role of the contractile vacuole complex as a ......relies on protein secretion of...

ROLE OF THE CONTRACTILE VACUOLE COMPLEX AS A

TRAFFICKING HUB IN TRYPANOSOMA CRUZI

by

SAYANTANEE NIYOGI

(Under the Direction of Roberto Docampo)

ABSTRACT

Trypanosoma cruzi is the etiologic agent of Chagas disease. It contains a Contractile

Vacuole Complex (CVC) that plays a vital role in the regulation of its cell volume and in

its responses to osmotic stresses in all its life cycle stages. It is peculiar that though,

T.cruzi is not a free-living organism it has a CVC; thus suggesting that the CVC could

have functions beyond just osmoregulation as occurs in some other protists; where the

CVC is involved in regulating calcium homeostasis and in the transfer of proteins to the

surface. Besides, the approach of combined proteomic and bioinformatics analyses

identified proteins localized to the CVC, several of them having trafficking roles, and

implying to a potential novel role of the CVC.

Here we used a combination of genetic and biochemical approaches to establish the

contribution of the CVC as a trafficking hub. T. cruzi relies on protein secretion of

glycosylphosphatidylinositol (GPI)-anchored surface proteins for invasion of host cells

and establishment of infection. In this study we show that the CVC acts as a trafficking

intermediate before GPI-anchored proteins reach the cell surface. Additionally we also

identify CVC-located TcRab11 as a regulator of protein transport of GPI-anchored trans-

sialidase to the plasma membrane, a process essential for the establishment of infection.

Demonstration of the role of TcTS in infection has been previously difficult given the

large number of genes encoding for this protein distributed through the genome of the

parasite. We also studied the role of another CVC-located Rab. Rab32 is located in

lysosome-related organelles (LRO) and since acidocalcisomes are LROs we investigated

whether TcRab32 is needed for the structure and function of acidocalcisomes. By

constructing GDP-bound dominant negative mutants of TcRab32 we were able to show a

defect in trafficking, which ultimately affects parasite infectivity. This study with

TcRab32 provides the link between the acidocalcisome and the contractile vacuole

complex as observed in T. cruzi and in some other protists like Chlamydomonas

reinhardtii and Dictyostelium discoideum.

Our results are consistent with a role of the CVC in regulating membrane traffic to

maintain the function of the acidocalcisome as well as traffic to the plasma membrane of

T. cruzi.

INDEX WORDS: T.cruzi, Contractile Vacuole Complex (CVC), acidocalcisomes,

TcRab32, TcRab11, trans-sialidase, trafficking, membrane



by

SAYANTANEE NIYOGI

BSc., Asutosh College, Kolkata, India, 2006

MSc., University of Calcutta, Kolkata, India, 2008

A Dissertation Submitted to the Graduate Faculty of The University of Georgia in Partial

Fulfillment of the Requirements for the Degree

DOCTOR OF PHILOSOPHY

ATHENS, GEORGIA

2014

© 2014

SAYANTANEE NIYOGI

All Rights Reserved



by

SAYANTANEE NIYOGI

Major Professor: Roberto Docampo

Committee: Boris Striepen

Rick Tarleton

Steve Hajduk

Electronic Version Approved:

Julie Coffield

Interim Dean of the Graduate School

The University of Georgia

August 2014

iv

DEDICATION

Dedicated to Maa, Baba, Titli and Deep for their constant encouragement, support and

unconditional love.

v

ACKNOWLEDGEMENTS

I would like to thank my mentor Dr Docampo for the opportunity, the support, the time

and patience he provided for me and the great projects he had lined up for me. He had to

start right from scratch with me!! When I joined the lab, I did not have a lot of experience

on the bench, in designing experiments. But thanks to him, I think I have become slightly

better at it. I thank him for all that he has taught me, all the knowledge he imparted on me

and guiding me all along. His love for science, his dedication to work has been an

inspiration to me; that helped me to work hard on my projects with full sincerity. He has

always been keen on answering my doubts, correcting my mistakes and also making sure

that I do not repeat those mistakes. He always encouraged me to present my work both in

external meetings as well as in internal seminars; something that has helped boost my

level of confidence. I would also like to thank Dr Moreno for all her invaluable

suggestions during lab meeting; which definitely made my dissertation a lot more solid.

Also her review whenever I presented during a lab meeting or practiced for an upcoming

seminar with her; is invaluable. I think I have learnt a lot about how important it is to be

able to present your work and make sure that people can follow the talk from these

discussions. Also I would like to thank my committee members Dr Striepen, Dr Tarleton

and Dr Hajduk whose advice and suggestion added value to my thesis and towards the

flow of the project.

Thanks to Veronica who trained me in my first year and for her positive criticizm. I am

and will be ever grateful to Melina for being the best lab manager and being a great

vi

friend; for always answering my questions and always encouraging me in the toughest of

time. Thanks to Noelia who is a great friend and a wonderful labmate; she helped answer

some of my doubts regarding the writing of the dissertation. And everyone else in the

Docampo-Moreno lab; an environment that always inspired and taught me to work hard,

help each other, to work together as a unit, discuss and share problems; and also taught

me how important it is to recognize everyone’s contribution and also to be able to

critically review each other’s as well as your own work. I can undoubtedly say these were

the best 5 years of my life!!

A big thank you to my parents; for giving us the best education and the best childhood.

And most importantly making sure that we become nice human beings; something that I

will carry with me wherever I go. They have made countless sacrifices to support me and

my sister and give us a life which I know was very difficult for them to provide at the

moment. My sister, for being my biggest cheerleader and for all the love she gives me.

Though I am the elder one, but her wisdom and mature suggestions have definitely taught

me a lot in life. Thank you to my brother-in-law who is more like my own brother; for all

the encouragement, the sense of humor you keep pouring in at difficult times which

always manages to bring a smile to my face on those days, when going gets tough. My

gratitude to my parents-in-law for being understanding and very supportive throughout.

And a big thank you to my husband for being my strength. Words will never do justice to

what you mean to me. Thank you for being by my side, for backing me up when I fall

down, for respecting my space and also being my biggest critique. You have indeed been

my guide, my teacher and my best friend. Surprisingly all my worries disappeared after I

vii

came back home to him. The support and love from my family has been my biggest

strength and instrumental in whatever I have been able to achieve.

viii

TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS v

LIST OF FIGURES xi

CHAPTER

1 INTRODUCTION………………………………………………………………….1

Introduction…………………………………………………………………………….…...1

Structure of the Dissertation……………………………………………..…………………3

References ……………………………………………………………………….…………4

2 LITERATURE REVIEW…………………………………………………………..5

Trypanosoma cruzi and Chagas disease ……………………………………………………5

Life cycle of Trypanosoma cruzi …………………………………………………………..6

Contractile Vacuole Complex………………………………………………………………7

Acidocalcisomes…………………………………………………………………………..10

Traffic in trypanosomes…………………………………………………………………...13

Rab proteins………………………………………………………….……………………15

Tools to investigate the function of Rab proteins in vesicle fusion and

transport mechanism……………………………………………………………………....16

GDP bound “OFF” stage of Rab proteins: examples……………………………………..18

Role of Rab32 protein in trafficking……………………………………………………...18

Role of Rab11 protein in trafficking………………………………………………………19

ix

Rab protein prenylation and potential treatment of Chagas disease………………………20

Overview of Trypanosoma cruzi infection……………………………………………......21

GPI-anchored surface proteins…………………………………………………………....23

Trans-sialidase…………………………………………………………………………....24

References………………………………………………………………………………...27

3 RAB11 REGULATES TRAFFICKING OF TRANS-SIALIDASE TO

THE PLASMA MEMBRANE THROUGH THE CONTRACTILE VACUOLE

COMPLEX OF TRYPANOSOMA CRUZI ………………………………………………..45

Abstract……………………………………………………………………………………46

Author Summary…………………………………………………………………………..47

Introduction……………………………………………………………………………..…47

Results …………………………………………………………………………………….50

Discussion…………………………………………………………………………………59

Materials and Methods….………………………………………………………………...64

References………………………………………………………………………………...73

4 RAB32 IS ESSENTIAL FOR MAINTAINING

FUNCTIONAL ACIDOCALCISOMES AND FOR GROWTH AND

VIRULENCE OF TRYPANOSOMA CRUZI……………………………………………101

Abstract………………………………………………………………………………..…102

Author Summary ………………………………………………………………………...102

Introduction………………………………………………………………………………103

Results……………………………………………………………………………………105

Discussion……………………………………………………………………………......111

x

Materials and methods…………………………………………………………………...113

References ……………………………………………………………………………….121

5 CONCLUSION…………………………………………………………………..139

Summary of key finding…………………………………………………………………139

Future work………………………………………………………………………………141

References ……………………………………………………………………………….147

xi

LIST OF FIGURES

Page

Figure 2.1: Life cycle of T. cruzi…………………………………………………………………39

Figure 2.2: The CVC in T. cruzi epimastigotes…………………………………………...40

Figure 2.3: Diagramatic representation of the enzymes and transporters

tentatively identified in the acidocalcisome of T. cruzi……………………………...……41

Figure 2.4: The GTP-GDP cycle of Rab-GTPases………………………………………..42

Figure 2.5: Schematic model summarizing the molecules involved on parasite-host

cell interaction process exposed on the surface of a host cell and in trypomastigotes

of T. cruzi……………………………………………………………………………..........43

Figure 2.6: Model of T. cruzi invasion………………………………………………..…..44

Figure 3.1: Fluorescence microscopy analysis of TcRab11 in different stages

of T. cruzi……………………………………………………………………………....................82

Figure 3.2: GFP-TcRab11DN localizes to the cytoplasm of different life cycle stages.....84

Figure 3.3: Regulatory volume changes of epimastigotes………………………………...85

Figure 3.4: Co-localization of GFP-TcRab11 and TcTS during amastigote differentiation

in human foreskin fibroblasts……………………………………………………………...87

Figure 3.5: Localization of TcTS during differentiation to cell-derived and metacyclic

trypomastigotes………………………………………………………………….............88

Figure 3.6: Cryo-immunoelectron microscopy localization of GFP-TcRab11 and TcTS

in amastigotes………………………………………………………………………….......89

xii

Figure 3.7: Overexpression of GFP-TcRab11DN reduces the surface

expression of TcTS……………………………………………………………………….91

Figure 3.8: Localization of surface proteins in GFP-TcRab11OE and

GFP-TcRab11DN-expressing parasites…………………………………………………..92

Figure 3.9: Localization of anti-Gal antibodies…………………………………………...93

Figure 3.10: Association of CVC proteins with lipid rafts and reduced infectivity

Of TcRab11DN trypomastigotes………………………………………………………….94

Figure 3.11: Cryo-immunoelectron microscopy localization of GFP-TcRab11

in epimastigotes…………………………………………………………………………..96

Figure 3.12: Growth rate, and western blot analyses of overexpressed TcRab11…..........97

Figure 3.13: TcAQP1 localization is not affected in GFP-TcRab11DN mutants

and western blot analysis of wild type and GFP-TcRab11DN shows specificity

of anti-SAPA antibodies………………………….............................................................98

Figure 3.14: Localization of GFP-TcRab11 and gp35/50 mucins

during metacyclogenesis………………………………………………………………….99

Figure 3.15: Infections of host cells by trypomastigotes overexpressing TcRab11……..100

Figure 4.1: TcRab32 localization in different life stages of T. cruzi……………………127

Figure 4.2: TcRab32 is digeranylated in vitro…………………………………………..129

Figure 4.3: Localization of GFP-TcRab32 mutants……………………………………..130

Figure 4.4: Lack of colocalization between GFP-TcRab32 and mitochondrial

marker and localization of mitochondrial marker is not affected

in TcRab32 mutants……………………………………………………………………..131

Figure 4.5: Colocalization of GFP-TcRab32 and VP1 under osmotic stress…………...132

xiii

Figure 4.6: Reduced short chain poly P and PPi levels in TcRab32DN

epimastigotes in comparison to wild type epimastigotes………………………………...133

Figure 4.7: Reduction in electron dense acidocalcisomes and considerable

increase in empty vacuole in TcRab32DN epimastigotes in comparison

to wild type……………………………………………………………………………...134

Figure 4.8: Traffic of trans-sialidase is not affected in TcRab32DN

mutant trypomastigotes…………………………………………………………...……..135

Figure 4.9: Effect of TcRab32 mutations on the cell growth of epimastigotes

and their response to hyposmotic and hyperosmotic

stress conditions………………………………………………………….......................136

Figure 4.10: Reduced infectivity of TcRab32 mutant trypomastigotes…………………137

1

CHAPTER 1

INTRODUCTION

Introduction

Kinetoplastids are a group of flagellated protozoans that include the species

Trypanosoma and Leishmania, which are human pathogens with devastating health and

economic effects. Because of their early divergence from other eukaryotes, they exhibit

unusual characteristics. They are distinguished by the presence of a DNA-containing

region known as “kinetoplast” in their single large mitochondrion. This was the first

extranuclear DNA ever discovered, long before mammalian mitochondria were shown to

contain DNA. Besides, trypanosomatids have unique peculiarities like the presence of

organelles like glycosomes, which are specialized peroxisomes containing most

glycolytic enzymes [1] [2]; acidocalcisomes, acidic organelles rich in calcium and

polyphosphate required for pH homeostasis and osmoregulation [3] [4]; contractile

vacuole complex (CVC); needed to maintain osmoregulation [5], and as a trafficking

intermediate; and biological processes first described in these organisms like RNA

editing, glycosylphosphatidylinositol(GPI)-anchor synthesis [6] and trans-splicing [7].

Details of the CVC and acidocalcisomes will be discussed in the following chapters.

Kinetoplastids are evolutionarily more early branched compared to the majority of other

groups of parasitic protists, widespread and adaptable, which is an apparent reflection of

their extremely successful life style. Although the different kinetoplastid pathogens have

a similar genomic organization and similar cellular structures and all undergo

2

morphogenesis during their life cycle, these pathogens are transmitted by different

vectors and cause specific diseases [8]. They are the causative agents of important

diseases such as African sleeping sickness (caused by the Trypanosoma brucei group),

Chagas' disease (caused by Trypanosoma cruzi) and Leishmaniases (caused by

Leishmania spp). People primarily in tropical and subtropical areas of the world are at

risk of contracting these diseases. Some of these parasites (T. brucei group) have an

efficient capability to adapt to their hosts, evading the host immune system by antigenic

variation.

A deep knowledge of what is occurring in the structures, organelles and in the cell

biology of these parasites may open new perspectives for the control of disease through

the development of (a) new chemotherapeutic agents, (b) vaccines or (c) more specific

diagnostic procedures. The completion of genome sequences of trypanosomatids, T.

brucei [9], T. cruzi [10] and Leishmania major [11] and also transcriptome and proteomic

analyses have generated information that provide helpful tools for investigation. Besides,

the TriTryp genome has advanced our understanding of the biology of these parasites and

their host-parasite interaction.

Though significant advance has been made in understanding the mechanism used by

these organisms in invading the host cell, very little is known about the molecular

machinery involved in trafficking in T.cruzi; specifically traffic of surface proteins and

endosomal targeting in T. cruzi. In this work we provide experimental evidence for the

role of the contractile vacuole complex (CVC) as a trafficking hub, involved in the traffic

of GPI-anchored proteins to the plasma membrane of the parasite and also its role as

3

endosomal system that transfers membrane proteins to the acidocalcisomes. We use a

combination of genetic and biochemical approach to address the goal.

Structure of the Dissertation

The dissertation is subdivided into five chapters. Chapter 2 reviews the current

knowledge regarding topics which are pertinent to the specific aims of my dissertation. In

this chapter I try to portray a detailed analysis of key pathways that were necessary for

our study, with a focus on mechanism of trafficking of GPI-anchored protein in other

organisms, and also a detailed analysis of the function of Rab-GTPases and tools to

investigate Rab function, as studied in other systems. This chapter also provides

structural and functional overview of organelles studied in this research. Chapter 3

describes the role of T. cruzi Rab11 in the traffic of trans-sialidase to the plasma

membrane via the contractile vacuole complex. This work was published in PLoS

Pathogens [12]. Chapter 4 describes the role of the other Rab-GTPase, T. cruzi Rab32, in

maintaining the function of acidocalcisomes and its involvement in growth and virulence

of the parasite. Chapter 5 provides an overall conclusion for this research in elucidating

the role of the CVC as a trafficking intermediate in T. cruzi. It also highlights open

questions pertinent for future study, not only limited to the cell biology of T. cruzi, but

also to the other trypanosomatids.

4

REFERENCES

1. Parsons M (2004) Glycosomes: parasites and the divergence of peroxisomal purpose.

Mol Microbiol 53: 717-724.

2. Opperdoes FR, Borst P (1977) Localization of nine glycolytic enzymes in a

microbody-like organelle in Trypanosoma brucei: the glycosome. FEBS Lett 80:

360-364.

3. Docampo R, de Souza W, Miranda K, Rohloff P, Moreno SN (2005) Acidocalcisomes

- conserved from bacteria to man. Nat Rev Microbiol 3: 251-261.

4. Docampo R, Scott DA, Vercesi AE, Moreno SN (1995) Intracellular Ca2+ storage in

acidocalcisomes of Trypanosoma cruzi. Biochem J 310 ( Pt 3): 1005-1012.

5. Rohloff P, Docampo R (2008) A contractile vacuole complex is involved in

osmoregulation in Trypanosoma cruzi. Exp Parasitol 118: 17-24.

6. Ferguson MA (1999) The structure, biosynthesis and functions of

glycosylphosphatidylinositol anchors, and the contributions of trypanosome

research. J Cell Sci 112 ( Pt 17): 2799-2809.

7. Liang XH, Haritan A, Uliel S, Michaeli S (2003) trans- and cis-splicing in

trypanosomatids: mechanism, factors, and regulation. Eukaryot Cell 2: 830-840.

8. Mableson HE, Okello A, Picozzi K, Welburn SC (2014) Neglected zoonotic diseases-

the long and winding road to advocacy. PLoS Negl Trop Dis 8: e2800.

9. Berriman M, Ghedin E, Hertz-Fowler C, Blandin G, Renauld H, et al. (2005) The

genome of the African trypanosome Trypanosoma brucei. Science 309: 416-422.

10. El-Sayed NM, Myler PJ, Bartholomeu DC, Nilsson D, Aggarwal G, et al. (2005) The

genome sequence of Trypanosoma cruzi, etiologic agent of Chagas disease.

Science 309: 409-415.

11. Ivens AC, Peacock CS, Worthey EA, Murphy L, Aggarwal G, et al. (2005) The

genome of the kinetoplastid parasite, Leishmania major. Science 309: 436-442.

12. Niyogi S, Mucci J, Campetella O, Docampo R (2014) Rab11 regulates trafficking of

trans-sialidase to the plasma membrane through the contractile vacuole complex

of Trypanosoma cruzi. PLoS Pathog 10: e1004224.

5

CHAPTER 2

LITERATURE OVERVIEW

Trypanosoma cruzi and Chagas disease

The obligate intracellular parasite Trypanosoma cruzi is the causative agent of Chagas

disease, which is the leading cause of cardiac death in endemic areas throughout Latin

America, where it is mostly vector-borne transmitted to humans by contact with faeces of

triatomine bugs, known as ‘kissing bugs’. The invertebrate hosts are Hemiptera and

Reduvidae such as Rhodinus prolixus, Triatoma infestans, and Panstrongylus megistus.

More than 11 million people are infected with the parasite and some 40 million more are

at risk. Among other Neglected Tropical Diseases (NTD), Chagas disease ranks near the

top in terms of annual death and DALYs (Disability Adjusted Life Years) lost [1,2]. In

the past decades it has been increasingly detected in the United States of America,

Canada, many European and some Western Pacific countries. This is due mainly to

population mobility between Latin America and the rest of the world [3] [4]. Although

currently available nitroheterocyclic drugs (benznidazole and nifurtimox) are moderately

efficacious when administered during the acute phase, they have been minimally

successful in treating chronic infection. Chronic Chagas' cardiomyopathy is the most

serious and frequent manifestation of Chagas’ disease characterized by cardiac

arrhythmias, heart failure, and risk of sudden death from ventricular fibrillation or

tachycardia [5]. It is the main cause of mortality among these patients and is associated to

6

a poorer survival compared with other forms of cardiomyopathies. Early detection of

heart involvement in seropositive individuals remains challenging.

Life cycle of Trypanosoma cruzi

Persistent infection with T. cruzi causes Chagas disease. The parasite is transmitted to

humans by infected blood-sucking Triatominae insects, which defecate after obtaining a

blood meal and thus release the trypomastigotes in faeces. Scratching the area of bite

causes the trypomastigotes to enter the wound and invade nearby cells. While

intracellular, they differentiate into amastigotes that multiply by binary fission. The

amastigotes differentiate into trypomastigotes, which are released into the bloodstream

and infect cells of multiple organs and tissues, including the heart, gut, CNS, smooth

muscle, and adipose tissue and once again become amastigotes. The Triatominae insects

become infected when they take a parasite-containing blood meal from an infected

human or animal. The trypomastigotes undergo morphological and physiological

transformations in the midgut of the vector and differentiate into infective

trypomastigotes in the hindgut. The morphological characteristics of these developmental

forms (intracellular, blood and insect stages) have been extensively investigated by

different microscopy techniques. The structural details of the different forms are as

following:

1) Amastigotes: They are spherical in shape, able to divide and are infective.

2) Trypomastigotes: these forms have a length of about 25 μm and a diameter of

about 2 μm. The kinetoplast is located posterior to the nucleus. These forms are

not able to divide. The nucleus is elongated and organized in the central portion of

the cell.

7

3) Epimastigotes: They are spindle-shaped, 20–40 μm long with kinetoplast located

anterior to the nucleus. These forms are able to divide. The nucleus has a rounded

shape.

Contractile vacuole complex

The Contractile Vacuole Complex (CVC) was first described in Paramecium more than

200 years ago (Spallanzani, 1799) and was later found in a wide range of amoeba,

photosynthetic and nonphotosynthetic flagellates and ciliates. Clark (1959) (J. Protozool.,

1959) was the first to describe the presence of a CVC in T. cruzi and reported a pulsation

period (time between contractions) in epimastigotes between 1 min and 1 min and 15 s.

Besides T. cruzi the CVC is also present in Leishmania sp [6] and in monogenetic

trypanosomes like Leptomonas collosoma [7] and Crithidia luciliae [8] and apparently

absent in Trypanosoma brucei.

Architecture: Structure and composition

The CVC is an intracellular compartment with an osmoregulatory role in different

protists (discussed below). This compartment has a bipartite structure, consisting of a

central vacuole or bladder and a surrounding loose network of tubules and vesicles

named the spongiome [9]; [10]. Functional distinctions between these 2 components of

the CVC were evidenced by the localization of different proteins to each compartment.

Recent proteomic analysis and microscopy studies of green fluorescent protein (GFP)-

tagged proteins have revealed the presence of the vacuolar H+-ATPase, Rab11, Rab32,

AP180, VAMP1 and a putative phosphate transporter (PT) in the bladder while

calmodulin and two SNAREs are localized to the spongiome [11]. The CVC is present in

all the different life cycle stages of T.cruzi. Fig 2.2 shows a turgid central vacuole and

8

interconnected tubules forming a network in a well preserved contractile vacuole. In fact

the contractile vacuole is believed to be docked to a domain of the flagellar pocket (Fig

2C, 2D) with the presence of an electron-dense region between the two. This domain of

the contractile vacuole seems to get deformed because of its physical connection with the

flagellar pocket (Fig 2.2D). This feature has been shown before in Leptomonas spp where

the contractile vacuole membrane is permanently attached to the plasma membrane of the

flagellar pocket by a dense adhesion plaque [7].

The search for other functions of the CVC

The function of the CVC with regard to osmoregulation in T.cruzi has been a subject of

study in our lab for many years with the result of several publications stating the

mechanistic role of this organelle. The CVC accumulates water through an aquaporin or

water channel [12] [13] [14] and expels it out of the cell through pores in the plasma

membrane [9,10]. It is important for regulatory volume decrease (RVD) after hyposmotic

stress [13], as well as for shrinking of the cells when submitted to hyperosmotic stress

[4]. The CVC bladder does not burst during volume regulation phenomenon. It has been

proposed [15] that the connected tubular spongiome acts as a reservoir for water which

increases in surface area by virtue of the phospholipids present in the membrane to

accommodate the increase in volume during hyposmotic stress. This result is supported

by our data as shown in Figure 3.3C-D and 3.11B-C and discussed in chapter 3.

Other roles of the CVC in T. cruzi had not been investigated before this dissertation.

CVC has been studied in several protists and we will discuss its role below. The presence

of several proteins related to calcium signaling [10] underscore the role of the CVC in

Ca2+

homeostasis. It also has a role in transfer of some proteins to the plasma membrane

9

[16-18]. In Dictyostelium discoideum, the vacuolar proton ATPase (V-H+-ATPase) and

calmodulin (CaM) move to the plasma membrane when cells are starved during

stationary phase [16], and the Ca2+

-ATPase PAT1 moves to the plasma membrane when

cells are incubated at high Ca2+

concentrations [17]. Some luminal proteins, such as the

adhesins DdCAD-1 and discoidin-1 can also be targeted to the cell surface via the CVC

in D. discoideum [18,19]. We recently reported (Chapter 3) the role of the CVC in traffic

of GPI-anchored surface proteins in T. cruzi [20]. In T. cruzi epimastigotes, the

polyamine transporter TcPOT1.1, which localizes to CVC-like structures, has also been

reported to appear in the plasma membrane when the culture medium is deficient in

polyamines [21]. Also a phosphate transporter (TcPHO1) has been localized to the CVC

[11]. It is interesting to note that dajumin-GFP (the CVC marker) is trafficked to the

CVC of D. discoideum via the plasma membrane and is internalized by a clathrin-

dependent mechanism, suggesting that clathrin-mediated endocytosis may have a role in

the biogenesis and/or, maintenance of the contractile vacuole by functioning in retrieval

of proteins from the cell membrane [22]

The proteomic and bioinformatics study [11] of the CVC of T. cruzi identified a cohort of

proteins having trafficking roles. This study detected the presence of SNAREs 2.1 and

2.2, VAMP1 (VAMP7 homolog), AP180, and the small GTPases Rab11 and Rab32. The

accumulation of all of these proteins which have role in vesicle fusion/fission and

tethering events in the CVC, suggests that the CVC of T. cruzi was acts as a trafficking

hub.

10

Acidocalcisome

Acidocalcisomes were first described in trypanosomes and later found in Apicomplexan

parasites, algae, slime molds, fungi, eggs of different origins, and human cells [23].

These organelles are acidic compartments storing high concentrations of calcium and

polyphosphate (polyP) [24]. Figure 2.3 shows the pumps and antiporters that are present

in the membrane of the acidocalcisome and are necessary for their cation and water

accumulation and release, as well as enzymes involved in the synthesis and degradation

of pyrophosphate and polyP. A number of these pumps, channels, and exchangers in the

membranes were biochemically characterized and their genes cloned and expressed.

Acidocalcisome: Structure

Acidocalcisome of protists in general are spherical in shape. Trypanosomatids are rich in

very short chain polyP such as polyP3, polyP4, and polyP5. PolyP is arbitrarily divided

into two forms: short-chain (from 3 to ~300 Pi) and long-chain (from 300 to ~1000 Pi)

polyP, based on the method used for its extraction. Besides polyP, trypanosomatids also

contain orthophosphate (Pi) and PPi. These phosphorus compounds are in close

association to cations (sodium, potassium, magnesium, calcium, zinc, and iron) and basic

amino acids [24] [25]. In eukaryotic cells, polyP is present in different compartments,

including the cytosol, nucleus, lysosomes, and mitochondria, but is preferentially

accumulated in acidic vacuoles such as the yeast vacuole and acidocalcisomes [23,26].

Taking into account its total concentration and the relative volume of acidocalcisomes in

some of these cells (about 1–2% of the total cell volume), the intraorganellar

concentration is in the molar range (~3 M) [24]. These vesicles are acidic and thus

accumulate dyes like acridine orange [27]. DAPI can be used to detect polyP in these

11

organelles [28]. By standard electron microscopy, they appear as empty vacuoles or

vacuoles containing a thin layer of dense material or an inclusion that sticks to the inner

face of the membrane. The electron-dense material inside acidocalcisomes is better

preserved with the use of cryomethods [29] where the organelles seem completely filled

by an electron-dense material. Two proton pumps were found in acidocalcisomes of

protists. One is the vacuolar-type H+-ATPase, a macromolecular complex of 14 subunits

[30,31], and the other is the V-H+-PPase, a single subunit protein that uses PPi instead of

ATP to transport protons.

