles of
these two proteins, strains with hetR-gfp (or hetR-cfp) encoded in the chromosome and all1758
deleted from the chromosome were constructed. In parent hetR-gfp (and hetR-cfp) strains (Table
3.1), GFP fluorescence was below the level of detection. No change in fluorescence intensity was
observed in hetR-gfp ∆all1758 and (hetR-cfp ∆all1758) strains (data not shown). The simplest
interpretation is that All1758 does not directly regulate HetR levels.
121
All1758 is required for normal cell size and cell growth. In double deletion or replacement strains
with deletions in all1758 (Table 3.1), the cell size and growth defect corresponding to ∆all1758 is
observed. Alterations in the levels of expression of other genes involved in heterocyst
differentiation have been shown to affect cell size. Inactivation of all2874, which encodes a
diguanylate cyclase results in a light intensity-dependent variability in heterocyst frequency and
reduction in vegetative cell size [81]. Conversely, a strain lacking hetF has enlarged cells, and
extra copies of hetF on a plasmid result in a diminutive cell phenotype [22]. In contrast with the
correlation between smaller cell size and a delay in heterocyst differentiation in the all1758
mutant, a strain with extra copies of hetF forms more heterocysts than the wild-type.
Overexpression of patA also results in enlarged cells [82]. There is no evidence for the
phosphorylation of HetF or PatA, but PatA is similar in sequence to response regulators of two-
component transduction systems [83].
Sequence homology to the PP2C phosphatases SpoIIE and RsbU may suggest a role for sigma
factor regulation by the PP2C phosphatase All1758. In this study, the hypothesized role of
All1758 in the regulation of a heterocyst-specific sigma factor was explored. The partner-switch
mechanism (Fig. 3.15) described for Bacillus and Staphylococcus involves different
phosphorylating states of sigma factor regulators to control regulons involved in sporulation and
stress response, respectively. A preliminary model to explain the genetic interactions between
putative sigma factor regulators, the heterocyst-development genes ntcA and hetR, and All1758
is proposed (Fig. 3.16). However these results represent a cursory study of sigma factor
regulation of heterocyst-specific gene expression and the model is speculative.
HetR appears to exhibit greater genetic control of all1758 than NtcA (Figs. 3.6, 3.7). Whereas
NtcA acts on the promoter of all1758, a direct interaction was shown between HetR and All1758.
Dual regulation by HetR and NtcA may fine-tune the temporal control of All1758 activity. In the
model as drawn, NtcA functions both as a negative and positive effector. NtcA (and HetR)
represses transcription of all1758 (the PP2C phosphatase) (Figures. 3.6, 3.7), but NtcA activates
transcription of all1087 (the anti-antisigma factor) (Fig. 3.12). The All1758-dependent
dephosphorylation of All1087 down-regulates All1087. This negative interaction between All1758
and All1087 deviates from the classical partner-switch model described for Bacillus and
Staphylococcus (Fig. 3.15). In the classical model, phosphatase-mediated dephosphorylation of
target anti-antisigma factors activates, rather than negatively regulates, the anti-antisigma factor.
Consistent with the classical model, All1087 negatively regulates its cognate partner, Alr3423 (an
antisigma factor with All1087-specific kinase activity) in the next stage of the partner-switch
mechanism. An additional mechanism is hypothesized to regulate Alr3423. In addition to
sequestration by All1087, an unidentified All1758-dependent protease is predicted to degrade
122
Alr3423. Degradation of the antisigma factor spoIIAB by the intracellular ClpCP protease
complex has been cited as a mechanism to compartmentalize σF (SigF) activity to the forespore
in Bacillus subtilis [84]. Here, the transient genetic asymmetry of alr3423 due to the All1758-
dependent protease may explain how the ∆all1758 phenotype is invoked in the wild-type upon
overexpression of alr3423.
The growing number of phosphatases and kinases implicated in heterocyst differentiation
indicates that protein phosphorylation plays a prominent role in the regulation of differentiation.
However, understanding the extent and nature of that role is dependent on uncovering the targets
of kinase and phosphatase activity. All1758 is not involved in pattern formation, and appears to
be involved in the later stages of heterocyst differentiation. The requirement of All1758 for normal
cell growth, cell division, morphology and development highlights the significance of
phosphatases in basic cellular processes. The complexities of phosphorylation in the regulation
of Anabaena development warrant further investigation.
Figure 3.15. Partner-switch model of sigma factor activation. (B) Regulation of σF
and σB in Bacillus subtilis and Staphylococcus aureus as typically depicted (bottom
panel; “•” indicates sigma factor sequestration, curved arrows represent direction of
cascading events) and shown with inhibitors (bars) and an activator (straight arrow)
of the pathway (top panel). (A) The preliminary model of interaction (detailed in
Figure 3.16) deviates from the classical pathway shown in (B).
123
Figure 3.16. A preliminary model for the regulation of heterocyst development by a
modified partner-switch mechanism. A speculative interpretation of the genetic
interactions between putative sigma factor regulators, a heterocyst-specific sigma factor, a
protease and the heterocyst-development genes ntcA and hetR with the PP2C
phosphatase All1758 is depicted. Dashed lines represent interaction with a hypothesized
protease. Inhibitors of the pathway represented with bars, activators represented with
arrows.
124
REFERENCES CITED
1. Murry, M.A. and C.P. Wolk, Evidence that the barrier to the penetration of oxygen into
heterocysts depends upon two layers of the cell envelope. Arch. Microbiol, 1989. 151: p.
469-474.
2. Meeks, J.C., et al., Pathways of assimilation of [13
N]N2 and 13
NH4+ by cyanobacteria with
and without heterocysts. J. Bacteriol., 1978. 134(1): p. 125-130.
3. Wolk, C.P., Movement of carbon from vegetative cells to heterocysts in Anabaena
cylindrica. J. Bacteriol., 1968. 96: p. 2138-2143.
4. Wolk, C.P., A. Ernst, and J. Elhai, Heterocyst metabolism and development, in The
Molecular Biology of Cyanobacteria, D.A. Bryant, Editor. 1994, Kluwer Academic
Publishers: Dordrecht, The Netherlands. p. 769-823.
5. Laurent, S., et al., Nonmetabolizable analogue of 2-oxoglutarate elicits heterocyst
differentiation under repressive conditions in Anabaena sp. PCC 7120. Proc. Natl. Acad.
Sci. U.S.A., 2005. 102: p. 9907-9912.
6. Vazquez-Bermudez, M.F., A. Herrero, and E. Flores, 2-Oxoglutarate increases the
binding affinity of the NtcA (nitrogen control) transcription factor for the Synechococcus
glnA promoter. FEBS letters, 2002. 512(1-3): p. 71-4.
7. Muro-Pastor, A.M., et al., Mutual dependence of the expression of the cell differentiation
regulatory protein HetR and the global nitrogen regulator NtcA during heterocyst
development. Mol. Microbiol., 2002. 44: p. 1377-1385.
8. Olmedo-Verd, E., et al., HetR-dependent and -independent expression of heterocyst-
related genes in an Anabaena strain overproducing the NtcA transcription factor. Journal
of bacteriology, 2005. 187(6): p. 1985-91.
9. Kennelly, P.J., Protein phosphatases--a phylogenetic perspective. Chem Rev, 2001.
101(8): p. 2291-312.
10. Cohen, P., The structure and regulation of protein phosphatases. Annu Rev Biochem,
1989. 58: p. 453-508.
11. Bork, P., et al., The protein phosphatase 2C (PP2C) superfamily: detection of bacterial
homologues. Protein Sci, 1996. 5(7): p. 1421-5.
12. Das, A.K., et al., Crystal structure of the protein serine/threonine phosphatase 2C at 2.0
A resolution. EMBO J, 1996. 15(24): p. 6798-809.
13. Barford, D., Molecular mechanisms of the protein serine/threonine phosphatases. Trends
Biochem Sci, 1996. 21(11): p. 407-12.
14. Wang, L., et al., Genomic analysis of protein kinases, protein phosphatases and two-
component regulatory systems of the cyanobacterium Anabaena sp. strain PCC 7120.
FEMS Microbiol Lett, 2002. 217(2): p. 155-65.
125
15. Ehira, S. and M. Ohmori, NrrA directly regulates expression of hetR during heterocyst
differentiation in the cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol., 2006.
188: p. 8520-8525.
16. Jang, J., et al., Mutual regulation of ntcA and hetR during heterocyst differentiation
requires two similar PP2C-type protein phosphatases, PrpJ1 and PrpJ2, in Anabaena sp.
strain PCC 7120. Journal of bacteriology, 2009. 191(19): p. 6059-66.
17. Cheng, Y., et al., A pair of iron-responsive genes encoding protein kinases with a Ser/Thr
kinase domain and a His kinase domain are regulated by NtcA in the Cyanobacterium
Anabaena sp. strain PCC 7120. Journal of bacteriology, 2006. 188(13): p. 4822-9.
18. Laurent, S., et al., Cell-type specific modification of PII is involved in the regulation of
nitrogen metabolism in the cyanobacterium Anabaena PCC 7120. FEBS letters, 2004.
576(1-2): p. 261-5.
19. Zhang, C.C., A. Friry, and L. Peng, Molecular and genetic analysis of two closely linked
genes that encode, respectively, a protein phosphatase 1/2A/2B homolog and a protein
kinase homolog in the cyanobacterium Anabaena sp. strain PCC 7120. Journal of
bacteriology, 1998. 180(10): p. 2616-22.
20. Saha, S.K. and J.W. Golden, Overexpression of pknE blocks heterocyst development in
Anabaena sp. strain PCC 7120. Journal of bacteriology, 2011. 193(10): p. 2619-29.
21. Orozco, C.C., D.D. Risser, and S.M. Callahan, Epistasis analysis of four genes from
Anabaena sp. strain PCC 7120 suggests a connection between PatA and PatS in
heterocyst pattern formation. J. Bacteriol., 2006. 188(5): p. 1808-1816.
22. Risser, D.D. and S.M. Callahan, HetF and PatA control levels of HetR in Anabaena sp.
strain PCC 7120. J. Bacteriol., 2008. 190: p. 7645-7654.
23. Shi, L., et al., Two genes encoding protein kinases of the HstK family are involved in
synthesis of the minor heterocyst-specific glycolipid in the cyanobacterium Anabaena sp.
strain PCC 7120. Journal of bacteriology, 2007. 189(14): p. 5075-81.
24. Jang, J., et al., PrpJ, a PP2C-type protein phosphatase located on the plasma membrane,
is involved in heterocyst maturation in the cyanobacterium Anabaena sp. PCC 7120.
Molecular microbiology, 2007. 64(2): p. 347-58.
25. Ning, D. and X. Xu, alr0117, a two-component histidine kinase gene, is involved in
heterocyst development in Anabaena sp. PCC 7120. Microbiology, 2004. 150(Pt 2): p.
447-53.
26. Ramirez, M.E., et al., Anabaena sp. strain PCC 7120 gene devH is required for synthesis
of the heterocyst glycolipid layer. Journal of bacteriology, 2005. 187(7): p. 2326-31.
27. Xu, W.L., et al., pkn22 (alr2502) encoding a putative Ser/Thr kinase in the
cyanobacterium Anabaena sp. PCC 7120 is induced by both iron starvation and oxidative
stress and regulates the expression of isiA. FEBS letters, 2003. 553(1-2): p. 179-82.
126
28. Espinosa, J., et al., DevT (Alr4674), resembling a Ser/Thr protein phosphatase, is
essential for heterocyst function in the cyanobacterium Anabaena sp. PCC 7120.
Microbiology, 2010. 156(Pt 12): p. 3544-55.
29. Hughes, K.T. and K. Mathee, The anti-sigma factors. Annu Rev Microbiol, 1998. 52: p.
231-86.
30. Duncan, L., et al., Activation of cell-specific transcription by a serine phosphatase at the
site of asymmetric division. Science, 1995. 270(5236): p. 641-4.
31. Delumeau, O., et al., Functional and structural characterization of RsbU, a stress
signaling protein phosphatase 2C. J Biol Chem, 2004. 279(39): p. 40927-37.
32. Brody, M.S., V. Stewart, and C.W. Price, Bypass suppression analysis maps the
signalling pathway within a multidomain protein: the RsbP energy stress phosphatase 2C
from Bacillus subtilis. Mol Microbiol, 2009. 72(5): p. 1221-34.
33. Risser, D.D. and S.M. Callahan, Mutagenesis of hetR reveals amino acids necessary for
HetR function in the heterocystous cyanobacterium Anabaena sp. strain PCC 7120. J.
Bacteriol., 2007. 189: p. 2460-2467.
34. Elhai, J. and C.P. Wolk, Conjugal transfer of DNA to cyanobacteria. Methods Enzymol.,
1988. 167: p. 747-754.
35. Fellay, R., J. Frey, and H. Krisch, Interposon mutagenesis of soil and water bacteria: a
family of DNA fragments designed for in vitro insertional mutagenesis of Gram-negative
bacteria. Gene, 1987. 52: p. 147-154.
36. Higa, K.C. and S.M. Callahan, Ectopic expression of hetP can partially bypass the need
for hetR in heterocyst differentiation by Anabaena sp. strain PCC 7120. Mol. Microbiol.,
2010. 77: p. 562-574.
37. Borthakur, P.B., et al., Inactivation of patS and hetN causes lethal levels of heterocyst
differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol.
Microbiol., 2005. 57: p. 111-123.
38. Ruppert, U., et al., The novel protein phosphatase PphA from Synechocystis PCC 6803
controls dephosphorylation of the signalling protein PII. Molecular microbiology, 2002.
44(3): p. 855-64.
39. Callahan, S.M. and W.J. Buikema, The role of HetN in maintenance of the heterocyst
pattern in Anabaena sp. PCC 7120. Mol. Microbiol., 2001. 40: p. 941-950.
40. Karimova, G., et al., A bacterial two-hybrid system based on a reconstituted signal
transduction pathway. Proc Natl Acad Sci U S A, 1998. 95(10): p. 5752-6.
41. van den Ent, F., et al., Dimeric structure of the cell shape protein MreC and its functional
implications. Mol Microbiol, 2006. 62(6): p. 1631-42.
42. Patrick, J.E. and D.B. Kearns, MinJ (YvjD) is a topological determinant of cell division in
Bacillus subtilis. Mol Microbiol, 2008. 70(5): p. 1166-79.
127
43. Buikema, W.J. and R. Haselkorn, Expression of the Anabaena hetR gene from a copper-
regulated promoter leads to heterocyst differentiation under repressing conditions. Proc.
Natl. Acad. Sci., U.S.A., 2001. 98: p. 2729-2734.
44. Nayar, A.S., et al., FraG is necessary for filament integrity and heterocyst maturation in
the cyanobacterium Anabaena sp. strain PCC 7120. Microbiology, 2007. 153: p. 601-607.
45. Callahan, S.M., unpublished.
46. Risser, D.D. and S.M. Callahan, Genetic and cytological evidence that heterocyst
patterning is regulated by inhibitor gradients that promote activator decay. Proc Natl Acad
Sci U S A, 2009. 106(47): p. 19884-8.
47. Wei, T.-F., R. Ramasubramanian, and J.W. Golden, Anabaena sp. strain PCC 7120 ntcA
gene required for growth on nitrate and heterocyst development. J. Bacteriol., 1994. 176:
p. 4473-4482.
48. Yoon, H.-S. and J.W. Golden, PatS and products of nitrogen fixation control heterocyst
pattern. J. Bacteriol., 2001. 183: p. 2605-2613.
49. Young-Robbins, S.S., et al., Transcriptional regulation of the heterocyst patterning gene
patA from Anabaena sp. strain PCC 7120. J. Bacteriol., 2010. 192: p. 4732-4740.
50. Higa, K.C. and S.M. Callahan, Ectopic expression of hetP can partially bypass the need
for hetR in heterocyst differentiation by Anabaena sp strain PCC 7120. Mol. Microbiol.,
2010. 77: p. 562-574.
51. Black, T.A., Y. Cai, and C.P. Wolk, Spatial expression and autoregulation of hetR, a gene
involved in the control of heterocyst development in Anabaena. Mol. Microbiol., 1993. 9: p.
77-84.
52. Lambein, F. and C.P. Wolk, Structural studies on the glycolipids from the envelope of the
heterocyst of Anabaena cylindrica. Biochemistry, 1973. 12: p. 791-798.
53. Soriente, A., et al., Reinvestigation of heterocyst glycolipids from the cyanobacterium,
Anabaena cylindrica. Phytochemistry (Oxford), 1994. 38(3): p. 641-645.
54. Gambacorta, A., et al., Heterocyst glycolipids from five nitrogen-fixing cyanobacteria.
Gazz. Chim. Ital., 1996. 126: p. 653-656.
55. Leganés, F., et al., Wide variation in the cyanobacterial complement of presumptive
penicillin-binding proteins. Arch. Microbiol., 2005. 184: p. 234-248.
56. Callahan, S.M. and W.J. Buikema, The role of HetN in maintenance of the heterocyst
pattern in Anabaena sp. PCC 7120. Molecular microbiology, 2001. 40(4): p. 941-50.
57. Frias, J.E., E. Flores, and A. Herrero, Nitrate assimilation gene cluster from the
Heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol., 1997.
179: p. 477-486.
128
58. Vazquez-Bermudez, M.F., E. Flores, and A. Herrero, Analysis of binding sites for the
nitrogen-control transcription factor NtcA in the promoters of Synechococcus nitrogen-
regulated genes. Biochim Biophys Acta, 2002. 1578(1-3): p. 95-8.
59. Levin, P.A., et al., Localization of the sporulation protein SpoIIE in Bacillus subtilis is
dependent upon the cell division protein FtsZ. Mol Microbiol, 1997. 25(5): p. 839-46.
60. Errington, J., R.A. Daniel, and D.J. Scheffers, Cytokinesis in bacteria. Microbiol Mol Biol
Rev, 2003. 67(1): p. 52-65, table of contents.
61. Hu, Z., et al., The MinC component of the division site selection system in Escherichia
coli interacts with FtsZ to prevent polymerization. Proc Natl Acad Sci U S A, 1999. 96(26):
p. 14819-24.
62. Dajkovic, A., et al., MinC spatially controls bacterial cytokinesis by antagonizing the
scaffolding function of FtsZ. Curr Biol, 2008. 18(4): p. 235-44.
63. Hu, Z., E.P. Gogol, and J. Lutkenhaus, Dynamic assembly of MinD on phospholipid
vesicles regulated by ATP and MinE. Proc Natl Acad Sci U S A, 2002. 99(10): p. 6761-6.
64. Johnson, J.E., L.L. Lackner, and P.A. de Boer, Targeting of (D)MinC/MinD and
(D)MinC/DicB complexes to septal rings in Escherichia coli suggests a multistep
mechanism for MinC-mediated destruction of nascent FtsZ rings. J Bacteriol, 2002.
184(11): p. 2951-62.
65. Adams, D.W. and J. Errington, Bacterial cell division: assembly, maintenance and
disassembly of the Z ring. Nat Rev Microbiol, 2009. 7(9): p. 642-53.
66. Khvorova, A., et al., The spoIIE locus is involved in the Spo0A-dependent switch in the
location of FtsZ rings in Bacillus subtilis. J Bacteriol, 1998. 180(5): p. 1256-60.
67. Kennelly, P.J., Protein phosphatases--a phylogenetic perspective. Chemical reviews,
2001. 101(8): p. 2291-312.
68. Carniol, K., et al., Insulation of the sigmaF regulatory system in Bacillus subtilis. J
Bacteriol, 2004. 186(13): p. 4390-4.
69. Pane-Farre, J., et al., Role of RsbU in controlling SigB activity in Staphylococcus aureus
following alkaline stress. J Bacteriol, 2009. 191(8): p. 2561-73.
70. Feucht, A., et al., Bifunctional protein required for asymmetric cell division and cell-
specific transcription in Bacillus subtilis. Genes Dev, 1996. 10(7): p. 794-803.
71. Hecker, M., J. Pane-Farre, and U. Volker, SigB-dependent general stress response in
Bacillus subtilis and related gram-positive bacteria. Annu Rev Microbiol, 2007. 61: p. 215-
36.
72. Giachino, P., S. Engelmann, and M. Bischoff, Sigma(B) activity depends on RsbU in
Staphylococcus aureus. J Bacteriol, 2001. 183(6): p. 1843-52.
73. Mella-Herrera, R.A., et al., The sigE gene is required for normal expression of heterocyst-
specific genes in Anabaena sp. strain PCC 7120. J Bacteriol, 2011. 193(8): p. 1823-32.
129
74. Aldea, M.R., R.A. Mella-Herrera, and J.W. Golden, Sigma factor genes sigC, sigE and
sigG are upregulated in heterocysts of the cyanobacterium Anabaena sp. strain PCC
7120. J. Bacteriol., 2007. 189: p. 8392-8396.
75. Lee, D.J., S.D. Minchin, and S.J. Busby, Activating transcription in bacteria. Annu Rev
Microbiol, 2012. 66: p. 125-52.
76. Lucet, I., et al., Direct interaction between the cell division protein FtsZ and the cell
differentiation protein SpoIIE. EMBO J, 2000. 19(7): p. 1467-75.
77. Sakr, S., et al., Inhibition of cell division suppresses heterocyst development in Anabaena
sp. strain PCC 7120. J. Bacteriol., 2006. 188: p. 1396-1404.
78. Sakr, S., et al., Relationship among several key cell cycle events in the developmental
cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol., 2006. 188: p. 5958-5965.
79. Barak, I. and P. Youngman, SpoIIE mutants of Bacillus subtilis comprise two distinct
phenotypic classes consistent with a dual functional role for the SpoIIE protein. J
Bacteriol, 1996. 178(16): p. 4984-9.
80. Barak, I. and A.J. Wilkinson, Where asymmetry in gene expression originates. Mol
Microbiol, 2005. 57(3): p. 611-20.
81. Neunuebel, M.R. and J.W. Golden, The Anabaena sp. strain PCC 7120 gene all2874
encodes a diguanylate cyclase and is required for normal heterocyst development under
high-light growth conditions. J Bacteriol, 2008. 190(20): p. 6829-36.
82. Young-Robbins, S.S., et al., Transcriptional regulation of the heterocyst patterning gene
patA from Anabaena sp. strain PCC 7120. J. Bacteriol., 2010. 192: p. 4732-4740.
83. Liang, J., L. Scappino, and R. Haselkorn, The patA gene product, which contains a
region similar to CheY of Escherichia coli, controls heterocyst pattern formation in the
cyanobacterium Anabaena 7120. Proc. Natl. Acad. Sci, USA, 1992. 89: p. 5655-5659.
84. Pan, Q., D.A. Garsin, and R. Losick, Self-reinforcing activation of a cell-specific
transcription factor by proteolysis of an anti-sigma factor in B. subtilis. Mol Cell, 2001.
8(4): p. 873-83.
130
CHAPTER 4. OVERACTIVE ALLELES OF HETR IN THE CYANOBACTERIUM ANABAENA
SP. STRAIN PCC 7120
INTRODUCTION
Composed of only two cell types under specific environmental conditions, the vegetative cell and
the differentiated heterocyst cell, Anabaena sp. strain PCC 7120 (herein Anabaena) represents
one of the most basic multicellular states present in nature. Anabaena executes the complexities
of developmental patterning common to higher organisms in a linear arrangement. The
assignment of cell type involves interaction between key developmental genes in response to a
starvation signal. Deprivation of nitrogen induces the regulatory cascade of heterocyst
differentiation in Anabaena. While each cell has the potential to become a differentiated cell, only
a subset of cells in Anabaena develops into a heterocyst. Moreover these heterocyst cells only
form at regular intervals (at an approximate frequency of one heterocyst per ten vegetative cells).
How genetically uniform cells diverge into different cell types and form a pattern is a central
question in developmental biology.
The activator-inhibitor model [1] has been applied to the molecular regulation of periodic
patterning in developmental systems including Anabaena. Central to this model is the dual role of
the activator, HetR, in this process. HetR auto-catalysis leads to the production of more HetR,
leading to self-enhancement of this activating signal, but simultaneously also produces the early-
stage developmental inhibitor, PatS, and the late-stage inhibitor, HetN. These two inhibitory
proteins, although temporally-restricted to different stages of development, contain the same
RGSGR-pentapeptide (“PatS-5”) motif in their primary sequence. The PatS peptide is
responsible for de novo pattern formation. Subsequent catalytic feedback between the activator
HetR and the inhibitor PatS leads to a spatial difference in the concentrations of both. Thus HetR
and PatS cooperatively reinforce random differences in HetR levels observed in each cell. The
distance between clusters of induced cells is a product of both the extent of intercellular transfer
of PatS and the corresponding effect on HetR. Across the filament, groups of cells are primed for
differentiation, but not in any predictable pattern. Over time, the groups of cells are arranged into
a periodic pattern foreshadowing the ultimate spacing of the differentiated cells. Eventually the
intervals of cell clusters resolve to a single cell which becomes the heterocyst. Whereas the
pattern is initiated by PatS, maintenance of the pattern of ten relies on lateral hetN-dependent
inhibition originating from differentiated cells. HetN concentration, and consequently HetN-
dependent inhibition of heterocyst formation, is inversely related to distance from heterocysts. As
cell division occurs in undifferentiated cells, the intervals between heterocysts are increased, and
HetN concentrations reach levels that no longer inhibit differentiation. Heterocysts arise at HetN-
131
concentration minima, following catalytic feedback between HetR and PatS, to restore the
periodic pattern.
Protein-mediated interplay between the developmental regulators HetR, PatS and HetN regulate
Anabaena development. HetR is essential in coordinating heterocyst development[2]. However,
the primary sequence of HetR does not show similarity to protein domains of known biological
function. Structural comparisons of HetR suggest that the N-terminal DNA-binding unit is related
to other DNA-binding proteins[3], consistent with its role in the transcriptional activation of
thousands of genes related to heterocyst development. The unique folds present in the structure
of HetR may to function as a physical scaffold for the organization of factors (RNA, RNA
polymerase and other proteins and peptides) necessary for the transcription of heterocyst-
development genes[3]. A genetic approach was used to identify interactions between HetR and
PatS-5, PatS, and HetN in an effort to further understand the molecular regulation of heterocyst
differentiation in Anabaena. Residues that contributed to the functional overactivity of HetR,
manifested as the enhanced activation of heterocyst formation irrespective of inhibitor
concentrations, were isolated. The region of HetR spanning amino acids 250-256 was found in
this study to be necessary for sensitivity of HetR to PatS-5. In addition, seven residues in HetR
were identified as necessary for function as part of a mutagenesis study.
MATERIALS AND METHODS
Bacterial strains and growth conditions. Descriptions of strains constructed in this study are
summarized in Table 4.1. Growth of Escherichia coli and Anabaena sp. strain PCC 7120 and its
derivatives, concentrations of antibiotics; induction of heterocyst formation in BG-110 medium,
which lacks a combined-nitrogen source; regulation of PpetE and Pnir expression; and conditions
for photomicroscopy were as previously described [4]. Images were processed in Adobe
Photoshop CS2.
Construction of plasmids. Descriptions of plasmids constructed in this study are summarized
in Table 4.2 and oligonucleotides relevant to this study are summarized in Table 4.3. Constructs
derived by PCR were sequenced to verify the integrity of the sequence.
Plasmids for making chromosomal alleles
Plasmids pST121, pST122, pST117, pST119, pST131, pST132, pST133, pST185, pST135,
pST143, pST144, pST145 and pST134 are suicide vectors used to replace the chromosomal
hetR-locus with hetR(Y51C), hetR(P206S), hetR(Y51F), hetR(Y51H), hetR(Q59P), hetR(D230G),
132
hetR(E56G) and hetR(C48R), hetR(L162I), hetR(Q59E), hetR(D230E), hetR(E56D) and
hetR(C48L), respectively. To generate each of the mutant hetR alleles, overlap extension PCR
was performed using the inner primers listed in Table 4.3 (primer numbers 4 to 27) with names
corresponding to that of the resulting substitution with the outer primers PhetR-BamHI-F and
hetR-SacI-SpeI-R. The resulting PCR products were cloned into plasmid pDR327 as NcoI−SpeI
fragments to create plasmids pST121, pST122, pST117, pST119, pST131, pST132, pST133,
pST185, pST135, pST143, pST144, pST145 and pST134.
Plasmids pJM100, pJM101, pJM102, pJM103, pST211, pJM104, pJM105 and pDR219 are
suicide vectors used to replace the chromosomal hetR-locus with hetR(R250K), hetR(A251G),
hetR(L252V), hetR(E253D), hetR(E254D), hetR(L255V), hetR(D256E) and hetR(E254G),
respectively. Overlap extension PCR was used to generate each of the mutant hetR alleles
except hetR(E254D) and hetR(E254G) that used the inner primers listed in Table 4.3 (primer
numbers 28 to 41) with names corresponding to that of the resulting substitution with the outer
primers PhetR-BamHI-F and hetR 3′ Seq. The resulting PCR products were cloned into plasmid
pDR327 as NcoI−SpeI fragments to create plasmids pJM100, pJM101, pJM102, pJM103,
pJM104, and pJM105. Plasmids pST211 and pDR219 were generated in a similar fashion, but
outer primer hetR-SacI-SpeI-R was used in place of hetR 3′ seq for pST211 and previously
published inner primers [4] were used to create hetR(E254G) in pDR219.
Plasmids pST376, pST377, pST378, pST379, pST380, pST381 and pST382 are suicide vectors
used to replace the chromosomal hetR-locus with PpetE-hetR(Y51C)-cfp, PpetE-hetR(P206S)-cfp,
PpetE-hetR(Q59P)-cfp, PpetE-hetR(D230G)-cfp, PpetE-hetR(C48R)-cfp, PpetE-hetR(L162I)-cfp,
respectively. To generate each of the mutant hetR alleles, primers PpetE-NcoI-F and cfp-SpeI-R
were used along with plasmids pST235, pST236, pST237, pST238, pST239, pST240 and
pST241 as template DNA for the reaction. The resulting PCR products were cloned directly into
plasmid pDR325 as NcoI−SpeI fragments to create plasmids pST376, pST377, pST378, pST379,
pST380, pST381 and pST382.
Plasmids for mutagenesis studies
A blunt end procedure was used to inactivate the BamHI site on plasmid pDR197 (bearing PpetE-
patS) to generate plasmid pST100 as an intermediate construct to create plasmid pST102.
Plasmid pST102 bears a transcriptional fusion between patS and the petE promoter. Using
primers PpetE-S-F and PpetE-S(ApR)-R, a 416-bp region containing PpetE-patS was amplified
from pST100 and cloned as an EcoRI fragment into pAM505 to yield pST102.
133
Plasmid pST103 bears PpetE-patS oriented divergently with PhetR-hetR. An 1848-bp fragment
containing PhetR-hetR was amplified from the chromosome using primers hetR-F-BamHI and
hetR-R-SacI and cloned into pST102 to generate pST103.
Multicopy plasmids
The mobilizable shuttle vectors plasmid pST125, pST126 and pST127 carrying hetR(Q59E),
hetR(D230E) and hetR(E56D) respectively were created by moving fragments containing each
hetR allele under the control of PhetR as BamHI−SacI fragments from pST143, pST144 and
pST145 into pAM504 to create pST125, pST126 and pST127.
Plasmids pST128, pST129, pST130 carrying hetR(Q59E), hetR(D230E) and hetR(E56D)
respectively were created by moving fragments containing each hetR allele under the control of
PhetR as BamHI−SacI fragments pST143, pST144 and pST145 into pST102 (bearing PpetE-patS)
to create pST128, pST129 and pST130.
Translational fusion constructs
Plasmids pST193, pST194, pST195, pST196, pST197, pST198, pST199, pST200, pST217,
pST218, pST219, pST220, pST221 and pST201 carry translational fusions to gfp with
hetR(Y51C), hetR(P206S), hetR(Y51F), hetR(Y51H), hetR(Q59P), hetR(D230G), hetR(E56G),
hetR(C48R), hetR(L162I), hetR(R250K), hetR(A251G), hetR(L252V), hetR(E253D),
hetR(E254D), hetR(L255V) and hetR(D256E), respectively, under the control of the petE
promoter. To generate each of the mutant hetR alleles, overlap extension PCR was performed
using pDR293 as template and the inner primers listed in Table 4.3 (primer numbers 4-7, 12-19,
28-41) with names corresponding to that of the resulting substitution with the outer primers
PhetR-BamHI-F and hetR-SmaI-R. The resulting PCR products were ligated into the EcoRV site
of pBluescript SK+ to make pST202, pST203, pST204, pST205, pST206, pST207, pST208,
pST209, pST222, pST223, pST224, pST225, pST226 and pST210 and subsequently moved as
BamHI−SmaI fragments into pSMC232 to create plasmids pST193, pST194, pST195, pST196,
pST197, pST198, pST199, pST200, pST217, pST218, pST219, pST220, pST221 and pST201.
Plasmids pST235, pST236, pST237, pST238, pST239, pST240, pST241, pST228, pST229,
pST230, pST231, pST232, pST233 and pST234 carry translational fusions to cfp with
hetR(Y51C), hetR(P206S), hetR(Y51F), hetR(Y51H), hetR(Q59P), hetR(D230G), hetR(E56G)
and hetR(C48R), hetR(L162I), hetR(R250K), hetR(A251G), hetR(L252V), hetR(E253D),
hetR(E254D), hetR(L255V) and hetR(D256E), respectively, under the control of the petE
134
promoter. Fragments containing PpetE-hetR(mutant) were moved from plasmids pST193,
pST194, pST195, pST196, pST197, pST198, pST199, pST200, pST217, pST218, pST219,
pST220, pST221 and pST201 as BamHI−SmaI fragments into pSMC242 to create plasmids
pST235, pST236, pST237, pST238, pST239, pST240, pST241, pST228, pST229, pST230,
pST231, pST232, pST233 and pST234.
Plasmids pST276, pST277, pST278, pST279, pST280, pST281, pST282, pST269, pST270,
pST271, pST272, pST273, pST274 and pST275 carry translational fusions to cfp with
hetR(Y51C), hetR(P206S), hetR(Y51F), hetR(Y51H), hetR(Q59P), hetR(D230G), hetR(E56G)
and hetR(C48R), hetR(L162I), hetR(R250K), hetR(A251G), hetR(L252V), hetR(E253D),
hetR(E254D), hetR(L255V) and hetR(D256E), respectively, under the control of the petE
promoter. Fragments containing PpetE-hetR(mutant)-cfp were moved from plasmids pST235,
pST236, pST237, pST238, pST239, pST240, pST241, pST228, pST229, pST230, pST231,
pST232, pST233 and pST234 as BamHI−SacI fragments into pCO100 to create plasmids
pST276, pST277, pST278, pST279, pST280, pST281, pST282, pST269, pST270, pST271,
pST272, pST273, pST274 and pST275.
Protein expression vectors
The pET26b (Novagen) derivatives, pST307 to pST313 were constructed to overexpress
hetR(R250K) to hetR(D256E) in E. coli and facilitate protein purification. A 900-bp region
containing the coding region for hetR was amplified from the chromosome using primers hetR F
NdeI express and hetR R XhoI express and plasmids pST200, pST217, pST218, pST219,
pST220, pST221 and pST201 as template DNA for the reaction. The fragments were ligated into
the EcoRV site of pBluescript SK+ to make pST300, pST301, pST302, pST303, pST304,
pST305, pST306. The region corresponding to the hetR substitution was moved individually as
NdeI-XhoI fragments from pST300 to pST306 into pET26b to generate pST307 to pST313.
Construction of strains containing mutant alleles
Descriptions of strains constructed in this study are summarized in Table 4.1. Replacements of
chromosomal DNA was performed as previously described [5]. All strains were screened via
colony PCR with primers annealing outside of the chromosomal region introduced on the suicide
plasmids used for strain construction and tested for sensitivity and resistance to the appropriate
antibiotics.
135
Strains of Anabaena with mutant alleles of hetR in place of wild-type hetR(R250) to hetR(D256)
region were created using the hetR-deletion strain UHM103 and plasmids pJM100, pJM101,
pJM102, pJM103, pST211, pJM104, pJM105, and pDR219 to generate strains UHM163,
UHM164, UHM165, UHM166 and UHM318, UHM167 and UHM331, UHM168, UHM169,
UHM122, respectively. Strains UHM166 and UHM167 (hetR(E253D) and hetR(E254D)
respectively) are single recombinants in which the entire plasmid is in the hetR chromosomal
locus, whereas UHM318 and UHM331 (also hetR(E253D) and hetR(E254D)) and the other
strains are the same as PCC 7120 except for the change in hetR sequence.
Strains of Anabaena with mutant alleles of hetR in place of wild-type hetR(Y51C), hetR(P206S),
hetR(Y51F), hetR(Y51H), hetR(Q59P), hetR(D230G), hetR(E56G) and hetR(C48R), hetR(L162I),
hetR(Q59E), hetR(D230E), hetR(E56D) and hetR(C48L) were created using the hetR-deletion
strain UHM103 and plasmids pST121, pST122, pST117, pST119, pST131, pST132, pST133,
pST185, pST135, pST143, pST144, pST145 and pST134 to generate strains UHM179, UHM182,
UHM180, UHM181 and UHM170, UHM171, UHM172, UHM173, UHM174, UHM175, UHM176,
UHM177 and UHM178 respectively.
Strains of Anabaena with mutant alleles of hetR(Y51C), hetR(P206S), hetR(Q59P),
hetR(D230G), hetR(E56G) and hetR(C48R), hetR(L162I) driven by PpetE and translationally fused
to cfp were to be created using the hetR-deletion strain and the hetR- patA-deletion strain with
plasmids pST376, pST377, pST378, pST379, pST380, pST381 and pST382, respectively.
Strains UHM304, UHM305, UHM306 and UHM307 were generated using the hetR-deletion strain
and plasmids pST376, pST378, pST380 and pST381. Strain UHM308 was made using the hetR-
patA-deletion strain with plasmid pST381.