Acidocalcisome: biogenesis

Acidocalcisome of eukaryotes is considered lysosome related organelles (LROs) like

platelets dense granules and mast cell granules. Human platelet dense granules contain

polyP and are similar to acidocalcisomes of bacteria and unicellular eukaryotes.

Polyphosphate released from platelets modulates blood coagulation and fibrinolysis. Mast

cell granules also have polyP, that is released and acts as a novel pro-inflammatory

regulator. Adaptor protein (AP) complexes are important mediators for vesicular

transport of membrane proteins between cellular compartments, such as Golgi complex,

endosomes, lysosomes, and plasma membrane [32]. AP-3 is involved in sorting of

proteins to lysosomes and LROs from the Golgi or from endosomes. Knockdown of the

β3 or δ subunits of the AP-3 complex led to a decrease in the number of acidocalcisomes

in both procyclic (PCF) and bloodstream forms of T. brucei [33].

Functional roles

Storage of phosphorus compounds (Pi, PPi, and polyP) and cations (calcium, magnesium,

sodium, potassium, zinc, and iron) is one of the main roles of acidocalcisomes from

12

different protists. This storage in an intracellular compartment reduces the osmotic effect

of large pools of these compounds in the cytosol. The recent discovery that polyP has

critical roles in blood clotting [34], and inflammation [35] suggests that polyP present in

microorganisms could be involved in their pathogenicity. Decrease in the levels of polyP

in parasites such as T. brucei, T. gondii, or L. major (reviewed in [36]) reduces their

pathogenicity. It is not known whether this is due to osmotic fragility of the parasites as a

result of changes in polyP levels that impact their ability to grow in vivo, making the

immune response against them more successful, or to a role of polyP in modulating the

immune response directly.

The discovery of an inositol 1,4,5-trisphosphate receptor (IP3R) in acidocalcisomes of T.

brucei [37] indicates that these organelles have a significant role in Ca2+

signaling. Ca2+

release via IP3Rs stimulates activities critical for life.

Acidocalcisomes also appear to have a role in regulation of intracellular pH.

Acidocalcisomes have also an important role in osmoregulation. There is rapid hydrolysis

or synthesis of acidocalcisome polyP during hypo- or hyperosmotic stress, respectively,

in T. cruzi [38], as well as changes in sodium and chloride content in acidocalcisomes of

L. major in response to acute hyposmotic stress [39]. It has been proposed that the

stimulus of cell swelling causes a spike in intracellular cAMP through an as yet

unidentified adenylyl cyclase, which causes aquaporin (TcAQP1) containing

acidocalcisome to fuse with the contractile vacuole and translocation of aquaporin [13].

This process helps the elimination of water by the contractile vacuole.

13

Traffic in trypanosomes

Trypanosomes appear to have a less complicated trafficking pathway in comparison to

eukaryotes, partly due to their unicellular structure and also due to a reduction in the copy

number of organelles in comparison to multicellular organisms. Trypanosomes have an

elongated shape, with the presence of tightly spaced subpellicular microtubules

subtending the plasma membrane. Endocytic and exocytic trafficking is restricted to the

posterior flagellar pocket (FP). It sometimes also occur at areas of the plasma membrane

where the cell cytoskeleton, formed by sub-pellicular microtubules, is absent.

Endocytosis in T. cruzi also occurs through the cytostome, present in both epimastigotes

and amastigotes.

One of the surface proteins whose traffic has been studied in T. brucei is the GPI-

anchored Variant Surface Glycoprotein (VSG), which is responsible for antigenic

variation in them. VSG is a major secretory cargo of T. brucei bloodstream forms, which

is trafficked to the surface; from where it is endocytosed and recycled via the flagellar

pocket [40], [41]. Secretory cargos leave the ER from defined ER exit sites (ERES)

where they are loaded into COPII secretory vesicles [42]. Though the post-Golgi

trafficking pathway is not very clear, it is known that cargo is destined either for the

lysosome or the cell surface. Some players which belong to the Rab family of proteins

responsible for vesicular fusion have been identified. These include TbRab5A/B (early

endosome), TbRab11 (recycling endosome), and TbRab7 (late endosome) (reviewed in

[43]). The pathway from the post-Golgi to the lysosome, or the flagellar pocket or to the

cell surface needs to be delineated. There are some basic similarities between the

secretory pathways of trypanosomes with model organisms like yeast or vertebrate cells,

14

but there are some defined differences as well. Nevertheless, because of their streamlined

architecture they offer unique opportunities to study general eukaryotic cell biology.

Endocytosis is rapid in T. brucei, probably because of the phenomenon of immune

evasion of this parasite. Clathrin-mediated mechanisms are the major route for

endocytosis in T. brucei and GPI-anchored proteins are endocytosed by clathrin-

dependent pathways in trypanosomes [44].

The mechanisms involved in exocytosis, endocytosis and recycling in T. cruzi are poorly

understood compared to mammalian cells or to the related organism T. brucei. Most of

what is known comes from structural and biochemical studies with regard to enzymes

and endocytic markers, as will be discussed below. T. cruzi ingests nutrients from the

environment by endocytosis, but the endocytic pathway and molecules/organelles

involved in this important metabolic pathway are still poorly known. Data on fluid-phase

pinocytosis of peroxidase and on receptor-mediated endocytosis of gold-labeled albumin,

peroxidase, transferrin and LDL [45] by T. cruzi showed that the ingested material

entered the cells through the cytostome and/or the flagellar pocket region [46,47]. Both

sites open at the anterior cell end, where the single flagellum emerges. Endocytosis of

transferrin-gold nanoparticles has been studied by confocal microscopy [48]. But unlike

T. brucei, endocytosis is mostly clathrin-independent in T. cruzi. In an attempt to identify

the compartments involved in endocytosis in T. cruzi, it has been found that ingested

material concentrates in the reservosome, an acidic pre-lysosomal compartment in the

posterior end of the cell, rich in cysteine proteinase, but which does not contain acid

phosphatase or other lysosomal membrane proteins [49].

15

Rab proteins

Proteomic and bioinformatics analyses of proteins localized to the CVC identified several

proteins with trafficking roles [11]. Among them, two Rab (Ras-related proteins in the

brain) GTPases (Rab32 and Rab11) were identified, which are the subject of my research.

Rab proteins are members of the highly evolutionarily conserved Rab superfamily of

GTPases that are structurally related to the Ras proteins. They regulate different

intracellular transport processes. Other members of the Ras superfamily such as Rho, Rab

and Ran proteins, are regulated by similar interactions with nucleotides. However, they

interact with distinct regulators and downstream target proteins, allowing them to

contribute to unique cellular functions (Fig. 2.3). The related regions include at least four

protein domains found in all GTPases that are involved in the binding of GTP or GDP

[50]. When Rabs, are in the GTP-bound state, they are thought to be functionally active

and are inactive when they bind GDP [50]. Conversion of the GDP-bound Rab into the

GTP-bound form occurs through the exchange of GDP for GTP, which is catalyzed by a

guanine nucleotide exchange factor (GEF) and causes a conformational change (Fig. 2.4).

The GTP-bound ‘active’ conformation is recognized by multiple effector proteins and is

converted back to the GDP-bound ‘inactive’ form through hydrolysis of GTP, which is

stimulated by a GTPase-activating protein (GAP) and releases an inorganic phosphate

(Pi). The newly synthesized Rab, in the GDP-bound form, is recognized by a Rab escort

protein (REP). The REP presents the Rab to a geranylgeranyl transferase (GGT), which

geranylgeranylates the Rab on one or two carboxy-terminal Cys residues. The

geranylgeranylated, GDP-bound Rab is recognized by Rab GDP dissociation inhibitor

(GDI), which regulates the membrane cycle of the Rab. Targeting of the Rab–GDI

16

complex to specific membranes is mediated by interaction with a membrane-bound GDI

displacement factor (GDF) that catalyzes the dissociation of Rab-GDI complex at

particular membrane surfaces. Coordinated regulation of Rab proteins is instrumental in

ensuring precision and fidelity of membrane trafficking. Accumulated evidence suggests

that Rab GTPases recruit tethering and docking factors to establish firm contact between

the membranes to fuse, after which SNAREs (Soluble NSF Attachment Protein Receptor)

become involved and complete the fusion process [51,52]. Crystallographic structure of

Rab proteins have been identified which include structural motifs and modes of effector

interaction that are distinct from those of other GTPase families. The active conformation

(GTP-bound) is stabilized by additional hydrogen bonding i

phosphate of GTP, mediated by serine residues in the P-loop and switch I region, as well

as an extensive hydrophobic interface between the switch I and II regions [53,54].

Besides the presence of a hydrophobic triad (residues Phe-58, Trp-75, and Tyr-90) leads

to a structural flexibility, thus contributing to the mechanism by which different Rabs

interact with their specific subset of effector proteins.

A total of 17 Rab proteins have been identified in T. cruzi. In addition to Rab32 and

Rab11, only three other Rab proteins: Rab4, Rab5 and Rab7 were studied in T. cruzi [55-

57]. The lack of genetic tools in T.cruzi prevented investigation regarding the mechanism

of function of these Rabs.

Tools to investigate the function of Rab proteins in vesicle fusion and transport

mechanism

There are several tools available to study the localization and function of Rab proteins in

mammalian cells and to study the involvement of Rab isoforms in specialized membrane

17

trafficking events [58]. The tools include study of enhanced green fluorescent protein

(EGFP)-tagged mouse and human Rabs, FLAG-tagged Rabs, glutathione S-transferase

(GST)-tagged Rabs, Gal4-binding domain (GBD)-tagged Rabs, Tre-2/Bub2/Cdc16

(TBC) domain-containing Rab-GTPase activating proteins (GAPs), and small interfering

RNAs. EGFP-Rabs are used to screen for Rabs that are localized on specific organelles

and regulate their transport, and GST-Rabs and GBD-Rabs are used to screen for novel

Rab effectors by GST pull-down assays and yeast two-hybrid assays, respectively.

Several methods have often been used to investigate the function of specific Rab

isoforms in membrane traffic. The first, and most commonly used method, has been

overexpression in cells of a constitutive active (CA) mutant that mimics the GTP-bound

form or of a constitutive negative (CN) mutant that mimics the GDP-bound form (Fig.

2(a)). The second method, which has come into use recently, is knockdown of a specific

Rab by RNA interference technology. The third method is based on a genetic approach in

which a specific Rab effector domain is overexpressed in cells. As the effectors that bind

to Rab proteins and their binding domains have not been studied in detail, the third

method has severe limitations. Since Rab-GAP is able to inactivate its substrate Rab by

promoting GTPase activity, overexpression of Rab-GAP in cells should result in specific

inactivation of its substrate Rab, which, in turn, would inhibit specific organelle transport.

Although the specific Rab-GAP of most mammalian Rabs has yet to be identified, a TBC

domain is generally thought to function as a Rab-GAP. Although TBC/Rab-GAP proteins

are useful for inactivating the function of endogenous Rab proteins, the results need to be

interpreted carefully based on the specificity of some TBC/Rab-GAPs (e.g.,[59]).

Unfortunately the RNAi machinery is absent in T.cruzi [23]. Hence, expression of the CN

18

or CA form that mimics loss-of-function or gain-of function effects was used for our

research. .

GDP bound “OFF” stage of Rab proteins: examples

Dominant-negative Rab mutants work in cells by competing with endogenous Rabs for

binding to Rab-GEFs. The mutants cannot interact with downstream target proteins

within cells, so when they are expressed in cells in excess they bind to GEFs and form

‘dead-end’ complexes. Thus sequestration of Rab-GEFs prevents the activation of

endogenous Rabs [60]. Biological experiments supporting this view [61] have shown that

the growth-inhibitory effect of Ras17N expression in mammalian cells, or of Ras15A

expression in yeast, can be overcome by increased expression of either a Ras-specific

GEF or wild-type Ras. In addition, mutations within the region of Ras that interacts with

GEFs suppress the inhibitory phenotype of Ras17N.

Role of Rab32 protein in trafficking

Different Rab-GTPases localize to different organelles which gives every organelle a

unique identity. Rab32 has been shown to regulate post-Golgi trafficking of melanogenic

enzymes in mammalian cells [62] and melanosome transport and melanocyte biogenesis

in Xenopus laevis [63]. It is known to regulate pigmentation, but it is not directly required

for the formation of melanosomes [62]. Rab32 has also been shown to regulate

phagosome maturation along with a network of other Rab GTPases [64]. It is required for

the formation of autophagic vacuoles and is involved in regulation of the clearance of

aggregated proteins by autophagy in a nucleotide binding state dependent manner [65].

Human Rab32 expressed in COS cells localizes to mitochondria as an A-kinase

19

anchoring protein (AKAP), and the expression of its GDP-bound form causes the

fragmentation of mitochondria [66].

No function of Rab32 has yet been reported in trypanosomes, although acidocalcisomes,

as melanosomes, are lysosome-related organelles [67]. Interestingly, Rab32 was found in

both granule and membrane fractions from human platelets [68]. Platelet dense granules

are the most similar to acidocalcisomes in that they contain PPi and polyP and are rich in

calcium (reviewed in [23]).

In this dissertation (Chapter 4) I study if the function of TcRab32 is conserved in T. cruzi,

by regulating function of acidocalcisomes. TcRab32 has the “DIAGQ” domain that is

present in Rab32 across all species. A similar replacement is found in Rab38, Rab29, and

Rab7L1/29 of mammalian cells, and in RabE from Dictyostelium discoideum [65], but

there are no orthologs to any of these other Rabs in T. cruzi.

Role of Rab11 protein in trafficking

Rab11 is one of the best studied Rab-GTPases, other than Rab5. Rab11 regulates

exocytic and recycling processes, thereby directing proteins and membranes towards the

cell surface. Rab11 generally localizes to the trans-Golgi as well as post-Golgi

endosomes of secretory pathway [69]. Rab11 has been shown to regulate traffic of

several receptors and adhesion proteins which have roles in cell-cell adhesion, migration

and invasion; with diverse cellular functions including ciliogenesis, cytokinesis,

neuritogenesis, and oogenesis [70-73]. This high degree of functional complexity is

achieved by mutually exclusive recruitment of a range of Rab11 effector proteins

In T. brucei, Rab11 localizes to the recycling endosomes [74]. It mediates the transfer of

the glycosylphosphatidylinositol (GPI)-anchored proteins transferrin [75] and variant

20

surface glycoprotein (VSG) [76] to the plasma membrane. Rab11 depletion inhibited

export, but not uptake, of internalized transferrin, thus implying its involvement in

secretion pathway [77]. Besides, Rab11 localizes to the CVC of D. discoideum [78]. Our

observation [11] that Rab11 localizes to the CVC in T. cruzi suggested that an

uncharacterized membrane transport exists connecting the CVC to the plasma membrane.

That is the subject of Chapter 3 of my dissertation.

Rab protein prenylation and potential treatment of Chagas disease:

Protein prenylation is a post–translational modification that occurs in many eukaryotic

cells which functions to bind proteins to cell membrane and they may direct protein-

protein interactions and thus are needed for many biological activities. Among the many

prenylated proteins Rabs form a distinct class. The C-terminus of Ras superfamily

GTPases terminates in a so-called CAAX box (where C is cysteine, A is usually but not

necessarily an aliphatic amino acid, and X is a variety of different amino acids). The

CAAX box serves as a signal for a series of post-translational modifications: 1)

farnesylation or geranylgeranylation of the cysteine sulfhydryl group, 2) endoproteolytic

removal of AAX, and 3) methylation of the -carboxyl group of the prenylated cysteine

residue. The hydrophobic C termini of Ras superfamily GTPases are thought to be

important for anchoring these proteins to cellular membranes [79] [80]. The three

structural classes of prenylation that have been identified are C-terminal farnesylation, C-

terminal geranylation and C-terminal digeranylgeranylation. It involves transfer of a 15-

carbon farnesyl or a 20-carbon geranylgeranyl from the corresponding prenyl-

pyrophosphate to the sulfhydryl group of the carboxyl-terminal cysteine, respectively

[81] [28]. Since prenylation is required for the function of important regulators of cell

21

growth, inhibitors of these enzymes are likely to have therapeutic potential for the

treatment of parasitic diseases. The fact that growth of T. brucei, T. cruzi, and L.

mexicana is blocked by protein farnesyl transferase (PFT) inhibitors suggests that

trypanosomatid PFT is a good target for treating sleeping sickness, Chagas disease, and

leishmaniasis In addition the mechanism of action of bisphosphonates involves the

inhibition of the enzyme farnesyl pyrophosphate synthase, thereby preventing the

prenylation of small GTPase signaling proteins, suggesting that they can be used to treat

parasitic diseases [82].

Overview of Trypanosoma cruzi infection:

Adhesion of T. cruzi to Vertebrate Cells

The first steps of the T. cruzi-host cell interaction process can be divided into three

stages: adhesion and recognition, signaling, and invasion. Invasion depends on the T.

cruzi strain and which developmental stage is used, the morphology of the

trypomastigote, whether slender or stout, and which host cell it is invading, as reviewed

in [83]. The mechanisms by which T. cruzi infective forms gain access to the intracellular

milieu are still being studied. The adhesion step involves the recognition of molecules

present on the surface of both parasite and host cells (Figure 2.4). T. cruzi, need to escape

their vacuole and instead replicate in the host cell cytosol. This vacuolar escape is the

first step of egress, which needs to be perfectly controlled in order to lyse the vacuole but

preserve host cell integrity. After replication, a second egress event then leads to the

release of the progeny from the host cell. Importantly, both steps need to be individually

regulated. This illustrates that the completion of replication must play a central role in

triggering egress for vacuolar as well as cytosolic pathogens. The timing is likely

22

controlled by intrinsic cues to optimize the number of progeny to be released and to

ensure that the replication and maturation of the transmission forms have been completed

Parasite Molecules

Different strains of T. cruzi as well as different forms of the parasite (tissue culture

derived trypomastigotes, metacyclic trypomastigotes and amastigotes), express different

molecules on their surface. These surface molecules interact with host components to

invade mammalian cells. Some of these surface antigens central to our study have been

discussed below.

Host cell molecules

One class of receptors present in mammalian cells is represented by lectin-like molecules.

Lectins are sugar-binding proteins which are highly specific for their sugar moieties and

are involved in attachment between pathogens and host cells [84]. Carbohydrate residues

present in the plasma membrane of mammalian cells can function as receptors. Studies

show galactosyl, mannosyl and sialyl residues play a role in parasite internalization [85].

Integrins, receptors that mediate attachment between two cells or cell and extracellular

matrix, are involved in the invasion processes [86]. Another molecule present on the host

cell surface and involved in trypomastigotes’ entry is the TGF receptor [87].

Model of T. cruzi invasion

As reviewed in [83] the model indicates three distinct mechanisms of T. cruzi entry into

host cell (Fig. 2.5). (a) The lysosome dependent pathway is initiated by targeted Ca2+

-

regulated exocytosis of lysosomes in the plasma membrane; (b) in the actin dependent

pathway trypomastigotes penetrate into a host cell through a plasma membrane expansion

that culminates in assembly of a parasitophorous vacuole. Either early endosomes or

23

lysosomes can fuse with the parasitophorous vacuole; (c) in the lysosome-independent

pathway, parasites enter cells through plasma membrane invaginations that accumulate

PIP3 (product of class I PI3K activation). Subsequently, internalized parasites are

contained in a vacuole formed from the plasma membrane that maturates with the

acquisition of early endosome markers (Rab5 and EEA1) and subsequently with the

acquisition of lysosome markers; the trypomastigote forms gradually transform into an

amastigote form with simultaneous lysis of the parasitophorous vacuole membrane. Then,

amastigotes in direct contact with the cytoplasm start to divide.

GPI-anchored surface proteins

Glycosylphosphatidylinositol (GPI)-anchoring is a common, relevant posttranslational

modification of eukaryotic surface proteins [88]. GPI-anchored proteins have been

postulated to serve diverse functions such as cell surface protection in protozoan

parasites, cell wall synthesis in yeast or cell adhesion and transmembrane signaling in

mammalian cells. GPI-anchored proteins are also the major cell surface molecules

expressed by the kinetoplastids; T. brucei, T. cruzi and Leishmania spp. Considering their

role in host cell invasion, protection from the host cell milieu, they are attractive targets

for drugs against parasitic diseases and for design of diagnostic probes [89,90].

GPI-anchored proteins are usually transported from the endoplasmic reticulum (ER) to

the plasma membrane through the Golgi apparatus, where lipid raft-like structures form

[91]. Sorting is achieved by the formation of domains rich in sphingolipids, cholesterol

and GPI-anchored proteins, specifically incorporated into vesicular carriers destined for

fusion with the plasma membrane. Though sorting is achieved mainly at the ER or the

Golgi, it can be achieved at several steps in the secretory pathway [92].

24

Trypanosomatids have an abundance of GPI-anchored surface molecules. T. brucei is

covered by a dense coat of GPI-anchored VSG protein. This primary secretory cargo is a

stage-specific protein expressed by T. brucei [93]. Only correctly folded GPI-anchored

VSG is able to reach the cell surface; GPI-deficient VSG is retained in the ER and later

degraded. In these parasites GPI-anchored homodimers are formed in the ER and reache

the flagellar pocket via the Golgi apparatus [94].

GPI-anchored surface proteins are expressed in all developmental stages of T. cruzi and

encoded by thousands of members of multigene families: mucins, mucin associated

surface proteins (MASP) [95] and members of the trans-sialidase family/gp85

glycoprotein [96,97] and metalloproteinase gp63. But, the traffic route taken by GPI-

anchored proteins and the carrier proteins are yet to be characterized in T. cruzi. This

topic is the aim of our study in Chapter 3.

Trans-sialidase

T. cruzi is unable to synthesize sialic acid and it depends on the host cell for it [98]. It is

achieved by the expression of trans-sialidase on its surface. This enzymatic activity is

different from the eukaryotic sialyltransferases present in the Golgi complex that

exclusively use CMP-sialic acid as the donor substrate. Trans-sialidase is

developmentally regulated in T. cruzi. The enzyme, located on the trypanosome surface,

is responsible for transferring sialyl residues from host glycoconjugates to parasite

molecules. Trans-sialidase is capable of directly transferring sialic acid residues between

a variety of molecules ([99] [100] [101]). TcTS is crucial in the life cycle of the parasite

because it allows the acquisition of sialyl residues from the host glycoconjugates

preventing their lysis by the alternative complement pathway [102,103], and opsonization

25

followed by killing by natural antibodies [104]. Trans-sialidases are important for neural,

glial and epithelial cell invasion through binding to the nerve growth factor receptors

[105,106], to prevent apoptosis during infection [107], and to trigger the appearance of

protective CD4+ and CD8

+ T cells [108]. It also enables the parasite to infect/attach cells

[101,109], and exit the parasitophorous vacuole [110]. Pereira and colleagues [104] using

trypomastigotes expressing trans-sialidases (TS+) and trypomastigotes that do not express

trans-sialidases (TS−) demonstrated that the TS

+ population was highly invasive, whereas

TS− was extremely inefficient to infect nonphagocytic cells.

TcTS is shed to the extracellular medium, including within the host cells [111], through

the action of an endogenous phospholipase C, and also with vesicles of the plasma

membrane [112]. The shed TcTS induces several hematological abnormalities and alters

the immune system [113], [114,115]. SAPA (Shed-Acute-Phase-Antigen) is a family of

three to six proteins of 160-200 kDa encoded by related genes which are mainly

expressed in the infective (trypomastigote) stage of the parasite [116]. The amino acid

sequence of SAPA as deduced from the DNA sequence showed that its C-terminal

portion contained a variable number of repeated units of 12 amino acids in length [117].

The SAPA N-terminal region contained two Ser-X-Asp-X-Gly-X-Thr-Trp motifs that are

conserved in bacterial and viral neuraminidases [118]. In addition, SAPA contained two

other of such motifs having three out of the five amino acids similar. These repetitive

motifs are readily detected by antibodies present in the sera from infected patients, thus

suggesting that they are major targets of the immune system.

The trans-sialidase displayed by the epimastigote (the parasite form present in the

reduviid vector) has a potential trans-membrane domain and is not released, even after

26

addition of exogenous phospholipase. But, the enzyme present in the trypomastigote (the

infective form of the parasite that circulates in the blood of the vertebrate host) is

anchored by a glycosylphosphatidylinositol (GPI) linkage to the T. cruzi surface and is

released into the environment [119].

TcTS genes are distributed in several families of which only one is composed by genes

encoding the active enzyme (TS) and its inactive isoform (iTS), which differs in only one

mutation (Tyr342His) [120]that completely abolishes its TS activity, but retains its

property to recognize terminal galactoses. The crystal structure of iTS has been

determined [121]. The 680 amino acids-amino terminal contains the catalytic activity.

The recombinant protein binds sialic acid and galactose in vitro and competes with a

neutralizing antibody to a discontinuous epitope of TS indicating that it is properly folded

[109].

Although TcTS has been known for several years, its structure has been solved and its

catalytic role been studied, our understanding of its trafficking is still limited. Many

biological roles have been attributed to TcTS in connection with Chagas disease; but due

to the lack of efficient inhibition, its direct effect on invasion had been difficult to study.

This dissertation delineates its traffic pathway and demonstrates the effect of TS on host

cell invasion (as addressed in Chapter 3).

27

REFERENCES

1. Hotez PJ, Dumonteil E, Heffernan MJ, Bottazzi ME (2013) Innovation for the 'bottom

100 million': eliminating neglected tropical diseases in the Americas. Adv Exp

Med Biol 764: 1-12.

2. Hotez PJ, Bottazzi ME, Franco-Paredes C, Ault SK, Periago MR (2008) The neglected

tropical diseases of Latin America and the Caribbean: a review of disease burden

and distribution and a roadmap for control and elimination. PLoS Negl Trop Dis

2: e300.

3. Gascon J, Bern C, Pinazo MJ (2010) Chagas disease in Spain, the United States and

other non-endemic countries. Acta Trop 115: 22-27.

4. Bern C, Kjos S, Yabsley MJ, Montgomery SP (2011) Trypanosoma cruzi and Chagas'

Disease in the United States. Clin Microbiol Rev 24: 655-681.

5. Rassi A, Jr., Rassi A, Marin-Neto JA (2010) Chagas disease. Lancet 375: 1388-1402.

6. Figarella K, Uzcategui NL, Zhou Y, LeFurgey A, Ouellette M, et al. (2007)

Biochemical characterization of Leishmania major aquaglyceroporin LmAQP1:

possible role in volume regulation and osmotaxis. Mol Microbiol 65: 1006-1017.

7. Linder JC, Staehelin LA (1979) A novel model for fluid secretion by the

trypanosomatid contractile vacuole apparatus. J Cell Biol 83: 371-382.

8. Baqui MM, De Moraes N, Milder RV, Pudles J (2000) A giant phosphoprotein

localized at the spongiome region of Crithidia luciliae thermophila. J Eukaryot

Microbiol 47: 532-537.

9. Allen RD, Naitoh Y (2002) Osmoregulation and contractile vacuoles of protozoa. Int

Rev Cytol 215: 351-394.

10. Docampo R, Jimenez V, Lander N, Li ZH, Niyogi S (2013) New insights into roles of

acidocalcisomes and contractile vacuole complex in osmoregulation in protists.

Int Rev Cell Mol Biol 305: 69-113.

28

11. Ulrich PN, Jimenez V, Park M, Martins VP, Atwood J, 3rd, et al. (2011)

Identification of contractile vacuole proteins in Trypanosoma cruzi. PLoS One 6:

e18013.

12. Montalvetti A, Rohloff P, Docampo R (2004) A functional aquaporin co-localizes

with the vacuolar proton pyrophosphatase to acidocalcisomes and the contractile

vacuole complex of Trypanosoma cruzi. The Journal of biological chemistry 279:

38673-38682.

13. Rohloff P, Montalvetti A, Docampo R (2004) Acidocalcisomes and the contractile

vacuole complex are involved in osmoregulation in Trypanosoma cruzi. The

Journal of biological chemistry 279: 52270-52281.



possible role in volume regulation and osmotaxis. Molecular microbiology 65:

1006-1017.

15. Clarke M, Kohler J, Arana Q, Liu T, Heuser J, et al. (2002) Dynamics of the vacuolar

H+-ATPase in the contractile vacuole complex and the endosomal pathway of

Dictyostelium cells. J Cell Sci 115: 2893-2905.

16. Heuser J, Zhu Q, Clarke M (1993) Proton pumps populate the contractile vacuoles of

Dictyostelium amoebae. J Cell Biol 121: 1311-1327.

17. Moniakis J, Coukell MB, Janiec A (1999) Involvement of the Ca2+

-ATPase PAT1

and the contractile vacuole in calcium regulation in Dictyostelium discoideum. J

Cell Sci 112 ( Pt 3): 405-414.

18. Sesaki H, Wong EF, Siu CH (1997) The cell adhesion molecule DdCAD-1 in

Dictyostelium is targeted to the cell surface by a nonclassical transport pathway

involving contractile vacuoles. The Journal of cell biology 138: 939-951.

19. Sriskanthadevan S, Lee T, Lin Z, Yang D, Siu CH (2009) Cell adhesion molecule

DdCAD-1 is imported into contractile vacuoles by membrane invagination in a

Ca2+

- and conformation-dependent manner. The Journal of biological chemistry

284: 36377-36386.

29

20. Niyogi S, Mucci J, Campetella O, Docampo R (2014) Rab11 regulates trafficking of

trans-sialidase to the plasma membrane through the contractile vacuole complex

of Trypanosoma cruzi. PLoS Pathog 10: e1004224.

21. Hasne MP, Coppens I, Soysa R, Ullman B (2010) A high-affinity putrescine-

cadaverine transporter from Trypanosoma cruzi. Molecular microbiology 76: 78-

91.

22. Macro L, Jaiswal JK, Simon SM (2012) Dynamics of clathrin-mediated endocytosis

and its requirement for organelle biogenesis in Dictyostelium. J Cell Sci 125:

5721-5732.

23. Docampo R (2011) Molecular parasitology in the 21st century. Essays Biochem 51:

1-13.

24. Docampo R, de Souza W, Miranda K, Rohloff P, Moreno SN (2005)

Acidocalcisomes - conserved from bacteria to man. Nat Rev Microbiol 3: 251-

261.

25. Rohloff P, Rodrigues CO, Docampo R (2003) Regulatory volume decrease in

Trypanosoma cruzi involves amino acid efflux and changes in intracellular

calcium. Mol Biochem Parasitol 126: 219-230.

26. Rao NN, Gomez-Garcia MR, Kornberg A (2009) Inorganic polyphosphate: essential

for growth and survival. Annu Rev Biochem 78: 605-647.


acidocalcisomes of Trypanosoma cruzi. Biochem J 310 ( Pt 3): 1005-1012.

28. Cuevas IC, Rohloff P, Sanchez DO, Docampo R (2005) Characterization of

farnesylated protein tyrosine phosphatase TcPRL-1 from Trypanosoma cruzi.

Eukaryot Cell 4: 1550-1561.

29. Scott DA, Docampo R, Dvorak JA, Shi S, Leapman RD (1997) In situ compositional

analysis of acidocalcisomes in Trypanosoma cruzi. J Biol Chem 272: 28020-

28029.

30. Ruiz FA, Marchesini N, Seufferheld M, Govindjee, Docampo R (2001) The

polyphosphate bodies of Chlamydomonas reinhardtii possess a proton-pumping

pyrophosphatase and are similar to acidocalcisomes. J Biol Chem 276: 46196-

46203.

30

31. Yagisawa F, Nishida K, Yoshida M, Ohnuma M, Shimada T, et al. (2009)

Identification of novel proteins in isolated polyphosphate vacuoles in the

primitive red alga Cyanidioschyzon merolae. Plant J 60: 882-893.

32. Besteiro S, Tonn D, Tetley L, Coombs GH, Mottram JC (2008) The AP3 adaptor is

involved in the transport of membrane proteins to acidocalcisomes of Leishmania.

Journal of cell science 121: 561-570.

33. Huang G, Fang J, Sant'Anna C, Li ZH, Wellems DL, et al. (2011) Adaptor protein-3

(AP-3) complex mediates the biogenesis of acidocalcisomes and is essential for

growth and virulence of Trypanosoma brucei. The Journal of biological chemistry

286: 36619-36630.

34. Smith SA, Mutch NJ, Baskar D, Rohloff P, Docampo R, et al. (2006) Polyphosphate

modulates blood coagulation and fibrinolysis. Proceedings of the National

Academy of Sciences of the United States of America 103: 903-908.

35. Muller F, Mutch NJ, Schenk WA, Smith SA, Esterl L, et al. (2009) Platelet

polyphosphates are proinflammatory and procoagulant mediators in vivo. Cell

139: 1143-1156.

36. Docampo R, Moreno SN (2011) Acidocalcisomes. Cell calcium 50: 113-119.

37. Huang G, Bartlett, P.D., Thomas, A.P., Moreno, S.N.J., Docampo, R. (2013)

Acidocalcisomes of Trypanosoma brucei have an inositol 1,4,5-trisphosphate

receptor that is required for growth and infectivity. Proc Natl Acad Sci USA in

press.

38. Li ZH, Alvarez VE, De Gaudenzi JG, Sant'Anna C, Frasch AC, et al. (2011)

Hyperosmotic stress induces aquaporin-dependent cell shrinkage, polyphosphate

synthesis, amino acid accumulation, and global gene expression changes in

Trypanosoma cruzi. The Journal of biological chemistry 286: 43959-43971.

39. LeFurgey A, Ingram P, Blum JJ (2001) Compartmental responses to acute osmotic

stress in Leishmania major result in rapid loss of Na+ and Cl. Comparative

biochemistry and physiology Part A, Molecular & integrative physiology 128:

385-394.

31

40. Engstler M, Thilo L, Weise F, Grunfelder CG, Schwarz H, et al. (2004) Kinetics of

endocytosis and recycling of the GPI-anchored variant surface glycoprotein in

Trypanosoma brucei. J Cell Sci 117: 1105-1115.

41. Bangs JD, Andrews NW, Hart GW, Englund PT (1986) Posttranslational

modification and intracellular transport of a trypanosome variant surface

glycoprotein. J Cell Biol 103: 255-263.

42. Hughes H, Stephens DJ (2008) Assembly, organization, and function of the COPII

coat. Histochem Cell Biol 129: 129-151.

43. Ackers JP, Dhir V, Field MC (2005) A bioinformatic analysis of the RAB genes of

Trypanosoma brucei. Mol Biochem Parasitol 141: 89-97.

44. Allen CL, Goulding D, Field MC (2003) Clathrin-mediated endocytosis is essential in

Trypanosoma brucei. Embo j 22: 4991-5002.

45. Soares MJ, de Souza W (1991) Endocytosis of gold-labeled proteins and LDL by

Trypanosoma cruzi. Parasitol Res 77: 461-468.

46. Rocha GM, Seabra SH, de Miranda KR, Cunha-e-Silva N, de Carvalho TM, et al.

(2010) Attachment of flagellum to the cell body is important to the kinetics of

transferrin uptake by Trypanosoma cruzi. Parasitol Int 59: 629-633.

47. Souza W (2009) Structural organization of Trypanosoma cruzi. Mem Inst Oswaldo

Cruz 104 Suppl 1: 89-100.

48. Eger I, Soares MJ (2012) Endocytosis in Trypanosoma cruzi (Euglenozoa:

Kinetoplastea) epimastigotes: visualization of ingested transferrin-gold

nanoparticle complexes by confocal laser microscopy. J Microbiol Methods 91:

101-105.

49. Soares MJ, Souto-Padron T, De Souza W (1992) Identification of a large pre-

lysosomal compartment in the pathogenic protozoon Trypanosoma cruzi. J Cell

Sci 102 ( Pt 1): 157-167.

50. Peter F, Nuoffer C, Pind SN, Balch WE (1994) Guanine nucleotide dissociation

inhibitor is essential for Rab1 function in budding from the endoplasmic

reticulum and transport through the Golgi stack. J Cell Biol 126: 1393-1406.

51. Pfeffer S, Aivazian D (2004) Targeting Rab GTPases to distinct membrane

compartments. Nat Rev Mol Cell Biol 5: 886-896.

32

52. Stenmark H (2009) Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell

Biol 10: 513-525.

53. Merithew E, Hatherly S, Dumas JJ, Lawe DC, Heller-Harrison R, et al. (2001)

Structural plasticity of an invariant hydrophobic triad in the switch regions of Rab

GTPases is a determinant of effector recognition. J Biol Chem 276: 13982-13988.

54. Dumas JJ, Zhu Z, Connolly JL, Lambright DG (1999) Structural basis of activation

and GTP hydrolysis in Rab proteins. Structure 7: 413-423.

55. Ramos FP, Araripe JR, Urmenyi TP, Silva R, Cunha e Silva NL, et al. (2005)

Characterization of RAB-like4, the first identified RAB-like protein from

Trypanosoma cruzi with GTPase activity. Biochem Biophys Res Commun 333:

808-817.

56. Araripe JR, Ramos FP, Cunha e Silva NL, Urmenyi TP, Silva R, et al. (2005)

Characterization of a RAB5 homologue in Trypanosoma cruzi. Biochem Biophys

Res Commun 329: 638-645.

57. Araripe JR, Cunha e Silva NL, Leal ST, de Souza W, Rondinelli E (2004)

Trypanosoma cruzi: TcRAB7 protein is localized at the Golgi apparatus in

epimastigotes. Biochem Biophys Res Commun 321: 397-402.

58. Fukuda M (2010) How can mammalian Rab small GTPases be comprehensively

analyzed?: Development of new tools to comprehensively analyze mammalian

Rabs in membrane traffic. Histol Histopathol 25: 1473-1480.

59. Cuif MH, Possmayer F, Zander H, Bordes N, Jollivet F, et al. (1999) Characterization

of GAPCenA, a GTPase activating protein for Rab6, part of which associates with

the centrosome. Embo j 18: 1772-1782.

60. Feig LA (1999) Tools of the trade: use of dominant-inhibitory mutants of Ras-family

GTPases. Nat Cell Biol 1: E25-27.

61. Chen SY, Huff SY, Lai CC, Der CJ, Powers S (1994) Ras-15A protein shares highly

similar dominant-negative biological properties with Ras-17N and forms a stable,

guanine-nucleotide resistant complex with CDC25 exchange factor. Oncogene 9:

2691-2698.

33

62. Wasmeier C, Romao M, Plowright L, Bennett DC, Raposo G, et al. (2006) Rab38 and

Rab32 control post-Golgi trafficking of melanogenic enzymes. J Cell Biol 175:

271-281.

63. Park M, Serpinskaya AS, Papalopulu N, Gelfand VI (2007) Rab32 regulates

melanosome transport in Xenopus melanophores by protein kinase a recruitment.

Curr Biol 17: 2030-2034.

64. Seto S, Tsujimura K, Koide Y (2011) Rab GTPases regulating phagosome maturation

are differentially recruited to mycobacterial phagosomes. Traffic 12: 407-420.

65. Hirota Y, Tanaka Y (2009) A small GTPase, human Rab32, is required for the

formation of autophagic vacuoles under basal conditions. Cell Mol Life Sci 66:

2913-2932.

66. Alto NM, Soderling J, Scott JD (2002) Rab32 is an A-kinase anchoring protein and

participates in mitochondrial dynamics. J Cell Biol 158: 659-668.

67. Moreno SN, Docampo R (2009) The role of acidocalcisomes in parasitic protists. J

Eukaryot Microbiol 56: 208-213.

68. Bao X, Faris AE, Jang EK, Haslam RJ (2002) Molecular cloning, bacterial expression

and properties of Rab31 and Rab32. Eur J Biochem 269: 259-271.

69. Urbe S, Huber LA, Zerial M, Tooze SA, Parton RG (1993) Rab11, a small GTPase

associated with both constitutive and regulated secretory pathways in PC12 cells.

FEBS Lett 334: 175-182.

70. Hobdy-Henderson KC, Hales CM, Lapierre LA, Cheney RE, Goldenring JR (2003)

Dynamics of the apical plasma membrane recycling system during cell division.

Traffic 4: 681-693.

71. Knodler A, Feng S, Zhang J, Zhang X, Das A, et al. (2010) Coordination of Rab8 and

Rab11 in primary ciliogenesis. Proc Natl Acad Sci U S A 107: 6346-6351.

72. Shirane M, Nakayama KI (2006) Protrudin induces neurite formation by directional

membrane trafficking. Science 314: 818-821.

73. Schuh M (2011) An actin-dependent mechanism for long-range vesicle transport. Nat

Cell Biol 13: 1431-1436.

34

74. Jeffries TR, Morgan GW, Field MC (2001) A developmentally regulated rab11

homologue in Trypanosoma brucei is involved in recycling processes. J Cell Sci

114: 2617-2626.

75. Pal A, Hall BS, Jeffries TR, Field MC (2003) Rab5 and Rab11 mediate transferrin

and anti-variant surface glycoprotein antibody recycling in Trypanosoma brucei.

Biochem J 374: 443-451.

76. Grunfelder CG, Engstler M, Weise F, Schwarz H, Stierhof YD, et al. (2003)

Endocytosis of a glycosylphosphatidylinositol-anchored protein via clathrin-

coated vesicles, sorting by default in endosomes, and exocytosis via RAB11-

positive carriers. Mol Biol Cell 14: 2029-2040.

77. Hall BS, Smith E, Langer W, Jacobs LA, Goulding D, et al. (2005) Developmental

variation in Rab11-dependent trafficking in Trypanosoma brucei. Eukaryot Cell

4: 971-980.

78. Harris E, Yoshida K, Cardelli J, Bush J (2001) Rab11-like GTPase associates with

and regulates the structure and function of the contractile vacuole system in

Dictyostelium. J Cell Sci 114: 3035-3045.

79. Gelb MH (1997) Protein prenylation, et cetera: signal transduction in two dimensions.

Science 275: 1750-1751.

80. Glomset JA, Farnsworth CC (1994) Role of protein modification reactions in

programming interactions between ras-related GTPases and cell membranes.

Annu Rev Cell Biol 10: 181-205.

81. Nepomuceno-Silva JL, Yokoyama K, de Mello LD, Mendonca SM, Paixao JC, et al.

(2001) TcRho1, a farnesylated Rho family homologue from Trypanosoma cruzi:

cloning, trans-splicing, and prenylation studies. J Biol Chem 276: 29711-29718.

82. Raikkonen J, Taskinen M, Dunford JE, Monkkonen H, Auriola S, et al. (2011)

Correlation between time-dependent inhibition of human farnesyl pyrophosphate

synthase and blockade of mevalonate pathway by nitrogen-containing

bisphosphonates in cultured cells. Biochem Biophys Res Commun 407: 663-667.

83. de Souza W, de Carvalho TM, Barrias ES (2010) Review on Trypanosoma cruzi:

Host Cell Interaction. Int J Cell Biol 2010.

35

84. Ming M, Ewen ME, Pereira ME (1995) Trypanosome invasion of mammalian cells

requires activation of the TGF beta signaling pathway. Cell 82: 287-296.

85. Barbosa HS, de Meirelles Mde N (1992) Ultrastructural detection in vitro of WGA-,

RCA I-, and Con A-binding sites involved in the invasion of heart muscle cells by

Trypanosoma cruzi. Parasitol Res 78: 404-409.

86. Ciavaglia Mdo C, de Carvalho TU, de Souza W (1993) Interaction of Trypanosoma

cruzi with cells with altered glycosylation patterns. Biochem Biophys Res

Commun 193: 718-721.

87. Hall BS, Pereira MA (2000) Dual role for transforming growth factor beta-dependent

signaling in Trypanosoma cruzi infection of mammalian cells. Infect Immun 68:

2077-2081.

88. McConville MJ, Ferguson MA (1993) The structure, biosynthesis and function of

glycosylated phosphatidylinositols in the parasitic protozoa and higher

eukaryotes. Biochem J 294 ( Pt 2): 305-324.

89. Ferguson MA (1999) The structure, biosynthesis and functions of

glycosylphosphatidylinositol anchors, and the contributions of trypanosome

research. J Cell Sci 112 ( Pt 17): 2799-2809.

90. Guha-Niyogi A, Sullivan DR, Turco SJ (2001) Glycoconjugate structures of parasitic

protozoa. Glycobiology 11: 45r-59r.

91. Fujita M, Kinoshita T (2012) GPI-anchor remodeling: potential functions of GPI-

anchors in intracellular trafficking and membrane dynamics. Biochim Biophys

Acta 1821: 1050-1058.

92. Lemmon SK, Traub LM (2000) Sorting in the endosomal system in yeast and animal

cells. Curr Opin Cell Biol 12: 457-466.

93. Bangs JD (1998) Surface coats and secretory trafficking in African trypanosomes.

Curr Opin Microbiol 1: 448-454.


Accumulation of a GPI-anchored protein at the cell surface requires sorting at

multiple intracellular levels. Traffic 3: 547-559.

95. Di Noia JM, Buscaglia CA, De Marchi CR, Almeida IC, Frasch AC (2002) A

Trypanosoma cruzi small surface molecule provides the first immunological

36

evidence that Chagas' disease is due to a single parasite lineage. J Exp Med 195:

401-413.



Science 309: 409-415.

97. Freitas LM, dos Santos SL, Rodrigues-Luiz GF, Mendes TA, Rodrigues TS, et al.

(2011) Genomic analyses, gene expression and antigenic profile of the trans-

sialidase superfamily of Trypanosoma cruzi reveal an undetected level of

complexity. PLoS One 6: e25914.

98. Giorgi ME, de Lederkremer RM (2011) Trans-sialidase and mucins of Trypanosoma

cruzi: an important interplay for the parasite. Carbohydr Res 346: 1389-1393.

99. Previato JO, Andrade AF, Pessolani MC, Mendonca-Previato L (1985) Incorporation

of sialic acid into Trypanosoma cruzi macromolecules. A proposal for a new

metabolic route. Mol Biochem Parasitol 16: 85-96.

100. Zingales B, Carniol C, de Lederkremer RM, Colli W (1987) Direct sialic acid

transfer from a protein donor to glycolipids of trypomastigote forms of

Trypanosoma cruzi. Mol Biochem Parasitol 26: 135-144.

101. Schenkman S, Jiang MS, Hart GW, Nussenzweig V (1991) A novel cell surface

trans-sialidase of Trypanosoma cruzi generates a stage-specific epitope required

for invasion of mammalian cells. Cell 65: 1117-1125.

102. Tomlinson S, Pontes de Carvalho LC, Vandekerckhove F, Nussenzweig V (1994)

Role of sialic acid in the resistance of Trypanosoma cruzi trypomastigotes to

complement. J Immunol 153: 3141-3147.

103. Buscaglia CA, Campo VA, Frasch AC, Di Noia JM (2006) Trypanosoma cruzi

surface mucins: host-dependent coat diversity. Nat Rev Microbiol 4: 229-236.

104. Pereira-Chioccola VL, Acosta-Serrano A, Correia de Almeida I, Ferguson MA,

Souto-Padron T, et al. (2000) Mucin-like molecules form a negatively charged

coat that protects Trypanosoma cruzi trypomastigotes from killing by human anti-

alpha-galactosyl antibodies. J Cell Sci 113 ( Pt 7): 1299-1307.

37

105. de Melo-Jorge M, PereiraPerrin M (2007) The Chagas' disease parasite

Trypanosoma cruzi exploits nerve growth factor receptor TrkA to infect

mammalian hosts. Cell Host Microbe 1: 251-261.

106. Weinkauf C, Salvador R, Pereiraperrin M (2011) Neurotrophin receptor TrkC is an

entry receptor for Trypanosoma cruzi in neural, glial, and epithelial cells. Infect

Immun 79: 4081-4087.

107. Chuenkova MV, PereiraPerrin M (2009) Trypanosoma cruzi targets Akt in host cells

as an intracellular antiapoptotic strategy. Sci Signal 2: ra74.

108. Risso MG, Pitcovsky TA, Caccuri RL, Campetella O, Leguizamon MS (2007)

Immune system pathogenesis is prevented by the neutralization of the systemic

trans-sialidase from Trypanosoma cruzi during severe infections. Parasitology

134: 503-510.

109. Buschiazzo A, Muia R, Larrieux N, Pitcovsky T, Mucci J, et al. (2012)

Trypanosoma cruzi trans-sialidase in complex with a neutralizing antibody:

structure/function studies towards the rational design of inhibitors. PLoS Pathog

8: e1002474.

110. Rubin-de-Celis SS, Uemura H, Yoshida N, Schenkman S (2006) Expression of

trypomastigote trans-sialidase in metacyclic forms of Trypanosoma cruzi

increases parasite escape from its parasitophorous vacuole. Cell Microbiol 8:

1888-1898.

111. Frevert U, Schenkman S, Nussenzweig V (1992) Stage-specific expression and

intracellular shedding of the cell surface trans-sialidase of Trypanosoma cruzi.

Infect Immun 60: 2349-2360.

112. Bayer-Santos E, Aguilar-Bonavides C, Rodrigues SP, Cordero EM, Marques AF, et

al. (2013) Proteomic analysis of Trypanosoma cruzi secretome: characterization

of two populations of extracellular vesicles and soluble proteins. J Proteome Res

12: 883-897.

113. Mucci J, Hidalgo A, Mocetti E, Argibay PF, Leguizamon MS, et al. (2002)

Thymocyte depletion in Trypanosoma cruzi infection is mediated by trans-

sialidase-induced apoptosis on nurse cells complex. Proc Natl Acad Sci U S A 99:

3896-3901.

38

114. Tribulatti MV, Mucci J, Van Rooijen N, Leguizamon MS, Campetella O (2005) The

trans-sialidase from Trypanosoma cruzi induces thrombocytopenia during acute

Chagas' disease by reducing the platelet sialic acid contents. Infect Immun 73:

201-207.

115. Freire-de-Lima L, Alisson-Silva F, Carvalho ST, Takiya CM, Rodrigues MM, et al.

(2010) Trypanosoma cruzi subverts host cell sialylation and may compromise

antigen-specific CD8+ T cell responses. J Biol Chem 285: 13388-13396.

116. Macina RA, Affranchino JL, Pollevick GD, Jazin EE, Frasch AC (1989) Variable

number of repeat units in genes encoding Trypanosoma cruzi antigens. FEBS Lett

257: 365-368.

117. Pollevick GD, Affranchino JL, Frasch AC, Sanchez DO (1991) The complete

sequence of a shed acute-phase antigen of Trypanosoma cruzi. Mol Biochem

Parasitol 47: 247-250.

118. Roggentin P, Rothe B, Kaper JB, Galen J, Lawrisuk L, et al. (1989) Conserved

sequences in bacterial and viral sialidases. Glycoconj J 6: 349-353.

119. Agusti R, Couto AS, Campetella OE, Frasch AC, de Lederkremer RM (1997) The

trans-sialidase of Trypanosoma cruzi is anchored by two different lipids.

Glycobiology 7: 731-735.

120. Cremona ML, Campetella O, Sanchez DO, Frasch AC (1999) Enzymically inactive

members of the trans-sialidase family from Trypanosoma cruzi display beta-

galactose binding activity. Glycobiology 9: 581-587.

121. Oppezzo P, Obal G, Baraibar MA, Pritsch O, Alzari PM, et al. (2011) Crystal

structure of an enzymatically inactive trans-sialidase-like lectin from

Trypanosoma cruzi: the carbohydrate binding mechanism involves residual

sialidase activity. Biochim Biophys Acta 1814: 1154-1161.

39

FIGURES

Figure 2.1. Life cycle of T. cruzi. The insect vector becomes infected after taking a

parasite-containing blood meal from an infected human or animal. Two main forms are

present in the insect vector: epimastigotes undergo morphological and physiological

transformation in the midgut and differentiate into infective metacyclic trypomastigotes

in the hindgut of the insect; the parasite is transmitted to humans by infected blood

sucking insects which deposit trypomastigotes in their feces during feeding and two main

forms in the vertebrate host are: intracellular amastigotes and bloodstream

trypomastigotes. (Figure published in Docampo R. et al, 2013).

40

Figure 2.2 The CVC in T. cruzi epimastigotes. (A) Thin section of chemically fixed

epimastigote showing the CVC. Collapsed aspect of the spongiome is denoted by arrows.

(B) Thin section of a high pressure freeze substituted epimastigote showing the CV and

the interconnected tubules (arrows) that form the spongiome (Sp). (C) Virtual section

showing the CV docked to the flagellar pocket (FP) and the electron-dense region

between both structures (arrow and inset). (D) Virtual section and 3D model of the CVC

and flagellar pocket (FP) where a deformation in the FP was observed (black arrows) and

a tubule of the spongiome was connected to the central vacuole (white arrow). Scale

bars¼200 nm. (Figure published in Docampo R. et al, 2013)

41

Figure 2.3. Diagramatic representation of the enzymes and transporters tentatively

identified in the acidocalcisome of T. cruzi (Diagram from Docampo et al. 2011)

42

Figure 2.4. The GTP-GDP cycle of Rab-GTPases. The GDP-bound (Constitutive

Negative; CN), inactivated form of Rab is activated by specific GEF. The wild type form

(WT) which cycles between GDP and GTP-bound form of Rab is recruited to a specific

type of organelle/vesicle. WT promotes the transport of the organelle/vesicle by

interacting with specific effector molecules. The GTP bound (Constitutive Active; CA)

form is inactivated by GAP. (Diagram from Peter F. et al. 1994)

43

Figure 2.5. Schematic model summarizing the molecules involved on parasite-host

cell interaction process exposed on the surface of a host cell and in trypomastigotes

of T. cruzi. The recognition between parasite and mammalian host cell involves cross-

talk between numerous molecules present on the surface of both cell types; which is

instrumental for adhesion to precede before invasion. Out of the surface proteins present

in the cell surface of the trypomastigotes, we show results with trans-sialidase, Mucin,

GP35/50 in Chapter 3. (Diagram from de Souza et al. 2010).

44

Figure 2.6. Model of T. cruzi invasion. This diagram illustrates lysosome dependent, or

actin dependent or lysosome-independent invasion pathway (Diagram from de Souza et

al. 2010).

45

CHAPTER 3

RAB11 REGULATES TRAFFICKING OF TRANS-SIALIDASE TO THE

PLASMA MEMBRANE THROUGH THE CONTRACTILE VACUOLE

COMPLEX OF TRYPANOSOMA CRUZI

Sayantanee Niyogi, Juan Mucci, Oscar Campetella, Roberto Docampo. 2014.

PLOS Pathogens. June 26. 10(6): e1004224. doi:10.1371/journal.ppat.1004224.

Reprinted here with permission of publisher.

46

Abstract

Trypanosoma cruzi is the etiologic agent of Chagas disease. Although this is not a free-

living organism it has conserved a contractile vacuole complex (CVC) to regulate its

osmolarity. This obligate intracellular pathogen is, in addition, dependent on surface

proteins to invade its hosts. Here we used a combination of genetic and biochemical

approaches to delineate the contribution of the CVC to the traffic of

glycosylphosphatidylinositol (GPI)-anchored proteins to the plasma membrane of the

parasite and promote host invasion. While T. cruzi Rab11 (TcRab11) localized to the

CVC, a dominant negative (DN) mutant tagged with GFP (GFP-TcRab11DN) localized

to the cytosol, and epimastigotes expressing this mutant were less responsive to

hyposmotic and hyperosmotic stress. Mutant parasites were still able to differentiate into

metacyclic forms and infect host cells. GPI-anchored trans-sialidase (TcTS), mucins of

the 60-200 KDa family, and trypomastigote small surface antigen (TcTSSA II) co-

localized with GFP-TcRab11 to the CVC during transformation of intracellular

amastigotes into trypomastigotes. Mucins of the gp35/50 family also co-localized with

the CVC during metacyclogenesis. Parasites expressing GFP-TcRab11DN prevented

TcTS, but not other membrane proteins, from reaching the plasma membrane, and were

less infective as compared to wild type cells. Incubation of these mutants in the presence

of exogenous recombinant active, but not inactive, TcTS, and a sialic acid donor, before

infecting host cells, partially rescued infectivity of trypomastigotes. Taking together these

results reveal roles of TcRab11 in osmoregulation and trafficking of trans-sialidase to the

plasma membrane, the role of trans-sialidase in promoting infection, and a novel

unconventional mechanism of GPI-anchored protein secretion.