Deletion of the alr9018 coding region was performed using plasmids pSMC237 and Anabaena
sp. strain PCC 7120 to yield strains Δalr9018 with Ω cassette (UHM188), respectively. The
resultant strains were screened via colony PCR with primers alr9018 flank up F and alr9018 flank
down R, which anneal outside the chromosomal region introduced onto pSC237 for deletion of
alr9018, and tested for sensitivity and resistance to the appropriate antibiotics.
Mutagenesis studies
To create a library of mutations in the coding region of hetR, error-prone PCR was performed on
plasmid pDR204 (with primers 505-BamHI and 505-SacI) using a previously described method to
generate 0.5 mutations/kb[4], but with the exception of 2 mM dNTPs. Error-prone PCR of the
region carrying Pnir-hetR on plasmid pDR204 was subsequently moved into plasmids pST102 and
136
pAM505 and stored for conjugation. Introduction of the mutated pST102 plasmids into ∆hetR is
used for isolation of patS-bypass mutants of HetR, and similarly mutations present on plasmid
pAM505 introduced into pN∆hetR is used for isolation of hetN-bypass mutants of HetR.
The hypermutator Escherichia coli strain XL1-RED was employed to create a library of mutations
within plasmids pST103 and pDR138 in a method described previously[4]. The library of
mutations in plasmid pST103 was introduced into ∆hetR via conjugation. Similarly, the library of
mutations in plasmid pDR138 was introduced into strains pN and pN∆hetR via conjugation.
In vivo PatS-5 sensitivity assays
Duplicate cultures of Anabaena sp. strain PCC 7120 and the hetR mutant strains (UHM163,
UHM162, UHM165, UHM166, UHM167, UHM168 and UHM169) were grown to an approximate
optical density of 0.4 at 750 nm in BG-11 medium, which contains nitrate, a fixed form of nitrogen.
For one set of cultures, the culture medium was replaced with fresh BG-11, and replaced
thereafter every 48 h with BG-110, which lacks fixed nitrogen. For the other set of cultures, PatS-5
was included in the medium at a concentration of 1 μM. The percentage of 500 cells that were
heterocysts was determined microscopically and recorded after each change of medium. Reported
values are the average of three replicates with one standard deviation. Conditions for
photomicroscopy were as described previously[4]
137
Table 4.1. Bacterial strains used in Chapter 4
Anabaena sp. strain
Relevant characteristic(s) Source or reference
PCC 7120 Wild-type Pasteur culture collection
7120PN PCC 7120 with PhetN-hetN replaced by PpetE-hetN [6]
UHM110 Strain 7120PN with deletion in hetR [7]
UHM103 hetR-deletion strain [5]
UHM109 hetR-, patA-deletion strain [7]
UHM132 hetR-, hetF-deletion strain [8]
UHM135 patA-, hetF-deletion strain [8]
UHM101 patA-deletion strain [7]
UHM114 patS-deletion strain [5]
UHM179 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(Y51C)
This study
UHM182 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(P206S)
This study
UHM180 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(Y51F)
This study
UHM181 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(Y51H)
This study
UHM170 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(Q59P)
This study
UHM171 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(D230G)
This study
UHM172 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(E56G)
This study
UHM173 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(C48R)
This study
UHM174 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(L162I)
This study
UHM175 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(Q59E)
This study
UHM176 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(D230E)
This study
UHM177 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(E56D)
This study
UHM178 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(C48L)
This study
UHM163 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(R250K)
[9]; This study
UHM164 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(A251G)
[9]; This study
UHM165 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(L252V)
[9]; This study
UHM166 Plasmid pJM103 recombined into the hetR locus of strain UHM103
[9]; This study
UHM318 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(E253D)
This study
138
Table 4.1. (Continued) Bacterial strains used in Chapter 4
Anabaena sp. strain
Relevant characteristic(s) Source or reference
UHM167 Plasmid pST211 recombined into the hetR locus of strain UHM103
[9]; This study
UHM331 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(E254D)
This study
UHM168 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(L255V)
[9]; This study
UHM169 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(D256G)
[9]; This study
UHM122 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(E254G)
[4]
UHM304 hetR-deletion strain with chromosomal PhetR-hetR replaced by PpetE-hetR(Y51C)-cfp
This study
UHM305 hetR-deletion strain with chromosomal PhetR-hetR replaced by PpetE-hetR(Q59P)-cfp
This study
UHM306 hetR-deletion strain with chromosomal PhetR-hetR replaced by PpetE-hetR(E56G)-cfp
This study
UHM307 hetR-deletion strain with chromosomal PhetR-hetR replaced by PpetE-hetR(C48R)-cfp
This study
UHM308 hetR- patA-deletion strain with chromosomal PhetR-hetR replaced by PpetE-hetR(C48R)-cfp
This study
UHM188 alr9018 replaced by Ω cassette This study
139
Table 4.2. Plasmids used in Chapter 4
Plasmids Relevant characteristic(s) Source or reference
pAM504 Mobilizable shuttle vector for replication in E. coli and Anabaena; Km
r Neo
r [10]
pCO100 Mobilizable shuttle vector based on pAM504 for replication in E. coli and Anabaena; Sm
r Sp
r
[11]
pDR197 pBluescript SK+ bearing PpetE-patS [11]
pDR138 pAM504 carrying PhetR-hetR [12]
pDR204 pAM504 carrying Pnir-hetR [11]
pDR211 pAM504 carrying PpetE-patS [13]
pDR320 pAM504 carrying PpetE-hetN [13]
pDR219 Suicide vector carrying PhetR-hetR(E254G) [4]
pDR293 pSMC232 carrying PpetE-hetR [8]
pDR325 Suicide plasmid based on pRL277, carrying hetR [11]
pDR327 Suicide plasmid based on pRL277, carrying PpetE-hetR-gfp [13]
pET28b Expression vector for generating polyhistidine epitope-tagged proteins; Km
r
Novagen
pRL277 Suicide vector; Smr Sp
r [14]
pSMC232 pAM504 bearing promotorless gfp for translational fusions [8]
pSMC242 pAM504 bearing promotorless cfp for translational fusions [8]
pSMC237 Suicide plasmid based on pRL278, carrying alr9018 [11]
pST100 pBluescript SK+ bearing PpetE-patS and inactivated BamHI restriction site
This study
pST102 pAM505 bearing PpetE-patS This study
pST103 pST102 bearing PhetR-hetR This study
pST121 Suicide vector carrying PhetR-hetR(Y51C) This study
pST122 Suicide vector carrying PhetR-hetR(P206S) This study
pST117 Suicide vector carrying PhetR-hetR(Y51F) This study
pST119 Suicide vector carrying PhetR-hetR(Y51H) This study
pST131 Suicide vector carrying PhetR-hetR(Q59P) This study
pST132 Suicide vector carrying PhetR-hetR(D230G) This study
pST133 Suicide vector carrying PhetR-hetR(E56G) This study
pST185 Suicide vector carrying PhetR-hetR(C48R) This study
pST135 Suicide vector carrying PhetR-hetR(L162I) This study
pST143 Suicide vector carrying PhetR-hetR(Q59E) This study
pST144 Suicide vector carrying PhetR-hetRD230E) This study
pST145 Suicide vector carrying PhetR-hetR (E56D) This study
pST134 Suicide vector carrying PhetR-hetR(C48L) This study
pJM100 Suicide vector carrying PhetR-hetR(R250K) [9]
pJM101 Suicide vector carrying PhetR-hetR(A251G) [9]
pJM102 Suicide vector carrying PhetR-hetR(L252V) [9]
pJM103 Suicide vector carrying PhetR-hetR(E253D) [9]
pST211 Suicide vector carrying PhetR-hetR(E254D) [9]
pJM104 Suicide vector carrying PhetR-hetR(L255V) [9]
140
Table 4.2. (Continued) Plasmids used in Chapter 4
Plasmids Relevant characteristic(s) Source or reference
pJM105 Suicide vector carrying PhetR-hetR(D256E) [9]
pST376 Suicide vector carrying PhetR-hetR(Y51C)-cfp This study
pST377 Suicide vector carrying PhetR-hetR(P206S)-cfp This study
pST378 Suicide vector carrying PhetR-hetR(Q59P)-cfp This study
pST379 Suicide vector carrying PhetR-hetR(D230G)-cfp This study
pST380 Suicide vector carrying PhetR-hetR(E56G)-cfp This study
pST381 Suicide vector carrying PhetR-hetR(C48R)-cfp This study
pST382 Suicide vector carrying PhetR-hetR(L162I)-cfp This study
pST108 pAM504 carrying PhetR-hetR (1-402) This study
pST109 pAM504 carrying PhetR-hetR (1-528) This study
pST121 pAM504 carrying PhetR-hetR(Y51C) This study
pST122 pAM504 carrying PhetR-hetR(P206S) This study
pST104 pAM504 carrying PhetR-hetR(Y51F) This study
pST105 pAM504 carrying PhetR-hetR(Y51H) This study
pST125 pAM504 carrying PhetR-hetR(Q59E) This study
pST126 pAM504 carrying PhetR-hetR(D230E) This study
pST127 pAM504 carrying PhetR-hetR(E56D) This study
pST128 pST102 carrying PhetR-hetR(Q59E) This study
pST129 pST102 carrying PhetR-hetR(D230E) This study
pST130 pST102 carrying PhetR-hetR(E56D) This study
pST193 pSMC232 carrying PhetR-hetR(Y51C) This study
pST194 pSMC232 carrying PhetR-hetR(P206S) This study
pST195 pSMC232 carrying PhetR-hetR(Q59P) This study
pST196 pSMC232 carrying PhetR-hetR(D230G) This study
pST197 pSMC232 carrying PhetR-hetR(E56G) This study
pST198 pSMC232 carrying PhetR-hetR(C48R) This study
pST199 pSMC232 carrying PhetR-hetR(L162I) This study
pST200 pSMC232 carrying PhetR-hetR(R250K) This study
pST217 pSMC232 carrying PhetR-hetR(A251G) This study
pST218 pSMC232 carrying PhetR-hetR(L252V) This study
pST219 pSMC232 carrying PhetR-hetR(E253D) This study
pST220 pSMC232 carrying PhetR-hetR(E254D) This study
pST221 pSMC232 carrying PhetR-hetR(L255V) This study
pST201 pSMC232 carrying PhetR-hetR(D256G) This study
pST235 pSMC242 carrying PhetR-hetR(Y51C) This study
pST236 pSMC242 carrying PhetR-hetR(P206S) This study
pST237 pSMC242 carrying PhetR-hetR(Q59P) This study
pST238 pSMC242 carrying PhetR-hetR(D230G) This study
pST239 pSMC242 carrying PhetR-hetR(E56G) This study
pST240 pSMC242 carrying PhetR-hetR(C48R) This study
141
Table 4.2. (Continued) Plasmids used in Chapter 4
Plasmids Relevant characteristic(s) Source or reference
pST241 pSMC242 carrying PhetR-hetR(L162I) This study
pST228 pSMC242 carrying PhetR-hetR(R250K) This study
pST229 pSMC242 carrying PhetR-hetR(A251G) This study
pST230 pSMC242 carrying PhetR-hetR(L252V) This study
pST231 pSMC242 carrying PhetR-hetR(E253D) This study
pST232 pSMC242 carrying PhetR-hetR(E254D) This study
pST233 pSMC242 carrying PhetR-hetR(L255V) This study
pST234 pSMC242 carrying PhetR-hetR(D256G) This study
pST276 pCO100 carrying PhetR-hetR(Y51C)-cfp This study
pST277 pCO100 carrying PhetR-hetR(P206S)-cfp This study
pST278 pCO100 carrying PhetR-hetR(Q59P)-cfp This study
pST279 pCO100 carrying PhetR-hetR(D230G-cfp This study
pST280 pCO100 carrying PhetR-hetR(E56G)-cfp This study
pST281 pCO100 carrying PhetR-hetR(C48R)-cfp This study
pST282 pCO100 carrying PhetR-hetR(L162I)-cfp This study
pST269 pCO100 carrying PhetR-hetR(R250K)-cfp This study
pST270 pCO100 carrying PhetR-hetR(A251G)-cfp This study
pST271 pCO100 carrying PhetR-hetR(L252V)-cfp This study
pST272 pCO100 carrying PhetR-hetR(E253D)-cfp This study
pST273 pCO100 carrying PhetR-hetR(E254D)-cfp This study
pST274 pCO100 carrying PhetR-hetR(L255V)-cfp This study
pST275 pCO100 carrying PhetR-hetR(D256G)-cfp This study
pST284 pCO100 carrying PhetR-hetR-cfp This study
pST307 pET26b carrying hetR(R250K) This study
pST308 pET26b carrying hetR(A251G) This study
pST309 pET26b carrying hetR(L252V) This study
pST310 pET26b carrying hetR(E253D) This study
pST311 pET26b carrying hetR(E254D) This study
pST312 pET26b carrying hetR(L255V) This study
pST313 pET26b carrying hetR(D256E) This study
142
Table 4.3. Oligonucleotides used in Chapter 4
Primer no.
Primer name Sequence (5’ to 3’)
1 PhetR-BamHI-F ATATAGGATCCA ACCCTTATGACAAAGGAC
2 HetR 3’ Seq TGCTCTACACCACATTGGTTGG
3 hetR-SacI-SpeI-R TATATAGAGCTCACTAGTACTTTTATTCACTCTGGGTGC
4 hetR Y51C-F AGTGTGCCATTTGCATGACTTATCTAGAGCAAGGAC
5 hetR Y51C-R AGATAAGTCATGCAAATGGCACACTTAGCCGCCGT
6 hetR P206S-F CTTGGGGAATGTCCTTCTATGCCCTGACTCGTCCC
7 hetR P206S-R AGGGCATAGAAGGACATTCCCCAAGGAGAATCAATTCTTG
8 hetR Y51F-F AGTGTGCCATTTTCATGACTTATCTAGAGCAAGGAC
9 hetR Y51F-R AGATAAGTCATGAAAATGGCACACTTAGCCGCCGT
10 hetR Y51H-F AGTGTGCCATTCACATGACTTATCTAGAGCAAGGAC
11 hetR Y51H-R AGATAAGTCATGTGAATGGCACACTTAGCCGCCGT
12 hetR Q59P-F TAGAGCAAGGACCAAACCTCCGGATGACCGGACATTTGC
13 hetR Q59P-R ATCCGGAGGTTTGGTCCTTGCTCTAGATAAGTCATG
14 hetR D230G-F TTATGGTGGAAGGTACCGCTCGGTATTTCCGCATGATGAAA
15 hetR D230G-R TACCGAGCGGTACCTTCCACCATAATATAAGTCCGCTCTTG
16 hetR C48R-F1 CGGCGGCTAAGCGTGCCATTTACATGACTTATCTAGAGC
17 hetR C48R-R1 ATGTAAATGGCACGCTTAGCCGCCGTTGCTGCTGCATC
18 hetR L162I-F TGATCGAATTTATCCATAAGCGATCGCAAGAGGATCTG
19 hetR L162I-R GATCGCTTATGGATAAATTCGATCAACTCCAAAAACTC
20 hetR Q59E-F TAGAGCAAGGAAACAACCTCCGGATGACCGGACATTTGC
21 hetR Q59E-R ATCCGGAGGTTGTTTCCTTGCTCTAGATAAGTCATG
22 hetR D230E-F TTATGGTGGAAGAGACCGCTCGGTATTTCCGCATGATGAAA
23 hetR D230E-R TACCGAGCGGTCTCTTCCACCATAATATAAGTCCGCTCTTG
24 hetR E56D-F TGACTTATCTAGATCAAGGACAAAACCTCCGGATGACC
25 hetR E56D-R TTTTGTCCTTGATCTAGATAAGTCATGTAAATGGCACAC
26 hetR C48R-F CGGCGGCTAAGCTGGCCATTTACATGACTTATCTAGAGC
143
Table 4.3. (Continued) Oligonucleotides used in Chapter 4
Primer no.
Primer name Sequence (5’ to 3’)
27 hetR C48R-R ATGTAAATGGCCAGCTTAGCCGCCGTTGCTGCTGCATC
28 hetRR250K-F CAAACGCTATGAAGGCCTTAGAAGAA
29 hetRR250K-R CTTCTAAGGCCTTCATAGCGTTTGGC
30 hetRA251G-F CGCTATGCGAGGATTAGAAGAACTCGATGTGCCAC
31 hetRA251G-R GTTCTTCTAATCCTCGCATAGCGTTTGGCCG
32 hetRL252V-F CTATGCGAGCCGTGGAAGAACTCGATGTGCCACC
33 hetRL252V-R CGAGTTCCTTCCACGCTCGCATAGCGTTTGG
34 hetRE253D-F CGCAGCCTTAGATGAACTCGATGTGCCACCAG
35 hetRE253D-R CATCGAGTTCATCTAAGGCTCGCATAGCGTTTG
36 hetR E254D-F CGAGCCTTAGAAGATCTCGATGTGCCACCAGAG
37 hetR E254D-R GCACATCGAGATCTTCATAGGCTCGCATAGCGTTTG
38 hetRL255V-F CCTTAGAAGAAGTGGATGTGCCACCA
39 hetRL255V-R GGTGGCACATCCACTTCTTCTAAGGC
40 hetRD256E-F CTTAGAAGAACTCGAAGTGCCACCAGAGCGCTG
41 hetRD256E-R CTGGTGGCACTTCGAGTTCTTCTAAGGCTCG
42 hetR-NdeI-R134-F CTCTT CATATGAAGACAAATTGAGCATAAG TTACCCAG
43 hetR-NdeI-M176-F CTCTTCATATGGAGTTAAGCGAAGCCCTGGCAGAGC
44 hetR-PstI-R ATATCTGCAGTTAATCTTCTTTTCTACCAAACACCATTTG
45 PpetE-S-F TATGAATTC GCTGAGGTACTGAGTACACAGC
46 PpetE-S(ApR)-R AAAGAATTCGGCGGCCGCTCTAGAACTAG
47 hetR-F-BamHI ATCCCGGATCCCCTGCCAATGCAGAAGGTTAAAC
48 hetR-R-SacI CATTAGAGCTCCTTTTATTCACTCTGGGTGC
49 505-BamHI CTACGGGGTCTGACGCTCAGTGG
50 505-SacI GTCGAACTGCGCGCTAACTAT TC
51 PpetE-NcoI-F ATATACCATGGCTGAGGTACTGAGTACACAG
52 CFP SpeI R AATAACTAGTTTACTTGTACAGCTCGTCCATGC
53 hetR F NdeI express ATCGATCGCATATGAGTAACGACATCGATCTGATC
54 hetR R XhoI express TGACTCTCGAGCTAATCTTCTTTTCTACCAAACACC
55 alr9018 flank up F TCAGGGATCAGAAAATCAGG
56 alr9018 flank down R GTATTTTGACGCAGAGCTTC
144
RESULTS
Conservative substitutions at HetR residues 250−256 affect heterocyst formation and
sensitivity to PatS-5
As part of a mutagenesis study designed to identify residues of HetR required for
function, an allele of hetR coding for an E254G substitution was found to cause
differentiation into heterocysts of essentially all cells containing a multicopy plasmid
carrying the mutant gene [15]. Introduction of a plasmid bearing the hetR(E254G) allele
under the control of the native promoter of hetR to PCC 7120 by conjugation resulted in
no viable transconjugants. To limit expression of the hetR(E254G) allele, the wild-type
promoter region was replaced with that of the copper-inducible petE promoter and the
plasmid was introduced into PCC 7120. Limited growth of a small number of
transconjugants on solid BG-11 medium containing ammonia and lacking copper was
observed. The resulting colonies lacked the green color of colonies of the wild-type, were
composed primarily of heterocysts, and showed little to no growth in liquid culture (data
not shown). By comparison, a strain with PpetE driving transcription of the wild-type allele
of hetR in place of the hetR(E254G) allele under the same conditions differentiated less
than 1% heterocysts. Replacement of the wild-type promoter region with a second
promoter, that of nirA, transcription from which is repressed in ammonia and induced in
nitrate or in the absence of fixed nitrogen [16], permitted the growth of filaments on solid
and liquid BG-11 medium with ammonia replacing nitrate as the nitrogen source.
Apparently, there is tighter on-off control of transcription with the nir promoter than with
petE in our hands. Transfer of filaments to BG-11 with nitrate or lacking a fixed source of
nitrogen resulted in the differentiation of greater than 90% of cells into heterocysts. By
comparison, a strain with Pnir driving transcription of the wild-type allele of hetR in place of
the hetR(E254G) allele under the same conditions differentiated about 30% heterocysts
(data not shown). When the native copy of hetR in PCC 7120 was replaced with an allele
encoding the E254G substitution, about 25% of cells in the resulting strain were
heterocysts 48 h after induction. The phenotype of this strain was indistinguishable from
that of a strain with a copy of hetR encoding the more conservative E254D substitution,
which is discussed in more detail below.
Differentiation of nearly all cells of a filament has been observed when both patS and
hetN are inactivated simultaneously or when an allele of hetR encoding protein less
sensitive to both inhibitors is overexpressed ectopically and the mutant strains are grown
in the absence of combined nitrogen [17, 18]. To determine if the more conservative
145
E254D substitution also resulted in an overactive allele of HetR and if residues in the
region of E254 were involved in the response of HetR to PatS-5, alleles of HetR encoding
individual conservative substitutions at residues R250 to D256 were used to substitute
hetR by allelic replacement in PCC 7120 (see Table 4.1). Filaments of strains with
alleles encoding R250K, E253D, E254D, L255V, and D256E substitutions consisted of
about 14 to 48% heterocysts, and the presence or absence of fixed nitrogen in the
medium had little effect on differentiation by an individual strain. By comparison, about
9% of cells in filaments of PCC 7120 were heterocysts in a medium that lacked fixed
nitrogen, and about 1% when fixed nitrogen was present. Conversely, A251G and L252V
substitutions prevented or reduced differentiation, respectively (Fig. 4.1). Strains that
differentiated an increased number of heterocysts were also less sensitive to PatS-5.
Addition of PatS-5 to the growth medium prevented differentiation of heterocysts by the
wild-type strain, PCC 7120 [19]. In contrast, 8 to 25% of cells in filaments of strains with
alleles encoding R250K, E253D, E254D, L255V, and D256E substitutions were
heterocysts in a medium that contained PatS-5 at a concentration of 1 M (Fig. 4.1). As
expected, PCC 7120 lacked heteroycsts under the same conditions. Taken together,
these results suggest that residues R250, E253, E254, L255 and D256 of HetR are
involved in sensitivity to PatS-dependent signals in vivo.
146
Figure 4.1. Sensitivity to PatS-5 of strains with mutant alleles of hetR. (A) Bar graph of the
percentage of cells that are heterocysts in the wild-type strain (PCC 7120) and strains with an
allele of hetR encoding the indicated amino-acid substitution (labeled on horizontal axis) 96 h
with a source of fixed nitrogen (green diagonal bars), and 96 h after removal of combined
nitrogen with (red horizontal bars) or without (solid blue bars) the addition of 1 M PatS-5 to
the medium. Values represent the average of 500 cells from three independent cultures.
Micrographs of strain PCC 7120 (B and C) and UHM167, which contained an allele of hetR
encoding an E254D substitution (D and E), 96 h after removal of combined nitrogen without (B
and D) or with (C and E) the addition of PatS-5 to the medium. Carets indicate heterocysts.
147
Conservative substitutions at HetR residues 250−256 affect heterocyst formation
and sensitivity to PatS and HetN overexpression
The genetic network controlling heterocyst development involves an intricate interplay between
positive and negative effectors. Coordination of heterocyst differentiation by the positive
regulator, HetR, is negatively regulated by two proteins encoding a RGSGR peptide sequence
(PatS-5), PatS and HetN. Heterocyst formation is abrogated upon introduction of plasmids
encoding patS or hetN independently into the wild-type, even during conditions of nitrogen
starvation[13]. Since residues 250-256 of HetR differed in sensitivity to PatS-5, response to full
length PatS and HetN was also evaluated (Table 4.5). Plasmids used for overexpression of patS
or hetN (pDR211 and pDR320, respectively) were introduced into strains encoding conservative
substitutions at HetR residues 250−256, and heterocyst formation was evaluated. Strains
HetR(E254D) and HetR(D256E) continued to form heterocysts when PpetE-patS was introduced.
Similarly, HetR(R250K), HetR(E253D), HetR(E254D) and HetR(D256E) continued to form
heterocysts when PpetE-hetN was introduced.
Identification of overactive alleles of hetR that bypass HetN function, but require a wild-
type copy of HetR for activity
To isolate additional alleles of hetR no longer responsive to regulation by the inhibitors PatS and
HetN, the hypermutator E. coli strain XL1-RED was used to introduce mutations into plasmids
carring PhetR-hetR (pDR138) alone and PhetR-hetR with PpetE-patS (pST103). The library of
mutations in plasmid pDR138 was introduced into a strain that has the native promoter of hetN
replaced by the copper-inducible promoter of petE (strain 7120PN) and a second hetR-deficient
strain that also has hetN driven by the PpeE promoter (strain UHM110; PpetE-hetN ∆hetR) to isolate
alleles of hetR that can overcome HetN inhibitory signals. The library of mutations in plasmid
pST103 was introduced into a hetR-deficient strain to isolate mutations that bypass inhibition by
PatS. A total of seven alleles of hetR were isolated from the XL1-RED mutagenesis studies.
Two substitutions were isolated independently in both the patS and hetN selection experiments.
Two truncated versions of hetR were also isolated with and without another substitution in hetR.
Finally, four plasmids containing an inversion of the multiple cloning sites were isolated,
presumably by a plasmid recombination event. These last four isolates were not pursued further
as they did not contain mutations in hetR.
The substitutions Y51C and P206S (arising from XL1-RED mutagenesis of plasmids carrying
PhetR-hetR), allowed heterocysts to form in an otherwise heterocyst-repressive PpetE-hetN
background. Additional mutations in PhetR-hetR were isolated. One mutation was identified in
148
the promoter region
of hetR. The
mutation at -772
relative to the
translational start site
is located near a
region that appears
to downregulate
expression from the
-728 and -696
transcriptional start
points of hetR when
a source of fixed
nitrogen is
available[20]. The
Y51C mutation was
also isolated with
additional mutations spanning R134-M176 at the C-terminus. Each of the mutations in the coding
region of hetR was isolated multiple times, but the Y51C mutation was the most frequently
encountered. Plasmids engineered with the Y51C and P206S mutations (plasmids pST121 and
pST122, respectively) did not form heterocysts upon reintroduction into the PpetE-hetN ∆hetR or
∆hetR strains. However, when introduced into the wild-type, heterocysts formed at a frequency
greater than that observed with wild-type hetR (on plasmid pDR138). On average, 62.8% for
Y51C, 56.0% for P206S as compared to 26.3% for wild-type hetR at 48 hours post-induction. For
this reason, the Y51C and P206S substitutions appear to require a copy of wild-type hetR in order
to overcome inhibition by HetN. Construction of Y51C and P206S in the chromosome resulted in
0% and 11.9% heterocysts, respectively (Fig. 4.2).
To understand the Y51C mutation of hetR, the conservative mutations Y51F and Y51H were
evaluated. The conservative substitutions Y51F and Y51H on plasmids (pST104 and pST105)
could not be introduced into the wild-type, ∆hetR or PpetE-hetN strains (but a few colonies taken to
be suppressor mutations eventually arose, but only in a PpetE-hetN background). To test if the
conservative mutations produced lethal levels of heterocysts, filaments were evaluated after 24
and 48 hours after conjugation with plasmids pST104 and pST105 (prior to selection with
appropriate antibiotics) for heterocyst formation. Most cells in strain ∆hetR carrying either
mutation on plasmids were heterocyst cells, suggesting that the conservative substitutions (Y51F,
Y51H) produced heterocysts at a frequency that impeded normal cell growth. To further
Figure 4.2. Heterocyst frequencies of strains UHM170 to UHM182
and the wild-type. Percentages represent the average of 500 cells
from three independent cultures of each strain (listed on horizontal
axis) 48 h after removal of combined nitrogen.
149
determine if the lethality of Y51F and Y51H alleles contributed to this phenomenon, these
mutations were recreated in the chromosome. The heterocyst frequency for Y51F and Y51H
(5.5% and 0%, respectively) in the chromosome (Fig. 4.2) was similar to Y51C (0%). It remains
unclear whether secondary site mutations that allow for survival of these strains with Y51C, Y51F
and Y51H substitutions (perhaps by dampening heterocyst frequencies) are responsible for this
phenotype.
A subset of plasmids isolated from the study resulted in the Y51C mutation accompanied with
additional mutations in the 299-residue HetR protein. These mutations were confined to residues
spanning R134 to M176, and did not arise without Y51C on the same XL1-RED-derived plasmid.
This correlation may underlie a function of the C-terminus on the activity of HetR(Y51C) or wild-
type HetR. To explore the role of the C-terminus of HetR in heterocyst development, residues
R134-D296 and M176-D296 were cloned into plasmids under the control of the PpetE promoter
and the effect of this truncated form of hetR on heterocyst frequency was accessed in different
genetic backgrounds. A plasmid with HetR R134-D296 (plasmid pST108) formed heterocysts at
a frequency well below wild-type hetR (carried on plasmid pDR138) in the wild-type and in a
patS-deficient strain. A plasmid with HetR M176-D296 (plasmid pST109) formed fewer
heterocysts in the wild-type compared to pST108 and a low frequency of heterocysts in a patS-
deficient strain. Also, plasmids pST108 and pST109 could not restore heterocyst formation in
∆hetR, pN nor pN∆hetR strains, unlike wild-type hetR carried on plasmid pDR138. The simplest
explanation for these results may relate to the inactivity of these truncations of HetR, a
phenomenon that is not directly dependent on the hetR(Y51C) allele.
Identification of overactive alleles of hetR that bypass HetN function
When a plasmid carrying wild-type hetR (plasmid pDR138) was mutagenized within XL1-RED E.
coli cells and introduced into strain PpetE-hetN ∆hetR, mutations in HetR were isolated that
represented bypass HetN-inhibitory signals. The mutations C48R, E56G, Q59P and D230G on
plasmid pDR138 individually conferred resistance to HetN overexpression, but the Q59P and
D230G substitutions were isolated the most frequently in this mutagenesis study. Unlike the
Y51C and P206 mutations previously described, the activities of these mutations were isolated in
the absence of a chromosomal copy of hetR.
The E56G, Q59P and D230G substitutions are non-conservative and may dramatically alter the
structure of HetR. Conservative substitutions for the E56G, Q59P and D230G mutations in HetR
were created on plasmids to more accurately address the role of these sites on HetR activity.
Compared to plasmids containing the E56G, Q59P and D230G non-conservative mutations, very
150
few colonies arose when plasmids containing HetR(E56D), HetR(Q59E) and HetR(D230E) on
plasmids (pST127, pST128 and pST129, respectively) were introduced into strain ∆hetR. In
addition, even fewer colonies arose when the same conservative substitutions were introduced
into strain PpetE-hetN ∆hetR. Colony formation in these strains was also delayed, suggestive of
secondary site mutations generated in response to the increased activity of the conservative
substitutions in comparison to the non-conservative substitutions. To determine if the
conservative mutations produced lethal levels of heterocysts in either strain, filaments were
evaluated at 24 and 48 hours after conjugation (prior to selection with appropriate antibiotics) for
heterocyst development. After conjugation, heterocyst cells were observed in strain ∆hetR.
However, because only vegetative cells were observed in strain PpetE-hetN ∆hetR, the
conservative substitutions were sensitive to HetN. In contrast, the non-conservative substitutions
produced heterocysts in both background strains under the same conditions, and also generated
a greater number of exconjugants as well. The discrepancy in heterocyst frequencies may
suggest that the non-conservative substitution is more active than the conservative substitution.
To further understand the E56, Q59 and D230 mutations, the corresponding non-conservative
and conservative substitutions were recreated in the chromosome. In strains with E56G and
Q59P substitutions, heterocyst frequency was 0%, but the D230G substitution resulted in 20.5%
heterocysts (Fig. 4.2). The corresponding E56D, Q59E and D230E conservative substitutions
resulted in heterocyst frequencies of 7.1%, 23.7% and 6.9% respectively (Fig. 4.2), suggesting
that only the non-conservative mutation at D230 is more active than the conservative mutation.
However, like the substitutions at the Y51 residue of HetR (Fig. 4.2), it remains unclear whether
heterocyst frequencies arising upon mutation of E56, Q59 and/or D230 are due to secondary site
mutations. Mutations that dampen lethal levels of heterocyst differentiation would allow these
strains to survive, and may explain the mutant phenotypes.
Identification of overactive alleles of hetR that bypass PatS and HetN function
When a plasmid carrying PhetR-hetR and PpetE-patS (plasmid pST103) was mutagenized by the E.
coli strain XL1-RED and introduced into strain ∆hetR, mutations were found in HetR that could
bypass PatS-inhibitory signals. Two of the substitutions found to bypass the activity of HetN were
found to also bypass the activity of PatS (Table 4.4). The mutations at residues Q59P, D230G
and L162I of HetR on plasmid pST103 individually conferred resistance to PatS overexpression.
Thus HetR with changes at residues at Q59 and D230 are resistant to both PatS- and HetN-
mediated repression of HetR, suggesting that the same RGSGR pentapeptide (also referred to as
‘PatS-5’) motif found in both inhibitory proteins may link these two pathways of heterocyst
151
repression. Like the E254G substitution, the Q59P and D230G alleles of hetR present on a
multicopy plasmid also caused nearly complete differentiation of all cells into heterocyst cells.
To determine the resistance of the remainder of the isolated hetR mutants (C48R, Y51C, E56G,
L162I and P206S) to both PatS and HetN, plasmids encoding each allele were individually
introduced into strains 1) PpetE-hetN ∆hetR or 2) ∆hetR, PpetE-hetN ∆hetR and the wild-type. A
plasmid containing the L162I mutation and PpetE-patS was introduced into strain PpetE-hetN ∆hetR.
Heterocysts were able to form, indicating bypass of HetN-overexpression in addition to PatS-
overexpression by the L162I substitution. Thus Q59P, L162I and D230G are less sensitive to
both negative regulators. However, the HetN-bypass mutants of HetR (at residues C48R, Y51C,
E56G, P206S) were sensitive to patS overexpression. Heterocyst development was abrogated
upon introduction of these corresponding plasmids into the different strains and grown in liquid
BG-110 (lacking a source of combined nitrogen) with 1 µM PatS-5 (the minimal inhibitory
concentration, or MIC), 2 µM PatS-5 and 6 µM PatS-5.
Table 4.4. Summary of sensitivity of seven alleles of hetR (driven by PhetR) encoded on plasmids
to PatS and HetN. Conditions include PpetE-patS (carried on derivatives of plasmids pST103), 1
to 6 µM PatS-5, and/or PpetE-hetN (from strains pN or pN∆hetR). ‘Yes’ indicates decreased
sensitivity (“bypass”) as evidenced by heterocyst formation. ‘No’ indicates sensitivity to the
inhibitors (PatS, middle two columns; or HetN, right column) tested as evidenced by the lack of
heterocyst formation. ‘ND’ indicates not determined.
HetR substitution on plasmid
PatS bypass (PpetE-patS on plasmid)
PatS bypass (1-6 µM PatS-5)
HetN bypass (PpetE-hetN in chromosome)
None (wild-type) No No No
C48R ND No Yes
Y51C ND No Yes
E56G ND No Yes
Q59P Yes ND Yes
L162I Yes ND Yes
P206S ND No Yes
D230G Yes ND Yes
Overactive alleles of hetR affect sensitivity to PatS and HetN overexpression
The seven mutations isolated in the bypass selection experiments were recreated in the
chromosome, along with six corresponding conservative substitutions (Fig. 4.2). Heterocyst
frequency of mutations in the chromosome was generally below the frequency observed on a
multicopy plasmid. One explanation for this discrepancy may relate to the presence of
suppressor mutations that arose in these strains to offset the increased lethal activity of these
152
alleles. Alternatively, the normal levels of PatS and HetN in the chromosome differ from the
selection conditions originally used to isolate these strains, since background strains as well as
plasmids that overexpress these inhibitors were used. This may explain sensitivity of all mutant
strains to overexpression of HetN (from plasmid pDR320), even though some of the isolated
alleles of hetR were insensitive to PpetE-hetN overexpression from the chromosome (Table 4.5).
Strains encoding Q59E, D230G, D230E and L162I were resistant to patS-overexpression (from
plasmid pDR211 and pST102), as expected (Table 4.5).
Table 4.5. Summary of sensitivity to different allelic replacements of hetR in the chromosome to
overexpression of PatS and HetN. Conditions include PpetE-patS (carried on plasmids pST102
and pDR211), 1 µM PatS-5, and PpetE-hetN (carried on plasmid pDR320). ‘Yes’ indicates
decreased sensitivity (“bypass”) as evidenced by heterocyst formation. ‘No’ indicates sensitivity
to the inhibitor (PatS or HetN) tested as evidenced by lack of heterocyst formation. ‘ND’ indicates
not determined.
HetR substitution in chromosome
PatS bypass (PpetE-patS on plasmid)
PatS bypass (1 µM PatS-5)
HetN bypass (PpetE-hetN on plasmid)
None (wild-type) No No No
Y51F No ND No
E56D No ND No
Q59E Yes ND No
L162I Yes ND No
P206S No ND No
D230G Yes ND No
D230E Yes ND No
R250K No Yes Yes
L252V No No No
E253D No Yes Yes
E254D Yes Yes Yes
L255V No Yes No
D256E Yes Yes Yes
HetR(mutant)-GFP localization predicts role in HetR turnover
Heterocysts are the source of the inhibitors of differentiation, PatS and HetN. Lateral diffusion of
the inhibitors from source cells results in inhibitor concentration gradients along a filament. In
turn, the inhibitor concentration gradients mediate patterning by promoting the posttranslational
decay of the activator, HetR. Thus concentrations of the activator and inhibitor are inversely
related. Activator decay can be indirectly observed by use of translational fusions of GFP to the
carboxy-terminal end of HetR. Levels of HetR-GFP decrease with increasing distance from
heterocysts due to PatS- and HetN-dependent degradation of HetR-GFP[13].