47

Author Summary

Several free-living protozoa possess a contractile vacuole complex (CVC) that protects

them from the hyposmotic environments where they live. Interestingly, the intracellular

parasite Trypanosoma cruzi, the etiologic agent of Chagas disease, has conserved a CVC

in all its developmental stages, where it has an osmoregulatory role under both

hyposmotic and hyperosmotic conditions. We found here that the CVC of T. cruzi has an

additional unconventional role in traffic of glycosylphosphatidylinositol (GPI)-anchored

proteins to the plasma membrane of the parasite. A combination of genetic and

biochemical approaches revealed the role of TcRab11, a protein localized to the CVC, in

traffic of trans-sialidase (TcTS), a GPI-anchored protein important for host cell invasion,

but not of other GPI-anchored proteins or integral membrane proteins, to the plasma

membrane. Demonstration of the role of TcTS in infection has been previously difficult

given the large number of genes encoding for this protein distributed through the genome

of the parasite. However, by constructing dominant negative TcRab11 we were able to

prevent traffic of TcTS to the plasma membrane and demonstrate its role in host invasion.

Introduction

The contractile vacuole complex (CVC) is an intracellular compartment with an

osmoregulatory role in different protists. This compartment has a bipartite structure,

consisting of a central vacuole or bladder and a surrounding loose network of tubules and

vesicles named the spongiome [1,2]. The CVC accumulates water through an aquaporin

[3-7] and expels it out of the cell through pores in the plasma membrane [1,2].

Trypanosoma cruzi, the etiologic agent of Chagas disease or American trypanosomiasis,

possesses a CVC [4,8,9] that is important for regulatory volume decrease (RVD) after

48

hyposmotic stress [4], as well as for shrinking of the cells when submitted to

hyperosmotic stress [10].

Besides its osmoregulatory role, the CVC of some protists is an acidic calcium store [11]

and has roles in calcium ion (Ca2+

) sequestration and excretion pathways [12-16], as well

as in transfer of some proteins to the plasma membrane [12,17,18]. Although it has been

indicated that there is no much mixing or “scrambling” of contractile vacuoles and

plasma membranes [19], transfer of membrane proteins from the CVC to the plasma

membrane has been observed. In Dictyostelium discoideum, the vacuolar proton ATPase

(V-H+-ATPase) and calmodulin (CaM) move to the plasma membrane when cells are

starved during stationary phase [17], and the Ca2+

-ATPase PAT1 moves to the plasma

membrane when cells are incubated at high Ca2+

concentrations [12]. Some luminal

proteins, such as the adhesins DdCAD-1 and discoidin-1 can also be targeted to the cell

surface via the CVC in D. discoideum [18,20]. In T. cruzi epimastigotes, the polyamine

transporter TcPOT1.1, which localizes to CVC-like structures, has also been reported to

appear in the plasma membrane when the culture medium is deficient in polyamines [21].

It is interesting to note that dajumin-GFP is trafficked to the CVC of D. discoideum via

the plasma membrane and is internalized by a clathrin-dependent mechanism, suggesting

that clathrin-mediated endocytosis may function as a back-up mechanism in case of

transfer of proteins from the CVC to the plasma membrane [22].

It is remarkable that Rab11, a GTPase that localizes in recycling endosomes in most cells

[23], including Trypanosoma brucei [24], localizes to the CVC of D. discoideum [25] and

T. cruzi [26], suggesting that it might have some function in trafficking of proteins from

the CVC to the plasma membrane, as recycling endosomes have. It was proposed [25]

49

that the CVC could be an evolutionary precursor to the recycling endosomal system in

other eukaryotes.

In T. brucei, Rab11 mediates the transfer of the glycosylphosphatidylinositol (GPI)-

anchored proteins transferrin [27] and variant surface glycoprotein (VSG) [28] to the

plasma membrane. T. cruzi is also rich in GPI-anchored proteins, among them the trans-

sialidase (TS)-like superfamily, which includes 1,430 gene members [29,30], and the

mucins, encoded by 500 to 700 genes distributed into three groups of which group III is

conformed by a single-copy gene named the trypomastigote small surface antigen (TSSA)

[31]. TcTS genes are actually distributed in several families of which only one is

composed by genes encoding the active enzyme (TS) and its inactive isoform (iTS),

which differs in only one mutation (Tyr342His) [32]. TcTS is crucial in the life cycle of

the parasite because it allows the acquisition of sialyl residues from the host

glycoconjugates preventing their lysis by the alternative complement pathway [33,34],

and opsonization followed by killing by natural antibodies [35]. It also enables the

parasite to infect/attach cells [36,37], and exit the parasitophorous vacuole [38]. The shed

TcTS induces several hematological abnormalities and alters the immune system [39-41].

Two major TcTSSA isoforms were originally recognized: TcTSSA I, present in TcI

parasite stocks, which are linked to the sylvatic cycle of the parasite, and TcTSSA II,

present in TcVI (previously TcIIe) isolates, which are linked to the more virulent strains

[31]. Since TcTSSA II is highly immunogenic it has been proposed as an immunological

marker for the most virulent T. cruzi types [31], and as an adhesin, engaging surface

receptor(s) and inducing signaling pathways in the host cell as a prerequisite for parasite

internalization [42]. Another group of GPI-anchored surface proteins is that formed by

50

the mucin family of 60-200 KDa proteins bearing several oligosaccharide chains and

present in tissue culture-derived trypomastigotes [43]. These T. cruzi O-linked

oligosaccharide-containing proteins are highly immunogenic under the conditions of

natural infection and are the targets for lytic anti-Gal antibodies [43-45]. Gp35/50 mucins

are also GPI-anchored glycoproteins rich in threonine and expressed in epimastigotes and

metacyclic forms of all T. cruzi isolates examined to date and are encoded by a large

multigene family [46]. Gp35/50 mucins are recognized by monoclonal antibodies 10D8

and 2B10 [47], which react with galactofuranose- and galactopyranose-containing

epitopes, respectively.

GPI-anchored proteins are usually transported from the endoplasmic reticulum (ER) to

the plasma membrane through the Golgi apparatus, where lipid raft-like structures form

[48]. In this work we demonstrate that TcTS, TcTSSA II, and other mucins are

transported to the plasma membrane of T. cruzi trypomastigotes through the CVC, which

also possesses lipid-raft like structures, and that expression of dominant-interfering

TcRab11 mutants altered their morphology, osmoregulation, traffic of TcTS to the

plasma membrane, and parasite infectivity. The results suggest the presence of a novel

unconventional mechanism of GPI-anchored protein transport to the cell surface of

eukaryotic cells.

Results

Localization of TcRab11 in different T. cruzi stages

In previous work we reported the N-terminal tagging of T. cruzi Rab11

(TcCLB.511407.60; TcRab11) with the green fluorescent protein (GFP) gene, and the

localization of GFP-TcRab11 to the bladder of the CVC of epimastigotes of T. cruzi [26].

51

Tagging with GFP was confirmed by western blot analysis [26]. Fig. 3.1A-C shows now

that GFP-TcRab11 localizes to the bladder of the CVC of epimastigotes, trypomastigotes,

and amastigotes. Fig. 3.1D shows the co-localization of GFP-TcRab11 with T. cruzi

aquaporin 1 (TcAQP1), a marker for the CVC [3,4]. These experiments were done after

submitting the cells to hyposmotic conditions, which increases the localization of

TcAQP1 to the CVC [4]. To confirm that the above results were not an artifact of protein

overexpression and/or mistargeting we also used affinity-purified antibodies against

TbRab11 [24] (Fig. 3.1E and 3.1F). This antibody was shown to predominantly react

with a protein of 24 kDa in all T. cruzi stages, as expected for TcRab11 (Fig. 3.1G).

TcRab11 is apparently less expressed in epimastigotes. Fig. 3.11 confirms the CVC

localization of GFP-TcRab11 in epimastigotes submitted to hyposmotic stress by cryo-

immunogold electron microscopy.

Localization of GFP-TcRab11DN mutant

Knockdown of Rabs by RNA interference (RNAi) is one of the preferred approaches to

investigate the function of specific Rab isoforms in membrane traffic [49]. Unfortunately,

T. cruzi lacks an RNAi system [50]. To perform a functional analysis of TcRab11, we

therefore developed an expression plasmid encoding a TcRab11 mutant that mimics the

GDP-bound form (dominant negative). An N-terminal GFP epitope tag was fused to the

T. cruzi point mutant TcRab11:S21N. TcRab11:S21N is predicted to bind GDP, based

upon homology to known Ras-related protein mutations [51]. In transfected T. cruzi

epimastigotes, GFP-TcRab11DN had a punctated cytosolic localization (Fig. 3.2A). This

localization was maintained when epimastigotes were differentiated into trypomastigotes

(Fig. 3.2B) and intracellular amastigotes (Fig. 3.2C). This localization is because the

52

dominant negative TcRab11 (GDP-bound) gets locked in an intermediate cytosolic

location. After membrane delivery by the GDP dissociation inhibitor (GDI), Rab proteins

interconvert between inactive, GDP-bound forms and active, GTP-bound forms [52]. The

growth rate of the mutant epimastigotes was not affected (Fig. 3.12A). We confirmed

tagging of the mutant by western blot analysis (Fig. S2B). Together these results suggest

that TcRab11 is localized to the membrane of the CVC in a GTP-dependent manner.

Densitometry analysis indicated that GFP-TcRab11 expression increased 5.2 fold

compared to that in wild type epimastigotes (Fig 3.12C). We also investigated whether

the dominant negative mutation of TcRab11 disrupted the structure and assembly of the

CVC. We did immunofluorescence studies on GFP-TcRab11DN mutant epimastigotes

using an antibody against T. cruzi aquaporin 1, a CVC marker [4]. The same aquaporin

distribution was observed in epimastigotes expressing the control GFP-TcRab11 (Fig.

3.13A) and the mutant GFP-TcRab11DN (Fig. 3.13B). The CVC can be identified in Fig.

3.13A and 3.13B because of its curvature and its location close to the kinetoplast. There

was a greater concentration of TcAQP1 in the CVC with some punctate labeling

corresponding to acidocalcisomes [4] (Fig. 3.13).

Cellular response to hyposmotic and hyperosmotic stresses

To examine the role of T. cruzi Rab11 in osmoregulation, wild-type, GFP-TcRab11-

overexpressing (GFP-TcRab11OE), and GFP-TcRab11DN-expressing epimastigotes

were submitted to hyposmotic stress and their regulatory volume decrease (RVD)

measured using the light-scattering technique, as described previously [53]. This

technique measures the changes in volume of the cells under hyposmotic (swelling and

recovery) and hyperosmotic conditions (shrinking and partial recovery). After recovery

53

the cells recuperate their normal morphology. DN mutants were less able to recover their

volume after hyposmotic stress than wild type cells, while recovery was faster in GFP-

TcRab11OE cells (OE, Fig. 3.3A). In addition, when submitted to hyperosmotic stress,

DN mutants shrank less while GFP-TcRab11OE cells shrank more than control cells

(Fig. 3.3B), and in all cases they did not recover their volume during the time of the

experiment. It has been shown previously that when epimastigotes are submitted to

hyperosmotic stress the parasites do not regain their normal volume at least during the

following two hours [10]. GFP-TcRab11OE epimastigotes were also studied under

hyposmotic and hyperosmotic stress conditions by video fluorescence microscopy.

Epimastigotes were immobilized on glass slides with poly-L-Lysine and bathed in

hyposmotic/hyperosmotic buffer. Video microscopy data were collected (Figs. 3.3C and

3.3D show selected frames), which revealed changes in the morphology of the CVC

when epimastigotes were treated under both hyposmotic (Fig. 3.3C) and hyperosmotic

(Fig. 3.3D) conditions. The single fluorescent spot corresponding to the CVC could be

seen enlarging and fusing with other vacuoles probably resulting from enlarged tubular

structures of the spongiome. Altogether, these results confirm the active participation of

the CVC on the cellular response to both hyposmotic and hyperosmotic stresses [10], and

indicate that alteration of TcRab11 function leads to disruption of osmoregulatory

processes.

Trans-sialidase co-localizes with GFP-TcRab11 during differentiation of amastigotes

into trypomastigotes

As Rab11 mediates the recycling of GPI-anchored proteins of T. brucei [27,28] we

investigated whether TcRab11 affected the traffic of GPI-anchored proteins in T. cruzi.

54

Trans-sialidase is an abundant GPI-anchored protein present in the cell surface of

trypomastigotes [54,55], where it catalyzes the transfer of sialic acid from host proteins to

parasite mucins [56].

To investigate the possibility that TcRab11 mediates the traffic of TcTS to the plasma

membrane, we infected L6E9 myoblasts with metacyclic trypomastigotes from stationary

cultures of GFP-TcRab11OE parasites and obtained cell culture-derived trypomastigotes.

GFP-TcRab11OE trypomastigotes were used to infect fibroblasts and labeling of TcTS

was detected by indirect immunofluorescence analysis using antibodies against the SAPA

repeats [57] at different time points during infection (Fig. 3.4A). We found reaction with

these antibodies starting 48 h after infection when the reaction co-localized with GFP-

TcRab11 in the contractile vacuole of intracellular amastigotes (Fig. 3.4A). Co-

localization progressed to almost 100% of the cells by 106 h, after which, labeling of the

CVC gradually disappeared and surface labeling was more evident (Figs. 3.4A, and

3.4B), suggesting that TcTS traffics through the contractile vacuole before reaching the

plasma membrane in differentiating trypomastigotes. Intermediate stages between

amastigotes and trypomastigotes (‘epimastigote-like’ forms) found in the supernatants of

tissue culture cells also showed co-localization of GFP-TcRab11 and TS (Fig. 3.5A) but

in fully differentiated trypomastigotes labeling of TcTS was predominantly in patches of

the plasma membrane while GFP-TcRab11 labeling remained in the CVC (Fig. 3.5B).

Cryo-immunogold electron microscopy confirmed the co-localization of GFP-TcRab11

and TcTS in the CVC (Fig. 3.6A). Co-localization was very intense in the spongiome of

collapsed vacuoles (Fig. 3.6B). TcTS was also observed in the flagellar pocket (Figs.

3.6C, and 3.6D) and in patches in the plasma membrane (Figs. 3.6A, D), at earlier time

55

points than by IFA analysis. At later time points stronger labeling of TcTS was detected

in patches of the plasma membrane and in vesicles close to the surface (Figs. 3.6E, F).

The surface localization of TcTS in trypomastigotes has been established before by

immunogold electron microscopy studies [55,58].

Trans-sialidase co-localizes with GFP-TcRab11 in intermediate stages of

differentiation from epimastigotes to metacylic trypomastigotes

As TcTS is also present in the surface of metacyclic trypomastigotes we investigated

whether there was co-localization of TcTS with GFP-TcRab11 during differentiation of

epimastigotes into metacyclic trypomastigotes as described under Materials and Methods.

Fig. 3.5C shows the co-localization of antibodies against TcTS with GFP-TcRab11 in

intermediate forms that appeared around day 5 of the metacyclogenesis process.

TcRab11DN mutant prevents plasma membrane localization of TcTS but not of

other plasma membrane proteins

To investigate whether mutation of TcRab11 affects general traffic of membrane proteins

to the cell surface of trypomastigotes, wild type and GFP-TcRab11DN trypomastigotes

were used to infect HF fibroblasts and labeling of TcTS and other membrane proteins

were detected by indirect immmunofluorescence analysis after a full cycle of

differentiation into trypomastigotes.

Wild type trypomastigotes showed labeling of TcTS in the plasma membrane (Fig. 3.7A)

while GFP-TcRab11DN intermediate forms (Fig. 3.7B) and trypomastigotes (Fig. 3.7C),

identified by the position of the kinetoplast anterior or posterior to the nucleus,

respectively, showed predominantly cytosolic labeling of TcTS (Fig. 3.7B-D). This weak

intracellular label with TcTS could be the result of ER retention and export to the cytosol

56

that ultimately results in its degradation by the ubiquitin/proteasome system [59].

Labeling of GFP-TcRab11DN was predominantly punctated cytosolic, as described

above for epimastigotes (Fig. 3.2A). These results suggest that DN mutation of TcRab11

inhibits traffic of TcTS to the plasma membrane. To further confirm this observation we

used SAPA antibodies to assess surface expression of TcTS by flow cytometry on GFP-

TcRab11DN and wild type trypomastigotes. As expected, flow cytometric analysis shows

reduction in surface expression of TcTS in the mutants as compared to control wild type

trypomastigotes (Fig. 3.7E). Western blot analyses showed that these trypomastigotes

maintained the overexpression of GFP-TcRab11 and GFP-TcRab11DN (Fig. 3.12D). To

address the specificity of the TcTS antibody, total parasite lysates of wild type and GFP-

TcRab11DN were subjected to western blot analyses. Signals were observed in both

lanes, matching the expected size of the TcTSs [37,60] (Fig. 3.13C).

We next investigated whether other GPI-anchored proteins or integral membrane proteins

required TcRab11 for trafficking to the surface. We selected for study TcTSSA II, which

is a mucin-type GPI-anchored protein [42], and GPI-anchored mucin-like glycoproteins

expressed on the cell surface of trypomastigotes that are recognized by anti-α-galactosyl

antibodies from patients with chronic Chagas disease [43-45]. Also selected was a P-

Type H+-ATPase, which is a proton pump important for maintenance of pH homeostasis

and plasma membrane potential of T. cruzi different stages [61,62] and that also localizes

to the endocytic pathway of the parasites [63]. Antibodies against TcTSSA II co-

localized with GFP-TcRab11 as assayed by indirect immunofluorescence analysis of

intermediate forms (Fig. 3.8A) and intracellular amastigotes (Fig. 3.8B) and trafficked to

the plasma membrane of trypomastigotes (Fig. 3.8C). Antibodies against α-Gal also co-

57

localized with GFP-TcRab11 in the intermediate forms (Fig. 3.9A) before reaching the

cell surface in the fully differentiated trypomastigotes (Fig. 3.9B). However, traffic of

both mucins to the plasma membrane was not prevented in GFP-TcRab11DN-expressing

parasites (Fig. 3.8D and 3.9C). Similarly, plasma membrane and intracellular localization

of the P-type H+-ATPase, which did not co-localize with GFP-TcRab11, was not affected

in GFP-Rab11DN parasites (Fig. 3.8E).

We also investigated the traffic of GPI-anchored surface antigens during

metacyclogenesis, as described under Materials and Methods. We followed traffic of

gp35/50 mucins, which are expressed in epimastigote and metacyclic forms.

Immunofluorescence assays on GFP-TcRab11OE parasites with monoclonal antibody

2B10 [64] demonstrates the co-localization of GFP-TcRab11 with gp35/50 in the CVC of

intermediate stages of differentiation (obtained at day 5 of metacyclogenesis) towards

metacyclics trypomastigotes (Fig. 3.14A) and the lack of co-localization in metacyclic

forms (obtained at day 10 of metacyclogenesis) (Fig. 3.14B). However, GFP-

TcRab11DN mutants did not show any defect on the surface localization of this protein

(Fig. 3.14C).

CVC is enriched in lipid rafts

It has been proposed that GPI-anchored proteins acquire detergent resistance by fatty acid

remodeling in the Golgi and their sorting is correlated with lipid raft formation at the

trans-Golgi (TG) network [48]. To investigate whether the CVC possesses rafts we

performed a detergent extraction of epimastigotes expressing different fusion constructs

previously demonstrated to associate with this organelle (TcSNARE2.1-GFP that

associates to the spongiome and GFP-TcRab11 that associates to the bladder [26],

58

followed by density gradient centrifugation in an Optiprep gradient to isolate detergent-

insoluble raft fractions. To determine whether rafts contained the fusion proteins,

detergent-insoluble fractions were separated using SDS-PAGE and analyzed by western

blotting with anti-GFP antibody. As a control for the isolation of lipid raft, a dually

acylated protein that is highly enriched in the flagellar membrane of T. cruzi, a 24-kDa

flagellar calcium-binding protein (FCaBP; [65]) was also used and detected with

monoclonal antibodies. Fractions from T. cruzi epimastigotes expressing cytoplasmic

GFP were used as negative control. Using this technique, we observed that GFP-

TcSNARE2.1, GFP-TcRab11, and FCaBP floated to the top of the Optiprep gradient

(Fig. 3.10A), suggesting the presence of lipid rafts in the CVC while GFP was associated

with the heavier fractions. The association of GFP-TcRab11 with lipid rafts was further

analyzed by another assay that is based on the temperature-dependence of lipid raft

sensitivity to detergent [66] (Fig. 3.10B). As expected GFP-TcRab11 remained insoluble

at 4°C and associated with the pellet fraction whereas it was soluble at 37oC after

centrifugation, and a cytoplasmic protein, GFP, remained soluble at either temperature

(Fig. 3.10B).

Trans-sialidase activity requirement for infection

As TcTS is important for infectivity [36] we investigated whether GFP-TcRab11DN

mutants were less effective than control cells or GFP-TcRab11OE parasites in the

establishment of T. cruzi infections. Invasion was significantly reduced in GFP-

TcRab11DN mutants as compared with controls transfected with GFP alone or GFP-

TcRab11OE parasites (Figs. 3.10C and 3.10D). There was no significant difference

between infections with wild-type trypomastigotes and trypomastigotes expressing GFP

59

alone (Fig. 3.15A and 3.15B). Pre-incubation of GFP-TcRab11DN-expressing

trypomastigotes for 30 min in the presence of recombinant TcTS and sialofetuin (as a

donor of sialic acid) [37] (Fig. 3.10D and 3.10E), but not asialofetuin (Fig. 3.15C and

3.15D) partially rescued the infectivity of the parasites demonstrating the importance of

TcTS activity for invasion of host cells.

The amino terminal 680 amino acids domain of TcTS contains the catalytic activity [67].

As a further control of the rescue experiments we did invasion experiments in the

presence of inactive recombinant TcTS (iTS), whose crystal structure has been

determined [68], and which differs in a single amino acid mutation Tyr342His that

completely abolishes its TS activity, but retains its property to recognize terminal

galactoses [32,69]. The recombinant protein binds sialic acid and galactose in vitro

[70,71] and competes with a neutralizing antibody to a discontinuous epitope of TS [37]

indicating that it is properly folded. Incubation in the presence of iTS did not rescue the

infectivity of GFP-TcRab11DN mutants (Fig. 3.10E and 3.10F). All invasion assays were

done in the absence of fetal bovine serum to prevent the presence of any other putative

exogenous sialic acid donors.

Discussion

The most significant finding of our studies is that GPI-anchored trans-sialidase (TcTS),

mucins from tissue culture-derived or metacyclic trypomastigotes, and trypomastigote

small surface antigen II (TcTSSA II) are trafficked to the plasma membrane of T. cruzi

by an unconventional pathway involving the CVC and that the CVC is enriched in lipid

rafts. We reported previously [26] that GFP-tagged TcRab11 localized to the CVC of

60

epimastigotes of T. cruzi. We now confirmed those results using antibodies against the

protein and found it in the CVC of different stages of the life cycle of the parasite. In

contrast, dominant negative TcRab11 has a punctated cytosolic localization indicating

that CVC localization is GTP-dependent. Expression of the dominant negative form of

TcRab11 makes epimastigotes less responsive to hyposmotic and hyperosmotic stresses.

These results, together with the detection by video microscopy of morphological changes

in the CVC under different osmotic conditions further demonstrate the role of the CVC in

both hyposmotic [4] and hyperosmotic [10] stresses. Expression of GFP-TcRab11DN

prevents traffic of TcTS, but not of other GPI-anchored (TcTSSA II, mucins) or integral

(H+-ATPase) membrane proteins to the plasma membrane of trypomastigotes, suggesting

a specific role of TcRab11 in trafficking of TcTS, and that this is not a default pathway

for all surface proteins. Dominant negative TcRab11 mutants might be acting by blocking

or reducing the function of endogenous TcRab11, by competing or sequestering Rab11

effector proteins [49]. GFP-TcRab11DN-expressing trypomastigotes were less virulent

but their pre-incubation with active, but not inactive, recombinant TcTS and a source of

sialic acid partially rescued their virulence, underscoring the relevance of TcTS activity

in infection. The identification of the specific role of TcTS in infection has been difficult

to demonstrate in the past because of the impossibility of doing knockouts of the

considerable number of gene copies encoding this protein scattered through the genome

of this parasite.

In mammalian cells the GPI anchor is synthesized and transferred to proteins in the ER.

GPI-anchored proteins (GPI-Aps) exit the ER from ER exit sites (ERES) and are

transported to the Golgi complex in COPII-coated vesicles [48]. Acquisition of detergent

61

resistance by fatty acid remodeling at the trans-Golgi facilitates their traffic to the plasma

membrane [48]. A similar pathway has been proposed in case of the GPI-AP variant

surface glycoprotein, or VSG, in Trypanosoma brucei, with the peculiarity that VSG

reaches first the flagellar pocket, which is the sole region for endo and exocytosis in this

organism [72]. GPI-APs are selectively endocytosed by a unique pathway involving

clathrin-independent vesicles in mammalian cells [48], while VSG is internalized via

clathrin-coated vesicles in T. brucei [72]. VSG can be retrieved from early and late

endosomes to the TbRab11-positive exocytic carriers and returned to the cell surface via

the flagellar pocket [72].

Very little is known about GPI-AP secretion or endocytosis in T. cruzi, although

uncoated vesicles containing transferrin have been observed budding off the flagellar

pocket membrane and cytostome of epimastigotes [73]. The trans-sialidase family of

proteins is predominantly expressed on the surface of trypomastigotes. Our results, using

anti-SAPA antibodies, are consistent with the synthesis of trans-sialidase in amastigotes

starting at least 48 h after infection [74] and its traffic through the CVC before reaching

the surface at the flagellar pocket. Anti-SAPA antibodies have been used before to

localize TcTS to the surface of trypomastigotes by immunoelectron microscopy [58]. The

presence of TcTS in the CVC by recycling from the surface is less probable because the

protein is only detected in the plasma membrane at later time points and no further

labeling of the CVC or endosomes is detected. It is possible that TcTS accumulates in the

CVC when rapidly synthesized during conversion of amastigotes into trypomastigotes

and then reaches a steady state and is below the limit of detection afterwards. In addition,

it is known that TcTS is shed to the extracellular medium, including within the host cells

62

[55], through the action of an endogenous phospholipase C, and also with vesicles of the

plasma membrane [75]. Other GPI-APs like TcTSSA II, and other mucins, also traffic

through the CVC before reaching the surface but its traffic to the surface is independent

of TcRab11. A possible explanation for the traffic of GPI-anchored proteins through the

CVC is that this organelle could be enriched in microdomains (or lipid rafts) in which

lipids with straight lipid chains, such as glycosphingolipids, phospholipids, and

palmitoylated proteins are packed together with cholesterol in a compact and stable

fashion [76]. Our results support the presence of lipid rafts in the CVC of T. cruzi. In this

regard, a proteomic analysis of GPI-anchored membrane protein fractions from

epimastigotes and metacyclic trypomastigotes, extracted using the neutral detergent

Triton X114 [77], detected several proteins that were later identified as present in the

CVC [26], such as TcRab11, and the membrane proteins V-H+-ATPase, and V-H

+-PPase.

Transfer of membrane [12,16,17,21] and luminal [18,20] proteins from the CVC to the

plasma membrane has been reported before in several cells, including T. cruzi

epimastigotes [21]. However, the mechanism involved was not known. In this work, we

provide evidence for a role of TcRab11 in the transfer of TcTS to the surface of the

infective stages of the parasite. The presence of vesicles labeled with antibodies against

TcTS in the proximity of the plasma membrane suggests that vesicle trafficking from the

CVC is involved in this process.

Rab proteins regulate a number of processes through their interactions with Rab effectors.

Rab11 effectors in mammalian cells comprise myosin Vb, Sec15, a component of the

exocyst complex, and a Family of Interacting Proteins or FIPs [52]. FIPS orthologues are

absent in trypanosomes, as well as class V myosins but T. brucei Rab11 has been shown

63

to interact with a Sec15 orthologue [78]. Interestingly both Rab11 [25] and Sec15 [79]

localize to the CVC of D. discoideum, and it was suggested that the CVC of D.

discoideum could be a precursor to the recycling endosomal system of other eukaryotes

[2,25].