153
The mutations in hetR discussed previously are less sensitive to either or both PatS- and HetN-
inhibitory signals. The decreased sensitivity is hypothesized to be mediated by the absence of
HetR protein degradation. To determine if PatS- and HetN-dependent degradation is impaired by
the various isolated mutations in HetR, translational fusions of gfp to the different alleles of hetR
were constructed on plasmids, and subsequently introduced into a ∆hetR ∆patA strain.
Visualization of a concentration gradient of HetR-GFP is not expected with the mutant alleles of
hetR because this mechanism presumably allowed for bypass of inhibition by PatS and/or HetN.
Unexpectedly, three different outcomes were observed independent of the promoter used (PpetE
or PhetR). One substitution was chosen to represent each of the three outcomes in Figure 4.3.
HetR(mutant)-GFP corresponding to the R250-D256 region is depicted in Figure 4.3. The
different translational fusions resulted in the observation of: 1) a HetR-GFP concentration
gradient (Fig.4. 3C, 4.3D), 2) the absence of HetR-GFP concentration gradient (Fig. 4.3E, 4.3F),
or 3) HetR-GFP punctate fluorescence in all cells, independent of cell type (Fig. 4.3G, 4.3H).
A concentration gradient similar to wild-type HetR-GFP (Fig. 4.3A, 4.3B and Fig. 4.4A, 4.4B) was
observed upon the independent introduction of plasmids carrying HetR(L162I)-GFP (Fig. 4.3C,
4.3D), HetR(P206S)-GFP, HetR(A251G)-GFP (Fig. 4.4E, 4.4F), HetR(L252V)-GFP (Fig. 4.4G,
4.4H) and HetR(L255V)-GFP (Fig. 4.4M, 4.4N) into strain ∆hetR ∆patA. The A251G and L255V
substitutions appear to have a shorter gradient than the wild-type. Together, these results may
suggest that bypass of inhibitor activity by these alleles may not directly relate to HetR-dependent
degradation.
In contrast, plasmids containing HetR(Y51C)-GFP, HetR(Q59P)-GFP (Fig. 4.3E, 4.3F),
HetR(R250K)-GFP (Fig. 4.4C, 4.4D), and HetR(D256E)-GFP (Fig. 4.4O, 4.4P) resulted in uniform
and increased levels of GFP fluorescence. Heterocysts were rarely observed with plasmids
carrying the Y51C mutation (and C48R mutation, below), and fluorescence was uniform in
vegetative cells. It is unclear if the mutation in patA is responsible for limiting levels of
differentiation promoted by the Y51C (and C48R) overactive allele of HetR. This phenomenon of
elevated HetR-GFP levels accompanied by the absence of heterocyst formation has been
observed in hetF-deficient strains[8]. Overall, these results implicate specific amino acids of HetR
in affecting turnover of HetR. Adjusting HetR levels with respect to inhibitor levels is consistent
with a mechanism to turn on heterocyst formation in Anabaena.
Lastly, plasmids bearing HetR(C48R)-GFP, HetR(E56G)-GFP, HetR(D230G)-GFP (Fig. 4.3G,
4.3H), HetR(E253D)-GFP (Fig. 4.4I, 4.4J) and HetR(E254D)-GFP (Fig. 4.4K, 4.4L) resulted in
punctate fluorescence in heterocysts and adjacent vegetative cells. In addition to this
154
phenomenon, the E253D substitution appeared to result in a shorter gradient than the wild-type.
Finally, over time similar “foci” were occasionally observed with plasmids containing HetR(Y51C)-
GFP, HetR(Q59P)-GFP, HetR(A251G)-GFP, and HetR(L162I)-GFP in the same genetic
backgrounds. Thus HetR(mutant)-GFP accumulated in cells irrespective of inhibitor levels, but
the mutant HetR protein was not stable. The observed foci may relate to a HetR-degradation
pathway. PatS- and HetN-dependent degradation of HetR is presumably mediated by targeting
HetR for degradation. During the differentiation process, conversion of HetR to these
substitutions may signal an unidentified cellular protease to degrade HetR. This may allow for
post-translational temporal regulation of HetR levels during heterocyst development.
This preliminary work was later applied to studies aimed at uncovering cellular proteases
responsible for HetR turnover. However, strains with PpetE-hetR(mutant)-cfp in the chromosome
(generated through plasmids pST376 to pST382; Table 4.2) produced HetR-CFP fluorescence
below the level of detection and were not pursued further (K. L. Hurd, personal communication).
155
Figure 4.3. Localization of representative HetR(mutant)-GFP fusions. Bright-field (A, C, E,
G) and fluorescence (B, D, F, H) micrographs of filaments of strain ∆hetR ∆patA carrying
plasmids bearing translational fusions to hetR-gfp expressed from PpetE at 48 h after
removal of combined nitrogen. Plasmids bearing wild-type hetR (pDR293; A, B), and the
hetR substitutions L162I (pST199; C, D), Q59P (pST195; E, F) and D230G (pST196; G, H)
are shown. Micrographs were acquired using identical microscope and camera settings.
Carets indicate heterocysts.
156
Figure 4.4. Localization of HetR(mutant)-GFP corresponding to the R250-D256 region.
Bright-field (A, C, E, G, I, K, M, O) and fluorescence (B, D, F, H, J, L, N, P) micrographs of
filaments of strain ∆hetR ∆patA carrying plasmids bearing translational fusions to hetR-gfp
expressed from PpetE at 48 h after removal of combined nitrogen. Plasmids bearing wild-
type hetR (pDR293; A, B), and the hetR substitutions R250K (pST200; C, D), A251G
(pST217; E, F), L252V (pST218; G, H), E253D (pST219; I, J), E254D (pST220; K, L),
L255KV (pST221; M, N), and D256E (pST201; O, P) are shown. Micrographs were
acquired using identical microscope and camera settings. Carets indicate heterocysts.
157
Overactive alleles of hetR fail to complement hetF- and patA-deficient strains
The relationship between mutations in HetR that allow for bypass of HetN- and PatS-mediated
lateral inhibition and additional positive regulators of heterocyst differentiation was investigated.
To determine if overactive alleles of hetR could complement the heterocyst deficiency observed
in hetF and patA backgrounds, plasmids carrying the seven mutations responsible for bypass as
well as plasmids carrying conservative substitutions were introduced into strains ∆hetR∆hetF,
∆patA∆hetF and ∆patA. No change to the parent phenotype was observed (data not shown). To
further test if the different alleles of hetR produced lethal levels of heterocysts (resulting in
secondary site mutations that allowed for survival of these strains), filaments were evaluated after
24 and 48 hours after conjugation (without selection with appropriate antibiotics) for heterocyst
formation. Heterocyst cells were not observed under these conditions in the same background
strains (strains ∆hetR∆hetF, ∆patA∆hetF and ∆patA). Taken together, these results suggest that
function of the overactive hetR alleles in patS- and hetN-dependent pathways is independent of
hetF- and patA-mediated pathways.
alr9018, a gene that complemented a mutant of a PpetE-hetN ∆patS strain, is not essential
for heterocyst differentiation
As negative regulators of heterocyst differentiation, inactivation of either patS or hetN results in a
Mch phenotype. Heterocyst frequencies of either strain are increased in comparison to the wild-
type (approximately 20% in the mutant strains and 9% in the wild-type). Simultaneous
inactivation of both inhibitory genes in strain PpetE-hetN ∆patS (UHM100) results in nearly
complete differentiation of heterocysts (approximately 98%)[5]. The lethal level of heterocyst
differentiation in this strain was used to isolate spontaneous suppressor mutations that could
represent genes important in the control of the patS and hetN regulatory circuit. One of the
isolated bypass mutants of PpetE-hetN ∆patS, strain NSM6, was heterocyst-deficient (P.B.
Borthaker, unpublished). The mutation corresponded to the gene alr9018 located on the epsilon
plasmid of Anabaena. Reintroduction of this gene on a plasmid was found to restore the Mch
phenotype to strain NSM6. In addition, presence of alr9018 in multicopy on a plasmid increased
heterocyst frequencies in the wild-type, indicating that alr9018 may represent a novel activator of
heterocyst differentiation (P.B. Borthaker, unpublished). However, a null mutation in alr9018 to
reconstruct the original strain NSM6 carrying a mutation in alr9018 could not be made in earlier
studies (P.B. Borthaker, unpublished).
To understand the role of alr9018 in heterocyst development, alr9018 was inactivated from the
epsilon plasmid. Because heterocysts formed in a wild-type pattern without any discernable
158
temporal delay or alteration in phenotype, all9018 is not essential for heterocyst formation (data
not shown). However this result does not preclude alr9018 from an adjunct role in development
nor a role in stabilization of the lethal PpetE-hetN ∆patS mutant phenotype.
DISCUSSION
The developmental genes hetR, patS and hetN are essential in the coordination of heterocyst
patterning. Mutagenesis experiments were performed in this study to understand the relationship
between HetR and the inhibitors of HetR, the heterocyst-development regulators PatS and HetN.
Seven overactive alleles of hetR were isolated in the mutagenesis experiments described in this
study: C48R, Y51C, E56G, Q59P, L162I, P206S and D230G. Translational fusions of different
alleles of hetR to gfp were used to cytologically demonstrate the resistance of these versions of
HetR to inhibitor-mediated decay (Fig. 4.3). However, only some of the substitutions resulted in
an absence of HetR-GFP concentration gradient. Some of the substitutions corresponding to the
most resistance to PatS and/or HetN overexpression resulted in cells with punctate HetR-GFP
fluorescence. One hypothesis for this observation may relate to impeded protein decay.
Table 4.6. Location of the overactive alleles (far right column) described in this study within the
domains (far left column; corresponding residues in middle column) of the 299-residue protein
HetR.
HetR domains Residues of HetR Overactive HetR substitutions
N-terminal domain 1-98 C48R, Y51C, E56G, Q59P
Flap domain (middle) 99-213 L162I, P206S
Hood domain (C-terminal) 214-296 D230G, R250-D256 region
Mapping of the overactive hetR alleles identified in this study to one of the three distinct domains
in the structure of HetR [3] may elucidate the role of HetR in the coordination of heterocyst
differentiation (summarized in Table 4.6). The N-terminal DNA-binding domain contains highly
conserved residues in the dimerization core (residues 16-51), a region that includes C48R and
Y51C. Because dimerization of HetR appears to be required for heterocyst differentiation[21],
mutations at the dimer interface would presumably affect HetR function. Additional alleles
mapped to other highly conserved regions of HetR. In the flap domain, L162I and P206S
mapped to conserved residues spanning residues 158-168 and 178-212 respectively. In the
hood domain, D230G mapped to a conserved region containing residues 222-236. The flap and
hood domains represent unique protein folds and have been suggested to impart flexibility to the
159
HetR structure, which may be essential for HetR interaction with peptides, proteins, ions and
solvents[3]. The hood domain, positioned on top of the DNA-binding unit present in the N-
terminal domain, forms a cavity. This negatively-charged recess may act as a scaffold necessary
for the assembly of transcriptional machinery, including RNA polymerase[3]. In addition, the two
flap domains may function to enhance the interaction of HetR with DNA to regulate heterocyst
formation. Mutations in these conserved regions may alter the conformation of the flap and hood
domains, ultimately affecting the genetic regulation of genes involved in heterocyst formation.
Although previous reports suggest no interaction between HetR and Anabaena RNA polymerase
using yeast two-hybrid analysis[21], this result may represent a limitation of the assay.
The phenotypes of strains with alleles of hetR encoding substitutions at residues R250,
E253, E254, L255 and D256 are consistent with decreased sensitivity of the substituted
HetR proteins to PatS- and HetN-dependent inhibitory signals. First, both patS and hetN
null mutants as well as the strains with overactive alleles described here differentiate an
increased number of heterocysts relative to that of the wild-type, PCC 7120 [19, 22].
Second, a patS null mutant and the strains described here with overactive alleles
differentiate heterocysts in the presence of a fixed source of nitrogen. And third,
inactivation of both patS and hetN simultaneously results in the formation of a number of
heterocysts in excess of that made by either of the individual mutants [18], similar to the
strains with alleles of hetR encoding E253D, E254D, L255V, and D256E substitutions.
The in vivo studies (Fig. 4.1) with mutant alleles of hetR(250) to hetR(256) led to
biophysical data showing direct binding between HetR and PatS-5[9]. Two different and
independent techniques corroborated that PatS-5 binds directly to HetR, namely EPR
spectroscopy and isothermal titration calorimetry. The discovery of the 250-256 region
led to 1) evidence that PatS binds directly to HetR from cysteine scanning mutagenesis
combined with continuous wave (CW) electron paramagnetic resonance (EPR)
spectroscopy; 2) determination of the stoichiometry of PatS-5 binding to HetR and that
PatS-5 binds HetR as a dimer from double electron electron resonance EPR
experiments; and, finally, 3) corroboration that PatS-5 binds directly to HetR and
measurement of the dissociation constant for HetR binding to PatS-5 using isothermal
titration calorimetry.
160
REFERENCES CITED
1. Gierer, A. and H. Meinhardt, A theory of biological pattern formation. Kybernetik, 1972.
12: p. 30-39.
2. Buikema, W.J. and R. Haselkorn, Characterization of a gene controlling heterocyst
development in the cyanobacterium Anabaena 7120. Genes Dev., 1991. 5: p. 321-330.
3. Kim, Y., et al., Structure of the transcription factor HetR required for heterocyst
differentiation in cyanobacteria. Proc. Natl. Acad. Sci., 2011. 108: p. 10109-10114.
4. Risser, D.D. and S.M. Callahan, Mutagenesis of hetR reveals amino acids necessary for
HetR function in the heterocystous cyanobacterium Anabaena sp. strain PCC 7120. J.
Bacteriol., 2007. 189: p. 2460-2467.
5. Borthakur, P.B., et al., Inactivation of patS and hetN causes lethal levels of heterocyst
differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol.
Microbiol., 2005. 57: p. 111-123.
6. Callahan, S.M. and W.J. Buikema, The role of HetN in maintenance of the heterocyst
pattern in Anabaena sp. PCC 7120. Mol. Microbiol., 2001. 40: p. 941-950.
7. Orozco, C.C., D.D. Risser, and S.M. Callahan, Epistasis analysis of four genes from
Anabaena sp. strain PCC 7120 suggests a connection between PatA and PatS in
heterocyst pattern formation. J. Bacteriol., 2006. 188(5): p. 1808-1816.
8. Risser, D.D. and S.M. Callahan, HetF and PatA control levels of HetR in Anabaena sp.
strain PCC 7120. J. Bacteriol., 2008. 190: p. 7645-7654.
9. Feldman, E.A., et al., Evidence for direct binding between HetR from Anabaena sp. PCC
7120 and PatS-5. Biochmistry, 2011. 50: p. 9212-9224.
10. Wei, T.-F., R. Ramasubramanian, and J.W. Golden, Anabaena sp. strain PCC 7120 ntcA
gene required for growth on nitrate and heterocyst development. J. Bacteriol., 1994. 176:
p. 4473-4482.
11. Callahan, S.M., unpublished.
12. Nayar, A.S., et al., FraG is necessary for filament integrity and heterocyst maturation in
the cyanobacterium Anabaena sp. strain PCC 7120. Microbiology, 2007. 153: p. 601-607.
13. Risser, D.D. and S.M. Callahan, Genetic and cytological evidence that heterocyst
patterning is regulated by inhibitor gradients that promote activator decay. Proc Natl Acad
Sci U S A, 2009. 106(47): p. 19884-8.
14. Black, T.A., Y. Cai, and C.P. Wolk, Spatial expression and autoregulation of hetR, a gene
involved in the control of heterocyst development in Anabaena. Mol. Microbiol., 1993. 9:
p. 77-84.
161
15. Risser, D.D. and S.M. Callahan, Mutagenesis of hetR reveals amino acids necessary for
HetR function in the heterocystous cyanobacterium Anabaena sp. strain PCC 7120. J
Bacteriol, 2007. 189(6): p. 2460-7.
16. Frías, J.E., E. Flores, and A. Herrero, Nitrate assimilation gene cluster from the
heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120. J Bacteriol, 1997.
179(2): p. 477-86.
17. Khudyakov, I.Y. and J.W. Golden, Different functions of HetR, a master regulator of
heterocyst differentiation in Anabaena sp. PCC 7120, can be separated by mutation.
Proc Natl Acad Sci U S A, 2004. 101(45): p. 16040-5.
18. Borthakur, P.B., et al., Inactivation of patS and hetN causes lethal levels of heterocyst
differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol Microbiol,
2005. 57(1): p. 111-23.
19. Yoon, H.S. and J.W. Golden, Heterocyst pattern formation controlled by a diffusible
peptide. Science, 1998. 282(5390): p. 935-8.
20. Rajagopalan, R. and S.M. Callahan, Temporal and spatial regulation of the four
transcription start sites of hetR from Anabaena sp. strain PCC 7120. J Bacteriol, 2010.
192(4): p. 1088-96.
21. Huang, X., Y. Dong, and J. Zhao, HetR homodimer is a DNA-binding protein required for
heterocyst differentiation, and the DNA-binding activity is inhibited by PatS. Proc. Natl.
Acad. Sci. U.S.A., 2004. 101(14): p. 4848-4853.
22. Callahan, S.M. and W.J. Buikema, The role of HetN in maintenance of the heterocyst
pattern in Anabaena sp. PCC 7120. Mol Microbiol, 2001. 40(4): p. 941-50.
162
CHAPTER 5. LOCALIZATION OF THE INTERCELLULAR SIGNALING PROTEIN, HETN, IN
ANABAENA SP. STRAIN PCC 7120
INTRODUCTION
Intercellular signaling regulates a variety of processes in bacteria, most notably as part of
quorum-sensing systems. In quorum sensing, individual cells communicate with short peptides or
other small molecules that are secreted into the surrounding medium to coordinate the behavior
of multiple cells. As a counterpoint to quorum sensing, signaling between cells in direct physical
contact has the potential to employ intercellular signals that pass directly between cells, without
an intermediate extracellular stage. Examples include signaling during the formation of transient
multicellular structures, such as the development of spores in Bacillus subtilis and in the fruiting
bodies elaborated by Myxococcus xanthus, or in bacteria that grow as multicellular organisms,
such as filamentous streptomycetes and cyanobacteria. In the latter of these examples, inhibitors
of cellular differentiation in filamentous cyanobacteria are thought to move from cell to cell and
govern the periodic patterning of heterocysts that form in response to deprivation of fixed nitrogen.
Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can be induced to form a
periodic pattern of nitrogen-fixing heterocysts from an unbranched chain of undifferentiated
vegetative cells. Heterocysts occur, on average, at 10-cell intervals, are terminally differentiated,
and differ from vegetative cells morphologically, metabolically, and genetically [1, 2]. They have a
single known function, to supply the remaining vegetative cells of the filament with a bioactive
form of nitrogen, which allows growth of the organism in nitrogen-poor environments. The
elaboration of heterocysts facilitates the spatial separation of an oxygen-labile metabolic process,
nitrogen fixation, from one that evolves molecular oxygen, photosynthesis with photosystem II.
Fixed nitrogen is supplied to vegetative cells from heterocysts, and in return, heterocysts receive
a source of carbon and reductant to compensate for their lack of PS II and the Calvin cycle [3, 4].
Experimental evidence for the phenomenon of “lateral inhibition” of differentiation to explain how
Anabaena “counts to 10” was first described by Wolk in 1967 [5, 6]. More recently, patterning of
differentiation has been shown to be dependent on an activator of differentiation, HetR, and two
inhibitors of differentiation, PatS and HetN, that have properties of intercellular signaling
molecules. HetR is at the center of a regulatory circuit that shares the properties of biological
switches, which turn graded input signals into a binary output: when the switch is “off”, the cell
remains undifferentiated, but when the switch is “turned on”, the differentiation process begins
and eventually becomes irreversible and self-sustaining [7, 8]. HetN or PatS produced in one cell
lowers levels of HetR in adjacent cells [9], and it has been proposed, but not demonstrated, that
the relative positions of cells is conveyed by concentration gradients of PatS and/or HetN
extending from source cells [10, 11].
163
HetR has prominent roles in both the patterning and differentiation of heterocysts. In a wild-type
genetic background, expression of hetR is both necessary and sufficient for differentiation. Its
inactivation prevents development of heterocysts, and over-expression of hetR leads to the
formation of multiple contiguous heterocysts (Mch phenotype), even in the presence of
concentrations of nitrate or ammonia that suppress differentiation in the wild-type [12, 13]. HetR
has DNA-binding activity, which is necessary for heterocyst formation [14], suggesting that its
primary role in promoting differentiation is the regulation of transcription of other developmental
genes. The protein has also been shown to bind directly to the promoter regions of 5 genes, patS,
hepA, hetP, pknE and hetR [14-16]. Induction of hetR by HetR is an example of direct positive
auto-regulation, predicted by patterning models, and the mutual dependence of ntcA, which is
also necessary for differentiation, and hetR creates a second, indirect example of positive auto-
regulation [17]. The recent crystal structure of HetR reveals a dimer with a central DNA-binding
region, two outward facing flaps, and a hood-like domain over the core of the protein [18]. It was
suggested that HetR might serve as a scaffold for the assembly of transcription initiation
complexes.
The patS gene is predicted to encode 17 amino acid protein that is presumably processed to a
smaller, active form, perhaps during export from the cytoplasm to the periplasm of the cell or
directly to a neighboring cell [11]. The active form of PatS has yet to be identified, and a
presumed gradient of PatS has not been demonstrated. However, when confined to the
cytoplasm of the cell that produced it via a translational fusion to GFP, PatS is incapable of
restoring a normal pattern of heterocysts to a patS-mutant strain, suggesting that it must diffuse
from cell to cell to function properly [19]. A synthetic peptide corresponding to the predicted C-
terminal 5 amino acids of PatS (PatS-5; RGSGR) prevents DNA-binding activity of HetR in vitro
[14], prevents differentiation of heterocysts when added to the medium [11], and was recently
shown to bind directly to HetR with a 1:1 stoichiometry [20]. In a genetic selection to identify
residues of the 17 amino acid peptide that are necessary for activity of PatS, mutations were
found only in the RGSGR sequence, with mutations resulting in substitution of the underlined
residues reducing activity. A patS-null mutant has reduced spacing between heterocysts, and
adjacent cells often differentiate, the hallmark of the Mch phenotype (multiple contiguous
heterocysts). Transcription of patS is initially up-regulated in contiguous groups of cells, as shown
by a patS-gfp transcriptional reporter fusion, but between 10 and 12 hours after induction, at
about the same time that cells are irreversibly committed to differentiation, fluorescence has been
resolved to single cells in a pattern that predicts the eventual pattern of heterocysts along
filaments [21].
Interactions between PatS and HetR appear to control formation of the initial pattern of
differentiation, but HetN is necessary for stabilization of the initial pattern and prevents
164
differentiation of cells adjacent to existing heterocysts. It seems likely that it is also involved in
maintenance of the pattern as filaments lengthen. Several cell-generation times after the
formation of an initial Mch pattern by a patS-null mutant, the pattern normalizes to a wild-type-like
pattern [21], suggesting the presence of other patterning factors. In contrast, a patS mutant
conditionally lacking expression of hetN forms an Mch pattern initially like that of the patS mutant,
but the pattern fails to normalize over time, and eventually most cells of the filament differentiate
to form heterocysts [22]. A hetN single mutant has a delayed Mch phenotype; the pattern is
initially wild-type at 24 h after induction but is Mch after 48 h, approximately twice the time from
induction to the formation of an initial pattern of mature heterocysts [10]. The inhibitory activity of
HetN, as for that of PatS, includes blockage of the positive auto-regulation of hetR [10, 23].
The 287 amino-acid HetN protein is predicted to be a reductase in the short chain alcohol
dehydrogenase (ADH) family [24]. Within the sequence of HetN is the PatS-5 sequence, RGSGR,
at positions 132-136, raising the possibility that this same sequence is responsible for the
inhibitory activity of HetN. Experiments showing that the PatS- and HetN-dependent pathways
converge at or just before HetR and the identification of a point mutation in hetR that confers
resistance to suppression by PatS and HetN suggests that the RGSGR sequence of HetN may
be critical for its activity as it is in PatS [22, 25]. The RGSGR motif of HetN and not the predicted
ADH reductase activity is necessary for patterning of heterocysts[26]. When grown with
combined nitrogen, all cells of filaments have a low level of HetN in thylakoid and cytoplasmic
membranes, but upon nitrogen step-down, HetN is degraded [23]. After formation of
proheterocysts, HetN protein and expression of hetN is found exclusively in proheterocysts and
heterocysts. Localization of HetN-YFP fluorescence to the cell periphery is demonstrated in this
study.
MATERIALS AND METHODS
Bacterial strains and growth conditions. Descriptions of strains constructed in this study are
summarized in Table 5.1. Growth of Escherichia coli and Anabaena sp. strain PCC 7120 and its
derivatives, concentrations of antibiotics; induction of heterocyst formation in BG-110 medium,
which lacks a combined-nitrogen source; regulation of PpetE and Pnir expression; and conditions
for photomicroscopy were as previously described [27]. Images were processed in Adobe
Photoshop CS2 and ImageJ.
Construction of plasmids. Descriptions of plasmids constructed in this study are summarized
in Table 5.2 and oligonucleotides relevant to this study are summarized in Table 5.3. Constructs
derived by PCR were sequenced to verify the integrity of the sequence.
165
Plasmid pDR386 is a mobilizable shuttle vector based on pAM504 containing PpetE-hetR
translationally fused to YFP. This plasmid was used to make various HetN-YFP translational
fusion plasmids by replacing hetR with derivatives of hetN. Plasmid pDR386 was derived from
pDR293 [9] by replacing GFP with YFP. The coding region of YFP was amplified via PCR using
pUC57-PS12-yfp [28] as a template with primers YFP-TNL-F and YFP-SacI-R. The PCR product
was cloned as a SmaI-SacI fragment into pDR293 to replace gfp.
Plasmid pRR159 is a mobilizable shuttle vector containing PhetN-hetN translationally fused to YFP.
The insert was amplified via PCR using PCC 7120 chromosomal DNA as template with primers
PhetN-BamHI-Fwd and hetN-SmaI-R and cloned into pDR386 as a BamHI-SmaI fragment.
The plasmids pRR161, pRR162, pRR163 and pRR167 are mobilizable shuttle vectors containing
PpetE-hetN(1-46), PpetE-hetN(1-172), PpetE-hetN and PpetE-hetN(1-192), respectively, translationally
fused to YFP. The inserts were amplified via PCR using pDR320 as template with primers
PpetE-BamHI-F and hetN(1-46)-SmaI-R for plasmid pRR161, PpetE-BamHI-F and hetN(1-172)-
SmaI-R for plasmid pRR162, PpetE-BamHI-F and hetN-SmaI-R for plasmid pRR163, and PpetE-
BamHI-F and HetN(1-192)-SmaI-R for plasmid pRR167. The PCR products were cloned into
pDR386 as BamHI-SmaI fragments.
Plasmids pCO105, pCO107, pCO108, and pCO113 are shuttle vectors based on pAM505
carrying hetN encoding codon deletions Δ2-46, Δ47-176, Δ177-195, and Δ47-128, respectively,
transcriptionally fused to the petE promoter. The fragments used to make the hetN variants were
amplified via overlap extension PCR. The outside primers used to create the constructs were
hetN-EcoRI and hetN-BamHI-R. The following are the internal primers used: hetN-(Δ2-46)-F and
hetN-(Δ2-46)-R for pCO105; hetN-(Δ47-176)-F and hetN-(Δ47-176)-R for pCO107; hetN-(Δ177-
195)-F and hetN-(Δ177-195)-R for pCO108; and hetN-(Δ47-128)-F and hetN-(Δ47-128)-R for
pCO113. The overlap extension PCR products were cloned as EcoRI-BamHI fragments into
pKH256.
Plasmids pCO115, pCO117, pCO118, and pCO121 are mobilizable shuttle vectors containing
PpetE-hetN(Δ2-46), PpetE-hetN(Δ47-176), PpetE-hetN(Δ177-195), and PpetE-hetN(Δ47-128),
respectively, translationally fused to YFP. The fragments used to make the mutant alleles of hetN
were amplified via PCR using pCO105, pCO107, pCO108, and pCO113 as templates,
respectively. The primers used to create the constructs were PpetE-BamH1-F and hetN-Sma1-R.
The PCR products were cloned into pDR386 as BamHI-SmaI fragments to generate the fusions
with YFP.
166
Confocal microscopy
Cells were routinely viewed and imaged as described previously [22]. Confocal microscopy was
performed using an Olympus Fluoview 1000 laser scanning confocal mounted on an IX81
motorized inverted microscope. Fluorescence from Turbo-YFP was detected with an excitation of
525 nm and an emission of 538 nm. All images were processed in Adobe Photoshop CS2. To
estimate levels of fluorescence in parts of images, a two-dimensional plot profile of pixel
intensities along a line drawn on the image was constructed in ImageJ.
Mutagenesis studies
The hypermutator Escherichia coli strain XL1-RED was used to create a library of mutations
within plasmids pSMC115 in a method described previously[27] and subsequently introduced into
the wild-type via conjugation.
Table 5.1. Bacterial strains used in Chapter 5
Anabaena sp. strain
Relevant characteristic(s) Source or reference
PCC 7120 Wild-type Pasteur culture collection
UHM150 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(R223W)
[29]
UHM163 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(R250K)
[30]
UHM169 hetR-deletion strain with chromosomal PhetR-hetR replaced by PhetR-hetR(D256E)
[30]
167
Table 5.2. Plasmids used in Chapter 5
Plasmids Relevant characteristic(s) Source or reference
pAM504 Mobilizable shuttle vector for replication in E. coli and Anabaena; Km
r Neo
r
[31]
pSMC115 pAM504 with PpetE-hetN [10]
pDR320 pAM504 with PpetE-hetN [32]
pDR386 pAM504 with PpetE-hetR-yfp This study
pRR159 pAM504 with PhetN-hetN-yfp This study
pRR163 pAM504 with PpetE-hetN-yfp This study
pRR161 pAM504 with PpetE-hetN(1-46)-yfp This study
pRR162 pAM504 with PpetE-hetN(1-172)-yfp This study
pRR167 pAM504 with PpetE-hetN(1-192)-yfp This study
pCO115 pAM504 with PpetE-hetN(∆2-46)-yfp This study
pCO117 pAM504 with PpetE-hetN(∆47-176)-yfp This study
pCO118 pAM504 with PpetE-hetN(∆177-195)-yfp This study
pCO121 pAM504 with PpetE-hetN(∆47-128)-yfp This study
Table 5.3. Oligonucleotides used in Chapter 5
Primer no.
Primer name Sequence (5’ to 3’)
1 YFP-TNL-F ATATACCCGGGGATCGGCGTCAGCTAGCAGCGGCGCCTTGCTGTTC
2 YFP-SacI-R ATATAGAGCTCTCAGCTGGTGTCTCCGGAAC
3 PhetN-BamHI-Fwd ATATAGGATCCAGGAGAAGACGCGATGAATC
4 hetN-SmaI-R ATATACCCGGGATGAGCGATGAGACTCAACAG
5 PpetE-BamHI-F ATATAGGATCCCTGAGGTACTGAGTACACAG
6 hetN(1-46)-SmaI-R ATATACCCGGGACGTTTGGGCTAATCCTGATTG
7 hetN(1-172)-SmaI-R GGATCCTTATAATTTTTCTCTTTCTGTCAAAGCGGCGCGTGCG
8 HetN(1-192)-SmaI-R ATTATCCCGGGACCCAGTTTGCGAGACATAGCC
9 hetN-(Δ2-46)-F GGTTACAATGTGTAATGCGGTTAAGGCTGC
10 hetN-(Δ2-46)-R CCGCATTACACATTGTAACCTGCTAGTCTCTGTTGACAGCCGTTTGGGCTAATCCTGATTG
11 hetN-(Δ47-176)-F AGCCCAAACGGGTGTCAACATTTCGGTGGTTTG
12 hetN-(Δ47-176)-R TGTTGACAGCCGTTTGGGCTAATCCTGATTG
13 hetN-(Δ177-195)-F AGTTGGTACTGATACTCGTGTCTCTGCGCCCACGAGTATCAGTACCAACTAATTCCTGAC
14 hetN-(Δ177-195)-R CACGAGTATCAGTACCAACTAATTCCTGAC
15 hetN-(Δ47-128)-F AGCCCAAACGATGATGGAACGCGGTAGTG
16 hetN-(Δ47-128)-R GTTCCATCATCGTTTGGGCTAATCCTGATTG
168
RESULTS
HetN-YFP localizes to heterocysts in stains expressing overactive alleles of hetR
The 287-residue HetN
protein can be divided into
4 domains based on
hydrophobicity (Fig. 5.1).
An N-terminal
hydrophobic domain
(shown in gray), which
may serve as a leader
peptide, was found to consist of amino acids 1 – 46 (N-terminal hydrophobic domain). An N-
terminal hydrophilic domain containing the RGSGR motif and putative catalytic triad was found at
amino acids 47 – 176 (N-terminal hydrophilic domain). A second hydrophobic domain (shown in
gray), which has a length consistent with that of a central transmembrane domain, was found at
amino acids 177 – 195 (central hydrophobic domain). Lastly, a C-terminal hydrophilic domain
was found at amino acids 196 – 287 (C-terminal domain). The presence of two hydrophobic
domains is consistent with association of HetN to the cell membrane. In addition, HetN has been
detected in immunoblot experiments using purified thylakoid and plasma membranes[23].
Cytological evidence of the localization of HetN is hampered by the role of this protein in the
regulation of heterocyst development. Translational fusions of HetN to YFP (yellow fluorescent
protein) inhibit the formation of heterocysts (Fig.5.2A, 5.2B). For this reason, localization of HetN-
YFP to vegetative cells and heterocyst cells cannot be determined in the wild-type (Fig. 5.2A,
5.2B). To determine the localization of HetN-YFP in both cell types, variants of HetR less
sensitive to inhibition by PatS- and HetN-mediated inhibition of heterocyst differentiation were
used. Because the R223W, R250K, D256E forms of HetR differentiate heterocysts even when
HetN is overexpressed or present in multicopy (shown in Figure 5.2) [30, 33], fusion to YFP was
hypothesized to allow for visualization of HetN-YFP in both cell types. In strains with the
conservative substitutions R250K and D256E (UHM163 and UHM169, respectively), expression
of hetN-yfp fluorescence from the native hetN promoter was concentrated uniformly in
heterocysts (Fig.5. 2, C-F). In vegetative cells, fluorescence was below the level of detection
(Fig. 5.2, C-F). Thus the localization of HetN-YFP differs in vegetative cells and heterocysts.
Heterocysts did not form in a strain with the R223W substitution (data not shown). Introduction of
the empty vector plasmid into these strains did not result in any observable fluorescence, as
expected (data not shown). Finally, the formation of heterocysts in strains UHM163 and
Figure 5.1. Schematic of the domains present in the HetN protein.
169
UHM169, despite elevated levels of hetN on a plasmid, further confirms the overactive nature of
the R250K and D256E alleles of hetR.
Localization of HetN-YFP to the cell periphery
Further studies were done to examine the localization of HetN-YFP. Fluorescence from full-
length HetN fused at its C-terminus to YFP and driven by the petE promoter was observed
primarily at the periphery of cells in filaments using confocal microscopy (rather than fluorescence
microscopy), consistent with localization to the plasma membrane (Fig. 5.3A). In addition, a more
diffuse fluorescence signal was observed from the interior region of cells, consistent with previous
detection of HetN in thylakoid membranes. This result differs from previous studies
demonstrating the uniform concentration of HetN-YFP fluorescence in heterocysts (Fig. 5.2).
However, this discrepancy can be attributed to (i) the use of confocal microscopy (Fig. 5.3), which
achieves greater contrast and resolution than traditional fluorescence microscopy (Fig. 5.2), and
(ii) expression of hetN-yfp from the native hetN promoter in previous studies (Fig. 5.2).
Figure 5.2. Localization of HetN-YFP. Bright-field (A, C, E) and fluorescence
microscopy (B, D, F; false-colored green) of PCC 7120 (A, B), strain
UHM163 (C, D) and strain UHM169 (E, F) with a plasmid carrying PhetN-hetN-
yfp 48 hours after removal of combined nitrogen. Micrographs were acquired
using identical microscope and camera settings. Carets indicate heterocysts.
170
Again, since the fusion protein prevented the formation of heterocysts, it was not possible to view
the location of HetN in heterocysts in a wild-type genetic background. To facilitate visualization of
HetN-YFP in heterocysts, plasmid-borne hetN-yfp fusions were put into a derivative of PCC 7120
that continues to form heterocysts even when extra copies of hetN are introduced [20]. This
strain, UHM163, has the wild-type copy of hetR replaced by an allele that encodes a R250K
substitution. With transcription of hetN-yfp from either the native promoter or the petE promoter,
fluorescence from YFP was seen primarily at the periphery of heterocysts (Fig. 5.3B, 5.C). With
expression from the petE promoter, fluorescence was seen in both cell types, whereas with the
native hetN promoter fluorescence was seen only in heterocysts, consistent with heterocyst-
specific expression of hetN [10] and previous studies (Fig 5.2, C-F).
C-terminal translational fusions to YFP were also made with the following variants of HetN:
HetN(1-47), HetN(1-176), HetN(1-192), HetN(∆2-46), HetN(∆47-128), HetN(∆47-176), and
HetN(∆177-195), where the numbers in parentheses represent either the portion of HetN in the
fusion or, if preceded by a ∆ symbol, a protein lacking the amino acids indicated. Heterocyst
differentiation in a wild-type background was suppressed with all fusions in which the RGSGR
motif was present. However, with one exception, no fluorescence from YFP was observed. In
filaments with the construct encoding HetN(1-192)-YFP, which lacks the C-terminal domain of
HetN, YFP-dependent fluorescence was observed primarily at cell junctions (Fig. 5.3D). In
particular, rings of fluorescence circumscribed cell septa. Fusions were made with expression
from the native promoter of hetN or the petE promoter, but fluorescence was observed only when
the petE promoter was used. Rings of fluorescence were detected in vegetative cells but absent
from heterocysts. In addition, HetN-YFP-dependent fluorescence with both full-length HetN and
the C-terminal deletion was reduced from the cytoplasm of heterocysts relative to that from
vegetative cells (Fig. 5.3C, D). In a wild-type genetic background, the fusion protein inhibited
differentiation, so fluorescence could only be observed in vegetative cells (data not shown).