Our results confirm the role of the CVC in both hyposmotic [4] and hyperosmotic [10]

stress and suggest that TcRab11 is important for the response of these cells to these

osmotic stresses. During its developmental cycle in the mammalian and insect hosts, T.

cruzi faces critical environmental challenges and ones that are especially dramatic are the

changes in osmolarity. Trypomastigotes need to resist osmolarities of 1,400 mOsm/kg

and return to isosmotic conditions (300 mOsm/kg) when circulating through the renal

medulla [80]. Amastigotes reproduce in some tissues that have higher osmolarity than

serum (330 in lymphoid tissues vs 300 mOsm/kg) [81], and epimastigotes need to resist

high osmolarities (~1,000 mOsm/kg) in the rectal content of the insect vector [82].

TcRab11 appears to have a role in the resistance to these changes.

In summary, we describe a new unconventional pathway of GPI-APs to the plasma

membrane that includes their traffic through the contractile vacuole complex. TcTS

requires the participation of TcRab11 to reach the plasma membrane, while TcTSSA II

and other mucins do not. This traffic of proteins through the CVC appears to be specific

for GPI-APs, since other membrane proteins do not follow the same pathway.

64

Materials and Methods

Cell culture

Human foreskin fibroblasts (HFF) were grown in DMEM Low Glucose medium

supplemented with 10% Cosmic CalfTM

serum and 0.1% L-glutamine. Vero cells were

grown in RPMI supplemented with 10% fetal bovine serum. L6E9 myoblasts were grown

in DMEM High Glucose medium supplemented with 10% fetal bovine serum. Host cells

were maintained at 37°C with 5% CO2. Tissue culture cell-derived trypomastigotes were

obtained from L6E9 myoblasts infected with metacyclic trypomastigotes from stationary

cultures of GFP-TcRab11OE and GFP-TcRab11DN parasites. T. cruzi amastigote and

trypomastigote forms were collected from the culture medium of infected host cells,

using a modification of the method of Schmatz and Murray [83] as described previously

[84]. Epimastigotes from T. cruzi were cultured in liver infusion tryptose (LIT) medium

containing 10% newborn serum at 28°C [10]. T. cruzi epimastigotes transfected with

GFP-TcRab11OE and GFP-TcRab11DN were maintained in the presence of 250 µg/ml

geneticin (G418).

Chemicals and reagents

Fetal bovine serum, newborn calf serum, Dulbecco’s phosphate buffer saline (PBS) and

Hank’s solution, 4’,6-diamidino-2-phenylindole (DAPI), DMEM and RPMI media,

paraformaldehyde, bovine serum albumin, and protease inhibitors were purchased from

Sigma (St. Louis, MO). Restriction enzymes, were from New England BioLabs (Ipswich,

MA). pCR2.1-TOPO cloning kit, 1 kb plus DNA ladder, rabbit GFP antibodies and Gene

Tailor Site-Directed Mutagenesis System were from Invitrogen (Life Technologies,

Grand Island, NY). Hybond-N nylon membranes were obtained from PerkinElmer

65

(Waltham, MA). TbRab11 purified antibodies were a gift from Mark Field (University of

Dundee, Scotland). Monoclonal antibody 2B10 was a gift from Nobuko Yoshida (Federal

University of São Paulo, Brazil), Chagasic α-Gal antibodies were a gift from Igor de

Almeida (University of Texas, El Paso), antibody against TcTSSA II was a gift from

Carlos Buscaglia (National University of San Martin, Argentina), monoclonal antibody

FCaBP was a gift from David Engman (Northwestern University, Evanston, IL). Rabbit

and goat GFP antibodies were from Abcam (Cambridge, MA). Recombinant active TcTS

and inactive TcTS (iTS) were obtained as described (65-67). BCA Protein Assay Reagent

was from Pierce (Thermo Fisher Scientific, Rockford, IL). All other reagents were

analytical grade. The oligonucleotides were ordered from Sigma or IDT (Coralville, IA).

Metacyclogenesis

We followed the protocol described by Bourguignon et al. [85] with some modifications.

Epimastigotes were obtained after 4 days in LIT medium and submitted to a stress

(incubation for 2 h in a medium containing 190 mM NaCl, 17 mM KCl, 2 mM MgCl2, 2

mM CaCl2, 0.035% sodium bicarbonate, 8 mM phosphate, pH 6.9 at room temperature;

triatome artificial urine (TAU) medium). After this stress, parasites were incubated for 96

h in TAU 3AAG medium (which consists of the previously described TAU medium

supplemented with 10 mM L-proline, 50 mM sodium L-glutamate, 2 mM sodium L-

aspartate, and 10 mM glucose). To increase the number of metacyclic forms, the contents

of the flask were collected and resuspended in media containing fresh fetal bovine serum

and incubated at 37°C for 20 h. The complement in the FBS kills epimastigotes while

metacyclic trypomastigotes survive. Samples were harvested from the TAU 3AAG +

FBS-containing medium at days 5 and 10 of cultivation.

66

In vitro infection assay

HFF or irradiated myoblasts (6 x 105

cells per well) were equally distributed in a 12-well

plate on a sterile coverslip in their respective growth media (as mentioned above) and

were incubated for 24 h at 37°C in a 5% CO2 atmosphere. The following day, the cells

were washed once with Dulbecco’s Hank’s solution, and 6 x 106 wild type, TcGFP, GFP-

TcRab11OE, or GFP-TcRab11DN trypomastigotes were added to each well (10

trypomastigotes per myoblast or HFF), and they were incubated for 4 h at 37°C in a 5%

CO2 atmosphere. To decrease the chances of contamination of cell derived-

trypomastigotes with extracellular amastigotes, collections of parasites were centrifuged

and incubated at 37°C for 2 h to allow trypomastigotes to swim to the surface. The

supernatant was collected and used for subsequent invasion assays. Next, the parasites

were removed from the plate, and the infected cells were washed extensively with

Dulbecco’s Hank’s solution and fixed for immunofluorescence assays. For rescue

experiments the same number of trypomastigotes were incubated with PBS, pH 7.4, in

the absence of serum, and with fetuin or asialofetuin (solutions made in PBS, pH 7.4, and

sterilized by filtration) at a final concentration of 10 g/ml, and with 200 ng of active

(TcTS) or inactive (iTS) trans-sialidase for 30 min at room temperature before infecting

host cells. For attachment/internalization assays, recently internalized parasites, and

parasites caught in the process of invasion, were considered and manually counted in at

least 200 DAPI-stained cells in 3 independent experiments. The percentage of infected

cells and the average number of parasites per infected cell were determined.

67

Immunofluorescence and western blot analyses

For immunofluorescence microscopy, parasites were fixed in PBS, pH 7.4, with 4%

paraformaldehyde, adhered to poly-lysine coverslips, and permeabilized for 3 min with

PBS, pH 7.4, containing 0.3% Triton X-100. Permeabilized cells were quenched for 30

min at room temperature with 50 mM NH4Cl and blocked overnight with 3% BSA in

PBS, pH 8.0. Both primary and secondary antibodies were incubated for 1 h at room

temperature. Coverslips were mounted by using a mounting medium containing DAPI at

5 µg/ml for staining DNA-containing organelles. For imaging of intracellular parasites,

mammalian cells were seeded onto sterile coverslips in 12-well culture plates and

allowed to grow for 24 h. To semi-synchronize the infection, we added the parasites at a

ratio of 10:1 (parasite/host cell) for 4 hours, washed the cells to eliminate extracellular

parasites and fixed in cold methanol for 30 min. Infected cells were prepared for

immunofluorescence analyses as described above for extracellular parasites, except for

the permeabilization that was performed for 10 min with Triton X-100 in PBS, pH 7.4.

The dilution used for primary antibodies were as follows: rabbit anti-TcAQP1, 1:50 [3];

rabbit anti-TbRab11 [24] 1:200; rabbit polyclonal anti-GFP, 1:500; rabbit anti-TcTS [57],

1:2,000; rabbit anti-TcTSSA II [42], 1:200; rabbit anti-H+ATPase [63], 1:100.

Differential interference contrast (DIC) and direct fluorescence images were obtained by

using an Olympus IX-71 inverted fluorescence microscope with a

PhotometrixCoolSnapHQ charge-coupled device camera driven by Delta Vision

softWoRx3.5.1 (Applied Precision, Issaquah, WA). Images were deconvolved for 10

cycles using the same software and applying the “noise filter” at “medium” mode. This is

an automatic deconvolution software and was applied to all channels; brightness and

68

contrast were the same in all channels. The figures were built by using Adobe Photoshop

10.0.1 (Adobe System, Inc., San Jose, CA).

For western blot analysis, ~108 T. cruzi epimastigotes, amastigotes or trypomastigotes

were collected by centrifugation at 1,600 x g for 10 min, washed twice in PBS, pH 7.4,

and resuspended in modified radioimmunoprecipitation analysis (RIPA) buffer (150 mM

NaCl, 20 mM Tris-Cl pH 7.5, 1 mM EDTA, 1% SDS and 0.1% Triton X-100) containing

protease inhibitor cocktail (2 mM EDTA, 2 mM phenylmethylsulfonyl fluoride (PMSF),

2 mM tosylphenylalanylchloromethyl ketone (TPCK), 0.1 mM trans-epoxysuccinyl-L-

leucylamido(4-guanidino) butane (E64) and Sigma P8340 protease inhibitor cocktail,

1:250). Cells were mechanically fragmented by passing lysates through a 20-gauge

needle five times. The protein concentration was estimated by spectrophotometry, using

the BCA Protein Assay Reagent. Twenty micrograms of protein from each total cell

lysate was mixed with 2X Laemmli sample buffer, boiled for 5 min, and total

homogenate of each sample were separated by SDS-PAGE. Proteins were transferred

onto nitrocellulose membranes and blocked overnight with 5% nonfat dry milk in PBS-

0.1% Tween 20 (PBS-T). The following primary antibodies were applied at room

temperature for 1 hr: rabbit anti-GFP at 1:1000, mFCaBP at 1:50, and rabbit anti-TcTS at

1:5000. Densitometric analysis of 3 independent experiments was performed with Alfa-

Imager software.

Flow cytometry

Tissue culture-derived trypomastigotes (106

cells) were fixed in 4% paraformaldehyde in

PBS, pH 7.4, and washed in blocking solution (3% BSA in PBS). After washing, cells

were incubated with the anti-TcTS (1:2,000 dilution) in blocking solution for 1 hr on ice.

69

Parasites were washed and incubated in Alexa Fluor 633 goat anti-rabbit for one hour on

ice. After washing, parasites were resuspended in PBS and samples were sorted on a

MoFlo cytometer (Cytomation, Fort Collins, CO) using a 633 nm argon laser for

excitation and an emission filter of 632/647 nm band pass. Samples were manually gated

to eliminate debris and dead parasites or cells. Data were analyzed using Summit version

3.1 (Cytomation) and prepared for publication using Flowjo version 4.0.2 (Treestar, San

Carlos, CA)

Generation of TcRab11 dominant negative mutant and transfection

Dominant negative forms of Rab11 were constructed via site directed mutagenesis by the

use of Gene Tailor Site-Directed Mutagenesis System. This method involved methylating

the TOPO blunt end vector containing the coding sequence for TcRab11 with DNA

methylase at 37°C for 1 hour, followed by amplification of the plasmid in a mutagenesis

reaction with two overlapping primers, forward, 5’-

GCGATAGTGGCGTCGGCAAGAACAACCTCATGACG-3’ and reverse, 5’-

CTTGCCGACGCCACTATCGCCGATGATGACAAC-3’ of which the forward primer

had the target mutation, resulting in the mutation of amino acid serine to asparagine.

Mutations were confirmed by sequencing (Yale DNA Analysis Facility, Yale University,

New Haven, Connecticut). After transformation the resulting plasmid TcRab11S21N in

TOPO was digested with restriction enzymes BamHI and HindIII. The circular pTEX-N-

GFP vector was linearized by the corresponding restriction enzymes. Finally,

TcRab11S21N insert was ligated to pTEX-N-GFP followed by transformation. The

plasmid pTEX-N-GFPTcRab11S21N was sequenced to confirm that the correct reading

frame was used. T. cruzi CL strain epimastigotes were transfected in cytomix (120 mM

70

KCl, 0.15 mM CaCl2, 10 mM K2HPO4, 2 mM EDTA, 5 mM MgCl2, pH 7.6) containing

50 μg of the plasmid construct in a 4 mm cuvette. The cuvette was cooled on ice for 10

min and pulsed 3 times (1.5 kV, 25 μF) with a Gene Pulser Xcell™ (Bio-Rad), and

expression of GFP-fusion proteins was verified by western blot analyses. Stable cell lines

were established under drug selection with G418 at 250 μg/ml. Enrichment of GFP

fluorescent parasites was performed with a high-speed cell sorter when needed (MoFlo

Legacy; Beckman-Coulter, Hialeah, FL).

Cryo-immunoelectron microscopy

HFF containing intracellular GFP-TcRab11OE expressing amastigotes were detached by

treating the T25 flasks with 0.25% trypsin at 96 h and 106 h post-infection. The contents

of the flask were collected and amastigotes were isolated from the host cells by passing

them through a 20-gauge needle. The released amastigotes (with ~5% contamination of

trypomastigotes) were fixed in 4% paraformaldehyde in 0.1 M cacodylate buffer, pH 7.3

for 1 h on ice. Epimastigotes were collected as described above and submitted to

hyposmotic conditions. Hyposmotic stress was induced by addition of hyposmotic buffer

(64 mM NaCl, 4 mM KCl, 1.8 mM CaCl2, 0.53 mM MgCl2, 5.5 mM glucose, 50 mM D-

mannitol, 5 mM Hepes-Na, pH 7.4) to a final osmolarity of 177 mosmol/L for 2 min and

then fixed with 0.1 % glutaraldehyde and 4% paraformaldehyde in 0.1 M cacodylate

buffer, pH 7.3 for 1 h on ice. The samples were processed for cryo-immunoelectron

microscopy at the Molecular Microbiology Imaging Facility, Washington University

School of Medicine. The antibodies used were: goat anti-GFP (1:500), rabbit anti-GFP

(1:50), rabbit anti-TcTS (1:250), donkey anti-goat 18 nm colloidal gold, donkey anti-

rabbit 18 nm colloidal gold, donkey anti-rabbit 12 nm colloidal gold.

71

Cell volume measurements

T. cruzi epimastigotes (GFP-TcRab11OE, GFP-TcRab11DN and wild-type) at log phase

of growth (3 days) were collected at 1,600 g for 10 min (at a density of 1 x 108/ml),

washed twice in PBS and resuspended in isosmotic buffer (64 mM NaCl, 4 mM KCl, 1.8

mM CaCl2, 0.53 mM MgCl2, 5.5 mM glucose, 150 mM D-mannitol, 5 mM Hepes-Na,

pH 7.4, to a final osmolarity of 282 mosmol/L, as determined using an Advanced

Instruments 3D3 osmometer. Relative cell volume changes after osmotic stress were

measured by light scattering. Aliquots of parasites were distributed in 96 well plates such

that each well had 1 x 107 cells and an appropriate volume of the corresponding buffer

was added for osmotic stress. Hyposmotic stress was induced by dilution of the isosmotic

cell suspension with deionized water to a final osmolarity of 150 mOsm at time zero.

Hyperosmotic stress was induced by addition of hyperosmotic buffer (64 mM NaCl, 4

mM KCl, 1.8 mM CaCl2, 0.53 mM MgCl2, 5.5 mM glucose, 500 mM D-mannitol, 5 mM

Hepes-Na, pH 7.4) to a final osmolarity of 650 mosmol/L. Absorbance at 550 nm was

monitored every 10 sec for 10 min using a SpectraMax M2e plate reader (Molecular

Devices) [10]. A decrease in absorbance corresponds to an increase in cell volume. The

results were normalized respect to the value of a 3 min pre-reading under isosmotic

conditions.

Video microscopy

Epimastigotes (1 x 108 cells) in logarithmic phase of growth were collected by

centrifugation, washed 3 times in PBS and resuspended in isosmotic buffer (composition

mentioned above). GFP-TcRab11 overexpressing epimastigotes were immobilized with

poly-L-lysine on coverslips in MatTek glass bottom dishes for 30 min at room

72

temperature. Unattached cells were washed with PBS. To induce hyposmotic stress the

isosmotic buffer was diluted by 1:1 with deionized water. Hyperosmotic stress was

induced by bathing the chamber with hyperosmotic buffer (as described above). Time

lapse photographic data were collected at 1 sec intervals with a 60X objective and a 1024

X 1024 field with a Delta Vision Elite system (Applied Precision). Video sequences were

reconstructed using Quicktime software.

Lipid raft isolation

An Optiprep gradient centrifugation (sucrose float) procedure was used to isolate lipid

rafts from T. cruzi epimastigotes wild type Y strain and those expressing GFP, GFP-

TcRab11 and GFP-TcSNARE2.1 fusion proteins using lysates equivalent to 2.5 x 108

mid log phase epimastigotes for each sample. The procedure was as described before [86]

with minor modifications. Briefly, tubes were centrifuged continuously at 4 °C in a

Beckman Coulter OptimaTM

L-100XP ultracentrifuge with a Beckman SW32Ti rotor at

35,000 rpm (210,000 x g) for 5 h and then 25,000 rpm (107,000 x g) for 8 h. After

collecting the fractions, a 24 µl aliquot of each fraction was mixed with 6 µl of 5X SDS-

PAGE loading buffer, boiled for 10 min, and processed for SDS-PAGE and western blot

analysis as above. The procedure for temperature-dependent Triton X-100 extraction for

GFP-TcRab11- and GFP-expressing epimastigotes was as described [66].

73

REFERENCES

1. Allen RD, Naitoh Y (2002) Osmoregulation and contractile vacuoles of protozoa.

International review of cytology 215: 351-394.



International review of cell and molecular biology 305: 69-113.

3. Montalvetti A, Rohloff P, Docampo R (2004) A functional aquaporin co-localizes with

the vacuolar proton pyrophosphatase to acidocalcisomes and the contractile


38673-38682.







1006-1017.

6. Nishihara E, Yokota E, Tazaki A, Orii H, Katsuhara M, et al. (2008) Presence of

aquaporin and V-ATPase on the contractile vacuole of Amoeba proteus. Biology

of the cell / under the auspices of the European Cell Biology Organization 100:

179-188.

7. Komsic-Buchmann K, Stephan LM, Becker B (2012) The SEC6 protein is required for

contractile vacuole function in Chlamydomonas reinhardtii. Journal of cell

science 125: 2885-2895.

8. Clark TB (1959) Comparative morphology of four genera of trypanosomatidae. J

Protozool 6: 227-232.

74

9. Girard-Dias W, Alcantara CL, Cunha ESN, de Souza W, Miranda K (2012) On the

ultrastructural organization of Trypanosoma cruzi using cryopreparation methods

and electron tomography. Histochemistry and cell biology 138: 821-831.





11. Patel S, Docampo R (2010) Acidic calcium stores open for business: expanding the

potential for intracellular Ca2+ signaling. Trends in cell biology 20: 277-286.

12. Moniakis J, Coukell MB, Janiec A (1999) Involvement of the Ca2+-ATPase PAT1

and the contractile vacuole in calcium regulation in Dictyostelium discoideum.

Journal of cell science 112 ( Pt 3): 405-414.

13. Malchow D, Lusche DF, Schlatterer C, De Lozanne A, Muller-Taubenberger A

(2006) The contractile vacuole in Ca2+-regulation in Dictyostelium: its essential

function for cAMP-induced Ca2+-influx. BMC developmental biology 6: 31.

14. Ladenburger EM, Korn I, Kasielke N, Wassmer T, Plattner H (2006) An Ins(1,4,5)P3

receptor in Paramecium is associated with the osmoregulatory system. Journal of

cell science 119: 3705-3717.

15. Ludlow MJ, Durai L, Ennion SJ (2009) Functional characterization of intracellular

Dictyostelium discoideum P2X receptors. The Journal of biological chemistry

284: 35227-35239.

16. Sivaramakrishnan V, Fountain SJ (2012) A mechanism of intracellular P2X receptor

activation. The Journal of biological chemistry 287: 28315-28326.


Dictyostelium amoebae. The Journal of cell biology 121: 1311-1327.




19. Heuser J (2006) Evidence for recycling of contractile vacuole membrane during

osmoregulation in Dictyostelium amoebae--a tribute to Gunther Gerisch.

European journal of cell biology 85: 859-871.

75



Ca2+- and conformation-dependent manner. The Journal of biological chemistry

284: 36377-36386.



91.

22. Macro L, Jaiswal JK, Simon SM (2012) Dynamics of clathrin-mediated endocytosis

and its requirement for organelle biogenesis in Dictyostelium. J Cell Sci 125:

5721-5732.

23. Kelly EE, Horgan CP, McCaffrey MW (2012) Rab11 proteins in health and disease.

Biochemical Society transactions 40: 1360-1367.


homologue in Trypanosoma brucei is involved in recycling processes. Journal of

cell science 114: 2617-2626.



dictyostelium. Journal of cell science 114: 3035-3045.


Identification of contractile vacuole proteins in Trypanosoma cruzi. PloS one 6:

e18013.

27. Pal A, Hall BS, Jeffries TR, Field MC (2003) Rab5 and Rab11 mediate transferrin

and anti-variant surface glycoprotein antibody recycling in Trypanosoma brucei.

The Biochemical journal 374: 443-451.


Endocytosis of a glycosylphosphatidylinositol-anchored protein via clathrin-

coated vesicles, sorting by default in endosomes, and exocytosis via RAB11-

positive carriers. Molecular biology of the cell 14: 2029-2040.



Science 309: 409-415.

76

30. Freitas LM, dos Santos SL, Rodrigues-Luiz GF, Mendes TA, Rodrigues TS, et al.

(2011) Genomic analyses, gene expression and antigenic profile of the trans-

sialidase superfamily of Trypanosoma cruzi reveal an undetected level of

complexity. PloS one 6: e25914.

31. Di Noia JM, Buscaglia CA, De Marchi CR, Almeida IC, Frasch AC (2002) A

Trypanosoma cruzi small surface molecule provides the first immunological

evidence that Chagas' disease is due to a single parasite lineage. The Journal of

experimental medicine 195: 401-413.

32. Cremona ML, Campetella O, Sanchez DO, Frasch AC (1999) Enzymically inactive

members of the trans-sialidase family from Trypanosoma cruzi display beta-

galactose binding activity. Glycobiology 9: 581-587.

33. Tomlinson S, Pontes de Carvalho LC, Vandekerckhove F, Nussenzweig V (1994)

Role of sialic acid in the resistance of Trypanosoma cruzi trypomastigotes to

complement. Journal of immunology 153: 3141-3147.

34. Buscaglia CA, Campo VA, Frasch AC, Di Noia JM (2006) Trypanosoma cruzi

surface mucins: host-dependent coat diversity. Nature reviews Microbiology 4:

229-236.

35. Pereira-Chioccola VL, Acosta-Serrano A, Correia de Almeida I, Ferguson MA,

Souto-Padron T, et al. (2000) Mucin-like molecules form a negatively charged

coat that protects Trypanosoma cruzi trypomastigotes from killing by human anti-

alpha-galactosyl antibodies. Journal of cell science 113 ( Pt 7): 1299-1307.

36. Schenkman S, Jiang MS, Hart GW, Nussenzweig V (1991) A novel cell surface trans-

sialidase of Trypanosoma cruzi generates a stage-specific epitope required for

invasion of mammalian cells. Cell 65: 1117-1125.

37. Buschiazzo A, Muia R, Larrieux N, Pitcovsky T, Mucci J, et al. (2012) Trypanosoma

cruzi trans-sialidase in complex with a neutralizing antibody: structure/function

studies towards the rational design of inhibitors. PLoS pathogens 8: e1002474.

38. Rubin-de-Celis SS, Uemura H, Yoshida N, Schenkman S (2006) Expression of

trypomastigote trans-sialidase in metacyclic forms of Trypanosoma cruzi

increases parasite escape from its parasitophorous vacuole. Cellular microbiology

8: 1888-1898.

77

39. Tribulatti MV, Mucci J, Van Rooijen N, Leguizamon MS, Campetella O (2005) The

trans-sialidase from Trypanosoma cruzi induces thrombocytopenia during acute

Chagas' disease by reducing the platelet sialic acid contents. Infection and

immunity 73: 201-207.

40. Mucci J, Hidalgo A, Mocetti E, Argibay PF, Leguizamon MS, et al. (2002)

Thymocyte depletion in Trypanosoma cruzi infection is mediated by trans-

sialidase-induced apoptosis on nurse cells complex. Proceedings of the National


41. Freire-de-Lima L, Alisson-Silva F, Carvalho ST, Takiya CM, Rodrigues MM, et al.

(2010) Trypanosoma cruzi subverts host cell sialylation and may compromise

antigen-specific CD8+ T cell responses. J Biol Chem 285: 13388-13396.

42. Canepa GE, Degese MS, Budu A, Garcia CR, Buscaglia CA (2012) Involvement of

TSSA (trypomastigote small surface antigen) in Trypanosoma cruzi invasion of

mammalian cells. The Biochemical journal 444: 211-218.

43. Almeida IC, Ferguson MA, Schenkman S, Travassos LR (1994) Lytic anti-alpha-

galactosyl antibodies from patients with chronic Chagas' disease recognize novel

O-linked oligosaccharides on mucin-like glycosyl-phosphatidylinositol-anchored

glycoproteins of Trypanosoma cruzi. Biochem J 304 ( Pt 3): 793-802.

44. Almeida IC, Krautz GM, Krettli AU, Travassos LR (1993) Glycoconjugates of

Trypanosoma cruzi: a 74 kD antigen of trypomastigotes specifically reacts with

lytic anti-alpha-galactosyl antibodies from patients with chronic Chagas disease. J

Clin Lab Anal 7: 307-316.

45. Almeida IC, Milani SR, Gorin PA, Travassos LR (1991) Complement-mediated lysis

of Trypanosoma cruzi trypomastigotes by human anti-alpha-galactosyl antibodies.

J Immunol 146: 2394-2400.

46. Di Noia JM, D'Orso I, Aslund L, Sanchez DO, Frasch AC (1998) The Trypanosoma

cruzi mucin family is transcribed from hundreds of genes having hypervariable

regions. J Biol Chem 273: 10843-10850.

47. Yoshida N, Mortara RA, Araguth MF, Gonzalez JC, Russo M (1989) Metacyclic

neutralizing effect of monoclonal antibody 10D8 directed to the 35- and 50-

78

kilodalton surface glycoconjugates of Trypanosoma cruzi. Infect Immun 57:

1663-1667.

48. Fujita M, Kinoshita T (2012) GPI-anchor remodeling: potential functions of GPI-

anchors in intracellular trafficking and membrane dynamics. Biochimica et

biophysica acta 1821: 1050-1058.

49. Fukuda M (2010) How can mammalian Rab small GTPases be comprehensively

analyzed?: Development of new tools to comprehensively analyze mammalian

Rabs in membrane traffic. Histology and histopathology 25: 1473-1480.

50. Docampo R (2011) Molecular parasitology in the 21st century. Essays in

biochemistry 51: 1-13.

51. Feig LA (1999) Tools of the trade: use of dominant-inhibitory mutants of Ras-family

GTPases. Nature cell biology 1: E25-27.

52. Stenmark H (2009) Rab GTPases as coordinators of vesicle traffic. Nature reviews

Molecular cell biology 10: 513-525.

53. Rohloff P, Rodrigues CO, Docampo R (2003) Regulatory volume decrease in

Trypanosoma cruzi involves amino acid efflux and changes in intracellular

calcium. Molecular and biochemical parasitology 126: 219-230.

54. Pereira ME (1983) A developmentally regulated neuraminidase activity in

Trypanosoma cruzi. Science 219: 1444-1446.

55. Frevert U, Schenkman S, Nussenzweig V (1992) Stage-specific expression and

intracellular shedding of the cell surface trans-sialidase of Trypanosoma cruzi.

Infection and immunity 60: 2349-2360.

56. Giorgi ME, de Lederkremer RM (2011) Trans-sialidase and mucins of Trypanosoma

cruzi: an important interplay for the parasite. Carbohydrate research 346: 1389-

1393.

57. Buscaglia CA, Campetella O, Leguizamon MS, Frasch AC (1998) The repetitive

domain of Trypanosoma cruzi trans-sialidase enhances the immune response

against the catalytic domain. The Journal of infectious diseases 177: 431-436.

58. Souto-Padron T, Reyes MB, Leguizamon S, Campetella OE, Frasch AC, et al. (1989)

Trypanosoma cruzi proteins which are antigenic during human infections are

located in defined regions of the parasite. Eur J Cell Biol 50: 272-278.