When the background strain was UHM163, which forms heterocysts even when hetN is over-
expressed ectopically, rings of fluorescence similar to those in the wild-type were observed in
vegetative cells but lacking in heterocysts (Fig. 5.3D).
171
Figure 5.3. Localization of HetN-YFP using confocal microscopy. Confocal micrographs of
PCC 7120 with a plasmid carrying PpetE-hetN-yfp (A). From left to right: bright-field, chlorophyll
autofluorescence, HetN-YFP fluorescence, and composite image. Arrows indicate areas
showing the lack of overlap between autofluorescence and HetN-YFP at the periphery of cells.
UHM163, a strain that forms heterocysts even when hetN is in extra copy or overexpressed, with
a plasmid carrying PpetE-hetN-yfp (B). UHM163 with a plasmid carrying PhetN-hetN-yfp (C). Top
panels are bright-field images and bottom panels are corresponding fluorescence images
corresponding to a 0.2 m section of the filament for (B) and (C). UHM163 with plasmid carrying
PpetE-hetN(1-192)-yfp (D). Bright-field (top-left) and fluorescence (top-right) images are shown.
Rings of fluorescence indicated by arrows are apparent when the three-dimensional image at
top-left is rotated 50 degrees horizontally. A 7x and 3x digital zoom on the confocal was used
for (A) and (D), respectively. Carets indicate heterocysts.
172
hetN mutagenesis studies to identify necessary sites for function
A positive selection was performed to identify necessary sites for HetN function. The
hypermutator E. coli strain XL1-RED was used to introduce mutations onto a plasmid carrying
PpetE-hetN. Overexpression of hetN in the wild-type using this plasmid inhibits heterocyst
development even in the absence of a source of fixed nitrogen. Mutations in hetN that allow the
wild-type to grow under these conditions were hypothesized to represent sites that functionally
suppress HetN activity. However, plasmids isolated from this study did not have a mutation in
hetN nor the PpetE promoter. Instead, all plasmids isolated from the study contained a sequence
with homology to a transposon. The sequence may have transposed onto the plasmid after
transformation into the hypermutator strain. The event appeared to have subsequently biased
the selection against the desired mutations in hetN. This finding may explain why a greater than
expected number of colonies arose under the selection conditions.
DISCUSSION
HetN and PatS are required for different stages of heterocyst patterning. PatS is necessary for
formation of the initial pattern of cells in a filament composed exclusively of vegetative cells that
will differentiate after a transition to conditions that require diazotrophy for growth. A hetN-mutant
strain is capable of forming this de novo pattern whereas a patS mutant is not [10, 11]. HetN is
necessary for stabilization of this initial pattern. The wild-type pattern of heterocysts initially
formed in a hetN-mutant turns Mch shortly thereafter [10]. Genetic and mathematical modeling
evidence relating to placement of additional heterocysts between existing ones as vegetative
cells divide to maintain the pattern and ratio of heterocysts to vegetative cells suggests that a
HetN-dependent signal produced in mature heterocysts is responsible for specification of a region
of cells at the midpoint between two heterocysts, and that PatS resolves this region to a single
cell that will differentiate [11, 34]. Despite the different roles of PatS and HetN in patterning, the
RGSGR motif is essential to the function of both. In over-expression studies, conservative
substitutions in any of the five amino acids reduced the ability of HetN to suppress differentiation.
Alteration of either of the two arginines appeared to eliminate suppression by HetN, even though
the gene for HetN was expressed at a level higher than that experienced in the wild-type
organism. These results are comparable to those found with substitutions in PatS. In this case, a
genetic selection identified four of the five amino acids of the RGSGR motif as necessary for
suppression of differentiation [11]. Whether or not substitution of the fifth has the same effect is
unknown. To take the analysis of HetN further, a single nucleotide or two corresponding to a
codon in the RGSGR motif was changed in the chromosome of the wild-type. Each of the strains
with an allele of hetN encoding a conservative substitution in one of the amino acids of the
173
RGSGR motif resembled the hetN-deletion strain more than the wild-type; the number of cells
that differentiated was higher than in wild-type and instead of a periodic pattern of single
heterocysts, the Mch phenotype was observed. As for the over-expression studies, substitution
of the two arginines had the most dramatic effect, producing strains with phenotypes
indistinguishable from that of the hetN-deletion strain. In contrast, conservative substitutions in
the putative catalytic triad of ADH activity had no effect on the function of HetN in suppression of
differentiation or patterning of heterocysts. The RGSGR motif of HetN and not predicted ADH
reductase activity was necessary for patterning of heterocysts.
Three previous studies have addressed the quality of HetN necessary for its ability to suppress
heterocyst differentiation, with varied interpretations. In the first, mutation of residues in the
RGSGR sequence of HetN was reported to have no effect on the ability of HetN to suppress
differentiation when the corresponding alleles of hetN were over-expressed [23]. In addition to
R132K and R136L substitutions, the report claims that G134S and S135D substitutions were
made and had no effect. However, this is confusing because the HetN sequence is S134 and
G135, not G134 and S135 as indicated, so what substitutions were actually made is unclear. In
the second study, substitution of one of the three amino acids in the predicted catalytic triad of
ADH activity in HetN prevented suppression of heterocyst differentiation by over-expression of
the corresponding mutant allele [35]. However, substitution of the other two had no effect. In the
another study, over-expression of hetN was shown to cause post-translational decay of HetR,
which presumably contributes to suppression of heterocyst formation. When the RGSGR motif
was replaced by RGDAR, over-expression of the corresponding allele of hetN did not lower levels
of HetR in filaments nor did it suppress differentiation [9], suggesting that the RGSGR motif is
necessary for suppression. The most recent study [26] is the most comprehensive with respect
to the regions of HetN that are necessary for inhibition and patterning. It clearly shows that the
RGSGR motif of HetN and not the predicted ADH reductase activity is necessary for patterning of
heterocysts.
The RGSGR motif as the primary functional group of HetN and PatS in patterning is consistent
with known activities of HetN and PatS. In electrophoretic mobility shift assays the synthetic
RGSGR peptide prevents the binding of HetR to a region of hetR-promoter DNA that includes the
autoregulated transcriptional start point at position -271, and over-expression of hetN or patS
prevents transcription from this same tsp [8, 14]. Addition of RGSGR peptide to medium causes
posttranslational decay of HetR protein in whole filaments, as does over-expression of hetN or
patS in all cells of filaments [9]. Over-expression of hetN or patS in individual cells of filaments
also causes decay of HetR levels in adjacent groups of cells, suggesting that the HetN- and PatS-
dependent signals that diffuse from cell to cell contain the RGSGR sequence.
174
Individual deletions of the predicted signal sequence, membrane-spanning hydrophobic domain,
and C-terminal domain had no effect on suppression of differentiation or patterning[26].
However, two pieces of evidence suggest that it is not solely the RGSGR motif of HetN that is
necessary for normal suppression and patterning of heterocysts. First, it has been reported that a
K159E substitution prevents the ability of HetN to suppress differentiation when the gene
encoding the protein is over-expressed [35]. This non-conservative substitution of a positively
charged amino acid with a negatively charged one, unlike the conservative K159R substitution
used in a later study, apparently alters HetN sufficiently to prevent it from suppressing formation
of heterocysts. The second piece of evidence is the formation of fewer heterocysts by a strain
with the wild-type hetN replaced with an allele encoding a deletion of amino acids 47 – 128, which
would lack the N-terminal hydrophilic domain up to three amino acids before the RGSGR
sequence. The resulting protein appears to lead to suppression of differentiation of cells in a
larger region of a filament than does the wild-type protein. Possible explanations of this
enhanced range of lateral inhibition include a more active form of the protein, a longer half-life, an
increased rate of diffusion or increased production of the mature form of HetN that presumably is
transferred between cells.
Despite sharing a functional protein motif, the forms of HetN and PatS that diffuse from cell to cell
and presumably interact with HetR may be different and remain unknown. Increased expression
of hetN in cells that will become heterocysts around the time of commitment to differentiation is
very different from that of patS, which occurs in groups of cells very soon after induction of
filaments to differentiate by growth-limiting levels of fixed nitrogen in the medium [21, 36]. The
difference in expression patterns reflects the respective roles of HetN and PatS in patterning.
The involvement of two separate proteins with a similar functional motif, rather than one protein
with two modes of expression, suggests that intrinsic differences in the mature HetN- and PatS-
dependent signals play roles in patterning. Recent mathematical modeling of heterocyst pattering
with two inhibitors having different rates of diffusion is consistent with this notion [34].
HetN has been reported to be a membrane protein that resides in both cytoplasmic and thylakoid
membranes. In this study, fluorescence from HetN-YFP was observed primarily in the cell
envelope, presumably in the cytoplasmic membrane, with a more diffuse, lower level of
fluorescence from the interior of the cell, suggesting that the concentration of HetN is higher than
that in thylakoid membranes. HetN-YFP-dependent fluorescence intensity in the cell membrane
was about twice that from thylakoid membranes, but given the much larger surface area of
thylakoid membranes, the majority of HetN in a cell is likely to be in thylakoid membranes,
consistent with earlier Western blot analysis [23]. The only fusions to YFP in this study for which
175
fluorescence was observed were those where YFP either replaced or was at the end of the C-
terminal domain, suggesting that this domain of the protein is located in the cytoplasm. Folding of
GFP is efficient only in the cytoplasm of bacterial cells, which has been used to map the topology
of inner-membrane proteins [37]. The YFP used in the fusions is a derivative of GFP and would
be expected to behave in a similar fashion. If the C-terminal domain is in the cytoplasm, the N-
terminal hydrophilic domain, which contains the RGSGR motif, may be located in the periplasm if
the central hydrophobic domain at amino acids 177 – 195 spans the cytoplasmic membrane.
However, it is difficult to interpret the lack of fluorescence with fusions to other parts of HetN,
which could be explained by the creation of an unstable protein with a short half-life.
Lateral inhibition implies the intercellular transfer of a signal that suppresses differentiation.
Based on the deletion studies, the essential part of HetN that comprises the suppression signal
appears to be little more than the RGSGR motif. This raises the possibility that the signal that
diffuses from cell to cell may be a peptide processed from the full protein. Location of HetN in the
cytoplasmic membrane suggests three potential routes of transfer between cells. First, the
periplasm of cells in filaments is contiguous, and there is evidence both for and against the
diffusion of proteins between cells via the periplasmic space [38, 39]. Processing of the N-
terminal domain after insertion in the membrane could release a soluble fragment of HetN that
contains the RGSGR motif and diffuses through the contiguous periplasmic space. Uptake into
the cytoplasm would be necessary to allow interaction with HetR. Inhibition of heterocyst
differentiation by addition of synthetic RGSGR peptide to the medium [11] suggests that transport
into the cytoplasm is possible for such a molecule or that it can act from the periplasm. The
second potential route of transfer is direct exchange between the membranes of adjacent cells.
Although the cytoplasmic membranes at cell septa are not shared by adjacent cells and so are
not continuous between cells, they are in close proximity [40], and could be bridged by an as yet
uncharacterized intermembrane transport system. The HetN-dependent patterning signal does
not appear to travel from cell to cell via one of these two potential routes because localization of
HetN to the membrane is not required for proper patterning of heterocysts. Deletion of the
putative transmembrane or signal sequence prevented HetN-YFP from localizing to the
membrane and had no effect on heterocyst patterning when deleted from the chromosomal copy
of hetN. In its simplest form, transfer of the RGSGR-containing portion of HetN via the
cytoplasmic membrane or the periplasmic space would likely require localization to the
membrane. The most likely route of transfer is via inter-cytoplasmic exchange mediated by SepJ,
FraC, and/or FraD, which are located at intercellular septa. Intercellular transfer of the
fluorescent molecular tracer calcein occurs in the wild-type, but is impaired in strains lacking one
of the three proteins [41, 42]. Calcein has a molecular weight of 623 Da, slightly more than that
of RGSGR peptide. An RGSGR-containing peptide could be processed from a subpopulation of
176
HetN prior to insertion into the membrane and be transferred via inter-cytoplasmic pores.
Deletion of the putative transmembrane and signal sequence domains of HetN-YFP prevented
not only localization to the membrane, but also detectable fluorescence. The lack of fluorescence
is likely attributable to proteolytic digestion of a protein that cannot fold properly. Processing of
an RGSGR-containing peptide from HetN in the cytoplasm prior to proteolytic digestion would be
consistent with retention of function of these truncated forms of HetN even in the absence of an
accumulation of HetN-YFP that can be detected by fluorescence microscopy. In addition,
preliminary results with a strain lacking SepJ, which has been shown to be necessary for inter-
cytoplasmic exchange of calcien, indicate that SepJ is necessary for decay of HetR in cells
adjacent to those overexpressing hetN in genetic mosaics [9]. Taken together, these results
suggest that an RGSGR-containing peptide derived from HetN diffuses between cells via direct
cytoplasmic exchange to direct pattering of heterocysts.
177
REFERENCES CITED
1. Golden, J.W. and H.-S. Yoon, Heterocyst development in Anabaena. Curr. Opin.
Microbiol., 2003. 6: p. 557-563.
2. Zhang, C.-C., et al., Heterocyst differentiation and pattern formation in cyanobacteria: a
chorus of signals. Mol. Microbiol., 2006. 59(2): p. 367-375.
3. Meeks, J.C., et al., Pathways of assimilation of [13
N]N2 and 13
NH4+ by cyanobacteria with
and without heterocysts. J. Bacteriol., 1978. 134(1): p. 125-130.
4. Wolk, C.P., Movement of carbon from vegetative cells to heterocysts in Anabaena
cylindrica. J. Bacteriol., 1968. 96: p. 2138-2143.
5. Haselkorn, R., How cyanobacteria count to 10. Science, 1998. 282: p. 891-892.
6. Wolk, C.P., Physiological basis of the pattern of vegetative growth of a blue-green alga.
Proc. Natl. Acad. Sci. U.S.A., 1967. 57: p. 1246-1251.
7. Ferrell, J.E.J., Self-perpetuating states in signal transduction: positive feedback, double-
negative feedback and bistability. Curr. Opin. Cell Bio., 2002. 14: p. 140-148.
8. Rajagopalan, R. and S.M. Callahan, Temporal and spatial regulation of the four
transcription start sites of hetR from Anabaena sp. strain PCC 7120. J. Bacteriol., 2010.
192: p. 1088-1096.
9. Risser, D.D. and S.M. Callahan, Genetic and cytological evidence that heterocyst
patterning is regulated by inhibitor gradients that promote activator decay. Proc. Natl.
Acad. Sci., 2009. 106: p. 19884-19888.
10. Callahan, S.M. and W.J. Buikema, The role of HetN in maintenance of the heterocyst
pattern in Anabaena sp. PCC 7120. Mol. Microbiol., 2001. 40: p. 941-950.
11. Yoon, H.-S. and J.W. Golden, Heterocyst pattern formation controlled by a diffusible
peptide. Science, 1998. 282: p. 935-938.
12. Buikema, W.J. and R. Haselkorn, Characterization of a gene controlling heterocyst
development in the cyanobacterium Anabaena 7120. Genes Dev., 1991. 5: p. 321-330.
13. Buikema, W.J. and R. Haselkorn, Expression of the Anabaena hetR gene from a copper-
regulated promoter leads to heterocyst differentiation under repressing conditions. Proc.
Natl. Acad. Sci., U.S.A., 2001. 98: p. 2729-2734.
14. Huang, X., Y. Dong, and J. Zhao, HetR homodimer is a DNA-binding protein required for
heterocyst differentiation, and the DNA-binding activity is inhibited by PatS. Proc. Natl.
Acad. Sci. U.S.A., 2004. 101(14): p. 4848-4853.
15. Higa, K.C. and S.M. Callahan, Ectopic expression of hetP can partially bypass the need
for hetR in heterocyst differentiation by Anabaena sp. strain PCC 7120. Mol. Microbiol.,
2010. 77: p. 562-574.
178
16. Saha, S.K. and J.W. Golden, Overexpression of pknE blocks heterocyst development in
Anabaena sp. strain PCC 7120. J. Bacteriol., 2011. 193: p. 2619-2629.
17. Muro-Pastor, A.M., et al., Mutual dependence of the expression of the cell differentiation
regulatory protein HetR and the global nitrogen regulator NtcA during heterocyst
development. Mol. Microbiol., 2002. 44: p. 1377-1385.
18. Kim, Y., et al., Structure of the transcription factor HetR required for heterocyst
differentiation in cyanobacteria. Proc. Natl. Acad. Sci., 2011. 108: p. 10109-10114.
19. Wu, X., et al., patS minigenes inhibit heterocyst development of Anabaena sp. strain
PCC 7120. J. Bacteriol., 2004. 186: p. 6422-6429.
20. Feldman, E.A., et al., Evidence for direct binding between HetR from Anabaena sp. PCC
7120 and PatS-5. Biochemistry, 2011. 50: p. 9212-9224.
21. Yoon, H.-S. and J.W. Golden, PatS and products of nitrogen fixation control heterocyst
pattern. J. Bacteriol., 2001. 183: p. 2605-2613.
22. Borthakur, P.B., et al., Inactivation of patS and hetN causes lethal levels of heterocyst
differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol.
Microbiol., 2005. 57: p. 111-123.
23. Li, B., X. Huang, and J. Zhao, Expression of hetN during heterocyst differentiation and its
inhibition of hetR up-regulation in the cyanobacterium Anabaena sp. PCC 7120. FEBS
Lett., 2002. 517: p. 87-91.
24. Black, T., A. and C.P. Wolk, Analysis of a Het- mutation in Anabaena sp. strain PCC 7120
implicates a secondary metabolite in the regulation of heterocyst spacing. J. Bacteriol.,
1994. 176: p. 2282-2292.
25. Khudyakov, I.Y. and J.W. Golden, Different functions of HetR, a master regulator of
heterocyst differentiation in Anabaena sp. PCC 7120, can be separated by mutation.
Proc. Natl. Acad. Sci. U.S.A., 2004. 101: p. 16040-16045.
26. Higa, K.C., et al., The RGSGR amino acid motif of the intercellular signaling protein,
HetN, is required for patterning of heterocysts in Anabaena sp. strain PCC 7120. Mol.
Microbiol., 2012. 83: p. 682-693.
27. Risser, D.D. and S.M. Callahan, Mutagenesis of hetR reveals amino acids necessary for
HetR function in the heterocystous cyanobacterium Anabaena sp. strain PCC 7120. J.
Bacteriol., 2007. 189: p. 2460-2467.
28. Norris, M.H., et al., Stable, site-specific fluorescent tagging constructs optimized for
Burkholderia species. Appl. Environ. Microbiol., 2010. 76: p. 7635-7640.
29. Callahan, S.M., unpublished.
30. Feldman, E.A., et al., Evidence for direct binding between HetR from Anabaena sp. PCC
7120 and PatS-5. Biochmistry, 2011. 50: p. 9212-9224.
179
31. Wei, T.-F., R. Ramasubramanian, and J.W. Golden, Anabaena sp. strain PCC 7120 ntcA
gene required for growth on nitrate and heterocyst development. J. Bacteriol., 1994. 176:
p. 4473-4482.
32. Risser, D.D. and S.M. Callahan, Genetic and cytological evidence that heterocyst
patterning is regulated by inhibitor gradients that promote activator decay. Proc Natl Acad
Sci U S A, 2009. 106(47): p. 19884-8.
33. Khudyakov, I.Y. and J.W. Golden, Different functions of HetR, a master regulator of
heterocyst differentiation in Anabaena sp. PCC 7120, can be separated by mutation.
Proc Natl Acad Sci U S A, 2004. 101(45): p. 16040-5.
34. Zhu, M., S.M. Callahan, and J.A. Allen, Maintenance of heterocyst patterning in a
filamentous cyanobacterium. J. Biol. Dynamics, 2010.
35. Liu, J. and W.-L. Chen, Characterization of HetN, a protein involved in heterocyst
differentiation in the cyanobacterium Anabaena sp. strain PCC 7120. FEMS Microbiol.
Lett., 2009. 297: p. 17-23.
36. Bauer, C.C., et al., Suppression of heterocyst differentiation in Anabaena sp. strain PCC
7120 by a cosmid carrying wild-type genes encoding enzymes for fatty acid synthesis.
FEMS Microbiol. Lett., 1995. 151: p. 23-30.
37. Drew, D., et al., Rapid topology mapping of Escherichia coli inner-membrane proteins by
prediction and PhoA/GFP fusion analysis. Proc. Natl. Acad. Sci., 2002. 99: p. 2690-2695.
38. Mariscal, V., A. Herrero, and E. Flores, Continuous periplasm in a filamentous,
heterocyst-forming cyanobacterium. Mol. Microbiol., 2007. 65: p. 1139-1145.
39. Zhang, L.-C., et al., Existence of periplasmic barriers preventing green fluorescent protein
diffusion from cell to cell in the cyanobacterium Anabaena sp. strain PCC 7120. Mol.
Microbiol., 2008. 70: p. 814-823.
40. Flores, E., et al., Is the periplasm continuous in filamentous multicellular cyanobacteria?
Trends Microbiol, 2005. 14: p. 439-443.
41. Merino-Puerto, V., et al., Fra proteins influencing filament integrity, diazotrophy and
localization of septal protein SepJ in the heterocyst forming cyanobacterium Anabaena
sp. Mol. Microbiol., 2010. 75: p. 1159-1170.
42. Mullineaux, C.W., et al., Mechanism of intercellular molecular exchange in heterocyst-
forming cyanobacteria. EMBO J, 2008. 27: p. 1299-1308.
180
APPENDIX A. PEER REVIEWED PUBLICATION: The putative phosphatase all1758 is
necessary for normal growth, cell size, and synthesis of the minor heterocyst-specific
glycolipid in the cyanobacterium Anabaena sp. strain PCC 7120
MICROBIOLOGY Vol. 158, p. 380-389
Copyright © 2012, Society for General Microbiology Journals. All Rights Reserved.
Sasa K. Tom and Sean M. Callahan
*
Department of Microbiology, University of Hawaii, Honolulu, HI 96822
Received 16 September 2011/Revised 30 October 2011/Accepted 1 November 2011
ABSTRACT
The filamentous cyanobacterium Anabaena sp. strain PCC 7120 differentiates nitrogen-fixing
heterocysts arranged in a periodic pattern when deprived of a fixed source of nitrogen. In a
genetic screen for mutations that prevent diazotrophic growth, open reading frame all1758, which
encodes a putative serine/threonine phosphatase, was identified. Mutation of all1758 resulted in
a number of seemingly disparate phenotypes that included a delay in the morphological
differentiation of heterocysts, reduced cell size, and lethality under certain conditions. The mutant
was incapable of fixing nitrogen under both oxic and anoxic conditions, and lacked the minor
heterocyst-specific glycolipid. Pattern formation, as indicated by the timing and pattern of
expression from the promoters of hetR and patS fused transcriptionally to the gene for GFP, was
unaffected by mutation of all1758, suggesting that its role in the formation of heterocysts is limited
to morphological differentiation. Transcription of all1758 was constitutive with respect to both cell
type and conditions of growth, but required a functional copy of all1758. The reduced cell size of
the all1758 mutant and the location of all1758 between the cell division genes ftsX and ftsY may
be indicative of a role for all1758 in cell division. Taken together, these results suggest that the
protein encoded by all1758 may represent a link between cell growth, division and regulation of
the morphological differentiation of heterocysts.
181
INTRODUCTION
Heterocysts are terminally differentiated, non-dividing cells that allow the simultaneous execution
of two incompatible processes, fixation of nitrogen and oxygen-evolving photosynthesis, in some
filamentous cyanobacteria. They maintain a micro-oxic environment where oxygen-labile
nitrogenase can function. The envelope of heterocysts includes a layer of distinct glycolipid that
reduces the diffusion of molecular oxygen into cells, an outer layer of heterocyst-specific
exopolysaccharides that protect the integrity of the glycolipid layer, and increased respiration
reduces the level of molecular oxygen that does enter heterocysts [1]. Fixed nitrogen from
heterocysts supports the growth of vegetative cells in the filament, which in turn supply
heterocysts with fixed carbon [2, 3]. In the cyanobacterium Anabaena sp. PCC 7120 heterocysts
are arranged in a periodic pattern at intervals of approximately 10 cells along unbranched
filaments under conditions that require fixation of nitrogen for growth of the organism [4].
Activation of the heterocyst differentiation signaling pathway in response to nitrogen limitation
leads to an accumulation of the metabolite 2-oxoglutarate (2-OG) in cells [5]. Binding of 2-OG
stimulates the DNA-binding activity of the global transcriptional regulator of nitrogen and carbon
metabolism in cyanobacteria, NtcA [6]. NtcA indirectly leads to upregulation of the master
regulator of heterocyst differentiation, hetR, which feeds back on the regulation of transcription of
ntcA [7], and together with NtcA, directly or indirectly activates genes involved in the patterning
and morphogenesis of heterocysts [8]. Induction of differentiation, pattern formation, and
morphogenesis involves the transcription of hundreds of genes specific for the formation of
heterocysts.
The reversibility of protein phosphorylation mediated by kinases and phosphatases is an
essential part of many signaling cascades and regulatory networks. In Anabaena sp. genes with
homology to signaling components have been reported to influence nitrogen metabolism and the
early regulatory stages of heterocyst development. NrrA which encodes a response regulator of
the OmpR family, acts early in the differentiation process by directly upregulating hetR expression
[9]. The PP2C-type protein phophatases PrpJ1 and PrpJ2 are also involved in the initiation of
heterocyst development through mutual regulation of both ntcA and hetR [10]. The protein
kinases Pkn41 and Pkn42, which contain Ser/Thr-kinase and His-kinase domains respectively,
are cotranscribed specifically under iron deficient conditions and regulated by NtcA [11]. The
nitrogen regulatory protein PII encoded by glnB, is differentially modified in the two cell types. It
goes from a phosphorylated to non-phosphorylated state during transition from vegetative cell to
heterocyst [12]. The pknE gene lies 301 bp downstream from the protein phosphatase 1/2A/2B
homolog encoded by prpA. Both pknE and prpA inactivation mutants produce aberrant
182
heterocysts [13]. Overexpression of the putative Ser/Thr kinase encoded by pknE from its native
promoter inhibited heterocyst development, possibly through inhibition of HetR [14]. Another
protein that appears to affect HetR, PatA, contains a phophoacceptor domain with homology to
the response regulator CheY, although a corresponding histidine kinase has not been isolated. It
appears to attenuate the negative regulation of heterocyst differentiation by PatS and HetN [15],
while promoting the activity, and limiting the accumulation, of HetR [16].
In addition, protein phosphorylation has also been implicated in the later stages of development,
in particular during the process of heterocyst maturation. Formation of the minor heterocyst
glycolipid involves two protein kinases of the hstK family, Pkn30 and Pkn44, which contain both
an N-terminal Ser/Thr kinase domain and a C-terminal His-kinase domain [17]. PrpJ1 has been
shown to regulate the synthesis of the major heterocyst glycolipid [18]. Alr0117 and HepK
(All4496) both encode putative two-component system sensory histidine kinases that appear to
be involved in the induction of hepA, one of the genes responsible for synthesis of the heterocyst
polysaccharide layer [19-21]. The manganese-dependent Ser/Thr protein phophatase of the PPP
family DevT (Alr4674) accumulates in mature heterocysts, is not regulated by NtcA, and appears
to have a role in the later steps of heterocyst differentiation (Espinosa et al., 2010). In this study,
the isolation and characterization of a gene encoding a putative PP2C-type protein phosphatase,
all1758 is described.
MATERIALS AND METHODS
Bacterial strains and growth conditions. Strains used in this study are described in Table 1.
The growth of Escherichia coli and Anabaena sp. strain PCC 7120 and its derivatives;
concentrations of antibiotics; and induction of heterocyst formation in BG-110, which lacks a
combined-nitrogen source; regulation of PpetE expression; and conditions for photomicroscopy
were as previously described [22]. Images were processed in Adobe Photoshop CS2. To avoid
complications from the vacuolization phenotype observed with strains UHM183 and UHM184
upon growth in BG-11 liquid medium, which contains a source of combined nitrogen, these
strains were transferred from solid BG-11 medium to liquid BG-110 medium for induction of
heterocyst differentiation. Plasmids were conjugated from E. coli into Anabaena strains as
previously described [23].
Construction of plasmids used in this study. Plasmids used in this study are described in
Table 1. Oligonucleotides used in this study are described in Table 2. Constructs derived by
PCR were sequenced to verify the integrity of the sequence. Plasmid pST112 was used to delete
most of the coding region of all1758. An 852-bp region containing the first 30-bp of the all1758
183
coding region and upstream DNA was amplified from the chromosome (with primers 1758 up F
and 1758 up R) and fused to an 848-bp region containing the last 30-bp of the all1758 coding
region and downstream DNA (using primers 1758 down F and 1758 down R) via overlap
extension PCR. The 1700-bp fragment was cloned into pRL277 as a BglII-SacI fragment using
restriction sites introduced on the primers to generate pST112.
Plasmid pST114 was used to replace most of the coding region of all1758 with an Ω interposon.
The 1700-bp fragment used for construction of pST112 was moved into the EcoRV site of
pBluescript SK+ (Stratagene) to generate pST110. The 1700-bp fragment was moved from
pST110 into pRL278 as a BlgII-SacI fragment to create pST113. To generate pST114, the 2082-
bp Ω interposon, which confers resistance to Sp and Sm [24], was introduced into pST113 at a
SmaI site generated during overlap extension PCR.
pST141 is a mobilizable shuttle vector containing the putative promoter and coding regions of
all1758. An 1866-bp fragment was amplified from the chromosome (using primers Pall 1758
BamHI F and all1758 SacI R) and cloned into pAM504 as a BamHI-SacI fragment using
restriction sites engineered on the primers to generate pST141.
The translational all1758-gfp reporter fusion under the control of the all1758 promoter was
created using primers Pall1758 BamHI F and all1758 SmaI R to amplify the 1866-bp fragment
from the chromosome. The fragment was moved as a BamHI-SmaI fragment into pSMC232, a
replicating plasmid used generate translational fusions to gfp [16], to give pST150.
To create the gfp transcriptional reporter for all1758, a 474-bp region upstream of all1758 was
amplified from the chromosome with primers Pall1758 SacI F and all1758 15 bp up SmaI R and
cloned into pAM1956 as a SacI-SmaI fragment to create pST151. To create the gfp
transcriptional reporter for all1759, a 304-bp region upstream of all1759 was amplified from the
chromosome using primers Pall1759-SacI-F and Pall1759-SmaI-R and moved into the EcoRV
site of pBluescript SK+ to generate pST252. The fragment was moved from pST252 as a SacI-
SmaI fragment into pAM1956 to create pST249.
Two plasmids carrying a PpetE-all1758 transcriptional fusion were constructed. Plasmid pST156 is
a mobilizable shuttle vector carrying a transcriptional fusion between the petE promoter and
all1758. The 1392-bp coding region of all1758 was amplified from the chromosome using
primers all1758 OE EcoRI F and all1758 OE BamHI R and ligated into the EcoRV site of
pBluescript SK+ to create pST184. The fragment was moved from pST184 as a EcoRI-BamHI
fragment into pKH256 [25], which is designed to create transcriptional fusions to the petE
184
promoter, to generate pST156. Plasmid pST367 differs from pST156 in the engineered
ribosomal binding site that was introduced by using primer all1758 EcoRI rbs F in place of all1758
OE EcoRI F to amplify all1758 from the chromosome. The PCR fragment was moved into the
EcoRV site of pBluescript SK+ to generate pST365, and subsequently moved from pST365 as a
EcoRI-BamHI fragment into pKH256 to generate pST367.
The pPROEX-1 (Life Technologies) derivative, pST188 was used to over-express all1758 in E.
coli and facilitate purification. A 1392-bp region containing the coding region for all1758 was
amplified from the chromosome using primers all1758-NdeI-F and all1758-NH6-NotIR, and
moved into the EcoRV site of pBluescript SK+ to create pST192. To generate pST188, the
fragment was moved as a NdeI-NotI fragment into the pPROEX-1 backbone derived from
pSMC148 [16] digested with NdeI-NotI. The resulting open reading frame, designated
all1758(H6), encodes a glycine, then six histidine codons preceding sixteen codons
(DYDIPTTENLYFQGAHAH, which contains a sequence recognized by the Tobacco Etch Virus
protease) fused to all1758 followed by a stop codon after the last codon of all1758.
The transcriptional fusion Pnir-all1758 present on plasmid pST368 was created using the primers
all1758 rbs EcoRI F and all1758 OE BamHI R to amplify all1758 from the chromosome. The
fragment was ligated into the EcoRV site of pBluescript SK+ to generate pST366. To create
pST368, the fragment was moved as a EcoRI-BamHI fragment into pSMC188, a replicating
plasmid used to generate transcriptional fusions to the nirA promoter [22]
Strain construction. Deletion of the all1758 coding region was performed as previously
described [26], using plasmid pST112 or pST114 and Anabaena sp. strain PCC 7120 to yield
strains UHM183 and UHM184, respectively. The resultant strains were screened via colony PCR
with primers all1758 flank up F and all1758 flank down R, which anneal outside the chromosomal
region introduced onto pST112 and pST114 for deletion of all1758, and tested for sensitivity and
resistance to the appropriate antibiotics. Primers all1758 3’ F and all1757 5’ R were used in a
PCR reaction to test if recombination between plasmid pST141, with harbors Pall1758-all1758, and
the chromosomal locus of all1758 of strain UHM183 had occurred.
Overexpression and purification of recombinant all1758 and phosphatase assays.
Recombinant All1758 was produced from E. coli BL21 (DE3) transformed with pST188 using Ni-
nitrilotriacetic acid affinity chromatography (Qiagen) as described previously [22] with the
following exception: 4 mL of wash buffer (50 mM NNaH2PO4, 300 mM NaCl, 20 mM imidazole, 20%
glycerol) was added to the column twice, followed by four 500 µL volumes of elution buffer (50
mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, 20% glycerol), each diluted four-fold directly
185
into a total volume of 1.5 mL of capture buffer (50 mM NaH2PO4, 300 mM NaCl) upon elution
from the column.
Assays for phosphatase activity were conducted as described by previously [27]. The substrate,
4-nitrophenol phosphate (pNPP), was dissolved in pNPP buffer containing 10 mM Tris-HCl, pH
8.5, 1 mM DDT, and 50 mM NaCl with addition of either 2 mM MnCl2 or 5 mM MgCl2 and
supplemented with either 10 or 100 µM cAMP or cGMP. As a test of hydrolysis of pNPP by the
putative phosphatase activity of All1758, 2 µg of the recombinant protein was added to the
cocktail at a final reaction volume of 1 mL. Absorbance at 400 nm was monitored as a
measurement of hydrolysis of pNPP at 25 °C every thirty seconds for the first thirty minutes after
addition of protein to the cocktail, then at 45 minutes, 1 hour, 2 hours, 5 hours, and 24 hours.
Measurement of cell size. Reported values for cell sizes were obtained by measuring the
“height” of one hundred randomly distributed cells of Anabaena sp. strains PCC 7120 and
UHM184. Height refers to the dimension perpendicular to the longitudinal axis of the filament
halfway between cell poles. Significance of height distributions was established using an
unpaired t-test with a two-tailed P value of less than 0.0001. Approximate cell volumes were
calculated by treating cells as spheres using the average cell height as the radius in the formula,
Volumesphere=4/3πr3.
RNA isolation and RT-PCR. Total RNA was extracted as previously described [16]. For
reverse-transcription PCR (RT-PCR), 0.5 µg of total RNA was used for the synthesis of cDNA
with reverse transcriptase and the corresponding reverse primers for subsequent use in PCR
carried out for 27 cycles using primers 23 to 32 in a manner as previously described [16].
Acetylene reduction, glycolipid and exopolysaccharide assays. Acetylene reduction assays
measured from three independent cultures were performed as previously described [26].
Glycolipid extraction for thin layer chromatography and staining of exopolysaccharides also were
conducted as previously described [28].
186
Table 1. Strains and plasmids used in this study
Strain or plasmid Relevant Characteristic(s) Source or Reference
Anabaena sp. strains
PCC 7120 Wild type Pasteur Culture Collection
UHM103 ΔhetR [29]
UHM128 Δpbp6 [30]
UHM183 Δall1758 This study
UHM184 Δall1758 with Ω cassette This study
Plasmids
pAM504 Shuttle vector for replication in E. coli and Anabaena; Km
r,, Neo
r
[31]
pAM505 Shuttle vector pAM504 with inverted multiple cloning site
[31]
pAM1951 pAM505 with PpatS-gfp [32]
pAM1956 pAM505 bearing promoterless gfp for transcriptional fusions
[32]
pDR138 pAM504 carrying PhetR-hetR [30]
pDR211 pAM504 carrying PpetE-patS [33]
pDR320 pAM504 carrying PpetE-hetN [33]
pROEX-1 Expression vector for generating polyhistidine epitope-tagged proteins; Ap
r
Life Technologies
pRL277 Suicide vector; Smr Sp
r [34]
pRL278 Suicide vector; Neor [34]
pSMC127 pAM504 carrying PhetR-gfp [35]
pSMC148 pPROEX-1 carrying hetR [16]
pSMC188 pAM504 bearing Pnir for transcriptional fusions [22]
pSMC232 pAM504 bearing promotorless gfp for translational fusions
[16]
pST112 Suicide plasmid used to delete all1758 This study
pST114 Suicide plasmid used to replace all1758 with an interposon
This study
187
Table 1. (Continued) Strains and plasmids used in this study
pST141 pAM504 carrying Pall1758-all1758 This study
pST150 pSMC232 with Pall1758-all1758 This study
pST151 pAM1956 with Pall1758 fused to gfp This study
pST156 pAM505 bearing PpetE-all1758 This study
pST188 pPROEX-1 carrying all1758 This study
pST249 pAM1956 with Pall1759 fused to gfp This study
pST367 pAM505 bearing PpetE-all1758 This study
pST368 pAM504 bearing Pnir-all1758 This study
188
Table 2. Oligonucletotides used in this study
Primer No.
Primer Name Sequence (5’ to 3’)
1 1758 up F AGATCTGGTGGTGCGATCGCTTGGAG
2 1758 up R GCCACGACTGTCCCCGGGTGCCTGTTGTTATTATCACG
3 1758 down F ACGGACAACAATAATCCCGGGCGGTGCTGACAG
4 1758 down R GAGGCTCGCAGCCGCCCAGCTGTATCTAC
5 all1758 flank up F GCCCAAGCACGAAATACAG
7 all1758 flank down R CTTCCCGGTAAACTGTTGG
8 all1758 3’ F GCTAGAACCTGGTGATACAG
9 all1757 5’ R ACAGACTGAGAGTTACGTGC
10 Pall 1758 BamHI F TATATGGATCCTAGAAGCTCTCTTGAGTGGC
11 all1758 SacI R ATATAGAGCTCCCCAGTCCCTTTTATACTCG
12 all1758 SmaI R ATATACCCGGGATTCGATCTGTAAGACCAC
13 Pall1758 SacI F TATATGAGCTCTAGAAGCTCTCTTGAGTGGC
14 all1758 15bp up SmaI R ATATACCCGGGAAAGGGGTTAATTTTAGATTGAC
15 Pall1759-SacI-F TATATGAGCTCCCAAAAAAAGGCGCTGAGTG
16 Pall1759-SmaI-R ATATACCCGGGTAGTTGTTACGAGTTATGAG
17 all1758 OE EcoRI F TATATGAATCCATGTGCCTGTGC CTCCATTTTC
18 all1758 OE BamHI R TATATGGATCCCCCAGTCCCTTTTATACTCG
19 all1758-NdeI-F ATATACATATG CCTGTGCCTCCATTTTCCTCTCAAC
20 all1758-NH6-NotIR TTACTGCGGCCGCTTTTCGATCTGTAAGACCACTAAAGTC
21 all1758 EcoRI rbs F TATATGAATTCAGGAGGTGATTGTGCCTGTGCCTCCATTTTC
22 all1758 rbs EcoRI F TATATAAGGAGGAATTCTGTGCCTGTGCCTCCATTTTC
23 asr5349 RT F AACTAAATCTAGTGAGCATGG
24 asr5349 RT R AAGCATATAAAAGGTGATGGT
25 asr5350 RT F ATGGCATTCATCAAGATACAG
26 asr5350 RT R AACGCTTGACTCTTGATATTG
189
Table 2. (Continued) Oligonucletotides used in this study
27 all1757 RT F CTGCCGTCAGTACTGTTAC
28 all1757 RT R AGTCCAGGCTTGCTCTTTAG
29 all1759 RT F GGTTCCGTCGTCAAACTAACG
30 all1759 RT R CACGCCAGTTGTTTGTACTG
31 rnpB RT F ATAGTGCCACAGAAAAATACCG
32 rnpB RT R AAGCCGGGTTCTGTTCTCTG
RESULTS
Mutation of all1758 prevents diazotrophic growth
In an effort to identify genes necessary for diazotrophic growth of Anabaena sp. strain PCC 7120,
a genetic screen using transposon mutagenesis to both increase and mark the sites of mutations
was conducted as previously described [30]. In one mutant the transposon had disrupted open
reading frame all1758 in the annotated genome sequence, suggesting that all1758 was
necessary for diazotrophic growth. To verify a cause-and-effect relationship between inactivation
of all1758 and the phenotype of the mutant, an Ω interposon conferring spectinomycin and
streptomycin resistance was used to replace nucleotides +31 to +1358 relative to the GTG
translational initiation codon of all1758 in the wild type strain. The resulting mutant, UHM184,
contained the first and last thirty nucleotides of all1758 flanking the Ω interposon and exhibited
impaired diazotrophic growth similar to that of the isolated transposon mutant. Complementation
of UHM184 with a plasmid bearing all1758 preceded by 497 bp upstream of all1758, including the
474 bp intergenic region between the end of upstream gene all1759 and the start of all1758,
restored diazotrophic growth to the mutant and suggested that inactivation of all1758 and not
polar effects of the transposon insertion was the cause of the mutant phenotype. The all1758
gene is located between two genes transcribed in the same orientation and predicted to have a
role in cell division, ftsX (all1757) and ftsY (all1759). To verify that inactivation of all1758 was
solely responsible for the phenotypes of the mutants, nucleotides +31 to +1358 were cleanly
deleted from the chromosome of the wild type. The resulting strain, UHM183, had an in-frame
deletion of all1758 and differed from UHM184 only by the absence of the Ω interposon. The
phenotype of this strain was similar to that of UHM184. Strain UHM183 was complemented in
the same manner as for UHM184, and there was no evidence for recombination between the
plasmid and the chromosomal locus of all1758 as indicated by the lack of a PCR product using
primers corresponding to the region of all1758 that is deleted from the mutant chromosome and
190
the coding region of all1757. Lastly, transcripts of all1757 and all1759 were detected by RT-PCR
in RNA isolated from strains UHM184 and the wild type (data not shown). Taken together, these
results indicated that a functional copy of all1758 was required for diazotrophic growth of
Anabaena sp. strain PCC 7120.
The predicted 463 amino acid sequence encoded by all1758 was similar to sequences of other
proteins in the Protein Database maintained by NCBI. Residues 45 to 200 appeared to comprise
a GAF domain, which is named after the types of proteins containing the domain (cGMP-specific
phosphodiesterases, adenylyl cyclases and FhlA). Many of these proteins bind cyclic nucleotides.
Residues 270 to 463 were similar in sequence to serine/threonine protein phosphatases of the
PP2C superfamily, which is comprised of metallo-phosphatases that employ two metal ions in the
catalytic site. PP2C proteins generally have a catalytic domain of approximately 290 amino acids
that includes eight absolutely conserved residues within eleven conserved motifs [17, 36].
However, the predicted protein sequence of All1758 lacked the invariant glycine present in Motif 5
and, instead, had an alanine in its place.
In an attempt to demonstrate phosphatase activity of All1758, the 52 kD protein with an N-
terminal polyhistidine epitope tag was purified from E. coli strain BL21 by affinity chromatography.
Attempts to characterize phosphatase activity using p-nitrophenol (pNPP) as a substrate were
unsuccessful even after addition of either 10 or 100 uM cAMP or cGMP separately with the PNPP
substrate, in an effort to support the potential role of the GAF domain in phosphatase function.
Pleiotropic phenotype of all1758 null mutants
Although all1758 was discovered in a genetic screen designed to isolate mutants incapable of
growth on nitrogen-deficient media, disruption of all1758 also affected viability on nitrogen-replete
media. Colonies of the mutant were pale green rather than the vibrant green of the wild type,
and after about three weeks of growth on BG-11 solid media with either 17 mM nitrate or 2 mM
ammonia as a source of fixed nitrogen, growth appeared to cease, and the strain could not be
revived by subculturing onto fresh medium. In comparison, the wild type strain remained viable
under the same conditions in excess of three months. However, the strain could apparently be
maintained indefinitely if repeatedly subcultured onto BG-11 solid medium every two weeks. To
test if loss of viability was the result of a change in the medium over time, non-viable filaments of
UHM184 were scraped from a plate culture 3 weeks after its inoculation, and the resulting
“conditioned” solid medium was streaked with PCC 7120. Growth of the wild-type strain was
indistinguishable from that on unconditioned medium. Cells of UHM184 filaments cultured on
BG-11 solid medium were markedly smaller than those of the wild type grown under the same
191
Figure 1. Phenotype of the all1758 deletion strain, UHM184 under varying conditions. The
diminutive cell size of UHM184 (B) as compared to the wild type strain Anabaena sp. strain
PCC 7120 (A) cultured on solid BG-11 medium. At 24 h after culturing in liquid BG-11 medium,
UHM184 develops intracellular vacuoles among all cells of a filament (C). At 24 h after transfer
from solid BG-11 medium to liquid BG-110 medium, which lacks a source of combined nitrogen,
heterocysts form in PCC 7120 (D) but not in UHM184 (E). After 48 h of nitrogen starvation,
UHM 184 exhibits heterocyst patterning among cells of diminutive size (F). Carets indicate
heterocysts. Bars = 10 µM.
192
conditions. The average vegetative cell height (measured perpendicular to the longitudinal axis
of the filament) of mutant cells was 2.88 ± 0.25 m, compared to 4.34 ± 0.23 m for cells of the
wild type, which corresponded to a more than 3-fold reduction in cell volume for the mutant (Fig.
1a, b). This diminutive phenotype persisted until loss of viability and when cells were transferred
to liquid medium lacking fixed nitrogen.
Growth of the mutant in liquid BG-11 containing nitrate or ammonium as a source of fixed
nitrogen was different from that on solid medium. Within 24 hours of inoculation into liquid
medium, the cytoplasm was found on one side of the cell, and the majority of the cell volume was
occupied by what appears to be a single, large vacuole (Fig. 1c). Alternatively, the plasma
membrane may have pulled away from the cell wall in a manner resembling plasmolysis in plant
cells. The process was unlikely to be attributable to the formation of a large gas vesicle because
mutant cells settled more readily than those of the wild type to the bottom of growth vessels.
Vacuole formation was accompanied by enlargement of cells and resulted in cell lysis within 48
hours. To test if cell lysis and/or vacuolization of cells was in response to a substance excreted
into the medium by the mutant, conditioned medium separated from cellular debris by
centrifugation was inoculated with PCC 7120. Growth of PCC 7120 in medium conditioned by
UHM184 was similar to that in unconditioned medium, indicating that lysis of UHM184 was not
caused by amendment of the medium by the mutant so as to make it unfit for growth of PCC
7120. The pH of medium conditioned by growth of UHM184 was similar to that conditioned by
the wild type and unconditioned medium. In addition, the inverse experiment, growing UHM184 in
spent medium of the strain PCC 7120 did not rescue any of the mutant phenotypes.
UHM184 was incapable of growth in the absence of fixed nitrogen, and morphologically distinct
heterocysts were not observed until 48 h after removal of fixed nitrogen, about twice the time for
the wild type (Fig. 1d, e, f). The periodic pattern of heterocyts along filaments was similar to that
of the wild type. Heterocysts of UHM184 had characteristic reduced levels of auto-fluorescence,
indicative of degradation of phycobiliproteins, and polar cyanophycin granules associated with
mature heterocysts. Note that all of the mutant phenotypes were complemented by introduction
of all1758 on a plasmid to strain UHM184 as described above.
193
Strain UHM184 was Fix- and lacked the minor heterocyst-specific glycolipid.
During the late stages of
heterocyst development,
deposition of heterocyst-specific
polysaccharides contributes to the
creation of the microoxic
environment necessary for the
function of nitrogenase, an oxygen-
labile enzyme. Heterocysts of
strain UHM184 were readily
stained by Alcian blue, indicative of
the presence of heterocyst
envelope exopolysaccharides (Fig.
2). Thus, polysaccharide synthesis
and deposition appears unimpaired
in the mutant.
Just interior to the layer of exopolysaccharide, a layer of heterocyst-specific glycolipid also
contributes to the microoxic interior of a heterocyst. To determine if heterocyst-specific
glycolipids (HGLs) were present in mutant strain UHM184, lipids from strains PCC 7120,
UHM184, and UHM103, a hetR mutant that served as a negative control, were extracted after 72
hours of combined nitrogen deprivation, and separated by thin-layer chromatography for
visualization (Fig. 3). Two HGLs have been characterized in the wild type [37-39]. Although the
more abundant, slower-migrating species corresponding to 1-(0-a-D-glucopyranosyl)-3,25-
hexacosanediol was present in strains UHM184 and PCC 7120 (the major HGL), the less
abundant, faster migrating glycolipid, 1-(0-a-D-glycopyranosyl)-3-keto-25-hexacosanol (the minor
HGL) was absent from UHM184. As expected, both HGLs were absent from strain UHM103,
which does not make heterocysts. The absence of the minor HGL, which is necessary for a
functional heterocyst, could account for the inability of UHM184 to grow under diazotrophic
conditions. Typically strains affected in HGL synthesis lack both the minor and major HGL, with
one exception. A double kinase mutant was shown by RT-PCR to lack expression of two
glycolipid synthesis genes, asr5349 and asr5350 [17]. Conversely, transcripts of asr5349 and
asr5350 were detected by RT-PCR in RNA isolated from strain UHM184 (data not shown).
Strains that lack one or both of the heterocyst specific glycolipids cannot fix nitrogen in the
presence of molecular oxygen (Fox- phenotype) but can in its absence. Other strains that are
Figure 2. Heterocyst-specific exopolysaccharide of
UHM184. Bright-field images of heterocyst-specific
exopolysaccharides stained by Alcian Blue in (A) PCC
7120 and (B) UHM184 at 48 h after removal of combined
nitrogen. Carets indicate heterocysts. Bars = 10 µM.
194
deficient in more than just the creation of microoxic heterocysts cannot fix under either condition
(Fix- phenotype). The nitrogenase activity of strain UHM184 at 48 h post-induction was assessed
Figure 3. Heterocyst-specific glycolipids of UHM184. 1, 2, 3 are lane numbers. Lane 1,
lipid extract from the all1758 mutant, UHM184, which lacks the minor heterocyst glycolipid
(HGL); lane 2, PCC 7120; and lane 3, the ∆hetR mutant, UHM103, which lacks both the
minor and major HGLs separated by thin-layer chromatography 72 h after removal of
combined nitrogen. The minor (1-(0-a-D-glycopyranosyl)-3-keto-25-hexacosanol), and the
major (1-(0-a-D-glucopyranosyl)-3,25-hexacosanediol) heterocyst-specific glycolipids are
indicated by the top and bottom arrows, respectively. Lipid extracts were deposited at the
origin, denoted by ‘*’.
195
by acetylene reduction assays under both oxic and anoxic conditions to determine if it was a Fox-
or Fix- strain. Under oxic conditions, rates of acetylene reduction were 0.350 ± 0.064 nmol
ethylene h-1
ml -1
(OD750 unit)-1
for PCC 7120 and undetectable for strains UHM184; UHM103, a
Fix- strain; and UHM128, a previously characterized Fox
- strain [30, 40]. Under anoxic conditions
rates of acetylene reduction were 0.073 ± 0.038 nmol ethylene h-1
ml -1
(OD750 unit)-1
for strain
UHM128 and undetectable for strains UHM184 and UHM103. Thus, the phenotype of UHM184
was Fix-, suggesting that lack of a functional copy of all1758 disrupted more than just the creation
of microoxic conditions in heterocysts.
all1758 is constitutively expressed and autoregulates its own expression.
Expression of all1758 was
assessed both temporally
and spatially using the
gene for green
fluorescence protein (GFP)
as a reporter. A uniform
level of bright florescence
was observed in
vegetative cells and
heterocysts when a
shuttle vector carrying the
putative promoter region
of all1758 fused to gfp
was introduced into the
wild-type strain. Similar
levels of expression were
seen with and without
nitrate in the medium (Fig.
4a). However, no GFP-
dependent fluorescence
was observed when the
same plasmid was
introduced into strain
UHM184, which has
all1758 deleted from the
chromosome (Fig. 4b).
Figure 4. A functional all1758 gene is required for expression of
all1758 but not for patterned expression of patS. Expression of
all1758 as visualized with a transcriptional Pall1758-gfp fusion on
plasmid pST151 in strains (A) PCC 7120 or (B) UHM184 at 24 h
after removal of combined nitrogen. Expression of patS in PCC
7120 (C) and UHM184 (D) as visualized using the transcriptional
fusion patS-gfp on plasmid pAM1951 at 14 h after induction of
heterocyst formation. Micrographs show bright-field (left panels)
and fluorescence (right panels) images recorded using identical
microscope and camera settings. Carets indicate heterocysts.
Bars = 10 µM.
196
No GFP-dependent fluorescence was observed from the wild type strain harboring a plasmid
bearing all1758 translationally fused to gfp under the control of its native promoter in the
presence or absence of nitrate (data not shown). UHM184 bearing the same plasmid also
remained dim, similar to the wild type, although the cell size had returned to the wild-type
dimensions, apparently due to complementation by the fusion protein encoded on the plasmid. In
addition, over-expression of all1758 from the copper-inducible petE promoter in the wild-type
strain had no apparent effect on heterocyst differentiation or cell size, whereas extra copies of
patS or hetN expressed from the petE promoter on a plasmid in strain UHM184 prevented
heterocyst differentiation, but the diminutive cell phenotype remained (data not shown). Over-
expression of all1758 from the nirA promoter, which is induced under both nitrate-replete
conditions or conditions of nitrogen-starvation [41], yielded the same results as those observed
with use of the petE promoter (data not shown).
all1758 is not required for the timing of pattern formation.
A null mutation in all1758 delays morphological differentiation of heterocysts. Prior to changes in
the morphology of differentiating cells, the cells of filaments that will differentiate are specified by
the generation of a pattern of gene expression. This pattern can be visualized using fusions of
the promoters of hetR or patS to gfp [32, 35]. Strain UHM184 carrying a plasmid with the
promoter of either hetR or patS fused to gfp exhibited a pattern of GFP-dependent fluorescence
that was similar to that observed in the wild type carrying the same plasmid (Fig. 4c, d). Both the
number of cells between fluorescing cells and the timing of the appearance of fluorescence were
similar. The only noticeable difference was the smaller size of the cells in filaments of UHM184.
Thus, all1758 was not required for formation of the pattern that specifies which cells will
differentiate into heterocysts.
Bypass of mutation of al1758 by extra copies of hetR
In an attempt to ascertain where in the regulatory network controlling heterocyst differentiation
all1758 may have been acting, plasmid borne copies of hetR were put into UHM184 and the
resulting strain was examined for phenotypic differences. The strain with extra copies of hetR
had multiple contiguous heterocysts and reduced spacing between groups of heterocysts in
media with or without nitrate as a fixed nitrogen source (data not shown). The same Mch
phenotype was observed when the plasmid was introduced into the wild-type strain. Extra copies
of hetR bypassed the delay in morphological differentiation of heterocysts, but the diminutive cell
phenotype and other associated phenotypes remained.
197
DISCUSSION
Phosphorylation of proteins is widely used in the regulation of various cellular processes. All1758
is predicted to be a PP2C phosphatase, which is a member of the PPM family of serine/threonine
phosphatases that are dependent on the presence of the divalent cation Mg2+
for catalytic
function. However, repeated attempts to support the role of All1758 as a phosphatase were
unsuccessful. The simplest explanation for the lack of discernable phosphatase activity relates to
the absence of one of the eight absolutely conserved residues in the protein sequence of all1758.
PP2C proteins generally have a catalytic domain of approximately 290 amino acids that includes
eight absolutely conserved residues within eleven conserved motifs [17, 36]. All1758 harbors an
alanine residue, a conservative substitution, in lieu of the glycine residue reported as invariant in
Motif 5. Alternatively, phosphatase activity of the protein encoded by all1758 may not be
measurable under the conditions of our assay due, for instance, to substrate specificity, lack of a
cofactor, or improper folding of the recombinant protein.
The minor heterocyst glycolipid, which is essential for provision of microaerobic conditions
necessary for the activity of nitrogenase within the heterocyst, was absent in a strain lacking
all1758. However, the absence of nitrogen fixation in the mutant strain even under anoxic
conditions suggests that all1758 is required for some cellular process(es) related to fixation of
nitrogen not related to diminution of molecular oxygen in heterocysts. Indeed, a diverse and
seemingly unrelated range of phenotypes resulted from mutation of all1758. For instance, the
delay in heterocyst formation in UHM184 may suggest the involvement of all1758 in the timing of
heterocyst morphology development. The diminutive cell size and associated decrease in cell
volume apparent upon mutation of all1758 may be indicative of a change in the timing of cell
division in the mutant, which would prevent the cell from attaining a normal and/or enlarged cell
size. Inhibition of cell division has been shown to prevent differentiation of heterocysts, and
heterocysts have twice the DNA content of vegetative cells [42, 43]. The increased rate of cell
division in strains lacking all1758 may account for the defect in heterocyst differentiation in the
mutant. The location of all1758 between the cell division genes ftsX and ftsY may implicate
all1758 as a cell division gene as well. In Escherichia coli, for example, the cell division gene ftsE
(b3463) lies between ftsX (b3462) and ftsY (b3464). Alternatively, a defect in a process specific to
heterocyst differentiation may influence cell division. Also, the decrease in cell volume may have
perturbed the concentration of specific intracellular components, resulting in the observed
phenotypes. The relationship between cell division and heterocyst differentiation remains
enigmatic at this time.
198
Unpatterned expression of all1758 in all cells was evident under both nitrate-replete and depleted
conditions using a GFP transcriptional reporter fusion, suggesting that the gene is constitutively
expressed. In contrast, GFP-dependent fluorescence was not observed from an all1758
translational fusion in all background strains tested. However, the fusion protein did appear to
complement strain UHM184, suggesting the fusion protein was functional. The lack of detectable
fluorescence may indicate that level of All1758 are very low in cells, and the associated
fluoresecence from the fusion protein was below the level of detection, or the GFP portion of the
protein may have been non-functional. This phenomenon is not new. In our hands, plasmid
constructs bearing hetR-gfp and hetF-gfp translational fusions in hetR and hetF backgrounds,
respectively, also complement the inactivated gene, yet visible fluorescence is lacking (Risser
and Callahan, 2008).
Alterations in the levels of expression of other genes involved in heterocyst differentiation have
been shown to affect cell size. Inactivation of all2874 encoding a diguanylate cyclase results in a
light intensity-dependent variability in heterocyst frequency and reduction in vegetative cell size
(Neunuebel and Golden, 2008). Conversely, a strain lacking hetF has enlarged cells, and extra
copies of hetF on a plasmid result in a diminutive cell phenotype [16]. In contrast with the
correlation between smaller cell size and a delay in heterocyst differentiation in the all1758
mutant, a strain with extra copies of hetF forms more heterocysts than the wild type. Over-
expression of patA also results in enlarged cells [44]. There is no evidence for the
phosphorylation of HetF or PatA, but PatA is similar in sequence to response regulators of two-
component transduction systems [45]. The growing number of phosphatases and kinases
implicated in heterocyst differentiation indicates that protein phosphorylation plays a prominent
role in the regulation of differentiation. However, understanding the extent and nature of that role
is dependent on uncovering the targets of kinase and phosphatase activity.
ACKNOWLDEMENTS
We wish to thank Kelly C. Higa for plasmid pKH256. This work was supported by grant IOS-
0919878 from the National Science Foundation.
FOOTNOTES
*For correspondence: E-mail [email protected]; Tel. (+1) 808 956 8015; Fax (+1) 808 956
5339
199
REFERENCES CITED
1. Murry, M.A. and C.P. Wolk, Evidence that the barrier to the penetration of oxygen into
heterocysts depends upon two layers of the cell envelope. Arch. Microbiol, 1989. 151: p.
469-474.
2. Meeks, J.C., et al., Pathways of assimilation of [13
N]N2 and 13
NH4+ by cyanobacteria with
and without heterocysts. J. Bacteriol., 1978. 134(1): p. 125-130.
3. Wolk, C.P., Movement of carbon from vegetative cells to heterocysts in Anabaena
cylindrica. J. Bacteriol., 1968. 96: p. 2138-2143.
4. Wolk, C.P., A. Ernst, and J. Elhai, Heterocyst metabolism and development, in The
Molecular Biology of Cyanobacteria, D.A. Bryant, Editor. 1994, Kluwer Academic
Publishers: Dordrecht, The Netherlands. p. 769-823.
5. Laurent, S., et al., Nonmetabolizable analogue of 2-oxoglutarate elicits heterocyst
differentiation under repressive conditions in Anabaena sp. PCC 7120. Proc. Natl. Acad.
Sci. U.S.A., 2005. 102: p. 9907-9912.
6. Vazquez-Bermudez, M.F., A. Herrero, and E. Flores, 2-Oxoglutarate increases the
binding affinity of the NtcA (nitrogen control) transcription factor for the Synechococcus
glnA promoter. FEBS letters, 2002. 512(1-3): p. 71-4.
7. Muro-Pastor, A.M., et al., Mutual dependence of the expression of the cell differentiation
regulatory protein HetR and the global nitrogen regulator NtcA during heterocyst
development. Mol. Microbiol., 2002. 44: p. 1377-1385.
8. Olmedo-Verd, E., et al., HetR-dependent and -independent expression of heterocyst-
related genes in an Anabaena strain overproducing the NtcA transcription factor. Journal
of bacteriology, 2005. 187(6): p. 1985-91.
9. Ehira, S. and M. Ohmori, NrrA directly regulates expression of hetR during heterocyst
differentiation in the cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol., 2006.
188: p. 8520-8525.
10. Jang, J., et al., Mutual regulation of ntcA and hetR during heterocyst differentiation
requires two similar PP2C-type protein phosphatases, PrpJ1 and PrpJ2, in Anabaena sp.
strain PCC 7120. Journal of bacteriology, 2009. 191(19): p. 6059-66.
11. Cheng, Y., et al., A pair of iron-responsive genes encoding protein kinases with a Ser/Thr
kinase domain and a His kinase domain are regulated by NtcA in the Cyanobacterium
Anabaena sp. strain PCC 7120. Journal of bacteriology, 2006. 188(13): p. 4822-9.
12. Laurent, S., et al., Cell-type specific modification of PII is involved in the regulation of
nitrogen metabolism in the cyanobacterium Anabaena PCC 7120. FEBS letters, 2004.
576(1-2): p. 261-5.
200
13. Zhang, C.C., A. Friry, and L. Peng, Molecular and genetic analysis of two closely linked
genes that encode, respectively, a protein phosphatase 1/2A/2B homolog and a protein
kinase homolog in the cyanobacterium Anabaena sp. strain PCC 7120. Journal of
bacteriology, 1998. 180(10): p. 2616-22.
14. Saha, S.K. and J.W. Golden, Overexpression of pknE blocks heterocyst development in
Anabaena sp. strain PCC 7120. Journal of bacteriology, 2011. 193(10): p. 2619-29.
15. Orozco, C.C., D.D. Risser, and S.M. Callahan, Epistasis analysis of four genes from
Anabaena sp. strain PCC 7120 suggests a connection between PatA and PatS in
heterocyst pattern formation. J. Bacteriol., 2006. 188(5): p. 1808-1816.
16. Risser, D.D. and S.M. Callahan, HetF and PatA control levels of HetR in Anabaena sp.
strain PCC 7120. J. Bacteriol., 2008. 190: p. 7645-7654.
17. Shi, L., et al., Two genes encoding protein kinases of the HstK family are involved in
synthesis of the minor heterocyst-specific glycolipid in the cyanobacterium Anabaena sp.
strain PCC 7120. Journal of bacteriology, 2007. 189(14): p. 5075-81.
18. Jang, J., et al., PrpJ, a PP2C-type protein phosphatase located on the plasma membrane,
is involved in heterocyst maturation in the cyanobacterium Anabaena sp. PCC 7120.
Molecular microbiology, 2007. 64(2): p. 347-58.
19. Ning, D. and X. Xu, alr0117, a two-component histidine kinase gene, is involved in
heterocyst development in Anabaena sp. PCC 7120. Microbiology, 2004. 150(Pt 2): p.
447-53.
20. Ramirez, M.E., et al., Anabaena sp. strain PCC 7120 gene devH is required for synthesis
of the heterocyst glycolipid layer. Journal of bacteriology, 2005. 187(7): p. 2326-31.
21. Xu, W.L., et al., pkn22 (alr2502) encoding a putative Ser/Thr kinase in the
cyanobacterium Anabaena sp. PCC 7120 is induced by both iron starvation and oxidative
stress and regulates the expression of isiA. FEBS letters, 2003. 553(1-2): p. 179-82.
22. Risser, D.D. and S.M. Callahan, Mutagenesis of hetR reveals amino acids necessary for
HetR function in the heterocystous cyanobacterium Anabaena sp. strain PCC 7120. J.
Bacteriol., 2007. 189: p. 2460-2467.
23. Elhai, J. and C.P. Wolk, Conjugal transfer of DNA to cyanobacteria. Methods Enzymol.,
1988. 167: p. 747-754.
24. Fellay, R., J. Frey, and H. Krisch, Interposon mutagenesis of soil and water bacteria: a
family of DNA fragments designed for in vitro insertional mutagenesis of Gram-negative
bacteria. Gene, 1987. 52: p. 147-154.
25. Higa, K.C. and S.M. Callahan, Ectopic expression of hetP can partially bypass the need
for hetR in heterocyst differentiation by Anabaena sp. strain PCC 7120. Mol. Microbiol.,
2010. 77: p. 562-574.
201
26. Borthakur, P.B., et al., Inactivation of patS and hetN causes lethal levels of heterocyst
differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol.
Microbiol., 2005. 57: p. 111-123.
27. Ruppert, U., et al., The novel protein phosphatase PphA from Synechocystis PCC 6803
controls dephosphorylation of the signalling protein PII. Molecular microbiology, 2002.
44(3): p. 855-64.
28. Callahan, S.M. and W.J. Buikema, The role of HetN in maintenance of the heterocyst
pattern in Anabaena sp. PCC 7120. Mol. Microbiol., 2001. 40: p. 941-950.
29. Buikema, W.J. and R. Haselkorn, Expression of the Anabaena hetR gene from a copper-
regulated promoter leads to heterocyst differentiation under repressing conditions. Proc.
Natl. Acad. Sci., U.S.A., 2001. 98: p. 2729-2734.
30. Nayar, A.S., et al., FraG is necessary for filament integrity and heterocyst maturation in
the cyanobacterium Anabaena sp. strain PCC 7120. Microbiology, 2007. 153: p. 601-607.
31. Wei, T.-F., R. Ramasubramanian, and J.W. Golden, Anabaena sp. strain PCC 7120 ntcA
gene required for growth on nitrate and heterocyst development. J. Bacteriol., 1994. 176:
p. 4473-4482.
32. Yoon, H.-S. and J.W. Golden, PatS and products of nitrogen fixation control heterocyst
pattern. J. Bacteriol., 2001. 183: p. 2605-2613.
33. Risser, D.D. and S.M. Callahan, Genetic and cytological evidence that heterocyst
patterning is regulated by inhibitor gradients that promote activator decay. Proc. Natl.
Acad. Sci., 2009. 106: p. 19884-19888.
34. Black, T.A., Y. Cai, and C.P. Wolk, Spatial expression and autoregulation of hetR, a gene
involved in the control of heterocyst development in Anabaena. Mol. Microbiol., 1993. 9: p.
77-84.
35. Callahan, S.M. and W.J. Buikema, The role of HetN in maintenance of the heterocyst
pattern in Anabaena sp. PCC 7120. Molecular microbiology, 2001. 40(4): p. 941-50.
36. Kennelly, P.J., Protein phosphatases--a phylogenetic perspective. Chemical reviews,
2001. 101(8): p. 2291-312.
37. Lambein, F. and C.P. Wolk, Structural studies on the glycolipids from the envelope of the
heterocyst of Anabaena cylindrica. Biochemistry, 1973. 12: p. 791-798.
38. Soriente, A., et al., Reinvestigation of heterocyst glycolipids from the cyanobacterium,
Anabaena cylindrica. Phytochemistry (Oxford), 1994. 38(3): p. 641-645.
39. Gambacorta, A., et al., Heterocyst glycolipids from five nitrogen-fixing cyanobacteria.
Gazz. Chim. Ital., 1996. 126: p. 653-656.
40. Leganés, F., et al., Wide variation in the cyanobacterial complement of presumptive
penicillin-binding proteins. Arch. Microbiol., 2005. 184: p. 234-248.
202
41. Frias, J.E., E. Flores, and A. Herrero, Nitrate assimilation gene cluster from the
Heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol., 1997.
179: p. 477-486.
42. Sakr, S., et al., Inhibition of cell division suppresses heterocyst development in Anabaena
sp. strain PCC 7120. J. Bacteriol., 2006. 188: p. 1396-1404.
43. Sakr, S., et al., Relationship among several key cell cycle events in the developmental
cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol., 2006. 188: p. 5958-5965.
44. Young-Robbins, S.S., et al., Transcriptional regulation of the heterocyst patterning gene
patA from Anabaena sp. strain PCC 7120. J. Bacteriol., 2010. 192: p. 4732-4740.
45. Liang, J., L. Scappino, and R. Haselkorn, The patA gene product, which contains a
region similar to CheY of Escherichia coli, controls heterocyst pattern formation in the
cyanobacterium Anabaena 7120. Proc. Natl. Acad. Sci, USA, 1992. 89: p. 5655-5659.
203
APPENDIX B. PEER REVIEWED PUBLICATION: Evidence for Direct Binding Between
HetR from Anabaena sp. PCC 7120 and PatS-5
BIOCHEMISTRY Vol. 50, p. 9212-9244
Copyright © 2011, American Chemical Society. All Rights Reserved.
Erik A. Feldmanna, Shuisong Ni
a, Indra Dev Sahu
a, Clay H. Mishler
a, Douglas D. Risser
b, Jodi L.
Murakamib, Sasa K. Tom
b, Robert M. McCarrick
a, Gary A. Lorigan
a, Blanton S. Tolbert
a, Sean M.
Callahanb and Michael A. Kennedy
a1
a Department of Chemistry and Biochemistry, Miami University, Oxford, Ohio 45056
b Department of Microbiology, University of Hawaii, Honolulu, Hawaii 96822
Received 5 August 2011/Revised 22 September 2011/Published 26 September 2011
ABSTRACT
HetR, the master regulator of heterocyst differentiation in the filamentous cyanobacterium
Anabaena sp. strain PCC 7120, stimulates heterocyst differentiation via transcriptional
autoregulation and is negatively regulated by PatS and HetN, both of which contain the active
pentapeptide RGSGR. However, the direct targets of PatS and HetN are unknown. Here we
report experimental evidence for direct binding between HetR and the RGSGR pentapeptide,
PatS-5. Strains with an allele of hetR coding for conservative substitutions at residues 250-256
had an altered pattern of heterocsyts and, in some cases, reduced sensitivity to PatS-5. Cysteine
scanning mutagenesis coupled with electron paramagnetic resonance (EPR) spectroscopy
showed quenching of spin label motion at HetR amino acid 252 upon titration with PatS-5,
indicating direct binding of PatS-5 to HetR. Gel shift assays confirmed that PatS-5 disrupted
binding of HetR to a 29 base pair inverted-repeat-containing DNA sequence upstream from hetP.
Double electron electron resonance EPR experiments confirmed that HetR existed as a dimer in
solution and indicated that PatS-5 bound to HetR without interfering with the dimer form of HetR.
Isothermal titration calorimetry experiments corroborated direct binding of PatS-5 to HetR with a
Kd of 227 nM. Taken together, these results indicate that 2 molecules of PatS-5 bind to a dimer
of HetR to prevent binding of DNA. PatS-5 appears to either bind in the vicinity of HetR amino
acid L252 or, alternately, to bind in a remote site that leads to constrained motion of this amino
acid via an allosteric effect or change in tertiary structure.
204
INTRODUCTION
Cellular differentiation and patterning are fundamental concepts in the field of developmental
biology. One of the earliest known examples of cell differentiation is that of ancient filamentous
cyanobacteria, which, under pressure of nitrogen starvation, evolved the capability to fix
atmospheric N2 using specialized terminally differentiated cells called “heterocysts” [1-12] more
than 2 billion years ago [13, 14] Heterocyst differentiation in filamentous cyanobacteria evolved
as a means of isolating oxygenic photosynthesis associated with CO2 fixation in vegetative cells
from oxygen-sensitive nitrogenases that carry out nitrogen fixation in heterocysts [15, 16]. Soluble
nitrogen-containing compounds generated as a result of nitrogen fixation in heterocysts are then
shared with neighboring vegetative cells to sustain continued growth of the organism (see
discussion by [17] regarding intercellular transport in filamentous cyanobacteria). Under
conditions of nitrogen starvation, a pattern is established in which approximately every tenth cell
along the filament is terminally differentiated into a heterocyst [18, 19]. Heterocysts support
nitrogenase-based N2 fixation by generating a microoxic environment within the cell that involves
production of two additional layers external to the outer membrane found in vegetative cells,
including a heterocyst-specific glycolipid layer and a heterocyst envelope polysaccharide layer
[20-22]. Initiation of heterocyst differentiation, pattern formation, and pattern maintenance are
regulated by small signaling molecules and a host of different genes in a process that resembles
signaling pathways of higher eukaryotic organisms [10, 11].
The hetR gene plays a central role in regulation of heterocyst differentiation [23]. The master
regulatory protein, HetR, controls heterocyst differentiation through transcriptional autoregulation
[24] and responds to two heterocyst differentiation inhibitors, PatS and HetN, both of which
contain the active pentapeptide RGSGR [24-26]. Interestingly, hetR and patS genes are
widespread throughout both non-heterocyst-forming, as well as heterocyst-forming, filamentous
cyanobacteria, suggesting that their evolutionary role may have emerged before heterocyst
differentiation appeared [27]. While much has been learned about regulation of heterocyst
differentiation in recent years, the molecular level interactions between HetR, PatS, and HetN
during regulation of heterocyst differentiation are still not well understood. There is growing
experimental evidence that PatS and HetN control pattern formation by establishing concentration
gradients along the filament that promote degradation of HetR in an activator-inhibitor type
manner [28], however, the precise mechanism for how HetR interacts with PatS and HetN
remains unknown.