79

59. Ellgaard L, Molinari M, Helenius A (1999) Setting the standards: quality control in

the secretory pathway. Science 286: 1882-1888.

60. Parodi AJ, Pollevick GD, Mautner M, Buschiazzo A, Sanchez DO, et al. (1992)

Identification of the gene(s) coding for the trans-sialidase of Trypanosoma cruzi.

EMBO J 11: 1705-1710.

61. Vanderheyden N, Benaim G, Docampo R (1996) The role of a H(+)-ATPase in the

regulation of cytoplasmic pH in Trypanosoma cruzi epimastigotes. The

Biochemical journal 318 ( Pt 1): 103-109.

62. Luo S, Scott DA, Docampo R (2002) Trypanosoma cruzi H+-ATPase 1 (TcHA1) and

2 (TcHA2) genes complement yeast mutants defective in H+ pumps and encode

plasma membrane P-type H+-ATPases with different enzymatic properties. The


63. Vieira M, Rohloff P, Luo S, Cunha-e-Silva NL, de Souza W, et al. (2005) Role for a

P-type H+-ATPase in the acidification of the endocytic pathway of Trypanosoma

cruzi. The Biochemical journal 392: 467-474.

64. Yoshida N (2006) Molecular basis of mammalian cell invasion by Trypanosoma

cruzi. An Acad Bras Cienc 78: 87-111.

65. Tyler KM, Fridberg A, Toriello KM, Olson CL, Cieslak JA, et al. (2009) Flagellar

membrane localization via association with lipid rafts. J Cell Sci 122: 859-866.

66. Maric D, McGwire BS, Buchanan KT, Olson CL, Emmer BT, et al. (2011) Molecular

determinants of ciliary membrane localization of Trypanosoma cruzi flagellar

calcium-binding protein. J Biol Chem 286: 33109-33117.

67. Campetella OE, Uttaro AD, Parodi AJ, Frasch AC (1994) A recombinant

Trypanosoma cruzi trans-sialidase lacking the amino acid repeats retains the

enzymatic activity. Mol Biochem Parasitol 64: 337-340.

68. Oppezzo P, Obal G, Baraibar MA, Pritsch O, Alzari PM, et al. (2011) Crystal

structure of an enzymatically inactive trans-sialidase-like lectin from

Trypanosoma cruzi: the carbohydrate binding mechanism involves residual

sialidase activity. Biochim Biophys Acta 1814: 1154-1161.

80

69. Cremona ML, Sanchez DO, Frasch AC, Campetella O (1995) A single tyrosine

differentiates active and inactive Trypanosoma cruzi trans-sialidases. Gene 160:

123-128.

70. Todeschini AR, Dias WB, Girard MF, Wieruszeski JM, Mendonca-Previato L, et al.

(2004) Enzymatically inactive trans-sialidase from Trypanosoma cruzi binds

sialyl and beta-galactopyranosyl residues in a sequential ordered mechanism. J

Biol Chem 279: 5323-5328.

71. Todeschini AR, Girard MF, Wieruszeski JM, Nunes MP, DosReis GA, et al. (2002)

trans-Sialidase from Trypanosoma cruzi binds host T-lymphocytes in a lectin

manner. J Biol Chem 277: 45962-45968.

72. Silverman JS, Bangs JD (2012) Form and function in the trypanosomal secretory

pathway. Current opinion in microbiology 15: 463-468.

73. Soares MJ, Souto-Padron T, De Souza W (1992) Identification of a large pre-

lysosomal compartment in the pathogenic protozoon Trypanosoma cruzi. Journal

of cell science 102 ( Pt 1): 157-167.

74. Chiribao ML, Libisch MG, Osinaga E, Parodi-Talice A, Robello C (2012) Cloning,

localization and differential expression of the Trypanosoma cruzi TcOGNT-2

glycosyl transferase. Gene 498: 147-154.

75. Bayer-Santos E, Aguilar-Bonavides C, Rodrigues SP, Cordero EM, Marques AF, et

al. (2013) Proteomic analysis of Trypanosoma cruzi secretome: characterization

of two populations of extracellular vesicles and soluble proteins. Journal of

proteome research 12: 883-897.

76. Maeda Y, Kinoshita T (2011) Structural remodeling, trafficking and functions of

glycosylphosphatidylinositol-anchored proteins. Progress in lipid research 50:

411-424.

77. Cordero EM, Nakayasu ES, Gentil LG, Yoshida N, Almeida IC, et al. (2009)

Proteomic analysis of detergent-solubilized membrane proteins from insect-

developmental forms of Trypanosoma cruzi. Journal of proteome research 8:

3642-3652.

81

78. Gabernet-Castello C, Dubois KN, Nimmo C, Field MC (2011) Rab11 function in

Trypanosoma brucei: identification of conserved and novel interaction partners.

Eukaryotic cell 10: 1082-1094.

79. Essid M, Gopaldass N, Yoshida K, Merrifield C, Soldati T (2012) Rab8a regulates

the exocyst-mediated kiss-and-run discharge of the Dictyostelium contractile

vacuole. Molecular biology of the cell 23: 1267-1282.

80. Lang F, Busch GL, Volkl H (1998) The diversity of volume regulatory mechanisms.

Cellular physiology and biochemistry : international journal of experimental

cellular physiology, biochemistry, and pharmacology 8: 1-45.

81. Go WY, Liu X, Roti MA, Liu F, Ho SN (2004) NFAT5/TonEBP mutant mice define

osmotic stress as a critical feature of the lymphoid microenvironment.

Proceedings of the National Academy of Sciences of the United States of America

101: 10673-10678.

82. Kollien AH, Grospietsch T, Kleffmann T, Zerbst-Boroffka I, Schaub GA (2001) Ionic

composition of the rectal contents and excreta of the reduviid bug Triatoma

infestans. Journal of insect physiology 47: 739-747.

83. Schmatz DM, Murray PK (1982) Cultivation of Trypanosoma cruzi in irradiated

muscle cells: improved synchronization and enhanced trypomastigote production.

Parasitology 85 (Pt 1): 115-125.

84. Moreno SN, Silva J, Vercesi AE, Docampo R (1994) Cytosolic-free calcium

elevation in Trypanosoma cruzi is required for cell invasion. The Journal of

experimental medicine 180: 1535-1540.

85. Bourguignon SC, de Souza W, Souto-Padron T (1998) Localization of lectin-binding

sites on the surface of Trypanosoma cruzi grown in chemically defined

conditions. Histochemistry and cell biology 110: 527-534.

86. de Paulo Martins V, Okura M, Maric D, Engman DM, Vieira M, et al. (2010)

Acylation-dependent export of Trypanosoma cruzi phosphoinositide-specific

phospholipase C to the outer surface of amastigotes. J Biol Chem 285: 30906-

30917.

82

FIGURES

Figure 3.1 Fluorescence microscopy analysis of TcRab11 in different stages of T.

cruzi. (A-C) GFP fusion protein of TcRab11 was detected in the contractile vacuole

bladder of epimastigotes (Epi, A), trypomastigotes (Trypo, B), and intracellular

amastigotes (Ama, C) using antibodies against GFP. Upper panels show differential

interference contrast microscopy (DIC) images merged with DAPI staining of DNA (in

blue) and GFP-TcRab11 (in green). Lower panels show fluorescence images. (D) GFP-

TcRab11 (green) co-localizes with antibodies against T. cruzi aquaporin 1 (-AQP, red),

a marker for the contractile vacuole, under hyposmotic conditions. (E) Antibodies against

TbRab11 (-Rab11, red) co-localize with GFP-TcRab11 (green). (F) Antibodies against

TbRab11 (red) localize to a compartment that resembles the contractile vacuole in (E).

83

DAPI staining is in blue. Arrowheads in D-F show co-localization between antibodies

against TcAQP1 and GFP (D), TbRab11 antibody and GFP (E) and labeling with

antibodies against TbRab11 (F), respectively. Bars in A-F = 10 µm. (G) Western blot

analyses with TbRab11 antibody of lysates of epimastigotes overexpressing GFP-

TcRab11 (E-OE), or wild-type epimastigotes (E), trypomastigotes (T) and amastigotes

(A) showing bands (arrows) corresponding to the endogenous TcRab11 (24 kDa) and to

GFP-TcRab11 (50 kDa). The blots were sequentially probed with TbRab11 and anti-

tubulin antibodies, used as loading control.

84

Figure 3.2 GFP-TcRab11DN localizes to the cytoplasm of different life cycle stages.

(A-C) GFP-TcRab11DN, mimicking the GDP–bound state of the protein has a cytosolic

punctate localization in epimastigotes, (A), trypomastigotes (B), and intracelular

amastigotes (C), as detected using antibodies against GFP. DNA was stained with DAPI.

Bars = 10 µm.

85

Figure 3.3 Regulatory volume changes of epimastigotes (A-B) Cells were pre-

incubated in isosmotic buffer for 3 min and then subjected to hyposmotic (final

osmolarity = 150 mOsm) (A) or hyperosmotic (final osmolarity = 650 mOsm) (B) stress.

Relative change in cell volume was followed by monitoring absorbance at 550 nm by

light scattering. As compared to wild-type cells (WT), cells expressing GFP-TcRab11DN

(DN) failed to fully recover their volume after hyposmotic stress and shrank less after

hyperosmotic stress, while cells overexpressing GFP-TcRab11 (OE) recovered their

86

volume faster after hyposmotic stress and shrank more after hyperosmotic stress. Values

are means ± SD of three different experiments. Asterisks indicate statistically significant

differences, p < 0.05, (Bonferroni’s multiple comparison “a posteriori” test of one-way

ANOVA) at all time points after induction of osmotic stress. (C-D) Epimastigotes were

immobilized on glass slides with poly-lysine and diluted with deionized water to a final

osmolarity of 150 mOsm (C) or bathed with hyperosmotic (650 mOsm) buffer (D). Video

microscopy data were collected and selected frames are shown. Times indicated in each

frame represent 1 second apart after induction of stress. Arrowheads show different

dilated compartments that transform into larger bladders at a later time. Results are

representative of those obtained from at least three independent experiments. Bars = 10

µm.

87

Figure 3.4 Co-localization of GFP-TcRab11 and TcTS during amastigote

differentiation in human foreskin fibroblasts. (A) Expression of TcTS becomes

apparent at 48 h p.i., when antibodies against TcTS (red) co-localize with GFP-TcRab11,

as detected with antibodies against GFP (green). Co-localization progresses to close to

80% of cells by 96 h, and after 106 h co-localization starts to decrease and surface

labeling of TcTS is more evident. Scale bars = 10 µm. Insets shows co-localization at

high magnification (double). (B) Percentage of amastigotes showing co-localization of

TcTS and GFP-Rab11 with time. Two hundred amastigotes were counted in each

experiment and results are expressed as means ± SEM (n = 3).

88

Figure 3.5 Localization of TcTS during differentiation to cell-derived and

metacyclic trypomastigotes. (A) Co-localization of TcTS and antibodies against GFP

in intermediate stages (epimastigote-like) obtained from tissue culture supernatants. (B)

TcTS localizes to patches of the plasma membrane in fully differentiated trypomastigotes

while GFP-TcRab11 remains in the CVC. (C) Co-localization of TcTS with GFP-

TcRab11 in epimastigotes during transformation into metacyclic stages. Scale bars (C-E)

= 10 µm.

89

Figure 3.6 Cryo-immunoelectron microscopy localization of GFP-TcRab11 and

TcTS in amastigotes. Amastigotes were isolated from HFF at different times p.i., as

described under Materials and Methods. GFP-TcRab11 and TcTS were detected with

goat anti-GFP, and rabbit anti-TcTS antibodies, and donkey anti-goat 18 nm colloidal

gold and donkey anti-rabbit 12 nm colloidal gold, respectively. (A-D) Amastigotes

obtained after 96 h p.i. Co-localization of antibodies against GFP (arrows) and TcTS

(small dots) is evident in the CV bladder (CV) and spongiome (Sp), while TcTS also

90

localizes to the flagellar pocket (FP) and in patches of the plasma membrane. Note in (B)

a collapsed bladder and intense labeling of the spongiome. (E-F) Amastigotes obtained

106 h p.i. GFP-TcRab11 localizes to the CV bladder while TcTS localizes to vesicles (V,

small arrows) close to the plasma membrane and in patches in the plasma membrane.

Scale bars = 500 nm. Note that the patchy appearance of the cytoplasm is due to the

absence of glutaraldehyde in the fixative because it abolished labeling of TcTS.

91

Figure 3.7 Overexpression of GFP-TcRab11DN reduces the surface expression of

TcTS. Tissue culture-derived wild type, and GFP-TcRab11DN-expressing

trypomastigotes and intermediate forms were fixed, permeabilized and stained with

antibodies against TcTS (A), or both TcTS and GFP (B and C). Labeling of TcTS (red) in

fully differentiated trypomastigotes was predominantly in surface patches (A). Labeling

of GFP-TcRab11DN (green) was predominantly cytosolic while labeling of TcTS was

punctated but did not reach the cell surface in intermediate forms (B) or fully

differentiated trypomastigotes (C). (D) The fluorescence intensity of TcTS in the cell

92

surface of tissue culture-derived GFP-TcRab11DN-expressing trypomastigotes was

measured in 200 cells in each experiment and expressed as percentage of control (wild-

type trypomastigotes). Values are means ± SEM of 3 independent experiments. **p <

0.05. (E) FACS analysis of fixed GFP-TcRab11DN trypomastigotes reveals a decrease in

the surface expression of TcTS as depicted by their lesser fluorescence intensity (DN) in

comparison to that of wild type cells (WT). The negative control were unstained wild

type trypomastigotes (US) showing background fluorescence. Wild type cells have two

peaks of TcTS, suggesting the presence of intermediate stages in these asynchronously

growing cultures. Data is representative of the profile analysis of 20,000 cells from 3

independent experiments.

Figure 3.8 Localization of surface proteins in GFP-TcRab11OE and GFP-

TcRab11DN-expressing parasites. Antibodies against TcTSSA II (red) co-localize with

93

antibodies against GFP (green) in intermediate forms (A) and amastigotes (B) but not in

trypomastigotes expressing GFP-TcRab11, where they localize to the plasma membrane

(C). Antibodies against TcTSSA II (D) still localize to the plasma membrane in GFP-

TcRab11DN-expressing cells, while antibodies against the H+-ATPase (E) maintain their

intracellular and plasma membrane localization in GFP-Rab11DN-expressing cells. In

(D) and (E) GFP staining localizes to the cytosol. Scale bars = 10 µm.

Figure 3.9 Localization of anti-Gal antibodies. (A) GFP-TcRab11 co-localizes with the

anti-Gal antibodies in the CVC of the intermediate forms as detected by polyclonal

antibody against GFP (green arrow) and anti-α-galactosyl antibodies from patients with

chronic Chagas disease (red arrow), respectively. (B) Anti-Gal antibodies strongly label

the surface of fully differentiated tissue culture derived trypomastigotes while GFP-

TcRab11 labels the CVC. (C) GFP-TcRab11DN mutants show a punctated cytosolic

94

localization (green) while anti-Gal antibodies (red) localize to the plasma membrane in

intermediate stages. Scale bars (A-C) = 10 µm

Figure 3.10 Association of CVC proteins with lipid rafts and reduced infectivity of

TcRab11DN trypomastigote. (A) Parasite extracts were loaded at the bottom (fraction

9) of a discontinuous Optiprep density gradient and subjected to ultracentrifugation.

Fractions were collected and analyzed by anti-GFP and anti-FCaBP immunoblotting.

Fractions 2 and 3 contain the lipid raft interface. The TcSNARE2.1GFP (SNARE), GFP-

TcRab11 (Rab11), and FCaBP floated to the lipid raft interface. Lanes 6-9 represent the

heavier fractions of the GFP and FCaBP derivatives and GFP alone was detected in these

fractions. A whole cell lysate (WCL) is included in each panel as a control of loading.

Total protein in lysates of GFP-TcSNARE2.1-, GFP-TcRab11- and GFP-expressing

epimastigotes were 1.41, 1.3 and 1.39 mg/ml, respectively. (B) T. cruzi expressing GFP-

TcRab11 or GFP were solubilized in Triton X-100 at 4°C or 37°C and separated into

95

soluble (S) and insoluble (P) fractions and analyzed by western blotting with anti-GFP.

Rab11-GFP partitions in the pellet fraction at 4°C, but is solubilized at 37°C, whereas

GFP is only detected in the soluble fraction. (C-D) Effect of TcRab11 overexpression

(OE) or mutation (DN) on trypomastigote invasion of host cells. In vitro infection assays

were carried out as described under Materials and Methods. (E-F) Partial rescue of the

infectivity of DN trypomastigotes by their incubation in the presence of active TcTS and

sialofetuin, whereas inactive trans-sialidase (iTS) does not rescue the infectivity of GFP-

TcRab11DN mutants. Fetuin was present in all samples. Other conditions under

Materials and Methods. Values in C-F are mean ± SD (n = 3). *, ** and *** indicate that

differences are statistically significant compared with respective controls, p < 0.05

(Ordinary one way ANOVA with Bonferroni post-test).

96

Supplementary figures

Figure 3.11 Cryo-immunoelectron microscopy localization of GFP-TcRab11 in

epimastigotes. Epimastigotes were isolated and submitted to hyposmotic stress as

described under Materials and Methods. GFP-TcRab11 was detected with rabbit anti-

GFP, and anti-rabbit 18 nm colloidal gold. GFP-TcRab11 localizes mainly to the CV

bladder. Arrows in C show labeling of the dilated spongiome (Sp) tubules. CV;

contractile vacuole bladder; Sp: spongiome; Fl, flagellum; K, kinetoplast. Scale bars =

100 nm.

97

Figure 3.12 Growth rate, and western blot analyses of overexpressed TcRab11. (A)

Growth rate of epimastigotes overexpressing (OE, blue) or expressing the dominant

negative (DN, green) mutant of TcRab11, as compared to controls (C, red). (B) Western

blot analyses of GFP-TcRab11OE (OE), GFP-TcRab11DN (DN) and GFP-expressing

(GFP) epimastigotes. Membranes were stripped and re-incubated with anti-tubulin

antibody as a loading control (bottom panel). (C) Densitometry analysis of western blots

of lysates from TcRab11 overexpressing epimastigotes (OE) as compared to those of

control cells. Values in arbitrary units (AU) correspond to mean ± SD from 3

independent experiments. (D) Western blot analyses of GFP-TcRab11OE (OE), GFP-

TcRab11DN (DN) and GFP-expressing (GFP) trypomastigotes. Membranes were

stripped and re-incubated with anti-tubulin antibody as a loading control (bottom panel).

98

Figure 3.13 TcAQP1 localization is not affected in GFP-TcRab11DN mutants and

western blot analysis of wild type and GFP-TcRab11DN shows specificity of anti-

SAPA antibodies. (A) Co-localization of GFP-TcRab11, as detected with antibodies

against GFP (green arrow), with antibodies against TcAQP1 (-TcAQP, red arrow) in

epimastigotes. (B) GFP-TcRab11DN mutants show a punctated cytosolic localization as

detected with anti-GFP (green), while antibodies against TcAQP1 still localize to the

CVC (red arrows). Co-localization is indicated in Merge images (yellow arrows). Bars =

10 µm. (C) Western blot analyses of GFP-TcRab11DN (DN), and wild type (WT)

trypomastigotes using anti-SAPA antibodies. Membranes were stripped and re-incubated

with anti-tubulin antibody as a loading control (bottom panel).

99

Figure 3.14 Localization of GFP-TcRab11 and gp35/50 mucins during

metacyclogenesis. (A) GFP-TcRab11 co-localizes with gp35/50 mucins in the CVC of

intermediate forms, as detected with polyclonal antibody against GFP (green arrow), and

monoclonal antibody 2B10 (red arrow), respectively. Surface localization of gp35/50 is

also evident (red). (B) GFP-TcRab11 (green arrows) does not co-localize with gp35/50

mucins, which have a surface localization in metacyclic trypomastigotes (red). (C) GFP-

TcRab11DN mutants show a punctated cytosolic localization of TcRab11DN (green)

while gp35/50 mucins (red) localize to the plasma membrane in intermediate stages.

Scale bars (A-C) = 10 µm.

100

Figure 3.15 Infections of host cells by trypomastigotes overexpressing TcRab11. A-

B. TcRab11 overexpression (OE) does not cause significant changes in trypomastigote

invasion of host cells as compared to wild type trypomastigotes. In vitro infection assays

were carried out as described under Materials and Methods. (C-D). Recombinant active

trans-sialidase rescues the infectivity of GFP-TcRab11DN mutants in the presence of

fetuin (F) but not in the presence of asialofetuin (A). Other conditions under Materials

and Methods.

101

CHAPTER 4

RAB32 IS ESSENTIAL FOR MAINTAINING FUNCTIONAL

ACIDOCALCISOMES AND FOR GROWTH AND VIRULENCE OF

TRYPANOSOMA CRUZI

Sayantanee Niyogi, Veronica Jimenez and Roberto Docampo. (To be submitted to PLoS

Pathogens)

102

Abstract

We recently reported that the contractile vacuole complex (CVC) of Trypanosoma cruzi,

the etiologic agent of Chagas disease, is involved in the transfer of GPI-anchored proteins

to the plasma membrane of the parasite during its differentiation to trypomastigotes and

that the CVC-located small GTPase TcRab11 is essential for the specific transfer of

trans-sialidase. Here we report that another CVC-located small GTPase, TcRab32, is

important for acidocalcisome function, suggesting its involvement in trafficking of

membrane proteins to these organelles. TcRab32 is geranylgeranylated and localizes to

the CVC. A dominant negative (DN) mutant tagged with GFP (GFP-TcRab32DN)

localizes to the cytosol, and epimastigotes expressing this dominant negative mutant are

less responsive to osmotic stress. Mutant parasites are still able to differentiate into

metacyclic forms and infect host cells but they are less virulent than wild type cells.

Parasites expressing GFP-TcRab32DN have a reduced number of acidocalcisomes, which

are deficient in pyrophosphate (PPi) and polyphosphate (polyP), and are less electron-

dense as compared to acidocalcisomes in wild type cells. Taking together these results

reveal roles of TcRab32 in osmoregulation and trafficking of membrane proteins to

acidocalcisomes and indicate that the CVC is a trafficking hub in these parasites.

Author Summary

The contractile vacuole complex (CVC) consists of a large vacuole or bladder and a loose

network of tubules known as the spongiome. In addition to its role in osmoregulation, the

CVC of Trypanosoma cruzi has a role in trafficking of GPI-anchored proteins to the

plasma membrane of differentiating cells. In this work we reveal that its role is not

limited to the traffic of GPI-anchored proteins to the plasma membrane but also includes

103

the traffic of membrane proteins to acidocalcisomes. Expression of dominant negative

mutants of the CVC-located GFP-TcRab32 results in acidocalcisomes of altered

morphology and content and less virulent parasites revealing the similarity of its role to

that of early/recycling endosomes.

Introduction

Trypanosoma cruzi [1], the etiologic agent of Chagas disease, together with Leishmania

spp. [2], and a number of monogenetic trypanosomes [3,4], possess a contractile vacuole

complex (CVC) involved in osmoregulation. In T. cruzi, the CVC was shown to be

important for regulatory volume decrease (RVD) after hyposmotic stress [5], and for

shrinking of the cells when submitted to hyperosmotic stress [6]. In addition, we recently

reported a role for the CVC in trafficking glycosylphosphatidylinositol(GPI)-anchored

proteins to the plasma membrane [7]. Previous studies in T. cruzi [8] and Dictyostelium

discoideum [9-12] suggested that other soluble [9,10] and membrane [8,11,12] proteins

can also be transported through the CVC to the plasma membrane. The presence of

Rab11, a small GTPase that localizes in recycling endosomes in most cells, including T.

brucei [13], in the CVC of T. cruzi [14] and D. discoideum [15], suggested that the CVC

could be an evolutionary precursor to the recycling endosomal system in other eukaryotes

[15,16].

In a previous proteomic and bioinformatics study of the CVC of T. cruzi we identified a

number of proteins involved in trafficking roles, among them SNAREs 2.1 and 2.2,

VAMP1 (VAMP7 homolog), AP180, and the small GTPases Rab11 and Rab32 [14]. It

was verified by immunofluorescence that indeed these proteins localize to the CVC. Rab

proteins mediate tethering of incoming vesicles to the correct target organelle through

104

cycling between a GDP-bound inactive and a GTP-active form [17]. They have also been

implicated in vesicle budding and in the interaction with cytoskeletal elements [17].

Different Rab GTPases are localized to different organelles and this represents an

important determinant of each organelle identity [18-20]. Rab32 and its close homolog

Rab38 are predominantly expressed in lysosome-related organelles-(LROs)-producing

cells such as melanocytes, and platelets [21], and it has been suggested that these Rabs

could be the specificity factors that work in concert with the ubiquitous trafficking

machinery for transport toward LROs [21]. It has been proposed that LROs arise by

delivery of specific cargoes from the early endosomal network, comprising sorting and

recycling endosomes [22,23].

T. cruzi possesses organelles with similarities to LROs of mammalian cells, known as

acidocalcisomes [24-26]. As LROs of human platelets [27,28] and mast cells [29],

acidocalcisomes have rounded morphology, are acidic, and rich in calcium,

pyrophosphate (PPi) and polyphosphate (polyP). In addition, adaptor protein complex-3

(AP-3), the system known to be involved in transport of membrane proteins to LROs of

mammalian cells [30], is also involved in the biogenesis of acidocalcisomes [31,32].

Interestingly, electron microscopy evidences of fusion of acidocalcisomes to the CVC of

T. cruzi [33], and D. discoideum [34] have been reported. Also, under hyposmotic stress

acidocalcisomes fuse to the CVC and results in translocation of an aquaporin (TcAQP1)

[5]. In this work we demonstrate that the expression of dominant-interfering TcRab32

mutants altered osmoregulation, acidocalcisome number and content, and parasite

infectivity. The results suggest that the CVC and TcRab32 are involved in trafficking

membrane proteins involved in acidocalcisome biogenesis, and reaffirm the role of the

105

CVC as a trafficking hub.

Results

Localization of TcRab32 in different T. cruzi stages:

We reported that N-terminal tagging of T. cruzi Rab32 (TcRab32; TcCLB.506289.80)

with green fluorescent protein (GFP) resulted in labeling of the CVC of epimastigotes

and an additional punctated staining [14]. We confirmed this localization by indirect

immunofluorescence analysis using an affinity purified TcRab32 antibody raised in

mouse against the recombinant protein. For the generation of antibody against the

protein, we expressed TcRab32 in Escherichia coli as a fusion protein with a C-terminal

polyhistidine tag. Recombinant Rab32 proteins was purified by affinity chromatography

using His-Bin cartridges and fractions were verified by SDS PAGE. Fig. 4.1A shows that

the bacterially expressed rTcRab32 protein (including the His-tag) appears as a strong

single band with an approximate molecular mass of 42 kDa. Fig. 4.1B-D shows that

αTcRab32 localizes to the bladder of the CVC of wild type epimastigotes,

trypomastigotes, and amastigotes (arrows), with additional punctated staining especially

in epimastigotes and trypomastigotes. This antibody was shown to predominantly react

with a protein of 26 kDa in all T. cruzi stages (Fig. 4.1E).

In vitro prenylation studies of TcRab32

TcRab32 possesses the sequence CXC at the carboxyl terminus (Fig. 4.2A; denoted by

red overlap) and it is known that Rab prenylation at Cys residues of the carboxyl

terminus retain Rabs at membranes [35]. Previous studies using recombinant T. cruzi

protein geranylgeranyl transferase I (GGTI) using a panel of mammalian and yeast

protein substrates reported that two mammallian Rab family GTPases containing the C-

106

terminal CXC sequence did not serve as substrates for this enzyme, as expected [36].

Accordingly, Prenylation Prediction Suite (PrePS) predicts that geranylgenanyl

transferase II (GGTII) is the enzyme involved in the prenylation of this protein. To

examine whether TcRab32 is geranylgeranylated, we performed in vitro prenylation

experiments (Fig. 4.2B) using recombinant Rab32 (rRab32) as substrate in the presence

of a cytosolic epimastigote extract as the source of prenyltransferases. When tritiated

geranylgeranyl pyrophosphate ([3H]GGPP) was used as the isoprenoid donor, His-tagged

TcRab32 was efficiently geranylgeranylated as shown by the labeled band of 42 kDa

detected, corresponding to the His-tagged protein. The intensity of the prenylated band

was strongest at 30 min, the optimum incubation time. Conversely, when tritiated

farnesyl pyrophosphate ([3H]FPP) was used as donor, we were unable to detect

prenylation of rTcRab32, even after exposure of the gel for more tan 2 weeks at -80°C

(data not shown). Therefore, TcRab32 is specifically geranylgeranylated.