HetR is a 299 residue DNA binding transcriptional regulator believed to be active as a homodimer
[29]. It has been reported that HetR dimer formation involves a disulfide bridge at position C48,
205
and that mutation of C48 to alanine abolished both dimerization and binding activity to its own
DNA promoter in vitro [29]. It has also been reported that HetR has Ser-type autoproteolytic
activity [30, 31] mediated through Ser152 [32]. However, Risser and Callahan have reported that
Cys48 and Ser152 in HetR from Anabaena are not required for proper heterocyst differentiation
[33]. The cause of the contradictory observations has not yet been resolved.
PatS is a short peptide, predicted to be 13 or 17 amino acids, that acts as a negative regulator of
heterocyst differentiation [25]. It is thought that a shorter, processed form of PatS acts as a
diffusible signal molecule [25, 34]. The RGSGR carboxyl terminus of PatS (PatS-5) inhibits
heterocyst differentiation when added to culture medium [25], and has been shown in vitro to
inhibit binding of HetR to a DNA sequence upstream from its own promoter [29, 33]. It has also
been shown that a R223W mutant of HetR was insensitive to in vivo overexpression of both PatS
and HetN [35]. However, the mechanism of PatS-5 disruption of HetR binding to DNA, and the
molecular level cause of loss of R223W HetR sensitivity to PatS remains unknown. A molecular-
level understanding of the biochemical mechanism of action of PatS-5 has not been established.
While it has been widely assumed that PatS-5 disrupts HetR binding to DNA through a direct
interaction between PatS-5 and HetR, based on observations reported in the literature [29, 33,
35], it is alternatively possible that PatS-5 disrupts the HetR-DNA complex through a direct
interaction between PatS-5 and the DNA. This possibility is worth considering given that the
amino acid sequence of PatS-5, RGSGR, with its symmetrically positioned arginines, is similar to
that of the well-established DNA-binding “AT-hook” motif [36], which has the minimal amino acid
consensus sequence PRGRP [37] with both symmetrically positioned arginine residues
conferring, and being required for, DNA binding capacity. The AT-hook is the fundamental DNA
binding motif building block of the HMG-I(Y) (a.k.a. HMGA) subfamily of non-histone high mobility
group chromatin proteins [38, 39], also known as “architectural transcription factors” [37, 40, 41],
with each HMG-I(Y) protein containing three AT-hooks. The AT-hook adopts a crescent-shaped
structure that interacts with AT-rich DNA through non-specific electrostatic interactions between
the negatively charged phosphodiester DNA backbone and the positively charged arginine side
chains that insert into the DNA minor groove [42]. Each PRGRP AT-hook sequence motif spans
5-6 DNA base pairs [36]. Given the similarity between the amino acid sequences of the AT-hook
motif and the PatS-5 sequence, and the observation that a single AT-hook confers DNA binding
capability [37], it is plausible that PatS-5 might also interact with DNA via non-specific
electrostatic interactions through its symmetrically positioned pair of arginine residues. The lack
of three-dimensional structures of most heterocyst regulatory proteins, including HetR, and any
complexes involving PatS-5, has impeded progress towards achieving a complete molecular level
understanding of regulation of heterocyst differentiation.
206
Here we report several major findings that should advance the understanding of regulation of
heterocyst pattern formation in Anabaena, including 1) discovery of a region of HetR including
amino acids 250-256 necessary for sensitivity of HetR to PatS-5; 2) evidence that PatS binds
directly to HetR from cysteine scanning mutagenesis combined with continuous wave (CW)
electron paramagnetic resonance (EPR) spectroscopy; 3) determination of the stoichiometry of
PatS-5 binding to HetR and that PatS-5 binds HetR as a dimer from double electron electron
resonance EPR experiments; and, finally, 4) corroboration that PatS-5 binds directly to HetR and
measurement of the dissociation constant for HetR binding to PatS-5 using isothermal titration
calorimetry.
MATERIALS AND METHODS
Bacterial strains and growth conditions. Growth of Escherichia coli and Anabaena sp. strain
PCC 7120 and its derivatives; concentrations of antibiotics; induction of heterocyst formation;
regulation of the petE and nir promoters; and photomicroscopy were as previously described [33].
Plasmids were conjugated from E. coli to Anabaena sp. strain PCC 7120 and its derivatives as
previously described [43].
Plasmid construction for making chromosomal alleles. Strains of Anabaena and plasmids
used in this study are described in Table S1. Plasmids pJM100, pJM101, pJM102, pJM103,
pST211, pJM104 , pJM105 and pDR219 are suicide vectors used to replace the chromosomal
hetR-locus with hetR(R250K), hetR(A251G), hetR(L252V), hetR(E253D), hetR(E254D),
hetR(L255V), hetR(D256E) and hetR(E254G), respectively. Overlap extension PCR was used to
generate each of the mutant hetR alleles except hetR(E254D) and hetR(E254G) using the inner
primers listed in Table S2 with names corresponding to that of the resulting substitution with the
outer primers PhetR-BamHI-F and hetR 3’ Seq. The resulting PCR products were cloned into
plasmid pDR327 as NcoI-SpeI fragments to create plasmids pJM100, pJM101, pJM102, pJM103,
pJM104 and pJM105. Plasmids pST211 and pDR219 were generated in a similar fashion, but
outer primer hetR-SacI-SpeI-R was used in place of hetR 3’ seq for pST211 and previously
published inner primers [33] were used to create hetR(E254G) in pDR219.
Construction of strains containing mutant alleles. Strains of Anabaena with mutant alleles of
hetR in place of the wild-type hetR were created as described previously [28] using the hetR-
deletion strain UHM103 and plasmids pJM100, pJM101, pJM102, pJM103, pST211, pJM104 ,
pJM105 and pDR219 to generate strains UHM163, UHM164, UHM165, UHM166, UHM167,
UHM168, UHM169 and UHM122, respectively. Strains with hetR(E253D) and hetR(E254D) are
207
single recombinants in which the entire plasmid is in the hetR chromosomal locus, whereas the
others are the same as PCC 7120 except for the change in hetR sequence.
In vivo PatS-5 sensitivity assays. Duplicate cultures of Anabaena sp. strain PCC 7120 and the
hetR mutant strains were grown to an approximate optical density of 0.4 at 750 nm in BG-11
medium, which contains nitrate, a fixed form of nitrogen. For one set of cultures, the culture
medium was replaced with fresh BG-11, and replaced thereafter every 48 h with BG-110, which
lacks fixed nitrogen. For the other set of cultures, PatS-5 was included in the medium at a
concentration of 1 µM. The percentage of 500 cells that were heterocysts was determined
microscopically and recorded after each change of medium. Reported values are the average of
three replicates with one standard deviation. Conditions for photomicroscopy were as described
previously [33].
Cloning, overexpression and purification of recombinant soluble HetR. The hetR gene was
PCR amplified from genomic DNA of Anabaena sp. PCC 7120 using the forward primer 5’-
ATCGATCGCATATGAGTAACGACATCGATCTGATC-3’ and the reverse primer 5’-
TGACTCTCGAGCTAATCTTCTTTTCTACCAAACACC-3’, cloned into pET28b (Novagen) at Nde
I and Xho I sites with an N-terminal 6x-His tag including a thrombin cleavage site, then
transformed into competent cells of the cloning host E. coli DH5α. For preparations of hetR
mutants, refer to Table S3. All mutants were generated using the QuickChange II XL site-directed
mutagenesis kit (Stratagene) and their DNA sequences confirmed by capillary electrophoresis
based sequencing at the Miami University Center for Bioinformatics and Functional Genomics.
HetR 250-256C mutants were generated using the C48A mutant plasmid as the DNA template.
Correctly mutated 250-256C plasmids were transformed into BL21(DE3) competent cells
containing the pGroESL vector to assist in proper protein folding [44]. The plasmid construct was
isolated using a Wizard Plus Miniprep kit (Promega) and transformed into competent cells of the
expression host BL21(DE3) (Novagen). The hetR-containing E. coli clone was grown at 37°C with
250 rpm shaking to an OD600 of 0.6-0.9 in 1 L of LB-Miller broth supplemented with 30 µg/mL
kanamycin. Protein expression was induced by addition of 0.25 mM isopropyl β-D-1-
thiogalactopyranoside at 18°C overnight. Cells were harvested and stored at -80°C for later use.
Thawed cells were resuspended in 25 mL of lysis buffer [1 M NaCl, 10% (w/v) glycerol, 10 mM
Tris pH 7.8] followed by 4 passes through a French Pressure Cell Press (Thermo Fisher). Cell
lysates were centrifuged at 24,000g for 20 min. The supernatant was loaded onto a 10 mL Ni-
NTA affinity column (Qiagen) and washed with 50 mL of wash buffer [1 M NaCl, 10% (w/v)
glycerol, 10 mM Tris pH 7.8] followed by a second wash with pre-elution buffer [1 M NaCl, 10%
(w/v) glycerol, 10 mM Tris pH 7.8, 30 mM imidazole]. Soluble His tagged protein was eluted from
the Ni-NTA column with elution buffer [1 M NaCl, 10% (w/v) glycerol, 10 mM Tris pH 7.8, 300 mM
208
imidazole] and concentrated with an Amicon Ultra (Millipore) to a concentration of 15 mg/mL as
determined by the Bradford assay (Thermo Scientific). Concentrated protein solutions were
further purified and analyzed on a Pharmacia Superdex200 HiLoad size exclusion column
equilibrated with buffer containing 1 M NaCl, 10% (w/v) glycerol, 10 mM Tris pH 7.8, and 300 mM
imidazole using a flow rate of 1 mL/min. The mutants co-expressed with the GroESL chaperone
were also supplemented with 30 µg/mL chloramphenicol during expression. Circular dichroism
spectra of HetR did not change with the buffer and solution conditions used in our experiments
following incubation at 37°C for 24 hours, indicating no loss of structure or change in the
secondary structure composition of the protein due to autoproteolytic activity, which has been
reported by Zhou et al. [30, 31], in the absence of phenylmethanesulfonylfluoride protease
inhibitor. The calcium ion concentrations in these solutions were on the order of 50 µM as
determined by inductively coupled plasma atomic emission spectroscopy.
DNA binding assays. Electrophoretic mobility shift assays were performed using 1.8% agarose
gels. Agarose gel electrophoresis experiments used buffer containing 0.2 µg/mL ethidium
bromide (Fisher) run at 80 mAmp for 1 h in TAE buffer. DNA binding reactions were incubated for
10 min at 22°C prior to electrophoresis. Images were generated using an Alpha Innotech camera
and Alpha Imager software. The individual strands of the 29 base pair inverted repeat upstream
DNA fragment were synthesized (250 nmole scale synthesis for each strand) and HPLC purified
(for determining HetR binding stoichiometry), or for all other experiments, synthesized at a 25
nmol scale with standard desalting, by Integrated DNA Technologies (Coralville, Iowa). The
complementary oligonucleotides, forward 5’-GTAGGCGAGGGGTCTAACCCCTCATTACC-3’ and
reverse 5’-GGTAATGAGGGGTTAGACCCCTCGCCTAC-3’, were annealed by suspending
equivalent stoichiometric amounts at 200 µM in the same buffer used to prepare HetR solutions,
heated to 85°C, and then allowed to cool slowly to room temperature. PatS-5 (RGSGR) peptide
was custom synthesized and purified by A & A Labs LLC (San Diego, CA), and PolyG (GGGGG)
peptide was synthesized and purified by Peptide2.0 (Chantilly, VA), both on a 10 mg scale. PatS-
5 was suspended in 100% nanopure H2O to stock 10 mM concentrations. PolyG was suspended
in 100% acetonitrile to a stock 10 mM concentration.
Circular dichroism spectroscopy. Circular dichroism spectra were obtained on a Jasco model
J-810 spectropolarimeter. Measurements were obtained on recombinant HetR using 300 µL of
approximately 15 µM at 25°C using a quartz cell of 1 mm path length. All circular dichroism
spectra were the result of 10 averaged scans from 200 to 250 nm. Jasco Spectra Analysis
software was used to generate the plots of molar ellipticity vs. wavelength.
209
Site-directed spin labeling. The nitroxide spin radical (1-Oxyl-2,2,5,5-tetramethyl-pyrrolin-3-
yl)methyl methanethiosulfonate (MTSL), (Toronto Research Chemicals Inc.) was dissolved in 50%
methanol to a stock concentration of 35 mM. HetR 250-256C mutants were spin-labeled using a
2-fold molar excess of MTSL at 22°C in the dark overnight with gentle shaking. Excess label was
removed (confirmed using CW EPR) by size exclusion chromatography using an analytical grade
Pharmacia Superdex200 10/300 GL column.
Preparation of samples for electron paramagnetic resonance spectroscopy. Spin-labeled
HetR proteins were concentrated to 100 µM. For CW EPR experiments, 30 µL of protein solution
was drawn into 1.1 mm internal diameter (1.6 mm external diameter) quartz capillaries. The
capillary tubes containing the samples were then placed into 3 mm internal diameter quartz EPR
tubes and inserted into the instrument microwave cavity. For pulsed EPR DEER experiments, a
cryoprotectant was added to the samples (samples were brought to a final concentration of 30%
glycerol) and then 8 µL of the cryoprotected protein solutions were drawn into 1.1 mm internal
diameter (1.6 mm external diameter) quartz capillaries. The capillary tubes containing the
samples were frozen in liquid nitrogen and then inserted into the resonator for data collection.
For DEER experiments involving samples containing DNA, the DNA concentration was 100 µM.
Electron paramagnetic resonance spectroscopy. EPR spectra were collected at the Ohio
Advanced EPR Laboratory. CW-EPR spectra were collected at X-band on a Bruker EMX CW-
EPR spectrometer using an ER041xG microwave bridge and ER4119-HS cavity coupled with a
BVT 3000 nitrogen gas temperature controller (temperature stability ± 0.2 K). CW EPR spectra
were collected by signal averaging 15 42-s field scans with a center field of 3370 G and sweep
width of 100 G, microwave frequency of 9.5 GHz, modulation frequency of 100 kHz, modulation
amplitude of 1 G, microwave power of 1 mW at 298 K. DEER data were collected using a Bruker
ELEXSYS E580 spectrometer equipped with a SuperQ-FT pulse Q-band system and EN5107D2
resonator. DEER data were collected at Q-band with a probe frequency of 34.174 GHz and a
pump frequency of 34.235 GHz, a probe pulse width of 20/40 ns, a pump pulse width of 48 ns,
shot repetition time of 499.8 µs, 100 echoes/point, 2-step phase cycling at 80 K collected out to 2
ns.
EPR spectral simulations. Qualitative analysis of spin-label mobility was obtained from
simulations of the CW EPR line shapes to extract best-fit values of the inverse line-width of the
central resonance line (ΔH0-1
) and the components of the diffusion tensor (R) required to
reproduce the observed averaging of the hyperfine interaction tensor. The line-width of central
resonance line was calculated by measuring central peak-to-peak magnetic field from the first
derivative spectrum. Simulations were performed in Matlab using a non-linear least square data
210
analysis program developed by Budil et al. [45, 46]. The three components of electronic Zeeman
interaction tensors (gxx, gyy, and gzz) and hyperfine interaction tensors (Axx, Ayy, and Azz) were
optimized using the spectrum of HetR 256C, which was characteristic of a spin label approaching
the rigid limit. This spectrum provided well-defined features to constrain the A and g tensors to
account for the polarity of the local environment of the MTSL nitroxide spin label [47, 48]. The A
and g tensors were held constant for all remaining simulations and it was assumed that remaining
differences in spectra were due to differential motion of the MTSL spin label. The three
components of the rotational diffusion tensor (Rxx, Ryy & Rzz, units of log (sec-1
)) were varied
during fitting. The best-fit components of the tensor were averaged to report the overall rate of
diffusion (Riso = 1/3(Rxx+Ryy+Rzz)) [49]. EPR spectra of HetR 252C in the presence of PatS-5
consisted of a sum of free and Pats-5 bound species. In this case, a two-site fit was used to
account for free and bound states. Best-fit diffusion tensors for each species in the mixture were
determined using a Brownian diffusion model. The percentage contribution of each motional
component to the overall spectrum was obtained for each sample. DEER data was simulated
using DEER Data Analysis 2009 [50]. The distance distributions P(r) were obtained by Tikhonov
regularization [51] in the distance domain, incorporating the constraint P(r) > 0. The regularization
parameter was adjusted to obtain the realistic resolution.
Molecular dynamics simulations. The atomic coordinates for the HetR crystal structure
(PDB ID: 3QOE) from Fischerella were downloaded from the Protein Data Bank and used to
generate the structures of various spin-labeled HetR constructs with the Nano-scale Molecular
Dynamics (NAMD) program [51]. The C48A and 250-256C cysteine mutations were created
using the molecular graphics software VMD [52]. The nitroxide spin-probe MTSL was attached
using CHARMM force field topology files incorporated into NAMD. The modified protein
assembly was solvated into a spherical water environment and further equilibrated and
minimized by running NAMD simulations at room temperature using CHARMM force field
parameters. The distance distribution for the 252C mutants was predicted with rotamer library
modeling of MTSL conformations using Multi-scale modeling of macromolecular systems
(MMM version 2010) [53]
Isothermal titration calorimetry. ITC measurements were performed at 25°C with a VP-ITC
titration calorimeter (Microcal, Northampton, MA). Size-exclusion-chromatography purified HetR
samples were dialyzed for 18 h at 4°C against the reference buffer: 1 M NaCl, 10% glycerol,
300 mM imidazole, 10 mM Tris pH 7.8. HetR was then diluted to a final concentration of 5 µM
for experiments. PatS-5 peptide was diluted into the reference buffer to a final concentration of
100 µM. The titrations were performed in triplicate using a total of 36 injections of PatS-5
peptide for each titration as follows: one 4 µL injection followed by 35 8 µL injections. For each
211
titration 0.60 mL of 100 µM PatS-5 peptide was loaded into the injection syringe. Blank titrations
of PatS-5 solutions into reference buffer were performed to correct for the heats of dilution of
PatS-5, which were found to be insignificant. Following the blank experiments, a 1.46 mL
sample of HetR was degassed and loaded into the sample cell from the 5 µM prepared stock for
each titration. The resulting titration curves were deconvoluted and fit using a one binding site
model with the ORIGIN for ITC software package (Microcal, Piscataway, NJ).
RESULTS
Conservative substitutions at HetR residues 250-256 affect heterocyst formation and
sensitivity to PatS-5
As part of a mutagenesis study designed to identify residues of HetR required for function,
an allele of hetR coding for an E254G substitution was found to cause differentiation into
heterocysts of essentially all cells containing a multicopy plasmid carrying the mutant gene (32).
Introduction of a plasmid bearing the hetR(E254G) allele under the control of the native promoter
of hetR to PCC 7120 by conjugation resulted in no viable transconjugants. To limit expression of
the hetR(E254G) allele, the wild-type promoter region was replaced with that of the copper-
inducible petE promoter and the plasmid was introduced into PCC 7120. Limited growth of a
small number of transconjugants on solid BG-11 medium containing ammonia and lacking
copper was observed. The resulting colonies lacked the green color of colonies of the wild
type, were composed primarily of heterocysts, and showed little to no growth in liquid
culture (data not shown). By comparison, a strain with PpetE driving transcription of the wild-
type allele hetR in place of the hetR(E254G) allele under the same conditions differentiated less
than 1% heterocysts. Replacement of the wild-type promoter region with a second
promoter, that of nirA, transcription from which is repressed in ammonia and induced in nitrate
or in the absence of fixed nitrogen [54], permitted the growth of filaments on solid and liquid BG-
11 medium with ammonia replacing nitrate as the nitrogen source. Apparently, there is tighter
on-off control of transcription with the nir promoter than with petE in our hands. Transfer of
filaments to BG-11 with nitrate or lacking a fixed source of nitrogen resulted in the differentiation
of greater than 90% of cells into heterocysts. By comparison, a strain with Pnir driving
transcription of the wild-type allele of hetR in place of the hetR(E254G) allele under the same
conditions differentiated about 30% heterocysts (data not shown). When the native copy of hetR
in PCC 7120 was replaced with an allele encoding the E254G substitution, about 25% of cells in
the resulting strain were heterocysts 48 h after induction. The phenotype of this strain was
indistinguishable from that of a strain with a copy of hetR encoding the more conservative
E254D substitution, which is discussed in more detail below.
212
Figure 1. Sensitivity to PatS-5 of strains with mutant alleles of hetR. (A) Bar graph of
the percentage of cells that are heterocysts in the wild-type strain (PCC 7120) and
strains with an allele of hetR encoding the indicated amino-acid substitution 96 h after
removal of combined nitrogen with (red-striped bars) or without (solid blue bars) the
addition of PatS-5 to the medium. Values represent the average of 500 cells from
three independent cultures. Strain PCC 7120 (B and C) and UHM167, which
contained an allele of hetR encoding an E254D substitution (D and E), 96 h after
removal of combined nitrogen without (B and D) or with (C and E) the addition of
PatS-5 to the medium. Carets indicate heterocysts.
213
Differentiation of nearly all cells of a filament has been observed when both patS and hetN
are inactivated simultaneously or when an allele of hetR encoding protein less sensitive to both
inhibitors is overexpressed ectopically and the mutant strains are grown in the absence of
combined nitrogen [34, 55]. To determine if the more conservative E254D substitution also
resulted in an overactive allele of HetR and if residues in the region of E254 were involved in
the response of HetR to PatS-5, alleles of HetR encoding individual conservative
substitutions at residues R250 – D256 were used to substitute hetR by allelic replacement in
PCC 7120 (see Table S1). Filaments of strains with alleles encoding R250K, E253D,
E254D, L255V, and D256E substitutions consisted of about 14 to 48% heterocysts, and the
presence or absence of fixed nitrogen in the medium had little effect on differentiation by an
individual strain. By comparison, about 9% of cells in filaments of PCC 7120 were heterocysts
in a medium that lacked fixed nitrogen, and about 1% when fixed nitrogen was present.
Conversely, A251G and L252V substitutions prevented or reduced differentiation, respectively
(Fig. 1). Strains that differentiated an increased number of heterocysts were also less
sensitive to PatS-5. Addition of PatS-5 to the growth medium prevented differentiation of
heterocysts by the wild-type strain, PCC 7120 [25]. In contrast, 8 to 25% of cells in
filaments of strains with alleles encoding R250K, E253D, E254D, L255V, and D256E
substitutions were heterocysts in a medium that contained PatS-5 at a concentration of 1 µM
(Fig. 1). As expected, PCC 7120 lacked heteroycsts under the same conditions. Taken
together, these results suggest that residues R250, E253, E254, L255 and D256 of HetR
are involved in sensitivity to PatS-dependent signals in vivo.
Evidence for direct binding of PatS-5 to HetR
The previous experiments pointed to amino acids at the C-terminus as being important for HetR
sensitivity to PatS. Guided by these in vivo observations, we designed in vitro experiments to
test the hypothesis that PatS-5 binds to HetR in the vicinity of amino acids 250-256. Initially, we
characterized the mobility and secondary structural environment of these amino acids using a
combination of site-directed spin labeling and continuous wave (CW) EPR spectroscopy to
provide a baseline for PatS-5 binding studies and then we used these techniques to determine
how the mobility of these residues were affected after the addition of PatS-5. CW EPR spectra
of MTSL spin-labeled proteins can be affected by interactions with other proteins, peptides or
small molecules (56-58) and can be monitored to identify changes in protein conformational
dynamics that accompany substrate binding [56-60]. To enable this approach, it was necessary
to employ site-specific mutagenesis and nitroxide spin labeling [61], whereby amino acids 250-
256 were individually mutated to cysteine and then labeled with the stable nitroxide free radical
(1-oxyl-2,2,5,5-tetramethyl- pyrrolin-3-yl)methyl methanethiosulfonate (MTSL). MTSL spin
214
labeling requires
substitution of the amino
acid at the desired site
with cysteine, and to
ensure that MTSL labeling
occurs only at one
position on the protein,
this should be the only
cysteine in the protein.
Therefore, the HetR
protein used to generate
CW EPR spectra had a
C48A substitution to
remove the naturally
occurring cysteine in
addition to substituting
amino acids 250-256
individually with cysteine.
The C48A substituted
protein resembled the
unmodified protein with
respect to binding of DNA
and response to PatS-5
peptide (see below). The
CW EPR spectrum of
each MTSL-labeled HetR
mutant (Fig. 2) was
measured to establish the
degree of conformational
mobility present at each
site in the absence of
PatS-5. Acquisition of these spectra were necessary to establish a baseline prior to looking for
changes in the conformational mobility of the spin label after addition of PatS-5, which, if
observed, would indicate a direct HetR PatS binding interaction. Control CW spectra of each
MTSL spin-labeled mutant were recorded at 100 µM protein, a concentration unlikely to exist
in cells but required for CW EPR spectra. Each mutant was titrated with 100 µM, 200 µM,
500 µM, and 1 mM PatS-5 and the CW EPR spectrum recorded after each addition.
Figure 2. Room temperature X-band CW-EPR spectra showing
variations in spin label mobility for HetR mutants in the range
250−256. The amino acid position of the MTSL label is indicated
above each spectrum. The solid blue line indicates experimental
data and the red dashed line is the best-fit simulation of the data.
Simulation parameters are included in Supporting Information
Table S4.
215
Simulations enabled determination of g-, A-, and R-tensor parameters (Table S2). CW EPR
spectra of MTSL labeled at positions R250C and L252C exhibited significant conformational
averaging and corresponding conformational dynamics based on their central resonance line
widths and isotropic rotational diffusion rates (∆Ho = 2.03 and 3.45 G, and log(Riso) = 7.73
and 6.53 sec-1
, respectively) indicating these residues likely occur either on surface exposed
helices or surface exposed loops [59, 62, 63]. MTSL at the A251C, E253C and D256C positions
were less mobile with time-scales of motion too slow to cause motional averaging of the
hyperfine interaction tensor (∆Ho values in the range 5.85-7.70 G and log(Riso) values in the
range of 5.54-5.60 sec-1
) indicating that they likely resided either at helix-helix contacts or in
buried locations within the protein [59, 62, 63]. The E254C and L255C mutants were difficult
to label, exhibited intrinsic protein instability and aggregation, gradually precipitated
over time, and produced poor EPR spectra, indicating that mutations at these sites disrupted the
local protein structure. The recently released HetR crystal structure from Fischerella (PDB ID:
3QOE, [64]) was used to examine the structural context of the MTSL spin- label in each HetR
cysteine mutant. The atomic coordinates for the structure were downloaded from the Protein
Data Bank and analyzed using the program VMD [52] in order to generate the initial C48A
mutation, followed by individual R250C-E256C cysteine mutations. Following substitutions,
MTSL groups were engineered onto the side chains, attached via the disulfide linkage to the free
sulfhydryl of cysteine using NAMD [51] and then simulated to achieve a local energy
minimization. The resulting structures, shown in Fig. 3 were rendered using Pymol molecular
visualization software. The general location of amino acids 250-256 can be seen in Fig. 3A in
which these residues are rendered using stick representation. A clear correspondence was
evident between the location of each spin label and the magnitude of the conformational mobility
based on the inspection and simulation of the CW EPR spectra. For example, the 250C mutant
exhibits a highly motionally averaged EPR spectrum (Fig. 2) that is consistent with the location
of residue 250 on the surface of the protein (Fig. 3B). The 251C mutant displays an EPR
spectrum devoid of motional averaging effects and the spin label appears buried in the model
(Fig. 3C). The 252C mutant exhibits significant motional averaging, consistent with the location
of the spin label on the surface of the protein (Fig. 3D). Likewise, the EPR spectra of the 253C
and 256C mutants show no signs of motional averaging consistent with the buried nature of
the spin label in the models (Figs. 3E and 3G).
The CW EPR spectrum of HetR spin-labeled at 252C changed dramatically after addition
of PatS-5 (Fig. 4), going from a distinctly motionally averaged spectrum in the absence of PatS-5
to a spectrum that showed no evidence of motional averaging in the presence of a ten-fold
molar excess of PatS-5. This observation indicated substantial quenching of the conformational
dynamics of the MTSL nitroxide electron radical upon addition of PatS-5. These observations
216
Figure 3. (A) Crystal structure of the HetR homodimer (PDB ID: 3QOE, [43]) from
Fischerella with the general location of residues 250−256 depicted by stick
representation, which were rendered using Pymol molecular visualization
software (The PyMOL Molecular Graphics System, Version 1.3, Schrodinger,
LLC.). Space filling representation of the MTSL group in HetR mutant (B) 250C,
(C) 251C, (D) 252C, (E) 253C, (F) 254C, (G) 255C, and (H) 256C.
217
Figure 4. CW-EPR spectra indicating direct binding between HetR and PatS-5.
The MTSL-labeled 252C HetR mutant was titrated with PatS-5 and monitored by
CW X-band EPR spectroscopy at room temperature. The control spectrum is
shown at the bottom. For the remaining spectra, the ratio of PatS-5 to HetR-252C
(indicated above each spectrum) increases from bottom to top in the stack. The
solid blue line indicates experimental data and the red dashed line is the best-fit
simulation of the data. Parameters for the EPR spectral simulations are included
in Supporting Information Table S4.
218
provided clear evidence for a direct binding interaction between HetR and PatS-5. At PatS-5 to
HetR-252C ratios < 10:1, a mixture of the free and bound states in slow exchange was evident
and the EPR spectra could be explained as a sum of spectra for free HetR mutant and HetR
mutant bound to PatS-5. At a 10:1 ratio, HetR-252C appeared predominantly in the PatS-5-
bound state. Simulations of the CW EPR spectra of the MTSL-labeled HetR-252C mutant
enabled determination of the change in the overall diffusion constant for spin-label motion
after binding to PatS-5, indicating almost an order of magnitude reduction in the diffusion rate in
the bound state (log(Riso) = 6.62 sec-1
in the free state compared to an upper limit of
log(Riso) = 5.92 sec-1
in the bound state (simulation parameters are in Table S3). Quenching
of the spin-label motion indicated either a proximal interaction with PatS-5 binding nearby, but
not necessarily at, amino acid 252, or a distal interaction in which PatS-5 could bind away from
the spin label, but the spin label motion could be quenched due to a tertiary or quaternary
change in protein structure that caused restriction of the spin label motion at amino acid 252.
Evidence for PatS-5 binding to the dimer form of HetR
The pulsed EPR double
electron electron resonance
(DEER) experiment [65, 66] can
be used to measure long-range
distances (from 20-70 Å)
between spin labels in large
proteins [67, 68]. Here, DEER
EPR experiments were used 1)
to measure the intermolecular
distance across the HetR
homodimer, 2) to determine if
PatS binding caused a change
in the quaternary structure of
the HetR dimer, and 3) to
determine if PatS-5 binding
disrupted the HetR dimer.
DEER data was initially
collected on the MTSL-labeled 252C HetR mutant. The time-domain DEER signal (Fig. 5A) had
an excellent signal to noise ratio and exhibited a strong modulation indicating substantial dipolar
coupling between the two MTSL spin labels across the dimer. Fourier transform of the time
Figure 5. DEER data for 252C HetR mutant. (A) The
time-domain DEER signal; (B) the frequency spectrum
resulting from the Fourier transform of the time-domain
data; (C) the best fit of the distance distribution that
explains the DEER data using a Tikhonov
regularization fitting procedure.
219
domain DEER modulation produced
a dipolar spectrum with well-
defined features (Fig. 5B).
Simulations of the time-domain
DEER data produced a clear peak
maximum in the distance
distribution indicating that the
distance between the MTSL spin
labels in each monomer was 2.7
nm (Fig. 5C). Observation of a
DEER signal in the MTSL spin-
labeled 252C mutant (which
contained the C48A mutation)
confirmed that C48 was not
necessary for HetR dimer formation,
since no DEER signal would be
detectable if the HetR mutant
existed as a monomer in solution.
In the presence of a 10-fold excess
of PatS-5, the DEER signal was
virtually unchanged compared to
the HetR alone sample,
demonstrating that PatS-5 binds
to HetR without disrupting the
HetR dimer. Furthermore, the
distance between the spin labels,
measured to be 2.6 nm in the presence of bound PatS-5, was the same within the uncertainty of
the measurement as the distance measured for HetR in the absence of bound PatS-5,
indicating that HetR binding to PatS-5 did not cause a structural rearrangement that resulted in
a change in the distance between the two spin-labeled 252C residues in the HetR dimer.
Furthermore, a DEER distance of 2.7 nm was measured when HetR 252C was bound to the 29
base pair hetP DNA fragment, also indicating that the HetR dimer also did not undergo a
structural rearrangement that changed the distance between the two 252C residues in the HetR
dimer upon DNA binding. The atomic coordinates of the crystal structure of HetR from
Fischerella (PDB ID: 3QOE, [64]) were used to measure the distance across the HetR dimer
from residue 252 (Fig. 6). The crystal structure was modified as discussed in the methods
section to create the 252C mutant modified by the MTSL spin label. The resulting modified
Figure 6. (A) Superposition of an ensemble of
structures of MTSLmodified 252C HetR mutant
generated by molecular dynamics simulation starting
from the crystal structure of the HetR homodimer
(PDB ID: 3QOE, [43]) from Fischerella as described
in the Materials and Methods. (B) Representation of
the average distance between the nitroxide groups of
the 252C-MTSL HetR mutant revealed an average
N−N distance of 26.5 Å and an average O−O
distance of 27.9 Å.
220
structure was subjected to molecular dynamics simulation to create an ensemble of structures,
which are depicted in Fig 6A. Average distances between the spin labels were analyzed using
the distance measurement tool in Pymol. Distance measurements between the nitroxide
groups of the 252C-MTSL revealed an average N-N distance of 26.5 Å and an average O-O
distance of 27.9 Å (Fig. 6B), consistent with our observed DEER distance of 27 Å.
Characterization of binding of HetR to a 29 bp inverted repeat containing DNA sequence
upstream of hetP
HetR was recently shown to bind
tightly to a 29 bp region upstream of
the hetP gene containing the
inverted repeat sequence 5´-
GAGGGGTCTAACCCCTC-3´ [69].
Indeed, HetR appears to bind more
tightly to this upstream hetP DNA
sequence than to any previously
used DNA substrate reported in the
literature, and thus, enabled us to
investigate the stoichiometry of
HetR binding to DNA. At a HetR to
DNA ratio of 3:1, the majority of the
DNA was shifted and approximately
half of the DNA was shifted at
between 2:1 and 3:1 (Fig. 7). This
data is consistent with HetR binding
the upstream hetP DNA sequence
with a 2:1 stoichiometry, since the
extent of completion of the gel shift
depends on the dissociation
constant, Kd. All these data taken
together, along with the fact that most prokaryotic transcription factors bind inverted repeat DNA
sequences as homodimers (70-72), suggests that HetR binds this single inverted- repeat
containing upstream hetP DNA sequence as a homodimer. Interestingly, at HetR to DNA ratios
greater than 4:1, a supershifted species was also present (Fig. 7) possibly caused by two HetR
homodimers binding to a single 29 base pair DNA molecule. The amount of supershifted species
depended on the amount of NaCl in solution, and the most DNA in the supershifted band
Figure 7. EMSA showing binding of HetR to the 29
base pair inverted repeat containing upstream hetP
DNA fragment. The ratio of HetR to DNA increases
from left to right. The resulting completeness of
shifted DNA was used to assess the stoichiometry of
binding between HetR and DNA as one molecule of
HetR dimer per double stranded DNA molecule. The
box contains the supershifted bands observed at high
HetR to DNA ratios.
221
compared to the shifted band was observed when using 0.5 M NaCl in the solution (data not
shown).
Sensitivity of the HetR-DNA complex to PatS-5
The strong interaction between HetR
and DNA from the hetP promoter
region permitted assessment of the
PatS-5 to HetR ratios required to
disrupt HetR binding to DNA. In gel
shift assays it was found that PatS-5
completely disrupted the supershifted
species at a substoichiometric ratio of
0.5:1 PatS-5 to HetR monomer and
the shifted species was completely
disrupted at a 10:1 ratio of PatS-5 to
HetR (Fig. 8). When PatS-5 was
titrated into a solution of the MTSL-
labeled HetR 252C-DNA complex,
the CW EPR spectra were the same
as HetR plus PatS-5 alone (Fig. S1
and Table S3). This result is
consistent with the gel shift assay
showing that the HetR-DNA
interaction is disrupted when HetR
binds to PatS-5. In other words, in a
solution containing HetR, PatS-5 and DNA, only a complex of HetR and PatS-5 would exist and
the DNA would be free in solution.
Similarity of HetR and HetR-C48A
As mentioned above, HetR containing a C48A substitution was used in the CW EPR work that
showed binding of PatS-5. It was therefore important to examine whether or not C48A substituted
HetR behaved similarly to wild-type protein. Huang et al. [29] previously reported that HetR
residue C48 was required for both dimer formation and DNA binding. Here, size exclusion
chromatography analysis of HetR-C48A showed that it eluted identically to wild type HetR
indicating that the proposed intermolecular cysteine disulfide bond was not required for dimer
formation (Fig. S1). The DEER EPR data confirmed that the C48A HetR spin-labeled mutant
existed as a dimer in solution. Comparison of wild type HetR and HetR-C48A using PAGE (Fig.
Figure 8. EMSA showing binding of HetR to the 29
base pair inverted repeat containing upstream hetP
DNA fragment. The ratio of HetR to DNA increases
from left to right. The resulting completeness of
shifted DNA was used to assess the stoichiometry of
binding between HetR and DNA as one molecule of
HetR dimer per double stranded DNA molecule. The
box contains the supershifted bands observed at high
HetR to DNA ratios.
222
9A) showed that the wild type HetR
exhibited a strong dimer band even
under denaturing conditions (0.1%
SDS in the protein buffer) and in the
presence of 10 mM dithiothreitol,
whereas the dimer band was almost
completely gone in the C48A mutant
under the same conditions. Huang et
al. [29] reported that the dimer band
was completely gone for the C48A
HetR mutant in SDS PAGE and
concluded that HetR-C48A was
unable to form dimers in vitro, that
the HetR dimer was formed through
a disulfide bond and that Cys-48 was
required for dimerization. We were,
however, able to detect a dimer band
for HetR-C48A under milder
denaturing conditions using 0.01%
SDS-PAGE (Fig. 9B). Taken
together with the size exclusion
chromatography and DEER data,
these results indicated that C48 was
not required for dimer formation,
however the dimer may have been stabilized by an interchain disulfide bond. In addition, circular
dichroism spectra of wild type HetR and the C48A HetR mutant were identical and characteristic
of a protein with predominantly α-helical secondary structure as indicated by distinct minima in
molar ellipticity at 209 and 222 nm (wild type HetR CD spectrum shown in Fig. S2).
In addition to having the same physical characteristics as the wild-type protein, C48A substituted
HetR behaved similarly to the wild type HetR in gel shift assays. At the same concentrations as
those described above, both shifted and supershifted species were observed, however the
supershifted band tended to be less prominent compared to that generated with wild type HetR.
The HetR-252C mutant also shifted the DNA in the same manner as the C48A mutant of HetR
(data not shown). When PatS-5 was included in the binding reactions, binding of the C48A HetR
mutant to the 29 bp hetP promoter region was affected in a manner similar to that for the wild
type protein, suggesting that the C48A substitution does not affect binding of HetR to DNA or its
interaction with PatS-5 peptide.
Figure 9. Polyacrylamide gel electrophoresis
analysis of soluble-expressed purified recombinant
HetR and C48A HetR mutant. (A) At 0.1% SDS and
10 mM dithiothreitol. Molecular weight marker (Fisher
Bioreagents EZ-run Rec Protein Ladder) are
indicated in units of kilodaltons (kDa) to the left of the
lane marked M. (B) At 0.01% SDS and 10 mM
dithiothreitol. Lanes are marked “HetR” for wild-type
HetR and “C48A” for the C48A mutant of HetR.
223
Determination of the stoichiometry, dissociation constant, and thermodynamic parameters
for binding of PatS-5 to HetR
Isothermal titration calorimetry
(ITC) is a highly sensitive
biophysical technique
designed for analyzing the
thermodynamics of molecular
interactions. ITC can be used
to study protein-protein or
protein-small molecule
binding interactions and is
capable of detecting heats
of binding directly, without
the use of any molecular
labels or tags that might
interfere with or influence
binding [73]. Here, ITC was
used to confirm direct binding
of PatS-5 to HetR (Fig. 10).
The integrated binding heats
were indicative of a single
exothermic binding event. A
single binding site model was
used to fit the binding curves,
which allowed determination
of the binding stoichiometry n,
Ka (equal to 1/Kd) and ∆H.
The ∆G was determined from
Ka, and ∆S was then
calculated using the ∆G and
∆H values. The data indicated
that one PatS-5 peptide binds
to one HetR monomer, i.e.
two peptides bind per
homodimer. It has been previously shown that calculations using a model for two non-interacting
identical binding sites of a homodimeric protein binding to two identical peptides are essentially
the same as one peptide binding-site for each monomer [74]. PatS-5 was found to bind HetR
Figure 10. Polyacrylamide gel electrophoresis analysis of
soluble-expressed purified recombinant HetR and C48A
HetR mutant. (A) At 0.1% SDS and 10 mM dithiothreitol.
Molecular weight marker (Fisher Bioreagents EZ-run Rec
Protein Ladder) are indicated in units of kilodaltons (kDa) to
the left of the lane marked M. (B) At 0.01% SDS and 10 mM
dithiothreitol. Lanes are marked “HetR” for wild-type HetR
and “C48A” for the C48A mutant of HetR.
224
with a mean Kd of 227 ± 23 nM, ∆G of -9.063 ± 0.059 kcal/mol, and n of 1.04 ± 0.01 sites,
indicating a single tight exothermic binding interaction. PatS-5 binding to HetR exhibited a
relatively large negative enthalpy (-8.337 ± 0.410) and a positive entropy (2.44± 1.55
cal/(mol·deg)). Inspection of Table 1 shows that the binding affinity of HetR for PatS-5 was
dominated by the change in enthalpy, in comparison to the relatively small change (more than 10-
fold smaller) in T∆S. This indicates that binding of PatS-5 to HetR is enthalpically driven as
opposed to an entropically driven process. It is difficult to elucidate the relative contributions to
binding of PatS-5, however, the relatively large negative enthalpy of binding is consistent with the
formation of hydrogen bonds or ionic interactions, which are associated with relatively large
negative contributions to enthalpy for ligands binding to proteins [75-77]. Collectively, the
isothermal titration calorimetry data corroborate the EPR observations that PatS-5 binds directly
to HetR in the absence of DNA.
Table 1. Summary of Quantities Associated with HetR Binding to PatS-5 Peptide Derived from
Isothermal Titration Calorimetry Experiments
DISSCUSSION
Since the original report of PatS as a diffusible inhibitor of heterocyst differentiation [25], the
specific partners that interact directly in the process of PatS-dependent heterocyst regulation
have been difficult to identify, both in vitro and in vivo. While multiple groups have
demonstrated that the RGSGR carboxyl terminus of PatS is capable of inhibiting DNA binding of
HetR to a region upstream from its own promoter in vitro [29, 32], and a R223W mutant of HetR
has been shown to be insensitive to in vivo overexpression of both PatS and HetN [34], all of
these observations have provided only indirect evidence of a direct interaction between HetR and
PatS. The specific partners that interact directly during PatS disruption of HetR binding to DNA,
and the direct molecular-level interactions that cause the loss of R223W HetR sensitivity to PatS,
have not been unambiguously elucidated with support of experimental data. Specifically
with regards to the gel shift experiments, no experimental data has been reported in the literature
to distinguish between the two following possibilities: 1) that the disruption is caused by PatS-5
displacing the DNA upon binding directly to HetR, or 2) that PatS-5 displaces HetR upon binding
directly to the DNA. Resolving these issues has been impossible using traditional techniques
used to observe direct intermolecular interactions, such as gel shift assays and size exclusion
chromatography assays to detect HetR binding directly to PatS-5 in the absence of DNA,
225
because these techniques lack sufficient resolution to detect shifts in the migration of either the
70 kDa HetR dimer or the > 20 kDa DNA fragments upon binding to the PatS-5 pentapeptide,
which adds only about 0.6 kDa to the overall complex molecular weight. Moreover, PatS lacks
any naturally occurring spectroscopic probe that could be used to detect binding between HetR
and PatS-5.
In this manuscript, we report the first unequivocal experimental data that shows direct binding
between HetR and PatS-5. Two different and independent techniques corroborated that PatS-5
binds directly to HetR, namely EPR spectroscopy and isothermal titration calorimetry. The
conclusion from the EPR experiments was based on the observation that the motion of the MTSL
spin-label on the HetR 252C mutant was quenched upon titration with PatS-5 in the absence of
any DNA in solution. This observation clearly indicated a direct binding interaction between the
mutant spin-labeled HetR and PatS-5. However, these data did not unambiguously
indicate that PatS-5 bound in the immediate vicinity of residue 252, since it is possible that PatS-5
could have bound to HetR in a site remote from residue 252 and caused quenching of spin label
motion through an allosteric effect or change in tertiary structure. However, given that in vivo
experiments indicated that HetR residues 250-256 were critical for sensitivity to PatS-5, it would
not be surprising if PatS-5 bound HetR in the C-terminal domain in the vicinity of amino acids
250-256. Besides demonstrating that PatS-5 binds directly to HetR, the DEER EPR experiments
also demonstrated that HetR persisted as a dimer even after binding PatS-5. The isothermal
titration calorimetry data independently corroborated that PatS-5 binds directly to HetR, using the
native HetR protein, without the mutation or MTSL spin-label required for the EPR experiments,
and firmly established that the stoichiometry of binding is one PatS-5 peptide per HetR monomer,
or said differently, two molecules of PatS-5 bind to each HetR dimer. By employing isothermal
titration calorimetry, we were not only able to corroborate that PatS-5 binds directly to HetR in the
absence of DNA, but we were also able to measure its dissociation constant and determine
thermodynamic parameters, which indicated that binding of PatS-5 to HetR was enthalpically
driven. The high affinity of HetR for the 29 base pair inverted repeat containing upstream hetP
DNA sequence enabled a semi-quantitative analysis of the stoichiometry of binding of HetR to
this DNA fragment, which indicated HetR likely binds this DNA at a 2:1 ratio, i.e. HetR binds the
inverted repeat containing upstream hetP DNA sequence as a homodimer. Finally, based on the
determination that the shifted species was a 2:1 complex of HetR to DNA, we concluded that the
supershifted complex possibly consisted of two HetR homodimers bound to a single hetP DNA
sequence, which is consistent with the observation that the supershifted species was only
detected when the ratio of HetR to DNA was greater than 4:1. Again, despite detecting the
supershifted species, the biological relevance of this species, if any, remains to be determined.
226
The biophysical data was driven by the in vivo studies with mutant alleles of hetR. The
phenotypes of strains with alleles of hetR encoding substitutions at residues R250, E253, E254,
L255 and D256 are consistent with decreased sensitivity of the substituted HetR proteins to PatS-
and HetN-dependent inhibitory signals. First, both patS and hetN null mutants as well as the
strains with overactive alleles described here differentiate an increased number of heterocysts
relative to that of the wild type, PCC 7120 [25, 26]. Second, a patS null mutant and the strains
described here with overactive alleles differentiate heterocysts in the presence of a fixed source
of nitrogen. And third, inactivation of both patS and hetN simultaneously results in the formation
of a number of heterocysts in excess of that made by either of the individual mutants [55], similar
to the strains with alleles of hetR encoding E253D, E254D, L255V, and D256E substitutions.
ACKNOWLEDGEMENTS
The authors thank Professor Susan Barnum for providing the genomic DNA of Anabaena sp.
strain PCC 7120 and Kelly Higa for insightful discussions. Bryan J. Glaenzer, Alisha N. Jones,
and Andrea F. Schilling are acknowledged for contributing to early stages of characterization of
soluble HetR. This work was supported in part by a grant from NSF (IOS-0919878) to SMC.
FOOTNOTES
1 Corresponding Author. Michael A. Kennedy, Department of Chemistry and Biochemistry,
Hughes Laboratories, Room 106, Miami University, 701 High Street, Oxford, OH 45056. Email:
[email protected]. Phone: 513-529-8267. Fax: 513-529-5715
227
REFERENCES CITED
1. Fritsch, F. (1904) Studies on cyanophyceae, The New Phytologist 3, 85-96.
2. Fogg, G. (1944) Growth and heterocyst production in Anabaena cylindrica Lemm, New
Phytologist 43, 164-175.
3. Fogg, G. (1949) Growth and heterocyst production in Anabaena Cylindrica Lemm. II in
relation to carbon and nitrogen metabolism, Annals of Botany 13, 241-259.
4. Haselkorn, R. (1978) Heterocysts, Annual Review of Plant Physiology and Plant
Molecular Biology, 319-344.
5. Adams, D. G., and Carr, N. G. (1981) The developmental biology of heterocyst and
akinete formation in cyanobacteria, Crit Rev Microbiol 9, 45-100.
6. Wolk, C. P. (1996) Heterocyst formation, Annu Rev Genet 30, 59-78.
7. Adams, D. G. (2000) Heterocyst formation in cyanobacteria, Curr Opin Microbiol 3, 618-
624.
8. Meeks, J. C., and Elhai, J. (2002) Regulation of cellular differentiation in filamentous
cyanobacteria in free-living and plant-associated symbiotic growth states., Microbiol Mol
Biol Rev 66, 94-121; table of contents.
9. Golden, J. W., and Yoon, H. S. (2003) Heterocyst development in Anabaena., Curr Opin
Microbiol 6, 557-563.
10. El-Shehawy, R., and Kleiner, D. (2003) The mystique of irreversibility in cyanobacterial
heterocyst formation: parallels to differentiation and senescence in eukaryotic cells,
Physiologia Plantarum, 49-55.
11. Zhang, C. C., Laurent, S., Sakr, S., Peng, L., and Bédu, S. (2006) Heterocyst
differentiation and pattern formation in cyanobacteria: a chorus of signals, Mol Microbiol
59, 367-375.
12. Kumar, K., Mella-Herrera, R. A., and Golden, J. W. (2010) Cyanobacterial heterocysts,
Cold Spring Harb Perspect Biol 2, a000315.
13. Brocks, J. J., Logan, G. A., Buick, R., and Summons, R. E. (1999) Archean molecular
fossils and the early rise of eukaryotes, Science 285, 1033-1036.
228
14. Tomitani, A., Knoll, A. H., Cavanaugh, C. M., and Ohno, T. (2006) The evolutionary
diversification of cyanobacteria: molecular-phylogenetic and paleontological perspectives,
Proc Natl Acad Sci U S A 103, 5442-5447.
15. Fay, P. (1992) Oxygen relations of nitrogen fixation in cyanobacteria, Microbiol Rev 56,
340-373.
16. Gallon, J. (1992) Reconciling the incompatible: N2 fixation and O2, New Phytologist 122,
571-609.
17. Haselkorn, R. (2008) Cell-cell communication in filamentous cyanobacteria, Mol
Microbiol 70, 783-785.
18. Fritsch, F. (1951) The heterocyst: a botanical enigma, Proceedings of the Linnean
Society of London 162, 194-211.
19. Wolk, C. P., and Quine, M. P. (1975) Formation of one-dimensional patterns by
stochastic processes and by filamentous blue-green algae, Dev Biol 46, 370-382.
20. Lambein, F., and Wolk, C. P. (1973) Structural studies on the glycolipids from the
envelope of the heterocyst of Anabaena cylindrica, Biochemistry 12, 791-798.
21. Khudyakov, I., and Wolk, C. P. (1997) hetC, a gene coding for a protein similar to
bacterial ABC protein exporters, is involved in early regulation of heterocyst differentiation
in Anabaena sp. strain PCC 7120, J Bacteriol 179, 6971-6978.
22. Nicolaisen, K., Hahn, A., and Schleiff, E. (2009) The cell wall in heterocyst formation by
Anabaena sp.PCC 7120, J Basic Microbiol 49, 5-24.
23. Buikema, W. J., and Haselkorn, R. (1991) Characterization of a gene controlling
heterocyst differentiation in the cyanobacterium Anabaena 7120, Genes Dev 5, 321-330.
24. Black, T. A., Cai, Y., and Wolk, C. P. (1993) Spatial expression and autoregulation of
hetR, a gene involved in the control of heterocyst development in Anabaena, Mol
Microbiol 9, 77-84.
25. Yoon, H. S., and Golden, J. W. (1998) Heterocyst pattern formation controlled by a
diffusible peptide, Science 282, 935-938.
26. Callahan, S. M., and Buikema, W. J. (2001) The role of HetN in maintenance of the
heterocyst pattern in Anabaena sp. PCC 7120, Mol Microbiol 40, 941-950.
229
27. Zhang, J. Y., Chen, W. L., and Zhang, C. C. (2009) hetR and patS, two genes necessary
for heterocyst pattern formation, are widespread in filamentous nonheterocyst-forming
cyanobacteria, Microbiology 155, 1418-1426.
28. Risser, D. D., and Callahan, S. M. (2009) Genetic and cytological evidence that
heterocyst patterning is regulated by inhibitor gradients that promote activator decay,
Proc Natl Acad Sci U S A 106, 19884-19888.
29. Huang, X., Dong, Y., and Zhao, J. (2004) HetR homodimer is a DNA-binding protein
required for heterocyst differentiation, and the DNA-binding activity is inhibited by PatS,
Proc Natl Acad Sci U S A 101, 4848-4853.
30. Zhou, R., Wei, X., Jiang, N., Li, H., Dong, Y., Hsi, K. L., and Zhao, J. (1998) Evidence
that HetR protein is an unusual serine-type protease, Proc Natl Acad Sci U S A 95, 4959-
4963.
31. Zhou, R., Cao, Z., and Zhao, J. (1998) Characterization of HetR protein turnover in
Anabaena sp. PCC 7120, Arch Microbiol 169, 417-423.
32. Risser, D. D., and Callahan, S. M. (2007) Mutagenesis of hetR reveals amino acids
necessary for HetR function in the heterocystous cyanobacterium Anabaena sp. strain
PCC 7120, J Bacteriol 189, 2460-2467.
33. Wu, X., Liu, D., Lee, M. H., and Golden, J. W. (2004) patS minigenes inhibit heterocyst
development of Anabaena sp. strain PCC 7120, J Bacteriol 186, 6422-6429.
34. Khudyakov, I. Y., and Golden, J. W. (2004) Different functions of HetR, a master
regulator of heterocyst differentiation in Anabaena sp. PCC 7120, can be separated by
mutation, Proc Natl Acad Sci U S A 101, 16040-16045.
35. Reeves, R., and Nissen, M. S. (1990) The A.T-DNA-binding domain of mammalian high
mobility group I chromosomal proteins. A novel peptide motif for recognizing DNA
structure, J Biol Chem 265, 8573-8582.
36. Banks, G. C., Mohr, B., and Reeves, R. (1999) The HMG-I(Y) A.T-hook peptide motif
confers DNA- binding specificity to a structured chimeric protein, J Biol Chem 274,
16536-16544.
37. Goodwin, G. H., and Johns, E. W. (1973) Isolation and characterisation of two calf-
thymus chromatin non-histone proteins with high contents of acidic and basic amino
acids, Eur J Biochem 40, 215-219.
230
38. Goodwin, G. H., Sanders, C., and Johns, E. W. (1973) A new group of chromatin-
associated proteins with a high content of acidic and basic amino acids, Eur J Biochem
38, 14-19.
39. Grosschedl, R., Giese, K., and Pagel, J. (1994) HMG Domain Proteins - Architectural
Elements in the Assembly of Nucleoprotein Structures, Trends in Genetics, 94-100.
40. Reeves, R., Leonard, W. J., and Nissen, M. S. (2000) Binding of HMG-I(Y) imparts
architectural specificity to a positioned nucleosome on the promoter of the human
interleukin-2 receptor alpha gene, Mol Cell Biol 20, 4666-4679.
41. Huth, J. R., Bewley, C. A., Nissen, M. S., Evans, J. N., Reeves, R., Gronenborn, A. M.,
and Clore, G. M. (1997) The solution structure of an HMG-I(Y)-DNA complex defines a
new architectural minor groove binding motif, Nat Struct Biol 4, 657-665.
42. Elhai, J., and Wolk, C. P. (1988) Conjugal transfer of DNA to cyanobacteria, Methods
Enzymol 167, 747-754.
43. Limphong, P., Crowder, M. W., Bennett, B., and Makaroff, C. A. (2009) Arabidopsis
thaliana GLX2-1 contains a dinuclear metal binding site, but is not a glyoxalase 2,
Biochem J 417, 323-330.
44. Schneider, D., and Freed, J. (1989) Calculating slow motional magnetic resonance
spectra: A user's guide, In Biological Magnetic Resonance (Berliner, L., and Reuben, J.,
Eds.), pp 1-76, Plenum, New York, NY.
45. Budil, D., Lee, S., Saxena, S., and Freed, J. (1996) Nonlinear-least-squares analysis of
slow-motion EPR spectra in one and two dimensions using a modified Levenberg-
Marquardt algorithm, Journal of Magnetic Resonance Series a, 155-189.
46. Hoofnagle, A. N., Stoner, J. W., Lee, T., Eaton, S. S., and Ahn, N. G. (2004)
Phosphorylation-dependent changes in structure and dynamics in ERK2 detected by
SDSL and EPR, Biophys J 86, 395-403.
47. Zhang, Z., Fleissner, M. R., Tipikin, D. S., Liang, Z., Moscicki, J. K., Earle, K. A., Hubbell,
W. L., and Freed, J. H. (2010) Multifrequency electron spin resonance study of the
dynamics of spin labeled T4 lysozyme, J Phys Chem B 114, 5503-5521.
48. Nesmelov, Y. E., Agafonov, R. V., Burr, A. R., Weber, R. T., and Thomas, D. D. (2008)
Structure and dynamics of the force-generating domain of myosin probed by
multifrequency electron paramagnetic resonance, Biophys J 95, 247-256.
231
49. Jeschke, G., Chechik, V., Ionita, P., Godt, A., Zimmermann, H., Banham, J., Timmel, C.,
Hilger, D., and Jung, H. (2006) DeerAnalysis2006 - a comprehensive software package
for analyzing pulsed ELDOR data, Applied Magnetic Resonance, 473-498.
50. Chiang, Y. W., Borbat, P. P., and Freed, J. H. (2005) The determination of pair distance
distributions by pulsed ESR using Tikhonov regularization, J Magn Reson 172, 279-295.
51. Phillips, J. C., Braun, R., Wang, W., Gumbart, J., Tajkhorshid, E., Villa, E., Chipot, C.,
Skeel, R. D., Kalé, L., and Schulten, K. (2005) Scalable molecular dynamics with NAMD,
J Comput Chem 26, 1781-1802.
52. Humphrey, W., Dalke, A., and Schulten, K. (1996) VMD: visual molecular dynamics, J
Mol Graph 14, 33-38, 27-38.
53. Polyhach, Y., Bordignon, E., and Jeschke, G. (2011) Rotamer libraries of spin labelled
cysteines for protein studies, Phys Chem Chem Phys 13, 2356-2366.
54. Frías, J. E., Flores, E., and Herrero, A. (1997) Nitrate assimilation gene cluster from the
heterocyst- forming cyanobacterium Anabaena sp. strain PCC 7120, J Bacteriol 179,
477-486.
55. Borthakur, P. B., Orozco, C. C., Young-Robbins, S. S., Haselkorn, R., and Callahan, S. M.
(2005) Inactivation of patS and hetN causes lethal levels of heterocyst differentiation in
the filamentous cyanobacterium Anabaena sp. PCC 7120, Mol Microbiol 57, 111-123.
56. Klug, C. S., Eaton, S. S., Eaton, G. R., and Feix, J. B. (1998) Ligand-induced
conformational change in the ferric enterobactin receptor FepA as studied by site-directed
spin labeling and time-domain ESR, Biochemistry 37, 9016-9023.
57. Buchaklian, A. H., and Klug, C. S. (2005) Characterization of the Walker A motif of MsbA
using site- directed spin labeling electron paramagnetic resonance spectroscopy,
Biochemistry 44, 5503-5509.
58. Hanson, S. M., Francis, D. J., Vishnivetskiy, S. A., Kolobova, E. A., Hubbell, W. L., Klug,
C. S., and Gurevich, V. V. (2006) Differential interaction of spin-labeled arrestin with
inactive and active phosphorhodopsin, Proc Natl Acad Sci USA 103, 4900-4905.
59. Fanucci, G. E., and Cafiso, D. S. (2006) Recent advances and applications of site-
directed spin labeling, Curr Opin Struct Biol 16, 644-653.
60. Klug, C. S., and Feix, J. B. (2008) Methods and applications of site-directed spin
labeling EPR spectroscopy, Methods Cell Biol 84, 617-658.
232
61. Altenbach, C., Marti, T., Khorana, H. G., and Hubbell, W. L. (1990) Transmembrane
protein structure: spin labeling of bacteriorhodopsin mutants, Science 248, 1088-1092.
62. Mchaourab, H. S., Lietzow, M. A., Hideg, K., and Hubbell, W. L. (1996) Motion of spin-
labeled side chains in T4 lysozyme. Correlation with protein structure and dynamics,
Biochemistry 35, 7692-7704.
63. Mchaourab, H. S., Kálai, T., Hideg, K., and Hubbell, W. L. (1999) Motion of spin-labeled
side chains in T4 lysozyme: effect of side chain structure, Biochemistry 38, 2947-2955.
64. Kim, Y., Joachimiak, G., Ye, Z., Binkowski, T. A., Zhang, R., Gornicki, P., Callahan, S. M.,
Hess, W. R., Haselkorn, R., and Joachimiak, A. (2011) Structure of transcription
factor HetR required for heterocyst differentiation in cyanobacteria, Proc Natl Acad Sci
U S A 108, 10109-10114.
65. Milov, A., Ponomarev, A., and Tsvetkov, Y. (1984) Electron electron double-resonance in
electron-spin echo - model biradical systems and the sensitized photolysis of decalin,
Chemical Physics Letters, 67-72.
66. Milov, A., Salikhov, K., and Shirov, M. (1981) Application of ELDOR in electron-spin
echo for paramagnetic center space distribution in solids, Fiz Tverd Tela (Leningrad) 23,
957-982.
67. Borbat, P. P., Davis, J. H., Butcher, S. E., and Freed, J. H. (2004) Measurement of large
distances in biomolecules using double-quantum filtered refocused electron spin-echoes,
J Am Chem Soc 126, 7746-7747.
68. Borbat, P., and Freed, J. (2001) Double quantum ESR and distance measurements,
Kluwer, New York, NY.
69. Higa, K. C., and Callahan, S. M. (2010) Ectopic expression of hetP can partially bypass
the need for hetR in heterocyst differentiation by Anabaena sp. strain PCC 7120, Mol
Microbiol 77, 562-574.
70. Harrison, S. C. (1991) A structural taxonomy of DNA-binding domains, Nature 353, 715-
719.
71. Latchman, D. S. (1997) Transcription factors: an overview, Int J Biochem Cell Biol 29, 1
305-1312.
72. Huffman, J. L., and Brennan, R. G. (2002) Prokaryotic transcription regulators: more than
just the helix- turn-helix motif, Curr Opin Struct Biol 12, 98-106.
233
73. Feig, A. L. (2007) Applications of isothermal titration calorimetry in RNA
biochemistry and biophysics, Biopolymers 87, 293-301.
74. Streicher, W. W., Lopez, M. M., and Makhatadze, G. I. (2009) Annexin I and annexin II N-
terminal peptides binding to S100 protein family members: specificity and thermodynamic
characterization, Biochemistry 48, 2788-2798.
75. Connelly, P. R., Aldape, R. A., Bruzzese, F. J., Chambers, S. P., Fitzgibbon, M. J.,
Fleming, M. A., Itoh, S., Livingston, D. J., Navia, M. A., and Thomson, J. A. (1994)
Enthalpy of hydrogen bond formation in a protein-ligand binding reaction, Proc Natl Acad
Sci U S A 91, 1964-1968.
76. Calderone, C. T., and Williams, D. H. (2001) An enthalpic component in cooperativity: the
relationship between enthalpy, entropy, and noncovalent structure in weak associations,
J Am Chem Soc 123, 6262-6267.
77. Williams, D. H., Stephens, E., O'Brien, D. P., and Zhou, M. (2004) Understanding
noncovalent interactions: ligand binding energy and catalytic efficiency from ligand-
induced reductions in motion within receptors and enzymes, Angew Chem Int Ed Engl 43,
6596-6616.
234
APPENDIX C. PEER REVIEWED PUBLICATION: The RGSGR amino-acid motif of the
intercellular signaling protein, HetN, is required for patterning of heterocysts in Anabaena
sp. strain PCC 7120
MOLECULAR MICROBIOLOGY Vol. 83, p. 682-693
Copyright © 2012, Blackwell Publishing Ltd. All Rights Reserved.
Kelly C. Higa1,*, Ramya Rajagopalan
2,*, Douglas D. Risser
3,*, Orion S. Rivers*, Sasa K. Tom,
Patrick Videau, Sean M. Callahan#
University of Hawaii, Department of Microbiology, Honolulu, HI 96822
Accepted 8 December 2011
ABSTRACT
Nitrogen-fixing heterocysts are arranged in a periodic pattern on filaments of the cyanobacterium
Anabaena sp. strain PCC 7120 under conditions of limiting combined nitrogen. Patterning
requires two inhibitors of heterocyst differentiation, PatS and HetN, which work at different stages
of differentiation by laterally suppressing levels of an activator of differentiation, HetR, in cells
adjacent to source cells. Here we show that the RGSGR sequence in the 287 amino acid HetN
protein, which is shared by PatS, is critical for patterning. Conservative substitutions in any of the
five amino acids lowered the extent to which HetN inhibited differentiation when over-produced
and altered the pattern of heterocysts in filaments with an otherwise wild-type genetic background.
Conversely, substitution of amino acids comprising the putative catalytic triad of this predicted
reductase had no effect on inhibition or patterning. Deletion of putative domains of HetN
suggested that the RGSGR motif is the primary component of HetN required for both its inhibitory
and patterning activity, and that localization to the cell envelope is not required for patterning of
heterocysts. The intercellular signaling proteins PatS and HetN use the same amino-acid motif to
regulate different stages of heterocyst patterning.
INTRODUCTION
Intercellular signaling regulates a variety of processes in bacteria, most notably as part of
quorum-sensing systems. In quorum sensing, individual cells communicate with short peptides or
other small molecules that are secreted into the surrounding medium to coordinate the behavior
235
of multiple cells. As a counterpoint to quorum sensing, signaling between cells in direct physical
contact has the potential to employ intercellular signals that pass directly between cells, without
an intermediate extracellular stage. Examples include signaling during the formation of transient
multicellular structures, such as the development of spores in Bacillus subtilis and in the fruiting
bodies elaborated by Myxococcus xanthus, or in bacteria that grow as multicellular organisms,
such as filamentous streptomycetes and cyanobaceria. In the latter of these examples, inhibitors
of cellular differentiation in filamentous cyanobacteria are thought to move from cell to cell and
govern the periodic patterning of heterocysts that form in response to deprivation of fixed nitrogen.
Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can be induced to form a
periodic pattern of nitrogen-fixing heterocysts from an unbranched chain of undifferentiated
vegetative cells. Heterocysts occur, on average, at 10-cell intervals, are terminally differentiated,
and differ from vegetative cells morphologically, metabolically, and genetically [1, 2]. They have a
single known function, to supply the remaining vegetative cells of the filament with a bioactive
form of nitrogen, which allows growth of the organism in nitrogen-poor environments. The
elaboration of heterocysts facilitates the spatial separation of an oxygen-labile metabolic process,
nitrogen fixation, from one that evolves molecular oxygen, photosynthesis with photosystem II.
Fixed nitrogen is supplied to vegetative cells from heterocysts, and in return, heterocysts receive
a source of carbon and reductant to compensate for their lack of PS II and the Calvin cycle [3, 4].
Experimental evidence for the phenomenon of “lateral inhibition” of differentiation to explain how
Anabaena “counts to 10” was first described by Wolk in 1967 [5, 6]. More recently, patterning of
differentiation has been shown to be dependent on an activator of differentiation, HetR, and two
inhibitors of differentiation, PatS and HetN, that have properties of intercellular signaling
molecules. HetR is at the center of a regulatory circuit that shares the properties of biological
switches, which turn graded input signals into a binary output: when the switch is “off”, the cell
remains undifferentiated, but when the switch is “turned on”, the differentiation process begins
and eventually becomes irreversible and self-sustaining [7, 8]. HetN or PatS produced in one cell
lowers levels of HetR in adjacent cells [9], and it has been proposed, but not demonstrated, that
the relative positions of cells is conveyed by concentration gradients of PatS and/or HetN
extending from source cells [10, 11].
HetR has prominent roles in both the patterning and differentiation of heterocysts. In a wild-type
genetic background, expression of hetR is both necessary and sufficient for differentiation. Its
inactivation prevents development of heterocysts, and over-expression of hetR leads to the
formation of multiple contiguous heterocysts (Mch phenotype), even in the presence of
concentrations of nitrate or ammonia that suppress differentiation in the wild type [12, 13]. HetR
236
has DNA-binding activity, which is necessary for heterocyst formation [14], suggesting that its
primary role in promoting differentiation is the regulation of transcription of other developmental
genes. The protein has also been shown to bind directly to the promoter regions of 5 genes, patS,
hepA, hetP, pknE and hetR [14-16]. Induction of hetR by HetR is an example of direct positive
auto-regulation, predicted by patterning models, and the mutual dependence of ntcA, which is
also necessary for differentiation, and hetR creates a second, indirect example of positive auto-
regulation [17]. The recent crystal structure of HetR reveals a dimer with a central DNA-binding
region, two outward facing flaps, and a hood-like domain over the core of the protein [18]. It was
suggested that HetR might serve as a scaffold for the assembly of transcription initiation
complexes.
The patS gene is predicted to encode a 13 or 17 amino acid protein that is presumably processed
to a smaller, active form, perhaps during export from the cytoplasm to the periplasm of the cell or
directly to a neighboring cell [11]. The active form of PatS has yet to be identified, and a
presumed gradient of PatS has not been demonstrated. However, when confined to the
cytoplasm of the cell that produced it via a translational fusion to GFP, PatS is incapable of
restoring a normal pattern of heterocysts to a patS-mutant strain, suggesting that it must diffuse
from cell to cell to function properly [19]. A synthetic peptide corresponding to the predicted C-
terminal 5 amino acids of PatS (PatS-5; RGSGR) prevents DNA-binding activity of HetR in vitro
[14], prevents differentiation of heterocysts when added to the medium [11], and was recently
shown to bind directly to HetR with a 1:1 stoichiometry [20]. In a genetic selection to identify
residues of the 17 amino acid peptide that are necessary for activity of PatS, mutations were
found only in the RGSGR sequence, with mutations resulting in substitution of the underlined
residues reducing activity. A patS-null mutant has reduced spacing between heterocysts, and
adjacent cells often differentiate, the hallmark of the Mch phenotype (multiple contiguous
heterocysts). Transcription of patS is initially up-regulated in contiguous groups of cells, as shown
by a patS-gfp transcriptional reporter fusion, but between 10 and 12 hours after induction, at
about the same time that cells are irreversibly committed to differentiation, fluorescence has been
resolved to single cells in a pattern that predicts the eventual pattern of heterocysts along
filaments [21].
Interactions between PatS and HetR appear to control formation of the initial pattern of
differentiation, but HetN is necessary for stabilization of the initial pattern and prevents
differentiation of cells adjacent to existing heterocysts. It seems likely that it is also involved in
maintenance of the pattern as filaments lengthen. Several cell-generation times after the
formation of an initial Mch pattern by a patS-null mutant, the pattern normalizes to a wild-type-like
pattern [21], suggesting the presence of other patterning factors. In contrast, a patS mutant
237
conditionally lacking expression of hetN forms an Mch pattern initially like that of the patS mutant,
but the pattern fails to normalize over time, and eventually most cells of the filament differentiate
to form heterocysts [22]. A hetN single mutant has a delayed Mch phenotype; the pattern is
initially wild type at 24 h after induction but is Mch after 48 h, approximately twice the time from
induction to the formation of an initial pattern of mature heterocysts [10]. The inhibitory activity of
HetN, as for that of PatS, includes blockage of the positive auto-regulation of hetR [10, 23].
When grown with combined nitrogen, all cells of filaments have a low level of HetN in thylakoid
and cytoplasmic membranes, but upon nitrogen step-down, HetN is degraded [23]. After
formation of proheterocysts, HetN protein and expression of hetN is found exclusively in
proheterocysts and heterocysts. The 287 amino-acid HetN protein is predicted to be a reductase
in the short chain alcohol dehydrogenase (ADH) family [24]. Within the sequence of HetN is the
PatS-5 sequence, RGSGR, at positions 132-136, raising the possibility that this same sequence
is responsible for the inhibitory activity of HetN. Experiments showing that the PatS- and HetN-
dependent pathways converge at or just before HetR and the identification of a point mutation in
hetR that confers resistance to suppression by PatS and HetN suggests that the RGSGR
sequence of HetN may be critical for its activity as it is in PatS [22, 25]. Here we show that the
RGSGR motif of HetN and not the predicted ADH reductase activity is necessary for patterning of
heterocysts.
MATERIALS AND METHODS
Culture conditions. Anabaena sp. PCC 7120 and its derivatives were grown in BG-11 medium
as previously described [12]. Media were supplemented with neomycin at 45 µg ml-1
or
spectinomycin and streptomycin at 2.5 µg ml-1
each as appropriate. Escherichia coli strains were
grown in Luria-Bertani (LB) broth for liquid culture and LB solidified with 1.5% agar for plate
culture. For selective growth, media were supplemented with 100 µg ml-1
spectinomycin, 50 µg
ml-1
kanamycin, 100 µg ml-1
ampicillin, or 10 µg ml-1
chloramphenicol.
To induce heterocyst formation, early exponential-phase cultures grown in BG-11 were washed
three times with BG-11 medium without combined nitrogen (BG-110), resuspended in BG-110
without antibiotics, and incubated under growth conditions. To induce the copper-inducible petE
promoter, media were supplemented with 2 μM CuSO4. Heterocyst percentages were
determined by counting 300 cells or more and scoring heterocysts as previously described (Yoon
and Golden, 2001). These counts were done on three separate cultures, and the percentages
reported are an average of the three counts.
238
Plasmid construction. Tables 1 and S2 describe the plasmids and oligonucleotides,
respectively, used in this study. Details of how plasmids were constructed can be found in
Supporting Information.
Construction of strains. Table 1 lists the strains used in this study. The hetN gene was cleanly
deleted from the chromosome of PCC 7120 using allelic replacement as previously described [10]
using plasmid pCCO103 to create strain UHM150. Allelic replacement was used with the
following plasmids and strain UHM150 to create the following strains with altered alleles of hetN
at the original hetN locus: pDR387 for UHM202; pDR388 for UHM200; pDR389 for UHM203;
pDR390 for UHM201; pDR391 for UHM204; pDR392 for UHM205; pDR393 for UHM206;
pDR394 for UHM207; pCO100 for UHM192; pCO102 for UHM209; pCO103 for UHM210;
pCO104 for UHM211; pCO111 for UHM212. As a control to re-create PCC 7120, pDR382 was
introduced into the ΔhetN strain using the same technique to create strain UHM208. Strains were
confirmed as double recombinants by PCR using primers up-hetN-F and down-hetN-R.
Microscopy. Cells were routinely viewed and imaged as described previously [22]. Confocal
microscopy was performed using an Olympus Fluoview 1000 laser scanning confocal mounted
on an IX81 motorized inverted microscope. Fluorescence from Turbo-YFP was detected with an
excitation of 525 nm and an emission of 538 nm. All images were processed in Adobe
Photoshop CS2. To estimate levels of fluorescence in parts of images, a two-dimensional plot
profile of pixel intensities along a line drawn on the image was constructed in ImageJ.