Localization of TcRab32 mutants

To examine the role of the prenylation motif in targeting of TcRab32 to cell membranes,

we generated mutants in which the prenylation motif was mutated and we studied the

effect of this mutation on the localization of the protein. An N-terminal GFP epitope tag

was fused to TcRab32 in which the C-terminal Cys residues were mutated to Ala. In

transfected T. cruzi epimastigotes GFP-TcRab32C241A/243A had a cytosolic

localization (Fig. 4.3A). We also constructed an expression plasmid encoding a TcRab32

mutant that mimics the GDP-bound form (dominant-negative; TcRab32T24N) (Fig.

4.3B) or the GTP-bound form (dominan-positive; TcRab32Q71L) (Fig. 4.3C). In

transfected T. cruzi epimastigotes, GFP-TcRab32DN have a punctated cytosolic

107

localization while GFP-TcRab32DP have a preferential localization in the CVC.

Together, these results suggest that TcRab32 localizes to the membrane of the CVC in a

GTP-dependent manner with the COOH-terminal cysteines.

Lack of co-localization of GFP-TcRab32 with a mitochondrial marker

It has been reported that mammalian Rab32 functions as an A-kinase anchoring protein

(AKAP), interacting with the type II regulatory subunit (RII) of protein kinase A (PKA)

and associating to the mitochondria [37]. An Ala at position 185 in the α5 helix acts as an

anchoring determinant and introduction of a phenylalanine, which is conserved in this

position in most Rab family members, prevents binding to RII. Interestingly, TcRab32

possesses a phenylalanine (F) at the equivalent position (Fig. 4.2A; denoted by blue

asteriks), and, as expected, GFP-TcRab32 does not co-localize with the mitocondrial

marker Mitotracker (Fig. 4.4A), and neither GFP-TcRab32DP (Fig. 4.4B) nor GFP-

TcRab32DN (Fig. 4.4C) affects mitocondrial labeling.

Co-localization of GFP-TcRab32 with TcVP1 under osmotic stress

It has been reported that mammalian [38] and Xenopus [39] Rab32 partially localizes to

melanosomes, which are LROs. We therefore investigated whether TcRab32 partially co-

localizes with the acidocalcisome marker vacuolar proton pyrophosphatase (VP1) [40].

We did not observe any significant overlap between antibodies to TbVP1 and against

GFP-TcRab32 under isosmotic conditions (Fig. 4.5A). However, under hyposmotic

conditions (Fig. 4.5B) we observed that TcVP1 staining overlaps with GFP staining at the

CVC region, in agreement with the reported fusion of these organelles under hyposmotic

stress [5,33].

108

TcRab32DN mutants have a decreased content of PPi and polyP

Most PPi and polyP in trypanosomes are accumulated in acidocalcisomes [25,26]. It is

not known whether PPi is taken up from the cytosol or synthesized inside

acidocalcisomes while synthesis of polyP is through the activity of polyP kinases such as

that formed by the vacuolar transporter chaperone (VTC) complex [41,42]. This is a

complex of at least two subunits in trypanosomatids, VTC1 and VTC4, both localized to

the membrane of acidocalcisomes and of which VTC4 is the catalytic subunit [41,42].

We hypothesized that if TcRab32 was important for the biogenesis of acidocalcisomes

these organelles would have a reduced ability to synthesize these compounds and that

was exactly the case. Expression of the dominant-negative form of TcRab32 (GFP-

TcRab32DN) led to a significant reduction in the levels of PPi (~50%) (4.6A) and short-

chain polyP (~80%) (4.6B) in comparison to GFP and wild type Rab32 expressing

epimastigotes. There was, however, no significant change in the expression of long chain

polyP (>300 up to 700–800 phosphate units) (4.6C), suggesting that only the activity of

TcVTC complex, which is mainly involved in the synthesis of short-chain polyP [41,42],

is affected in these mutants. The results were further verified by visualization of short

chain poly P extracted from the above cell lines, resolved by Urea-PAGE and stained

with toluidine blue (4.6D).

Changes in acidocalcisome electron-density and number in GFP-TcRab32DN

mutants

In previous work [43,44], electron microscopy techniques were used to demonstrate that

treatment of fixed trypanosomes with yeast pyrophosphatase resulted in loss of the

electron-density of acidocalcisomes, as observed in whole unstained cells, suggesting that

109

PPi (complexed with cations) was the main electron dense material of these organelles. In

agreement with the considerable decrease in PPi and short chain polyP content of GFP-

TcRab32DN mutants (Fig. 4.6), we detected by transmission electron microscopy on

intact unstained GFP-TcRab32DN (DN) expressing epimastigotes the presence of empty

vacuoles in comparison to wild type epimastigotes (WT) (Fig. 4.7A) and that there was a

significant reduction in the number of acidocalcisomes per cell (B). 84% of these DN

cells have acidocalcisomes that were not electron-dense (C) with an average of ~10

empty vacuole per cell expressing GFP-TcRab32DN (D).

Cells deficient in Rab32 display no defect in the traffic of trans-sialidase to the

plasma membrane

To investigate whether TcRab32 affects traffic of trans-sialidase (TcTS) to the cell

surface of trypomastigotes, or this is a process specific for TcRab11 [7], we infected Vero

cells with metacyclic trypomastigotes from stationary cultures of GFP-TcRab32DN

parasites and obtained cell culture-derived trypomastigotes. GFP-TcRab32DN

trypomastigotes were used to infect fibroblasts and labeling of TcTS was detected by

indirect immunofluorescence analysis using antibodies against the SAPA repeats of TcTS

after a full cycle of differentiation into trypomastigotes. Traffic of trans-sialidase to the

surface was not affected in TcRab32-DN trypomastigotes, further demonstrating that the

CVC-dependent trafficking pathway of trans-sialidase is specifically TcRab11-mediated

(Fig. 4.8).

GFP-TcRab32DN mutants have reduced growth and response to osmotic stress

The growth rate of the epimastigotes expressing GFP-TcRab32DN (DN) mutants was

significanlty reduced as compared to that of control epimastigotes expressing GFP alone

110

(C) (Fig. 4.9A). Wild-type, GFP-TcRab32-overexpressing (GFP-TcRab32OE), GFP-

TcRab32DP, and GFP-TcRab32DN-expressing epimastigotes were submitted to

hyposmotic stress and their regulatory volume decrease (RVD) measured using a light-

scattering technique, as described previously [7]. This technique measures the changes in

volume of the cells under hyposmotic (swelling and recovery) and hyperosmotic

conditions (shrinking and partial recovery). After recovery the cells recuperate their

normal morphology (Fig. 4.9B). DN mutants were less able to recover their volume after

hyposmotic stress than wild type cells, while recovery was faster in GFP-TcRab32OE

cells (OE). The response in TcRab32DP cells was similar to that of wild type cells. In

addition, when submitted to hyperosmotic stress (Fig. 4.9C), DN mutants shrank less

while GFP-TcRab32OE and GFP-TcRab32DP cells shrank more than control cells, and

in all cases they did not recover their volume during the time of the experiment. It has

been shown before that when epimastigotes are submitted to hyperosmotic stress the

parasites do not regain their normal volume at least during the subsequent two hours [6].

TcRab32 is required for infection

To study the effect of reduced polyP, and PPi levels and the effect of reduced cell

viability on the rate of invasion of the GFP-TcRab32DN mutants, we fully differentiated

them into cell derived trypomastigotes as described under Materials and Methods.

Invasion was significantly reduced in GFP-TcRab32DN and GFP-TcRab32OE mutants

as compared with controls transfected with GFP alone or with wild type parasites (Fig

4.10A and 4.10B). Cytosolic localization of GFP-TcRab32DN mutants was maintained

when epimastigotes were differentiated into trypomastigotes and intracellular amastigotes

(Fig. 4.10C).

111

Discussion

We show here that expression of dominant-negative form of the GTPase TcRab32 results

in alterations in the number and content of acidocalcisomes, and in deficient response to

osmotic stress, growth in vitro, and invasion of host cells. The results suggest that the

CVC, where TcRab32 is located, is involved in trafficking membrane proteins involved

in the synthesis/transport of phosphorus compounds to acidocalcisomes.

We reported before that GFP-tagged TcRab32 localizes to the CVC of epimastigotes of

T. cruzi [42]. We now confirm those observations using antibodies against the protein

and found it distributed in the CVC of different stages of the life cycle of the parasite and

with a punctate staining in epimastigotes and amastigotes. Mutants deficient in the

prenylation motif and dominant negative GFP-TcRab32, however, have a cytosolic

localization indicating that CVC localization is geranylgeranylation- and GTP-dependent.

Dominant negative TcRab32 mutants might be acting by blocking or reducing the

function of endogenous TcRab32, by competing or sequestering Rab32 effector proteins.

TcRab32, like other Rab32 proteins, contains amino acid sequences that are shared with

only a small number of other Rab sequences [45]. For example, threonine in the

WDTAGQE sequence (GTP binding site), which is conserved in almost all Rab proteins,

is replaced by isoleucine. A similar replacement is found in Rab38, Rab29, and

Rab7L1/29 of mammalian cells, and in RabE from Dictyostelium discoideum [45], but

there are no orthologs to any of these other Rabs in T. cruzi [46]. TcRab32 also possesses

three amino acids, the Gly at amino acid position 75, Asn-76, and Val-80 that are only

conserved in the switch II region of Rab32 and Rab38 alone and not of any of the other

58 Rabs of mammalian cells [47]. Val-80 is required for binding of mammalian Rab32 to

112

its effector VPS9-ankyrin-repeat protein/Ankrd27 (Varp) and this interaction is important

for trafficking of tyrosinase-related protein to melanosomes [47]. In contrast, TcRab32

has a phenylalanine at amino acid position 194 instead of an alanine in mammalian

Rab32. This Ala is an anchoring determinant for regulatory subunit II (RII subunit) of

protein kinase A and responsible for mammalian Rab32 interaction with mitochondria

[37]. In agreement with those studies we found that TcRab32 does not associate with

mitochondria. Interestingly, other authors were also unable to confirm the association of

human Rab32 with COS cells mitochondria [45]

Traffic of trans-sialidase to the plasma membrane of trypomastigotes is not affected in

GFP-TcRab32DN expressing parasites suggesting that the trafficking pathways of

membrane proteins to the plasma membrane and acidocalcisomes are independent of

each other.

Rab proteins participate in membrane trafficking events involving membrane fusion,

fission, and motility. Although our data do not distinguish between these events, the

localization of TcRab32 in the CVC and the deficient morphology and content of

acidocalcisomes upon expression of its dominant-negative form suggests that the CVC

acts equivalent to the recycling/early endosomes of mammalian cells where TcRab32

functions as tether facilitating cargo loading into fused vesicles [48]. The fusion of CVC

with acidocalcisomes would facilitate exchange of membrane proteins between the

organelles such as translocation of TcAQP1 from acidocalcisomes to the CVC [5] or of

membrane enzymes/transporters involved in the synthesis of phosphorus compounds

from the CVC to the acidocalcisomes. This model would be consistent with the known

interaction between Rab32 effector proteins and VAMP7 [38,47], which is a vesicle

113

SNARE protein involved in vesicle fusion, and its known interaction with the delta

subunit of adaptor complex-3 (AP-3) [49]. An ortholog to VAMP7 is present in the CVC

of T. cruzi [14] and AP-3 is known to be involved in the biogenesis of acidocalcisomes

[31,32].

In conclusion, we propose that the CVC is a trafficking hub involved not only in the

transfer of GPI-anchored proteins to the plasma membrane but also as a specialized

endosomal system that can be used to deliver membrane proteins important for the

biogenesis of acidocalcisomes.

Materials and Methods

Cell culture

Epimastigotes from T. cruzi were cultured in liver infusion tryptose (LIT) medium

containing 10% newborn serum at 28°C. T. cruzi epimastigotes transfected with GFP-

TcRab32OE, GFP-TcRab32DN, GFP-TcRab32DP and GFP-TcRab32C241A/243A were

maintained in the presence of 250 µg/ml geneticin (G418). Human foreskin fibroblasts

(HFF) were grown in DMEM Low Glucose medium supplemented with 10% Cosmic

Calf serum and 0.1% L-glutamine. Vero cells were grown in RPMI supplemented with

10% fetal bovine serum. L6E9 myoblasts were grown in DMEM High Glucose medium

supplemented with 10% fetal bovine serum. Host cells were maintained at 37°C with 5%

CO2. Tissue culture cell-derived trypomastigotes were obtained from Vero cells infected

with metacyclic trypomastigotes from stationary cultures of GFP-TcRab32OE and GFP-

TcRab32DN parasites. T. cruzi amastigote and trypomastigote forms were collected from

the culture medium of infected host cells, using a modification of the method of Schmatz

and Murray [50] as described previously [51].

114

Chemicals and reagents

Fetal bovine serum, newborn calf serum, Dulbecco’s phosphate buffer saline (PBS) and

Hank’s solution, 4’,6-diamidino-2-phenylindole (DAPI), DMEM and RPMI media,

paraformaldehyde, bovine serum albumin, and protease inhibitors were purchased from

Sigma (St. Louis, MO). Restriction enzymes, were from New England BioLabs (Ipswich,

MA). pCR2.1-TOPO cloning kit, 1 kb plus DNA ladder, rabbit GFP antibodies and Gene

Tailor Site-Directed Mutagenesis System were from Invitrogen (Life Technologies,

Grand Island, NY). Hybond-N nylon membranes were obtained from PerkinElmer

(Waltham, MA). Pierce ECL Western blotting substrate and BCA Protein Assay Reagent

was from Pierce (Thermo Fisher Scientific, Rockford, IL). All other reagents were

analytical grade. The oligonucleotides were ordered from Sigma or IDT (Coralville, IA).

Vector pET32 Ek/LIC, Benzonase® Nuclease, anti-Histidine tag antibodies, and S-

protein HRP conjugate were from Novagen (EMD Millipore, Billerica, MA). Farnesyl

Pyrophosphate, [1-3H(N)]-, Triammonium Salt, 1mCi (37MBq), Geranylgeranyl

Pyrophosphate, Triammonium Salt,[1-3H(N)]-, 50µCi (1.85MBq) and EN3HANCE were

from Perkin Elmer.

In vitro infection assay

HFF or irradiated myoblasts (6 x 105 cells per well) were equally distributed in a 12-well

plate on a sterile coverslip in their respective growth media (as mentioned above) and

were incubated for 24 h at 37°C in a 5% CO2 atmosphere. The following day, the cells

were washed once with Dulbecco’s Hank’s solution, and 6 x 106

wild type, TcGFP, GFP-

TcRab32OE, or GFP-TcRab32DN trypomastigotes were added to each well (10

trypomastigotes per myoblast or HFF), and they were incubated for 4 h at 37°C in a 5%

115

CO2 atmosphere. To decrease the chances of contamination of cell derived-

trypomastigotes with extracellular amastigotes, collections of parasites were centrifuged

and incubated at 37°C for 2 h to allow trypomastigotes to swim to the surface. The

supernatant was collected and used for subsequent invasion assays. Next, the parasites

were removed from the plate, and the infected cells were washed extensively with

Dulbecco’s Hank’s solution and fixed for immunofluorescence assays. For

attachment/internalization assays, recently internalized parasites, and parasites caught in

the process of invasion, were considered and manually counted in at least 200 DAPI-

stained cells in 3 independent experiments. The percentage of infected cells and the

average number of parasites per infected cell were determined.

Immunofluorescence and western blot analyses

To determine if there are domains of contact between TcRab32 with the mitochondria in

T. cruzi epimastigotes, live cells were labelled for 30 min with Mitotracker Red CMXRos

(Invitrogen) at 50 nM in LIT medium and then fixed and processed for

immunofluorescence. For immunofluorescence microscopy, parasites were fixed in PBS,

pH 7.4, with 4% paraformaldehyde, adhered to poly-lysine coverslips, and permeabilized

for 3 min with PBS, pH 7.4, containing 0.3% Triton X-100. Permeabilized cells were

quenched for 30 min at room temperature with 50 mM NH4Cl and blocked overnight

with 3% BSA in PBS, pH 8.0. Both primary and secondary antibodies were incubated for

1 h at room temperature. Coverslips were mounted by using a mounting medium

containing DAPI at 5 µg/ml for staining DNA-containing organelles. For imaging of

intracellular parasites, mammalian cells were seeded onto sterile coverslips in 12-well

culture plates and allowed to grow for 24 h. To semi-synchronize the infection, we added

116

the parasites at a ratio of 10:1 (parasite/host cell) for 4 hours, washed the cells to

eliminate extracellular parasites and fixed in cold methanol for 30 min. The dilution used

for primary antibodies were as follows: mouse anti-Rab32 (1:200), rabbit polyclonal anti-

GFP (1:500); rabbit anti-TcTS (1:2000), polyclonal rabbit anti-TbVP1 (1:250) [40].

Differential interference contrast (DIC) and direct fluorescence images were obtained by

using an Olympus IX-71 inverted fluorescence microscope with a Photometrix

CoolSnapHQ charge-coupled device camera driven by Delta Vision softWoRx3.5.1

(Applied Precision, Issaquah, WA). Images were deconvolved for 10 cycles using the

same software and applying the “noise filter” at “medium” mode. This is an automatic

deconvolution software and was applied to all channels; brightness and contrast were the

same in all channels. The figures were built by using Adobe Photoshop 10.0.1 (Adobe

System, Inc., San Jose, CA).

Generation of TcRab32 dominant negative, dominant positive and prenylation-

motif mutant and transfection

Dominant negative (GFP-TcRab32T24N), dominant positive (GFP-TcRab32Q71L) and

prenylation-motif mutant (GFP-TcRab32C241A/243A) forms of TcRab32 were

constructed via site directed mutagenesis by the use of Gene Tailor Site-Directed

Mutagenesis System. This method involved methylating the TOPO blunt end vector

containing the coding sequence for TcRab32 with DNA methylase at 37°C for 1 hour,

followed by amplification of the plasmid in a mutagenesis reaction with two overlapping

primers, of which the forward primer had the target mutation, resulting in the mutation of

amino acid threonine to asparagine (dominant negative), glutamine to leucine (dominant

positive), or Cysteine to Alanine (prenylation-motif mutant). Mutations were confirmed

117

by sequencing (Yale DNA Analysis Facility, Yale University, New Haven, Connecticut).

After transformation the resulting plasmids in TOPO was digested with restriction

enzymes BamHI and HindIII. The circular pTEX-N-GFP vector was linearized by the

corresponding restriction enzymes. Finally, TcRab32T24N, TcRab32Q71L and

TcRab32C241A/243A inserts were ligated to pTEX-N-GFP followed by transformation.

The plasmid pTEX-GFPTcRab32T24N/Q71L/C241A/243A were sequenced to confirm

that the correct reading frame was used. T. cruzi Y strain epimastigotes were transfected

in cytomix (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4, 2 mM EDTA, 5 mM

MgCl2, pH 7.6) containing 50 μg of the plasmid construct in a 4 mm cuvette. The cuvette

was cooled on ice for 10 min and pulsed 3 times (1.5 kV, 25 μF) with a Gene Pulser

Xcell™ (Bio-Rad), and expression of GFP-fusion proteins was verified by western blot

analyses. Stable cell lines were established under drug selection with G418 at 250 μg/ml.

Enrichment of GFP fluorescent parasites was performed with a high-speed cell sorter

when needed (MoFlo Legacy; Beckman-Coulter, Hialeah, FL).

Cell volume measurements

T. cruzi epimastigotes (GFP-TcRab32OE, GFP-TcRab32DN, GFP-TcRab32DP and wild-

type) at log phase of growth (3 days) were collected at 1,600 g for 10 min (at a density of

1 x 108/ml) and volume measurement experiments after stress were done exactly as

described in [7].

Recombinant protein expression, purification and antibody generation

DNA sequence corresponding to the entire open reading frame of TcRab32 was PCR-

amplified from T. cruzi Y strain gDNA

(Forward primer: 5' GACGACGACAAGATGTCATACTCGAA -3', Reverse primer:

118

5' GAGGAGAAGCCCGGTTTAACAGGAGCAGCCCGAC-3') and ligation-

independent cloned into vector pET32 Ek/LIC for heterologous expression in bacteria.

The sequence of several recombinant clones was verified and they were transformed by

heat shock into E. coli BL21 Codon Plus (DE3)-RIPL chemically competent cells.

Expression of recombinant protein was obtained by induction in 0.5 mM isopropyl-β-

Dthiogalactopyranoside (IPTG) in LB broth overnight at 37° C. His-tagged recombinant

protein was purified under denaturing conditions with His-Bind cartridges (Novagen).

Recombinant TcRab32 was used as immunogen for production of polyclonal antibody in

mice. This antibody was generated at the Monoclonal Antibody Facility of the College of

Veterinary Medicine, University of Georgia (Athens, GA).

In-vitro prenylation

In vitro prenylation reactions were done as described in [52] and [53] with minor

modifications. A total of 2 µCi of [3H] FPP or [

3H] GGPP was used as isoprenoid

donors. The assay reaction was carried out at 30°C for 30 min, 1 hour and 3 hour and 30

min was the optimum reaction time for this assay and resolved by SDS–10% PAGE. The

gel was incubated in En3Hance, dried, and exposed to film at -80°C for 2 weeks.

Short chain and long chain polyphosphate quantification

Cells (2 x 108) in log phase were harvested and washed twice with buffer A. The PPi and

short-chain polyP were extracted using 0.5 M perchloric acid (HClO4) [54], and the long-

chain polyP was extracted using glass milk (Molecular Probes) as described [55]. PPi

level was determined by the amount of Pi released upon treatment with an excess of

Saccharomyces cerevisiae inorganic pyrophosphatase (catalog no. I-1891, Sigma). The

free Pi (released) amount was determined by using a standard curve. Briefly, the

119

enzymatic reaction was performed on 96-well plates with 50 mM Tris-HCl (pH 7.4), 6

mM MgCl2, inorganic pyrophosphatase, and extracted PPi samples at a final volume of

100µl. After incubation at 30 °C for 10 min, the reaction was immediately stopped by the

addition of an equal amount of the fresh mixture of 3 parts of 0.045% malachite green

with 1 part of 4.2% ammonium molybdate (Sigma), which was filtered prior to use. The

absorbance at 660 nm was read using a SpectraMax M2e plate reader (Molecular

Devices, Sunnyvale, CA).

Short-chain and long-chain polyP levels were determined by the amount of Pi released

upon treatment with an excess of the purified recombinant exopolyphosphatase of S.

cerevisiae (rScPPX1) freshly purified in our laboratory (Ruiz et al., 2001).

Short chain PolyP extracted from 5 x 108 cells were mixed with 6X Dye (0.01% Orange

G; 30% glycerol; 10 mM TrisHCl pH 7.4; 1 mM EDTA) and resolved on 20% TBE

PAGE. Samples were run at 600 V 6 mA overnight at 4°C until the Orange G had run

through 2/3 of the gel. Gels were stained with 0.1% Toluidine blue.

Transmission electron microscopy

For imaging whole epimastigote forms, cells were washed with filtered buffer A [116

mM NaCl, 5.4 mM KCl, 0.8 mM MgSO4, 50 mM Hepes (pH 7.2) and 5.5 mM glucose]

twice, and directly applied to Formvar-coated copper grids, allowed to adhere for 10 min,

carefully blotted dry, and observed in JEM-1210 electron microscope operating at 80 kV.

Whole unfixed epimastigotes of wild type and TcRab32DN were randomly selected and

the number of acidocalcisome per cell was counted in 50 cells from 2 different

preparations.

120

Cell growth measurement

Measured optical density at 600 nm as a measure of concentration of epimastigotes in

suspensión in the Gilford spectrophotometer with a starting culture of 4.5 x 106

epimastigotes and monitored cell density for the next 7 days.

121

REFERENCES

1. Clark TB (1959) Comparative morphology of four genera of trypanosomatidae. J

Protozool 6: 227-232.




1006-1017.

3. Linder JC, Staehelin LA (1979) A novel model for fluid secretion by the

trypanosomatid contractile vacuole apparatus. The Journal of cell biology 83:

371-382.

4. Baqui MM, De Moraes N, Milder RV, Pudles J (2000) A giant phosphoprotein

localized at the spongiome region of Crithidia luciliae thermophila. The Journal of

eukaryotic microbiology 47: 532-537.








7. Niyogi S, Mucci J, Campetella O, Docampo R (2014) Rab11 Regulates Trafficking of

Trans-sialidase to the Plasma Membrane through the Contractile Vacuole

Complex of Trypanosoma cruzi. PLoS Pathog 10: e1004224.



91.

122






Ca2+- and conformation-dependent manner. The Journal of biological chemistry

284: 36377-36386.


Dictyostelium amoebae. The Journal of cell biology 121: 1311-1327.

12. Moniakis J, Coukell MB, Janiec A (1999) Involvement of the Ca2+-ATPase PAT1

and the contractile vacuole in calcium regulation in Dictyostelium discoideum.

Journal of cell science 112 ( Pt 3): 405-414.


homologue in Trypanosoma brucei is involved in recycling processes. Journal of

cell science 114: 2617-2626.


Identification of contractile vacuole proteins in Trypanosoma cruzi. PloS one 6:

e18013.



dictyostelium. Journal of cell science 114: 3035-3045.



International review of cell and molecular biology 305: 69-113.

17. Zerial M, McBride H (2001) Rab proteins as membrane organizers. Nat Rev Mol Cell

Biol 2: 107-117.

18. Pfeffer SR (2001) Rab GTPases: specifying and deciphering organelle identity and

function. Trends Cell Biol 11: 487-491.

19. Munro S (2002) Organelle identity and the targeting of peripheral membrane proteins.

Curr Opin Cell Biol 14: 506-514.

123

20. Seabra MC, Wasmeier C (2004) Controlling the location and activation of Rab

GTPases. Curr Opin Cell Biol 16: 451-457.

21. Bultema JJ, Ambrosio AL, Burek CL, Di Pietro SM (2012) BLOC-2, AP-3, and AP-1

proteins function in concert with Rab38 and Rab32 proteins to mediate protein

trafficking to lysosome-related organelles. J Biol Chem 287: 19550-19563.

22. Raposo G, Marks MS (2007) Melanosomes--dark organelles enlighten endosomal

membrane transport. Nat Rev Mol Cell Biol 8: 786-797.

23. Delevoye C, Hurbain I, Tenza D, Sibarita JB, Uzan-Gafsou S, et al. (2009) AP-1 and

KIF13A coordinate endosomal sorting and positioning during melanosome

biogenesis. The Journal of cell biology 187: 247-264.


acidocalcisomes of Trypanosoma cruzi. The Biochemical journal 310 ( Pt 3):

1005-1012.

25. Docampo R, de Souza W, Miranda K, Rohloff P, Moreno SN (2005)

Acidocalcisomes - conserved from bacteria to man. Nature reviews Microbiology

3: 251-261.

26. Docampo R, Moreno SN (2011) Acidocalcisomes. Cell calcium 50: 113-119.

27. Ruiz FA, Lea CR, Oldfield E, Docampo R (2004) Human platelet dense granules

contain polyphosphate and are similar to acidocalcisomes of bacteria and

unicellular eukaryotes. The Journal of biological chemistry 279: 44250-44257.

28. Smith SA, Mutch NJ, Baskar D, Rohloff P, Docampo R, et al. (2006) Polyphosphate

modulates blood coagulation and fibrinolysis. Proceedings of the National


29. Moreno-Sanchez D, Hernandez-Ruiz L, Ruiz FA, Docampo R (2012) Polyphosphate

is a novel pro-inflammatory regulator of mast cells and is located in

acidocalcisomes. The Journal of biological chemistry 287: 28435-28444.

30. Theos AC, Tenza D, Martina JA, Hurbain I, Peden AA, et al. (2005) Functions of

adaptor protein (AP)-3 and AP-1 in tyrosinase sorting from endosomes to

melanosomes. Mol Biol Cell 16: 5356-5372.