RNA isolation and analysis. Wild type Anabaena sp. PCC 7120 cells grown for RNA isolation
were harvested from nitrogen replete conditions as well as 21 h after induction of heterocyst
differentiation, flash-frozen in liquid nitrogen, and stored at -80ºC until processing. Samples were
lysed and the RNA was precipitated and extracted as described previously [26] using a mini
beadbeater (Biospec) and the RNeasy Kit (Qiagen) for RNA isolation. RLM-RACE (RNA Ligase
Mediated Rapid Amplification of cDNA Ends) was conducted using the FirstChoice RLM-RACE
kit (Ambion) according to the manufacturer’s instructions. The nested primer pairs petEint and
petEext and PhetN-R-Int and PhetN-R-Ext were used for RACE to determine the transcriptional
start points of petE and hetN, respectively. The internal PCR primer was used to sequence RACE
products to identify the transcriptional start points.
239
Table 1. Strains and plasmids used in this study
Strain or plasmid
Relevant characteristic(s) Source or reference (UHM designation)
Anabaena sp. strains
PCC 7120 Wild-type Pasteur culture collection
UHM150 ΔhetN This study
UHM163 hetR(R250K) [27]
UHM192 hetN(Δ2-46) This study
UHM201 hetN(G133A) This study
UHM202 hetN(G135A) This study
UHM203 hetN(R132K) This study
UHM204 hetN(S134A) This study
UHM205 hetN(R136K) This study
UHM206 hetN(S142A) This study
UHM207 hetN(Y155F) This study
UHM208 hetN(K159R) This study
UHM210 UHM150 with hetN reintroduced This study
UHM211 hetN(Δ47-176) This study
UHM212 hetN(Δ177-195) This study
UHM150 hetN(Δ196-287) This study
UHM163 hetN(Δ47-128) This study
Plasmids
pAM504 Mobilizable shuttle vector for replication in E. coli and Anabaena; Km
r Neo
r
[28]
pAM505 Same as pAM504 with multiple cloning site inverted [28]
pRL277 Suicide vector; Smr Sp
r [29]
pRL278 Suicide vector; Kmr Nm
r [29]
pSMC115 pAM504 with PpetE-hetN [10]
pSMC187 pAM505 with the EcoR1 site removed This study
pDR320 pAM504 with PpetE-hetN [30]
pDR364 pAM504 with PpetE-hetN(R132K) This study
pDR365 pAM504 with PpetE-hetN(G133A) This study
pDR366 pAM504 with PpetE-hetN(S134A) This study
pDR367 pAM504 with PpetE-hetN(S142A) This study
pDR368 pAM504 with PpetE-hetN(Y155F) This study
pDR369 pAM504 with PpetE-hetN(K159R) This study
pDR382 pRL277 used to make UHM208 This study
pDR386 pAM504 with PpetE-hetR-yfp This study
pDR387 pRL277 used to make UHM202 This study
pDR388 pRL277 used to make UHM200 This study
pDR389 pRL277 used to make UHM203 This study
240
Table 1. (Continued) Strains and plasmids used in this study
Strain or plasmid
Relevant characteristic(s) Source or reference (UHM designation)
Plasmids
pDR390 pRL277 used to make UHM201 This study
pDR391 pRL277 used to make UHM204 This study
pDR392 pRL277 used to make UHM205 This study
pDR393 pRL277 used to make UHM206 This study
pDR394 pRL277 used to make UHM207 This study
pRR154 pAM504 with PpetE-hetN(G135A) This study
pRR155 pAM504 with PpetE-hetN(R136K) This study
pRR159 pAM504 with PhetN-hetN-yfp This study
pRR161 pAM504 with PpetE-hetN(1-46)-yfp This study
pRR162 pAM504 with PpetE-hetN(1-172)-yfp This study
pRR163 pAM504 with PpetE-hetN-yfp This study
pRR167 pAM504 with PpetE-hetN(1-192)-yfp This study
pCO100 pRL277 used to make UHM192 This study
pCO102 pRL277 used to make UHM209 This study
pCO103 pRL277 used to make UHM210 This study
pCO104 pRL277 used to make UHM211 This study
pCO105 pAM505 with PpetE-hetN(Δ2-46) This study
pCO107 pAM505 with PpetE-hetN(Δ47-176) This study
pCO108 pAM505 with PpetE-hetN(Δ177-195) This study
pCO109 pAM505 with PpetE-hetN(Δ196-287) This study
pCO110 pAM505 with PpetE-hetN This study
pCO111 pRL277 used to make UHM212 This study
pCO113 pAM505 with PpetE-hetN(Δ47-128) This study
pCO115 pAM504 with PpetE-hetN(∆2-46)-yfp This study
pCO117 pAM504 with PpetE-hetN(∆47-176)-yfp This study
pCO118 pAM504 with PpetE-hetN(∆177-195)-yfp This study
pCO121 pAM504 with PpetE-hetN(∆47-128)-yfp This study
pCCO103 pRL278 used to make UHM150 This study
pPJAV155 pAM504 with PhetN-hetN(1-192)-yfp This study
241
RESULTS
Alleles of hetN encoding R132K and R136K substitutions fail to suppress heterocyst
differentiation
The wild-type allele of hetN completely suppresses the formation of heterocysts when expressed
from the copper-inducible promoter of petE [10]. To test if alleles of hetN encoding substitutions
in the putative catalytic triad of this predicted ketoacyl reductase also suppress differentiation of
heterocysts, alleles of hetN encoding S142A, Y155F, and K159R conservative substitutions were
placed behind the petE promoter on a shuttle vector and tested for their ability to suppress
differentiation of heterocysts. As expected, PCC 7120 with an empty control plasmid formed a
normal pattern and number of heterocysts, and the same plasmid with the wild-type allele of hetN
behind the petE promoter lacked heterocysts (Fig. 1A, B & C). As with the wild-type allele of hetN,
PCC 7120 with any of the three mutant alleles of hetN failed to form heterocysts, indicating that
each allele is capable of suppressing differentiation of heterocysts when expressed ectopically
from the petE promoter (Fig. 1A & D and data not shown), suggesting that the predicted
reductase activity of HetN is not required for suppression of differentiation.
Alleles of hetN encoding substitutions in the RGSGR motif of HetN were also tested in the
manner described above for their ability to suppress heterocyst differentiation. Alleles of hetN
encoding R132K, G133A, S134A, G135A, or R136K substitutions in HetN were introduced
individually behind the petE promoter on a shuttle vector to strain PCC 7120. Each of the five
substitutions reduced the ability of HetN to suppress heterocyst differentiation. Whereas strain
PCC 7120 with the wild-type allele formed no heterocysts, PCC 7120 with either the G133A or
S134A alleles formed morphologically distinct heterocysts that represented less than 1% of the
total number of cells in filaments (Fig. 1A & E). PCC 7120 with the G135A allele formed
approximately 2% heterocysts, and PCC 7120 with either the R132K or R136K alleles formed a
pattern and number of heterocysts similar to that of the same strain with the empty plasmid,
pAM504 (Fig. 1A & F). Substitution of each of the individual amino acids of the RGSGR motif
reduced the ability of HetN to suppress differentiation of heterocysts.
242
Figure 1. Alleles of hetN encoding R132K and R136K substitutions fail to
suppress heterocyst differentiation. A. Heterocyst percentages for PCC 7120
carrying control plasmid pAM504 (control), pAM504 carrying wild-type hetN
transcriptionally fused to PpetE, and pAM504 carrying the indicated alleles of hetN
transcriptionally fused to PpetE. Error bars represent standard error of the mean.
B-F. Brightfield images of PCC 7120 with pAM504 (B); pDR320, which contains
wild-type hetN (C); pDR367, which contains hetN(S142A) (D); pDR365, which
contains hetN(G133A) (E); and pDR364, which contains hetN(R132K) (F).
Micrographs were taken 24 hours after switching from BG-11 to BG-110 with 2 μM
CuSO4. Carets indicate heterocysts.
243
Each amino acid of the RGSGR motif of HetN is necessary for proper patterning of
heterocysts
Suppression of heterocyst differentiation with mutant alleles of hetN suggests that the RGSGR
motif and not the putative catalytic triad of HetN is involved in regulation of heterocyst
differentiation. However, expression of hetN from the petE promoter on a multi-copy shuttle
vector presumably results in much higher expression of hetN than is normally found in the
organism, potentially compensating for reduced activity of some of the substituted proteins. In
addition, the patterned expression of hetN from its native promoter is lost with the petE promoter.
To examine heterocyst patterning and number in strains with the mutant alleles of hetN, strains
were created that had a wild-type genotype except for a change in the chromosome of one or two
nucleotides that corresponded to one of the amino-acid substitutions mentioned previously.
These strains were created by reintroducing the alleles of hetN to a hetN-deletion strain. In strain
PCC 7120, which is the wild-type organism, and a strain with the wild-type allele of hetN
reintroduced to the deletion mutant, 7.1% and 6.9 % of cells were heterocysts, respectively, 48 h
after removal of combined nitrogen (Fig. 2A, B). These heterocysts occurred as single
heterocysts flanked on each side by groups of vegetative cells. In the hetN-deletion strain,
UHM150, about 12.2% of cells were heterocysts (Fig. 2A, C), and heterocysts were often found in
groups of 2, 3 or more contiguous heterocysts, the hallmark of the Mch phenotype. In strains with
alleles of hetN encoding one of the S142A, Y155F, and K159R conservative substitutions in the
putative catalytic triad, 7.1%, 7.3%, and 6.3% of cells were heterocysts, respectively, arranged in
a pattern similar to that of the wild type (Fig. 2A, D). Conversely, strains with alleles of hetN
encoding R132K, G133A, S134A, G135A, and R136K conservative substitutions formed an
average of 12.9%, 9.7%, 10.1%, 9.7%, and 11.9% heterocysts, respectively (Fig. 2A, E, F). For
each of these strains, heterocysts were often found in groups of 2, 3 or more, indicative of the
Mch phenotype and similar to the hetN-deletion strain. These results indicate that each of the
amino acids of the RGSGR motif and not those of the putative catalytic triad of HetN are
necessary for differentiation of the number and pattern of heterocysts found in the wild-type
organism.
244
Figure 2. Each amino acid of the RGSGR motif of HetN is necessary for proper
patterning of heterocysts. A. Heterocyst percentages for strains PCC 7120, wild-
type hetN reintroduced into a ΔhetN strain, a ΔhetN strain, and strains with the
indicated chromosomal hetN alleles. B-F. Brightfield images of PCC 7120 (B),
UHM150, which is ΔhetN (C); UHM207, which is hetN(K159R) (D); UHM203,
which is hetN(S134A) (E); and UHM201, which is hetN(G135A) (F). Micrographs
were taken 48 hours after removal of combined nitrogen. Carets indicate
heterocysts.
245
Regions of HetN necessary for heterocyst patterning and number
HetN can be divided into 4 domains
based on hydrophobicity. An N-
terminal hydrophobic domain, which
may serve as a leader peptide, was
found to consist of amino acids 1 – 46
(N-terminal hydrophobic domain); an
N-terminal hydrophilic domain
containing the RGSGR motif and
putative catalytic triad was found at
amino acids 47 – 176 (N-terminal
hydrophilic domain); a second
hydrophobic domain, which has a
length consistent with that of a central
transmembrane domain, was found at
amino acids 177 – 195 (central
hydrophobic domain); and a C-
terminal hydrophilic domain was found
at amino acids 196 – 287 (C-terminal
domain; Fig 3A). To identify the
domains of HetN that are necessary
for its suppression of heterocyst
differentiation, alleles of hetN coding
for protein that lacks one of the 4
domains were cloned behind the petE
promoter and introduced on a
replicating plasmid to PCC 7120.
Strains containing alleles encoding
deletions of the N-terminal
hydrophobic, central hydrophobic, or
C-terminal domain behaved the same
way as those containing the wild-type
allele and did not produce heterocysts
(Fig. 3B). Conversely, PCC 7120
containing an allele of hetN encoding
a deletion of the N-terminal hydrophilic
Figure 3. Regions of HetN necessary for heterocyst
patterning and number. A. Schematic of the domains
of HetN. B. Heterocyst percentages for PCC 7120
carrying control plasmid pKH256, pKH256 with wild-
type hetN, and pKH256 carrying the indicated alleles
of hetN. C. Heterocyst percentages for strains PCC
7120; strain UHM208, which has wild-type hetN
reintroduced into the ΔhetN strain UHM150; the ΔhetN
strain UHM150; and strains with the indicated hetN
alleles. Error bars represent standard error of the
mean.
246
domain formed a number and pattern of heterocysts similar to the negative control, the same
strain carrying the empty shuttle vector pAM504 (Fig. 3B). An allele of hetN encoding protein with
a partial deletion of the N-terminal hydrodophilic domain was also constructed and tested for its
ability to suppress differentiation. An allele encoding protein with deletion of residues 47 - 128, 3
amino acids before the RGSGR motif, fully suppressed differentiation of heterocysts (Fig. 3B).
Consistent with results of the amino acid substitutions, the RGSGR motif is required for
suppression of heterocyst differentiation.
To identify regions of HetN that are necessary for heterocyst patterning, strains with one of the
alleles of hetN tested above in place of the wild-type chromosomal hetN gene were created and
heterocyst patterning was examined. All of the strains formed a pattern of heterocysts similar to
that of the wild type with the exception of UHM209 and UHM212 (Fig. 3C). UHM209 has an allele
of hetN encoding protein that lacks residues 47 – 176, which includes the RGSGR motif.
Heterocyst formation in this strain was similar to that of the hetN-deletion strain. The hetN allele
of UHM212 lacks residues 47 – 128. Unexpectedly, 4.6% of cells in this strain were individual
heterocysts separated by regions of vegetative cells. This strain formed fewer heterocysts than
the wild type, indicating that this allele has an increased ability to suppress differentiation of cells
in filaments.
The 5’-ends of the hetN and petE transcripts
Immunoblots of proteins from fractionated whole filaments have shown that HetN is present in
both plasma and thylakoid cell membrane preparations [23]. Here, translational fusions of full
length HetN and several of its derivatives to YFP were used in an attempt to visualize their
location in cells. Transcription of fusion genes was driven by either the petE promoter or the
native hetN promoter. Because the start sites within the hetN and petE promoters have not been
characterized, we first determined the transcriptional start points (tsps) of hetN and petE. A single
tsp for petE was found using RNA ligase mediated rapid amplification of cDNA ends (RLM-RACE)
at -32 relative to the translational start site (Fig. S1). This putative transcription start site is well
within the regions used for the petE-promoter fusions used in this work, which begin 338 or 339
nucleotides upstream of the predicted translational start site, depending on the individual fusion.
For hetN, a single tsp at -401 relative to the annotated translational start site was found using
RLM-RACE (Fig. S1). Centered 10.5 nucleotides upstream of this putative transcription start site
is the sequence TATAAA, which is similar to the -10 sigma 70 binding site. No -35 binding site
was apparent. Correspondingly, fusions with the hetN promoter started at position –554 relative
to the annotated translational start site, upstream of a probable intrinsic transcription terminator of
hetM, which is located upstream of hetN. It is interesting to note that these genes are expressed
247
in both nitrogen replete and nitrogen limiting conditions, which, for hetN, corroborates previous
immunoblotting results [23]. Because RLM-RACE distinguishes between 5’-ends of transcripts
generated by initiation of transcription and RNA processing, it is likely that the 5’-ends of
transcripts detected here represent transcription start sites.
Localization of HetN-YFP to the cell periphery
Fluorescence from full-length HetN fused at its C-terminus to YFP and driven by the petE
promoter was observed primarily at the periphery of cells in filaments, consistent with localization
to the plasma membrane (Fig. 4A). In addition, a more diffuse fluorescence signal was observed
from the interior region of cells, consistent with previous detection of HetN in thylakoid
membranes. The fusion protein prevented the formation of heterocysts, so it was not possible to
view the location of HetN in heterocysts in a wild-type genetic background. To facilitate
visualization of HetN-YFP in heterocysts, plasmid-borne hetN-yfp fusions were put into a
derivative of PCC 7120 that continues to form heterocysts even when extra copies of hetN are
introduced [20]. This strain, UHM163, has the wild-type copy of hetR replaced by an allele that
encodes a R250K substitution. With transcription of hetN-yfp from either the native promoter or
the petE promoter, fluorescence from YFP was seen primarily at the periphery of heterocysts (Fig.
4B, C). With expression from the petE promoter, fluorescence was seen in both cell types,
whereas with the native hetN promoter fluorescence was seen only in heterocysts, consistent
with heterocyst-specific expression of hetN [10].
C-terminal translational fusions to YFP were also made with the following variants of HetN:
HetN(1-47), HetN(1-176), HetN(1-192), HetN(∆2-46), HetN(∆47-128), HetN(∆47-176), and
HetN(∆177-195), where the numbers in parentheses represent either the portion of HetN in the
fusion or, if preceded by a ∆ symbol, a protein lacking the amino acids indicated. Heterocyst
differentiation in a wild-type background was suppressed with all fusions in which the RGSGR
motif was present. However, with one exception, no fluorescence from YFP was observed. In
filaments with the construct encoding HetN(1-192)-YFP, which lacks the C-terminal domain of
HetN, YFP-dependent fluorescence was observed primarily at cell junctions (Fig. 4D). In
particular, rings of fluorescence circumscribed cell septa. Fusions were made with expression
from the native promoter of hetN or the petE promoter, but fluorescence was observed only when
the petE promoter was used. Rings of fluorescence were detected in vegetative cells but absent
from heterocysts. In addition, HetN-YFP-dependent fluorescence with both full-length HetN and
the C-terminal deletion was reduced from the cytoplasm of heterocysts relative to that from
vegetative cells (Fig. 4C, D). In a wild-type genetic background, the fusion protein inhibited
differentiation, so fluorescence could only be observed in vegetative cells (Data not shown).
248
When the background strain was UHM163, which forms heterocysts even when hetN is over-
expressed ectopically, rings of fluorescence similar to those in the wild type were observed in
vegetative cells but lacking in heterocysts (Fig. 4D).
249
Figure 4. Each amino acid of the RGSGR motif of HetN is necessary for proper
patterning of heterocysts. A. Heterocyst percentages for strains PCC 7120, wild-type
hetN reintroduced into a ΔhetN strain, a ΔhetN strain, and strains with the indicated
chromosomal hetN alleles. B-F. Brightfield images of PCC 7120 (B), UHM150, which
is ΔhetN (C); UHM207, which is hetN(K159R) (D); UHM203, which is hetN(S134A) (E);
and UHM201, which is hetN(G135A) (F). Micrographs were taken 48 hours after
removal of combined nitrogen. Carets indicate heterocysts.
250
DISCUSSION
HetN and PatS are required for different stages of heterocyst patterning. PatS is necessary for
formation of the initial pattern of cells in a filament composed exclusively of vegetative cells that
will differentiate after a transition to conditions that require diazotrophy for growth. A hetN-mutant
strain is capable of forming this de novo pattern whereas a patS mutant is not [10, 11]. HetN is
necessary for stabilization of this initial pattern. The wild-type pattern of heterocysts initially
formed in a hetN-mutant turns Mch shortly thereafter [10]. Genetic and mathematical modeling
evidence relating to placement of additional heterocysts between existing ones as vegetative
cells divide to maintain the pattern and ratio of heterocysts to vegetative cells suggests that a
HetN-dependent signal produced in mature heterocysts is responsible for specification of a region
of cells at the midpoint between two heterocysts, and that PatS resolves this region to a single
cell that will differentiate [11, 31]. Despite the different roles of PatS and HetN in patterning, the
RGSGR motif is essential to the function of both. In the over-expression studies presented here,
conservative substitutions in any of the 5 amino acids reduced the ability of HetN to suppress
differentiation. Alteration of either of the two arginines appeared to eliminate suppression by
HetN, even though the gene for HetN was expressed at a level higher than that experienced in
the wild-type organism. These results are comparable to those found with substitutions in PatS.
In this case, a genetic selection identified four of the five amino acids of the RGSGR motif as
necessary for suppression of differentiation [11]. Whether or not substitution of the fifth has the
same effect is unknown. To take the analysis of HetN further, a single nucleotide or two
corresponding to a codon in the RGSGR motif was changed in the chromosome of the wild type.
Each of the strains with an allele of hetN encoding a conservative substitution in one of the amino
acids of the RGSGR motif resembled the hetN-deletion strain more than the wild type; the
number of cells that differentiated was higher than in wild type and instead of a periodic pattern of
single heterocysts, the Mch phenotype was observed. As for the over-expression studies,
substitution of the two arginines had the most dramatic effect, producing strains with phenotypes
indistinguishable from that of the hetN-deletion strain. In contrast, conservative substitutions in
the putative catalytic triad of ADH activity had no effect on the function of HetN in suppression of
differentiation or patterning of heterocysts. The RGSGR motif of HetN and not predicted ADH
reductase activity was necessary for patterning of heterocysts.
Three previous studies have addressed the quality of HetN necessary for its ability to suppress
heterocyst differentiation, with varied interpretations. In the first, mutation of residues in the
RGSGR sequence of HetN was reported to have no effect on the ability of HetN to suppress
differentiation when the corresponding alleles of hetN were over-expressed [23]. In addition to
R132K and R136L substitutions, the report claims that G134S and S135D substitutions were
251
made and had no effect. However, this is confusing because the HetN sequence is S134 and
G135, not G134 and S135 as indicated, so what substitutions were actually made is unclear. In
the second study, substitution of one of the three amino acids in the predicted catalytic triad of
ADH activity in HetN prevented suppression of heterocyst differentiation by over-expression of
the corresponding mutant allele [32]. However, substitution of the other two had no effect. In the
most recent study, over-expression of hetN was shown to cause post-translational decay of HetR,
which presumably contributes to suppression of heterocyst formation. When the RGSGR motif
was replaced by RGDAR, over-expression of the corresponding allele of hetN did not lower levels
of HetR in filaments nor did it suppress differentiation [9], suggesting that the RGSGR motif is
necessary for suppression. The present study is the most comprehensive with respect to the
regions of HetN that are necessary for inhibition and patterning. It clearly shows that the RGSGR
motif of HetN and not the predicted ADH reductase activity is necessary for patterning of
heterocysts.
The RGSGR motif as the primary functional group of HetN and PatS in patterning is consistent
with known activities of HetN and PatS. In electrophoretic mobility shift assays the synthetic
RGSGR peptide prevents the binding of HetR to a region of hetR-promoter DNA that includes the
autoregulated transcriptional start point at position -271, and over-expression of hetN or patS
prevents transcription from this same tsp [8, 14]. Addition of RGSGR peptide to medium causes
posttranslational decay of HetR protein in whole filaments, as does over-expression of hetN or
patS in all cells of filaments [9]. Over-expression of hetN or patS in individual cells of filaments
also causes decay of HetR levels in adjacent groups of cells, suggesting that the HetN- and PatS-
dependent signals that diffuse from cell to cell contain the RGSGR sequence.
Individual deletions of the predicted signal sequence, membrane-spanning hydrophobic domain,
and C-terminal domain had no effect on suppression of differentiation or patterning. However,
two pieces of evidence suggest that it is not solely the RGSGR motif of HetN that is necessary for
normal suppression and patterning of heterocysts. First, it has been reported that a K159E
substitution prevents the ability of HetN to suppress differentiation when the gene encoding the
protein is over-expressed [32]. This non-conservative substitution of a positively charged amino
acid with a negatively charged one, unlike the conservative K159R substitution used in the work
presented here, apparently alters HetN sufficiently to prevent it from suppressing formation of
heterocysts. The second piece of evidence is the formation of fewer heterocysts by a strain with
the wild-type hetN replaced with an allele encoding a deletion of amino acids 47 – 128, which
would lack the N-terminal hydrophilic domain up to three amino acids before the RGSGR
sequence. The resulting protein appears to lead to suppression of differentiation of cells in a
larger region of a filament than does the wild-type protein. Possible explanations of this
252
enhanced range of lateral inhibition include a more active form of the protein, a longer half-life, an
increased rate of diffusion or.increased production of the mature form of HetN that presumably is
transferred between cells.
Despite sharing a functional protein motif, the forms of HetN and PatS that diffuse from cell to cell
and presumably interact with HetR may be different and remain unknown. Increased expression
of hetN in cells that will become heterocysts around the time of commitment to differentiation is
very different from that of patS, which occurs in groups of cells very soon after induction of
filaments to differentiate by growth-limiting levels of fixed nitrogen in the medium [21, 33]. The
difference in expression patterns reflects the respective roles of HetN and PatS in patterning.
The involvement of two separate proteins with a similar functional motif, rather than one protein
with two modes of expression, suggests that intrinsic differences in the mature HetN- and PatS-
dependent signals play roles in patterning. Recent mathematical modeling of heterocyst pattering
with two inhibitors having different rates of diffusion is consistent with this notion [31].
HetN has been reported to be a membrane protein that resides in both cytoplasmic and thylakoid
membranes. In this study, fluorescence from HetN-YFP was observed primarily in the cell
envelope, presumably in the cytoplasmic membrane, with a more diffuse, lower level of
fluorescence from the interior of the cell, suggesting that the concentration of HetN is higher than
that in thylakoid membranes. HetN-YFP-dependent fluorescence intensity in the membrane was
about twice that from thylakoid membranes, but given the much larger surface area of thylakoid
membranes, the majority of HetN in a cell is likely to be in thylakoid membranes, consistent with
earlier western blot analysis [23]. The only fusions to YFP in this study for which fluorescence
was observed were those where YFP either replaced or was at the end of the C-terminal domain,
suggesting that this domain of the protein is located in the cytoplasm. Folding of GFP is efficient
only in the cytoplasm of bacterial cells, which has been used to map the topology of inner-
membrane proteins [34]. The YFP used in the fusions is a derivative of GFP and would be
expected to behave in a similar fashion. If the C-terminal domain is in the cytoplasm, the N-
terminal hydrophilic domain, which contains the RGSGR motif, may be located in the periplasm if
the central hydrophobic domain at amino acids 177 – 195 spans the cytoplasmic membrane.
However, it is difficult to interpret the lack of fluorescence with fusions to other parts of HetN,
which could be explained by the creation of an unstable protein with a short half-life.
Lateral inhibition implies the intercellular transfer of a signal that suppresses differentiation.
Based on the deletion studies, the essential part of HetN that comprises the suppression signal
appears to be little more than the RGSGR motif. This raises the possibility that the signal that
diffuses from cell to cell may be a peptide processed from the full protein. Location of HetN in the
253
cytoplasmic membrane suggests three potential routes of transfer between cells. First, the
periplasm of cells in filaments is contiguous, and there is evidence both for and against the
diffusion of proteins between cells via the periplasmic space [35, 36]. Processing of the N-
terminal domain after insertion in the membrane could release a soluble fragment of HetN that
contains the RGSGR motif and diffuses through the contiguous periplasmic space. Uptake into
the cytoplasm would be necessary to allow interaction with HetR. Inhibition of heterocyst
differentiation by addition of synthetic RGSGR peptide to the medium [11] suggests that transport
into the cytoplasm is possible for such a molecule or that it can act from the periplasm. The
second potential route of transfer is direct exchange between the membranes of adjacent cells.
Although the cytoplasmic membranes at cell septa are not shared by adjacent cells and so are
not continuous between cells, they are in close proximity [37], and could be bridged by an as yet
uncharacterized intermembrane transport system. Results from this work strongly suggest that
the HetN-dependent patterning signal does not travel from cell to cell via one of these two
potential routes because localization of HetN to the membrane is not required for proper
patterning of heterocysts. Deletion of the putative transmembrane or signal sequence prevented
HetN-YFP from localizing to the membrane and had no effect on heterocyst patterning when
deleted from the chromosomal copy of hetN. In its simplest form, transfer of the RGSGR-
containing portion of HetN via the cytoplasmic membrane or the periplasmic space would likely
require localization to the membrane. The most likely route of transfer is via inter-cytoplasmic
exchange mediated by SepJ, FraC, and/or FraD, which are located at intercellular septa.
Intercellular transfer of the fluorescent molecular tracer calcein occurs in the wild type, but is
impaired in strains lacking one of the three proteins [38, 39]. Calcein has a molecular weight of
623 Da, slightly more than that of RGSGR peptide. An RGSGR-containing peptide could be
processed from a subpopulation of HetN prior to insertion into the membrane and be transferred
via inter-cytoplasmic pores. Deletion of the putative transmembrane and signal sequence
domains of HetN-YFP prevented not only localization to the membrane, but also detectable
fluorescence. The lack of fluorescence is likely attributable to proteolytic digestion of a protein
that cannot fold properly. Processing of an RGSGR-containing peptide from HetN in the
cytoplasm prior to proteolytic digestion would be consistent with retention of function of these
truncated forms of HetN even in the absence of an accumulation of HetN-YFP that can be
detected by fluorescence microscopy. In addition, preliminary results with a strain lacking SepJ,
which has been shown to be necessary for inter-cytoplasmic exchange of calcien, indicate that
SepJ is necessary for decay of HetR in cells adjacent to those overexpressing hetN in genetic
mosaics [9]. Taken together, these results suggest that an RGSGR-containing peptide derived
from HetN diffuses between cells via direct cytoplasmic exchange to direct pattering of
heterocysts.
254
ACKNOWLEDGEMENTS
We thank John Branigan, Michael Derocher and Cameron Olson for help with preliminary studies
and Tung Hoang for plasmid pUC57-PS12-yfp, the source of the gene for YFP used in this work.
This work was supported by grant number IOS-0919878 from the National Science Foundation.
FOOTNOTES
#For correspondence: E-mail [email protected]; Tel. (+1) 808 956 8015; Fax (+1) 808 956
5339
1Present address: University of Hawaii Cancer Center, Honolulu, HI 96813
2Present address: Department of Biochemistry and Molecular Biology, Michigan State University,
East Lansing, MI 48824
3Present address: Department of Microbiology, University of California, Davis, CA 95616
*These authors contributed equally to the work.
255
REFERENCES CITED
1. Golden, J.W. and H.-S. Yoon, Heterocyst development in Anabaena. Curr. Opin.
Microbiol., 2003. 6: p. 557-563.
2. Zhang, C.-C., et al., Heterocyst differentiation and pattern formation in cyanobacteria: a
chorus of signals. Mol. Microbiol., 2006. 59(2): p. 367-375.
3. Meeks, J.C., et al., Pathways of assimilation of [13
N]N2 and 13
NH4+ by cyanobacteria with
and without heterocysts. J. Bacteriol., 1978. 134(1): p. 125-130.
4. Wolk, C.P., Movement of carbon from vegetative cells to heterocysts in Anabaena
cylindrica. J. Bacteriol., 1968. 96: p. 2138-2143.
5. Haselkorn, R., How cyanobacteria count to 10. Science, 1998. 282: p. 891-892.
6. Wolk, C.P., Physiological basis of the pattern of vegetative growth of a blue-green alga.
Proc. Natl. Acad. Sci. U.S.A., 1967. 57: p. 1246-1251.
7. Ferrell, J.E.J., Self-perpetuating states in signal transduction: positive feedback, double-
negative feedback and bistability. Curr. Opin. Cell Bio., 2002. 14: p. 140-148.
8. Rajagopalan, R. and S.M. Callahan, Temporal and spatial regulation of the four
transcription start sites of hetR from Anabaena sp. strain PCC 7120. J. Bacteriol., 2010.
192: p. 1088-1096.
9. Risser, D.D. and S.M. Callahan, Genetic and cytological evidence that heterocyst
patterning is regulated by inhibitor gradients that promote activator decay. Proc. Natl.
Acad. Sci., 2009. 106: p. 19884-19888.
10. Callahan, S.M. and W.J. Buikema, The role of HetN in maintenance of the heterocyst
pattern in Anabaena sp. PCC 7120. Mol. Microbiol., 2001. 40: p. 941-950.
11. Yoon, H.-S. and J.W. Golden, Heterocyst pattern formation controlled by a diffusible
peptide. Science, 1998. 282: p. 935-938.
12. Buikema, W.J. and R. Haselkorn, Characterization of a gene controlling heterocyst
development in the cyanobacterium Anabaena 7120. Genes Dev., 1991. 5: p. 321-330.
13. Buikema, W.J. and R. Haselkorn, Expression of the Anabaena hetR gene from a copper-
regulated promoter leads to heterocyst differentiation under repressing conditions. Proc.
Natl. Acad. Sci., U.S.A., 2001. 98: p. 2729-2734.
14. Huang, X., Y. Dong, and J. Zhao, HetR homodimer is a DNA-binding protein required for
heterocyst differentiation, and the DNA-binding activity is inhibited by PatS. Proc. Natl.
Acad. Sci. U.S.A., 2004. 101(14): p. 4848-4853.
15. Higa, K.C. and S.M. Callahan, Ectopic expression of hetP can partially bypass the need
for hetR in heterocyst differentiation by Anabaena sp. strain PCC 7120. Mol. Microbiol.,
2010. 77: p. 562-574.
256
16. Saha, S.K. and J.W. Golden, Overexpression of pknE blocks heterocyst development in
Anabaena sp. strain PCC 7120. J. Bacteriol., 2011. 193: p. 2619-2629.
17. Muro-Pastor, A.M., et al., Mutual dependence of the expression of the cell differentiation
regulatory protein HetR and the global nitrogen regulator NtcA during heterocyst
development. Mol. Microbiol., 2002. 44: p. 1377-1385.
18. Kim, Y., et al., Structure of the transcription factor HetR required for heterocyst
differentiation in cyanobacteria. Proc. Natl. Acad. Sci., 2011. 108: p. 10109-10114.
19. Wu, X., et al., patS minigenes inhibit heterocyst development of Anabaena sp. strain
PCC 7120. J. Bacteriol., 2004. 186: p. 6422-6429.
20. Feldman, E.A., et al., Evidence for direct binding between HetR from Anabaena sp. PCC
7120 and PatS-5. Biochemistry, 2011. 50: p. 9212-9224.
21. Yoon, H.-S. and J.W. Golden, PatS and products of nitrogen fixation control heterocyst
pattern. J. Bacteriol., 2001. 183: p. 2605-2613.
22. Borthakur, P.B., et al., Inactivation of patS and hetN causes lethal levels of heterocyst
differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol.
Microbiol., 2005. 57: p. 111-123.
23. Li, B., X. Huang, and J. Zhao, Expression of hetN during heterocyst differentiation and its
inhibition of hetR up-regulation in the cyanobacterium Anabaena sp. PCC 7120. FEBS
Lett., 2002. 517: p. 87-91.
24. Black, T., A. and C.P. Wolk, Analysis of a Het- mutation in Anabaena sp. strain PCC 7120
implicates a secondary metabolite in the regulation of heterocyst spacing. J. Bacteriol.,
1994. 176: p. 2282-2292.
25. Khudyakov, I.Y. and J.W. Golden, Different functions of HetR, a master regulator of
heterocyst differentiation in Anabaena sp. PCC 7120, can be separated by mutation.
Proc. Natl. Acad. Sci. U.S.A., 2004. 101: p. 16040-16045.
26. Campbell, E.L., et al., Global gene expression patterns of Nostoc punctiforme in steady-
state dinitrogen-grown heterocyst-containing cultures and at single time points during the
differentiation of akinetes and hormogonia. J. Bacteriol., 2007. 189: p. 5247-5256.
27. Feldman, E.A., et al., Evidence for direct binding between HetR from Anabaena sp. PCC
7120 and PatS-5. Biochmistry, 2011. 50: p. 9212-9224.
28. Wei, T.-F., R. Ramasubramanian, and J.W. Golden, Anabaena sp. strain PCC 7120 ntcA
gene required for growth on nitrate and heterocyst development. J. Bacteriol., 1994. 176:
p. 4473-4482.
29. Cai, Y. and C.P. Wolk, Use of a conditionally lethal gene in Anabaena sp. strain PCC
7120 to select for double recombinants and to entrap insertion sequences. J. Bacteriol.,
1990. 172: p. 3138-3145.
257
30. Risser, D.D. and S.M. Callahan, Genetic and cytological evidence that heterocyst
patterning is regulated by inhibitor gradients that promote activator decay. Proc Natl Acad
Sci U S A, 2009. 106(47): p. 19884-8.
31. Zhu, M., S.M. Callahan, and J.A. Allen, Maintenance of heterocyst patterning in a
filamentous cyanobacterium. J. Biol. Dynamics, 2010.
32. Liu, J. and W.-L. Chen, Characterization of HetN, a protein involved in heterocyst
differentiation in the cyanobacterium Anabaena sp. strain PCC 7120. FEMS Microbiol.
Lett., 2009. 297: p. 17-23.
33. Bauer, C.C., et al., Suppression of heterocyst differentiation in Anabaena sp. strain PCC
7120 by a cosmid carrying wild-type genes encoding enzymes for fatty acid synthesis.
FEMS Microbiol. Lett., 1995. 151: p. 23-30.
34. Drew, D., et al., Rapid topology mapping of Escherichia coli inner-membrane proteins by
prediction and PhoA/GFP fusion analysis. Proc. Natl. Acad. Sci., 2002. 99: p. 2690-2695.
35. Mariscal, V., A. Herrero, and E. Flores, Continuous periplasm in a filamentous,
heterocyst-forming cyanobacterium. Mol. Microbiol., 2007. 65: p. 1139-1145.
36. Zhang, L.-C., et al., Existence of periplasmic barriers preventing green fluorescent protein
diffusion from cell to cell in the cyanobacterium Anabaena sp. strain PCC 7120. Mol.
Microbiol., 2008. 70: p. 814-823.
37. Flores, E., et al., Is the periplasm continuous in filamentous multicellular cyanobacteria?
Trends Microbiol, 2005. 14: p. 439-443.
38. Merino-Puerto, V., et al., Fra proteins influencing filament integrity, diazotrophy and
localization of septal protein SepJ in the heterocyst forming cyanobacterium Anabaena
sp. Mol. Microbiol., 2010. 75: p. 1159-1170.
39. Mullineaux, C.W., et al., Mechanism of intercellular molecular exchange in heterocyst-
forming cyanobacteria. EMBO J, 2008. 27: p. 1299-1308.