124

31. Besteiro S, Tonn D, Tetley L, Coombs GH, Mottram JC (2008) The AP3 adaptor is

involved in the transport of membrane proteins to acidocalcisomes of Leishmania.

Journal of cell science 121: 561-570.



growth and virulence of Trypanosoma brucei. The Journal of biological chemistry

286: 36619-36630.

33. Montalvetti A, Rohloff P, Docampo R (2004) A functional aquaporin co-localizes

with the vacuolar proton pyrophosphatase to acidocalcisomes and the contractile


38673-38682.

34. Marchesini N, Ruiz FA, Vieira M, Docampo R (2002) Acidocalcisomes are

functionally linked to the contractile vacuole of Dictyostelium discoideum. The


35. Jean S, Kiger AA (2012) Coordination between RAB GTPase and phosphoinositide

regulation and functions. Nat Rev Mol Cell Biol 13: 463-470.

36. Yokoyama K, Gillespie JR, Van Voorhis WC, Buckner FS, Gelb MH (2008) Protein

geranylgeranyltransferase-I of Trypanosoma cruzi. Mol Biochem Parasitol 157:

32-43.

37. Alto NM, Soderling J, Scott JD (2002) Rab32 is an A-kinase anchoring protein and

participates in mitochondrial dynamics. J Cell Biol 158: 659-668.

38. Tamura K, Ohbayashi N, Maruta Y, Kanno E, Itoh T, et al. (2009) Varp is a novel

Rab32/38-binding protein that regulates Tyrp1 trafficking in melanocytes. Mol

Biol Cell 20: 2900-2908.

39. Park M, Serpinskaya AS, Papalopulu N, Gelfand VI (2007) Rab32 regulates

melanosome transport in Xenopus melanophores by protein kinase a recruitment.

Current biology : CB 17: 2030-2034.

40. Rodrigues CO, Scott DA, Docampo R (1999) Characterization of a vacuolar

pyrophosphatase in Trypanosoma brucei and its localization to acidocalcisomes.

Mol Cell Biol 19: 7712-7723.

125

41. Lander N, Ulrich PN, Docampo R (2013) Trypanosoma brucei vacuolar transporter

chaperone 4 (TbVtc4) is an acidocalcisome polyphosphate kinase required for in

vivo infection. The Journal of biological chemistry 288: 34205-34216.

42. Ulrich PN, Lander N, Kurup SP, Reiss L, Brewer J, et al. (2014) The acidocalcisome

vacuolar transporter chaperone 4 catalyzes the synthesis of polyphosphate in

insect-stages of Trypanosoma brucei and T. cruzi. The Journal of eukaryotic

microbiology 61: 155-165.

43. Urbina JA, Moreno B, Vierkotter S, Oldfield E, Payares G, et al. (1999)

Trypanosoma cruzi contains major pyrophosphate stores, and its growth in vitro

and in vivo is blocked by pyrophosphate analogs. The Journal of biological

chemistry 274: 33609-33615.

44. Mendoza M, Mijares A, Rojas H, Rodriguez JP, Urbina JA, et al. (2002)

Physiological and morphological evidences for the presence acidocalcisomes in

Trypanosoma evansi: single cell fluorescence and 31P NMR studies. Mol

Biochem Parasitol 125: 23-33.

45. Hirota Y, Tanaka Y (2009) A small GTPase, human Rab32, is required for the

formation of autophagic vacuoles under basal conditions. Cell Mol Life Sci 66:

2913-2932.

46. Berriman M, Ghedin E, Hertz-Fowler C, Blandin G, Renauld H, et al. (2005) The

genome of the African trypanosome Trypanosoma brucei. Science 309: 416-422.

47. Tamura K, Ohbayashi N, Ishibashi K, Fukuda M (2011) Structure-function analysis

of VPS9-ankyrin-repeat protein (Varp) in the trafficking of tyrosinase-related

protein 1 in melanocytes. J Biol Chem 286: 7507-7521.

48. Bultema JJ, Di Pietro SM (2013) Cell type-specific Rab32 and Rab38 cooperate with

the ubiquitous lysosome biogenesis machinery to synthesize specialized

lysosome-related organelles. Small GTPases 4: 16-21.

49. Martinez-Arca S, Rudge R, Vacca M, Raposo G, Camonis J, et al. (2003) A dual

mechanism controlling the localization and function of exocytic v-SNAREs. Proc

Natl Acad Sci U S A 100: 9011-9016.

126

50. Schmatz DM, Murray PK (1982) Cultivation of Trypanosoma cruzi in irradiated

muscle cells: improved synchronization and enhanced trypomastigote production.

Parasitology 85 (Pt 1): 115-125.

51. Moreno SN, Silva J, Vercesi AE, Docampo R (1994) Cytosolic-free calcium

elevation in Trypanosoma cruzi is required for cell invasion. J Exp Med 180:

1535-1540.

52. Cuevas IC, Rohloff P, Sanchez DO, Docampo R (2005) Characterization of

farnesylated protein tyrosine phosphatase TcPRL-1 from Trypanosoma cruzi.

Eukaryot Cell 4: 1550-1561.

53. Nepomuceno-Silva JL, Yokoyama K, de Mello LD, Mendonca SM, Paixao JC, et al.

(2001) TcRho1, a farnesylated Rho family homologue from Trypanosoma cruzi:

cloning, trans-splicing, and prenylation studies. J Biol Chem 276: 29711-29718.

54. Ruiz FA, Rodrigues CO, Docampo R (2001) Rapid changes in polyphosphate content

within acidocalcisomes in response to cell growth, differentiation, and

environmental stress in Trypanosoma cruzi. J Biol Chem 276: 26114-26121.

55. Ault-Riche D, Fraley CD, Tzeng CM, Kornberg A (1998) Novel assay reveals

multiple pathways regulating stress-induced accumulations of inorganic

polyphosphate in Escherichia coli. J Bacteriol 180: 1841-1847.

127

FIGURES

Figure 4.1 TcRab32 localization in different life stages of T. cruzi. (A) Eluted and

desalted fractions (E1 to E9) obtained during recombinant TcRab32 purification from

E.coli as analyzed by SDS PAGE showing a band of correct size (42 KDa) corresponding

to the His-tagged protein. The 10% SDS PAGE gel was stained with Coommassie blue.

128

(B-D) TcRab32 was detected in the contractile vacuole bladder of epimastigotes (Epi),

trypomastigotes (Trypo), and intracellular amastigotes (Ama) with additional punctated

staining using specific antibodies against TcRab32 raised in mouse. (E) Western blot

analyses with TcRab32 antibody of lysates of wild-type trypomastigotes (T), amastigotes

(A) and epimastigotes (E), showing bands (arrows) corresponding to the endogenous

TcRab32 (26 kDa). The blots were sequentially probed with anti-tubulin antibodies, used

as loading control.

129

Figure 4.2 TcRab32 is digeranylated in vitro. (A) Comparison of the deduced amino

acid sequence of T. cruzi Rab32 with human Rab32. The presence of the “WDIAGQE”

and C terminal “CSC” domain is boxed in red and the presence of phenylalanine “F” at

position 194 is denoted in blue asterisk. (B)Radiolabelled proteins were analyzed by

SDS-PAGE on a 15% gel followed by autoradiography. Lane 1 in the presence of all

reactants; rTcRab32, epimastigote extract and (3H) GGPP, lanes 2 and 3 are negative

130

controls. Enzymatic assay performed for 30 min. A radioactive band of 42 KDa was

observed corresponding to the His-tagged protein.

Figure 4.3 Localization of GFP-TcRab32 mutants. GFP-TcRab32 prenylation-motif

mutants have a cytosolic localization. GFP-TcRab32DN mutants which mimic the GDP-

bound state of the protein have a punctated cytosolic localization. GFP-TcRab32DP

mutants that mimic the GTP-bound state of the proteins localize mainly to the membrane

of the CVC.

131

Figure 4.4 Lack of colocalization between GFP-TcRab32 and mitochondrial marker

and localization of mitochondrial marker is not affected in TcRab32 mutants. (A)

There is no colocalization between mitotracker (red) with GFP-TcRab32, as detected

with antibodies against GFP (green). Mitotracker (red) labels the mitochondria in GFP-

TcRab32 DP (B) and GFP-TcRab32DN (C) epimastigotes. Labeling of the GFP-

TcRab32DP and GFP-TcRab32DN was detected with anti-GFP (green).

132

Figure 4.5 Colocalization of GFP-TcRab32 and VP1 under osmotic stress. (A) There

is no colocalization between TbVP1 (red) with GFP-TcRab32 as detected with antibodies

against GFP (green) under isosmotic conditions. (B) Overlap between signals for TcVP1

(red) and GFP-TcRab32 (green) in the CVC occur under hyposmotic stress conditions.

133

Figure 4.6 Reduced short chain poly P and PPi levels in TcRab32DN epimastigotes

in comparison to wild type epimastigotes. Extracts from TcRab32DN epimastigotes

(DN) showed a 50% reduction in (A) PPi levels and an 80% reduction in (B) short chain

poly P levels with no significant changes in (C) long chain poly P levels in comparison to

GFP (C) and TcRab32 (OE) epimastigotes. TcRab32OE epimastigotes (OE) have levels

134

of PPi and short chain poly P slightly more than control epimastigotes. Values are means

± SD of three different experiments. *Differences are statistically significant as compared

to respective controls, p < 0.05 (Student’s t test). (D) Extracts of short chain PolyP

produced by OE, GFP and DN resolved by Urea PAGE and visualized by toluidine blue.

ORG represents migration of orange G dye. Levels of short chain poly P lower in lanes

labelled DN in comparison to lanes labelled OE and C.

Figure 4.7 Reduction in electron dense acidocalcisomes and considerable increase in

empty vacuole in TcRab32DN epimastigotes in comparison to wild type. (A)

Transmission electron microscopy (TEM) image from whole unstained and unfixed

TcRab32DN epimastigotes (DN) show the presence of numerous empty vacuoles with

complete loss of electron density of acidocalcisomes in comparison to wild type (WT)

135

epimastigotes. Scale bars, 2 µm (B) The number of acidocalcisomes per cell were

counted in 70 random cells from 2 independent experiments and the numeric distribution

of acidocalcisomes showed that majority of TcRab32DN epimastigotes had <10 or

between 11-20 electron-dense acidocalcisomes. (C and D) In order to quantitate the

phenotype of empty vacuoles we counted 50 random parasites in WT and DN after TEM

and found that there is a significant increase in parasites with empty vacuoles in DN w.r.t

WT. * indicates differences are statistically significant compared with respective

controls, p<0.05.

Figure 4.8 Traffic of trans-sialidase is not affected in TcRab32DN mutant

trypomastigotes. GFP-TcRab32 DN mutants show a punctated cytosolic localization as

136

detected with anti-GFP (green), while antibodies against TcTS still localize to the

surface.

Figure 4.9 Effect of TcRab32 mutations on the cell growth of epimastigotes and

their response to hyposmotic and hyperosmotic stress conditions. (A) Growth rate of

of epimastigotes expressing the dominant negative (DN) TcRab32 in comparison to GFP-

0

20000000

40000000

60000000

80000000

100000000

120000000

140000000

160000000

0 2 4 6 8 10

CE

LL

DE

NS

ITY

/ml

TIME (DAYS)

C

DN

137

expressing (C) epimastigotes. (B) Cells were pre-incubated in isosmotic buffer for 3 min

and then subjected to hyposmotic (final osmolarity = 150 mOsm) (C) or hyperosmotic

(final osmolarity = 650 mOsm) stress. Relative change in cell volume was followed by

monitoring absorbance at 550 nm by light scattering. As compared to wild-type cells

(WT), cells expressing GFPTcRab32DN (DN) failed to fully recover their volume after

hyposmotic stress and shrank less after hyperosmotic stress, while cells overexpressing

GFP-TcRab32 (OE) recovered their volume faster after hyposmotic stress and shrank

more after hyperosmotic stress. The response of the GFPTcRab32DP (DP) was very

similar to the wild-type cells. Values are means ± SD of three different experiments.

Asterisks indicate statistically significant differences, p<0.05, (Bonferroni’s multiple

comparison ‘‘a posteriori’’ test of one-way ANOVA) at all time points after induction of

osmotic stress.

Figure 4.10 Reduced infectivity of TcRab32 mutant trypomastigotes. (A and B)

Effect of TcRab32 overexpression (OE) or mutation (DN) on in vitro invasion by

138

trypomastigotes on host cell in comparison with control; wild type trypomastigotes (WT)

and GFP-expressing trypomastigotes (GFP). Values are mean ±SD (n = 3). * indicate that

differences are statistically significant compared with respective controls, p<0.05

(Ordinary one way ANOVA with Bonferroni post-test). (C) Punctated cytosolic

localization of GFP-TcRab32DN trypomastigotes and amastigotes as detected using

antibodies against GFP. DNA was stained with DAPI. Bars = 10 µm.

139

CHAPTER 5

CONCLUSION

Summary of key findings

At the beginning of my thesis work the role of the contractile vacuole complex (CVC) in

osmoregulation was well established in T. cruzi. As T. cruzi is exposed to different host

environments, the need for osmoregulation is critical in these parasites. Work from this

laboratory has shown the role of CVC not only in regulating volume under conditions of

hyposmotic stress [1], but also in shrinking of the parasites, under hyperosmotic stress

[2]. I got interested in studying the role of two Rab proteins: Rab11 (published in [3] and

Rab32 which were identified in a proteomic study of the CVC [4]. This study revealed

the presence of a cohort of proteins which usually have function in regulation of

intracellular traffic, vesicle fusion and protein secretion. Only a few Rab proteins:

TcRab7, TcRab5, and TcRab4 had been studied in T. cruzi, and molecular events of

vesicle trafficking were still poorly understood [5] [6] [7]. Although the localization of

some of these Rabs has been demonstrated, there was no functional study conducted with

them. Our study provides the first experimental evidence of the mechanistic role of two

Rab GTPases in T. cruzi: TcRab11 and TcRab32.

Mutation of Rab proteins has been of major value in determining the physiological role of

Rabs in other cell systems. The approach is based upon the ability to make GTP- and

GDP-locked forms of the proteins, with dominant positive and negative effects,

140

respectively, over the endogenous Rab protein. We applied this same approach for

studying TcRab32 and TcRab11.

Results with the dominant negative TcRab11 (TcRab11DN) were clear: there was a

defect in osmoregulation in the Rab11 mutant parasites suggesting that volume regulation

requires Rab11-dependent processes, such as membrane fusion. There was also a defect

in traffic of GPI-anchored trans-sialidase to the surface and as a result, an inability to

invade host cells properly in comparison to wild type parasites. Proper trafficking of

surface proteins is important for evading host immune defenses and to support host

invasion. The observed phenotype of perturbation in traffic was not a side effect of

mutating a contractile vacuole complex resident protein as the morphology of the CVC

was not affected in the mutant parasites. The observed phenotype was specific for the

traffic of trans-sialidase because the membrane traffic of other proteins (both GPI- and

non GPI-anchored) was not affected at all. The traffic of trans-sialidase was also

unaffected in the Rab32 mutant trypomastigotes, further suggesting the uniqueness of

each of these Rab proteins. Our study provides support for a role of the CVC as a

trafficking hub in addition to its role in osmoregulation. TcRab11 is developmentally

regulated and our results show that it has specific roles in different life cycle stages of T.

cruzi, suggesting different requirements of the protein for survival in the insect and

mammalian host.

The hypothesis that the CVC is a trafficking hub and an equivalent to early/recycling

endosomes of other eukaryotes was additionally supported by the phenotypic changes

occurring after mutation of the CVC-located TcRab32. Acidocalcisomes were less

numerous and electron-dense, and deficient in PPi and polyP, suggesting a deficient

141

traffic of proteins involved in the biogenesis of these organelles. This phenotype

suggested the traffic of proteins from the CVC to the acidocalcisomes. This ultimately

resulted in a reduced ability of these parasites to invade host cells.

The purpose of my thesis was two-fold: to investigate the function of the CVC as a

trafficking hub and to provide a detailed analysis of the roles of TcRab11 and TcRab32 in

this process. The CVC is a fascinating complex product of evolution. Much remains to be

studied about how this organelle evolved. It is clear that this organelle is central to

parasite growth, development and pathogenesis.

Future work

Does the Contractile Vacuole Complex (CVC) in T. cruzi have a role in calcium

homeostasis?

A role of the CVC in calcium homeostasis has been proposed in the amoeba D.

discoideum and in Paramecium tetraurelia on the basis of the presence in these

organelles of different calcium transporters, such as a Ca2+

-ATPase [8,9] and an inositol

1,4,5-trisphosphate receptor (IP3R) [10]. Ca2+

-ATPase PAT1, usually present in the

membrane of the CVC moves to the plasma membrane when cells are incubated at high

Ca2+

concentrations. The contractile vacuole membranes in Dictyostelium are also

extremely rich in calmodulin [11]. The identification of peptides corresponding to a

calcium channel (Tc00.1047053504105.130) and an IP3/ryanodine receptor

(Tc00.1047053509461.90) in subcellular fractions of T. cruzi enriched in the CVC

implies that the CVC could have a possible role in Ca2+

signaling. Besides, fusion events

may require a local calcium signal, as Ca2+

controls priming steps and prepares vesicles

for fusion [12].

142

The role of the CVC as a trafficking hub remains to be fully characterized

The presence of SNAREs, such as SNARE2.1 (TcCLB.507625.183), SNARE2.2

(TcCLB.53506715.50), and VAMP1 (TcCLB.53511627.60) in the proteomic data of T.

cruzi CVC and their localization to the CVC, suggests the existence of several membrane

to membrane interactions that facilitate vesicle docking for subsequent fusion. The

vesicle associated membrane proteins (VAMPs) belong to the R-SNAREs group.

Paramecium tetraurelia RSNARE PtSyb2-2 has been shown to localize to the entire

contractile vacuole complex [13], and its orthologue in T. cruzi (VAMP1,

TcCLB.53511627.60) was detected in the CV bladder of epimastigotes submitted to

hyposmotic stress. This could be indicative of a possible role of these contractile vacuole

complex-localized SNAREs in fusion/fision events between the bladder and the

spongiome or between the CVC and acidocalcisomes during swelling or collapse of the

CVC. In this regard, a study in Dictyostelium found that there is an interaction between

adaptor protein AP180 (present in clathrin-coated vesicles on contractile vacuole

bladders) and the contractile vacuole-localized SNARE, Vamp7, especially during fusion

events of the CVC [14]. Orthologues of both AP180 (TcCLB.53503449.30) and VAMP7

(TcCLB.53511627.60) are present in the CVC of T. cruzi. All this reflects that a

multitude of vesicle fusion and membrane interaction events probably exists in the CVC

of T. cruzi.

To identify the interaction partners of TcRab32 and the study of their cell-type

specific regulation

Presently we are immunoprecipitating proteins from the GFP-TcRab32-expressing cell

line and doing mass spectrometric analysis to identify potential interaction partners of

143

TcRab32. Candidates of interest are VAMP7 and AP-3, which were identified in other

eukaryotes as interaction partners for Rab32 [15]. VAMP7, which is a vesicle SNARE

protein, is highly conserved across eukaryotes and the identification of an interaction

between CVC-resident TcRab32 and VAMP7 in T. cruzi would further suggest a link

between higher and lower eukaryotes. The delta subunit of the AP-3 complex, whose role

in acidocalcisome biogenesis has been studied by our lab [16], is found to interact with

VAMP7 and direct its traffic along the endocytic pathway in mammalian cells. A

possible interaction between TcRab32, VAMP7 and AP-3 might serve as a pre-requisite

for the correct traffic of cargo to acidocalcisomes.

Precise regulation of Rab-GTPases requires activity and binding with Rab GAP (GTPase

Activating Protein), Rab GEF (guanine nucleotide exchange factor) and Rab GDI

(guanosine nucleotide dissociation inhibitor). Rab GEFs or Rab GAPs are activated at the

right place and time. It is probable that the CVC-resident TcRab32 gets recruited at

domains of endosomes. The failure to detect TcRab32 in the acidocalcisome membrane

could be attributed to sensitivity issues of the immunofluorescence technique used in our

experiments; or it can be that TcRab32 remain bound to vesicles (corresponding to the

punctate staining detected) but they do not fuse with the acidocalcisomes. Understanding

how the sequential activation of Rab GTPases is achieved during vesicle trafficking is a

central question in the study of the cell biology of these parasites.

Possible changes in the acidocalcisome proteome in the Rab32 mutant parasites?

Experiments can be conducted to demonstrate the direct effect of TcRab32 mutation in

these parasites and its effect (direct or indirect) on the membrane composition of the

acidocalcisome. As the TcRab32DN parasites suffer a loss in the level of short chain

144

polyP (~80% reduction), without any change in long chain polyP it seems that the

TcVTC complex (Vacuolar Transporter Chaperone Complex), which is mainly involved

in the synthesis of short chain polyP [17,18] is affected. The use of antibodies against

components of the VTC complex will be appropriate to investigate if there is a loss or

reduction in any of the components. An alternative will be to do proteomic analysis of

acidocalcisomes of TcRab32 mutant parasites to study whether there is an altered content

of membrane proteins. A detailed analysis has to be made while interpreting the data with

appropriate controls to minimize false positive data and to subtract background. These

data are often biased against proteins that are expressed in low abundance.

To investigate how cargo destined to the acidocalcisome is sorted out from lysosomal

cargo

The acidocalcisome is a lysosome-related organelle (LRO) whose biogenesis is

apparently dependent on protein sorting from the Golgi [19]. How cargo destined for the

acidocalcisome is sorted from the lysosomal cargo at the trans-Golgi should be an

interesting area to explore further. Most of the LROs coexist with conventional

lysosomes as distinct organelles in the same cells [20]. What is the signal that avoids their

undesirable fusion with lysosomes? Lysosomal hydrolases and membrane proteins follow

the same route that comprises of the ER, Golgi and trans-Golgi network and endosomes

to the lysosome (reviewed in [21]. The identification of specific receptors or individual

adaptor proteins or lipid components, or dissection of the molecular machinery on the

membrane of the acidocalcisome to look for particular traffic mediators would be

relevant. To ensure that the TcRab32 mediates sorting to the acidocalcisome and has no

effect on the lysosomal traffic we can investigate whether the localization of the

145

membrane glycoprotein p67 (a marker of the lysosome) [22] is unaltered in the Rab32

mutant parasites. Preliminary work from our lab has shown, with Trypanosoma brucei

AP-3, that the lysosomal traffic route is separated from that of the LRO (acidocalcisome

in this case) route [19].

CVC as a potential drug target?

Despite T. cruzi trans-sialidase (TcTS) being known for several years our understanding

of its intracellular trafficking is still limited. TS has been identified as a potential target

for drug discovery and design. Besides having key role in host cell invasion,

pathogenesis, and host immune system evasion, trans-sialidase is not present in the

mammalian host, thus making it a potential drug candidate. The identification of the

specific role of TcTS in infection has been difficult to demonstrate in the past because of

the impossibility of doing knockouts of the considerable number of gene copies encoding

this protein scattered through the genome of this parasite. The mechanistic details now

known, through this work, regarding the traffic of TcTS in these parasites can be used in

rational drug design experiments aiming at effective treatments of Chagas disease.

As sorting of GPI-anchored surface proteins responsible for invasion occurs at the CVC,

disrupting the integrity of the CVC may act as a potential block to the surface traffic of

the antigens, hence providing a mechanism for control of T. cruzi invasion. A deeper

understanding of the intracellular traffic in T. cruzi will potentially open the door to new

rational therapeutics. Besides, it will be helpful to dissect the information regarding key

biological processes of these parasites and its effect on pathogenesis.

146

Hopefully this will just be the start in understanding the multi-faceted role of the

contractile vacuole complex and unravelling its potential as a drug target, thus opening

doors to new therapeutics.

147

REFERENCES

1. Rohloff P, Docampo R (2008) A contractile vacuole complex is involved in

osmoregulation in Trypanosoma cruzi. Exp Parasitol 118: 17-24.




Trypanosoma cruzi. J Biol Chem 286: 43959-43971.

3. Niyogi S, Mucci J, Campetella O, Docampo R (2014) Rab11 Regulates Trafficking of

Trans-sialidase to the Plasma Membrane through the Contractile Vacuole

Complex of Trypanosoma cruzi. PLoS Pathog 10: e1004224.

4. Ulrich PN, Jimenez V, Park M, Martins VP, Atwood J, 3rd, et al. (2011) Identification

of contractile vacuole proteins in Trypanosoma cruzi. PLoS One 6: e18013.

5. Araripe JR, Cunha e Silva NL, Leal ST, de Souza W, Rondinelli E (2004)

Trypanosoma cruzi: TcRAB7 protein is localized at the Golgi apparatus in

epimastigotes. Biochem Biophys Res Commun 321: 397-402.

6. Araripe JR, Ramos FP, Cunha e Silva NL, Urmenyi TP, Silva R, et al. (2005)

Characterization of a RAB5 homologue in Trypanosoma cruzi. Biochem Biophys

Res Commun 329: 638-645.

7. Ramos FP, Araripe JR, Urmenyi TP, Silva R, Cunha e Silva NL, et al. (2005)

Characterization of RAB-like4, the first identified RAB-like protein from

Trypanosoma cruzi with GTPase activity. Biochem Biophys Res Commun 333:

808-817.

8. Plattner H (2013) Contractile vacuole complex--its expanding protein inventory. Int

Rev Cell Mol Biol 306: 371-416.

9. Bohme R, Bumann J, Aeckerle S, Malchow D (1987) A high-affinity plasma

membrane Ca2+-ATPase in Dictyostelium discoideum: its relation to cAMP-

induced Ca2+ fluxes. Biochim Biophys Acta 904: 125-130.

148

10. Ladenburger EM, Korn I, Kasielke N, Wassmer T, Plattner H (2006) An Ins(1,4,5)P3

receptor in Paramecium is associated with the osmoregulatory system. J Cell Sci

119: 3705-3717.


Dictyostelium amoebae. J Cell Biol 121: 1311-1327.

12. Neher E (2012) Introduction: regulated exocytosis. Cell Calcium 52: 196-198.

13. Schilde C, Wassmer T, Mansfeld J, Plattner H, Kissmehl R (2006) A multigene

family encoding R-SNAREs in the ciliate Paramecium tetraurelia. Traffic 7: 440-

455.

14. Wen Y, Stavrou I, Bersuker K, Brady RJ, De Lozanne A, et al. (2009) AP180-

mediated trafficking of Vamp7B limits homotypic fusion of Dictyostelium

contractile vacuoles. Mol Biol Cell 20: 4278-4288.

15. Schafer IB, Hesketh GG, Bright NA, Gray SR, Pryor PR, et al. (2012) The binding of

Varp to VAMP7 traps VAMP7 in a closed, fusogenically inactive conformation.

Nat Struct Mol Biol 19: 1300-1309.

16. Huang G, Bartlett, P.D., Thomas, A.P., Moreno, S.N.J., Docampo, R. (2013)

Acidocalcisomes of Trypanosoma brucei have an inositol 1,4,5-trisphosphate

receptor that is required for growth and infectivity. Proc Natl Acad Sci USA in

press.

17. Lander N, Ulrich PN, Docampo R (2013) Trypanosoma brucei vacuolar transporter

chaperone 4 (TbVtc4) is an acidocalcisome polyphosphate kinase required for in

vivo infection. The Journal of biological chemistry 288: 34205-34216.

18. Ulrich PN, Lander N, Kurup SP, Reiss L, Brewer J, et al. (2014) The acidocalcisome

vacuolar transporter chaperone 4 catalyzes the synthesis of polyphosphate in

insect-stages of Trypanosoma brucei and T. cruzi. The Journal of eukaryotic

microbiology 61: 155-165.



growth and virulence of Trypanosoma brucei. J Biol Chem 286: 36619-36630.

20. Marks MS, Seabra MC (2001) The melanosome: membrane dynamics in black and

white. Nat Rev Mol Cell Biol 2: 738-748.

149

21. Braulke T, Bonifacino JS (2009) Sorting of lysosomal proteins. Biochim Biophys

Acta 1793: 605-614.

22. Tazeh NN, Silverman JS, Schwartz KJ, Sevova ES, Sutterwala SS, et al. (2009) Role

of AP-1 in developmentally regulated lysosomal trafficking in Trypanosoma

brucei. Eukaryot Cell 8: 1352-1361.

role of the contractile vacuole complex as a ......relies on protein secretion of...

Documents