roles of a putative tumor suppressor gene, chc1l, in ... · roles of a putative tumor suppressor...
TRANSCRIPT
![Page 1: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/1.jpg)
Roles of a Putative Tumor Suppressor Gene, Chc1L, in
Tumorigenesis
By
David Spillane
MSc candidate
University of Toronto
Institute of Medical Science
Supervisor: Dr. Xiao-Yan Wen
Copyright 2012
![Page 2: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/2.jpg)
ii
Abstract
Roles of a Putative Tumor Suppressor Gene, Chc1L, in
Tumorigenesis
David Spillane
Master of Science 2012
Institute of Medical Science, University of Toronto
Human chromosome 13q14 has been identified as one of the hotspots of deletion in prostate
cancer, multiple myeloma, and chronic lymphocytic leukemia. Chromosome Condensation 1-like
(CHC1L) is an uncharacterized gene in this region. CHC1L is found within the smallest common
region of loss of heterozygosity in prostate cancer, and its decreased expression is linked to
pathogenesis and progression of both prostate cancer and multiple myeloma. In the present
study, we have generated Chc1L gene knockout mice and demonstrated that loss of this gene
increases tumorigenesis in two year old mice. Knockout and heterozygous mice are predisposed
to development of Histiocytic Sarcoma and Histiocyte-Associated Lymphoma. Bone marrow and
splenic cells from 8-12 week old knockout mice have elevated viability ex vivo. These data
provide the first direct evidence that CHC1L is a tumor suppressor gene involved in suppression
of histiocyte-rich neoplasms.
![Page 3: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/3.jpg)
iii
Acknowledgements
I would like to thank all of the people that have provided me with guidance over the past
two years.
My supervisor, Dr. Xiao-Yan Wen, was a great mentor and provided incredible expertise
in studying mouse model systems. His open-door policy allowed for many interesting
discussions and meant that his guidance was always just down the hallway.
I would like to thank my program advisory committee members for helping me all along
the way: Dr. Mingyao Liu, who was also my first year co-supervisor, for being a generous source
of scientific philosophy and providing excellent suggestions for plans of study; Dr. Aaron
Schimmer, for offering excellent constructive criticism as well as ways to improve my research.
Thank you to everyone that has helped me with the technical aspects of my research: Dr.
Ding Yan Wang, for teaching me several techniques including Western Blot and PI staining;
Youdong Wang, for help with mouse work; Pamela Plant, for showing me how to properly
extract tissue RNA as well as other molecular techniques; Christopher Spring, for teaching me
the art of flow cytometry.
Also, thank you to the other members of the Wen lab. You have become my closest
friends, and I wish you all the best in your future endeavors.
I would like to thank the Ontario Graduate Scholarship program for providing me with
funding.
Finally, thank you to my family and friends for providing me with support throughout my
academic career and life.
![Page 4: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/4.jpg)
iv
Contributions
In addition to acknowledging those whose expertise has guided me to this point, I would
also like to thank the people whose work has directly contributed to the results described here.
The Blimp1-Cre, and Chc1LloxP/+
mouse strains were created by Dr. Ding Yan Wang prior
to my arrival in the Wen lab.
Also, special thanks to Dr. Susan Newbigging for providing expert histopathological
analyses of all our samples, as well as her team at The Toronto Center for Phenogenomics for
preparing histological samples.
![Page 5: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/5.jpg)
v
Table of Contents
Abstract ......................................................................................................................................................... ii
Acknowledgements ...................................................................................................................................... iii
Contributions ............................................................................................................................................... iv
Table of Contents .......................................................................................................................................... v
List of Figures ............................................................................................................................................. viii
List of Tables ................................................................................................................................................ xi
List of Abbreviations .................................................................................................................................... xi
Chapter 1: Introduction ................................................................................................................................ 1
1.1 The burden of cancer .......................................................................................................................... 1
1.2 Chromosome 13q14 harbors putative tumor suppressor genes ........................................................ 3
1.2.1 13q14 deletions in CLL, MM and PC ............................................................................................ 3
1.2.2 Minimally deleted regions at 13q14 ............................................................................................ 6
1.2.3 Putative tumor suppressors at 13q14 ........................................................................................ 10
1.3 Chromosome Condensation 1-like: Structure and putative function ............................................... 16
1.3.1 CHC1L: Gene structure, mRNA isoforms, and protein product ................................................. 16
1.3.2 Function of CHC1L RCC1-like domain ........................................................................................ 19
1.3.3 RanGTPase and cancer ............................................................................................................... 26
1.4 Histiocytic Sarcoma ........................................................................................................................... 28
1.4.1 Murine HS .................................................................................................................................. 30
1.4.2 Pathway involvement in HS pathogenesis ................................................................................. 31
Chapter 2: Research aims and hypotheses ................................................................................................. 35
Chapter 3: Materials and Methods ............................................................................................................. 36
3.1 Mice and gene knockout strategies .................................................................................................. 36
![Page 6: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/6.jpg)
vi
3.2 Genotyping ........................................................................................................................................ 37
3.3 Gel purification.................................................................................................................................. 38
3.4 RNA extraction and cDNA synthesis ................................................................................................. 38
3.5 Histological preparation .................................................................................................................... 39
3.6 Histological analysis .......................................................................................................................... 40
3.7 Flow cytometry ................................................................................................................................. 41
3.8 Bone marrow and spleen primary culture ........................................................................................ 42
3.9 MTT assay .......................................................................................................................................... 43
3.10 PI staining ........................................................................................................................................ 44
3.11 Protein lysate preparation .............................................................................................................. 44
3.12 Polyacrylamide gel electrophoresis ................................................................................................ 45
3.13 Western Blotting ............................................................................................................................. 46
3.14 Transfection protocol ...................................................................................................................... 47
3.15 Statistical methods .......................................................................................................................... 48
Chapter 4: Results ....................................................................................................................................... 49
4.1 Generation of Chc1L gene knockout mice ........................................................................................ 49
4.2 HET and KO mice succumb to Histiocytic Sarcoma and Histiocyte-Associate Lymphoma ............... 53
4.3 Peripheral blood cell populations are unaffected by loss of Chc1L .................................................. 72
4.4 Splenocytes and bone marrow cells from young mice have increased viability ex vivo .................. 75
Chapter 5: Conclusions ............................................................................................................................... 77
Chapter 6: Discussion .................................................................................................................................. 79
6.1 Knockout strategy ............................................................................................................................. 79
6.2 Early phenotype ................................................................................................................................ 81
6.3 HS and HAL pathogenesis ................................................................................................................. 83
6.4 Prostate Cancer and Multiple Myeloma ........................................................................................... 85
![Page 7: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/7.jpg)
vii
6.5 Penetrance and haploinsufficiency ................................................................................................... 87
6.6 Transdifferentiation .......................................................................................................................... 90
Chapter 7:.................................................................................................................................................... 93
Future Directions ........................................................................................................................................ 93
7.1 Validate increased prevalence of HS ................................................................................................ 93
7.2 Investigate B lymphocyte transdifferentiation and myeloma .......................................................... 95
7.3 Investigation of mechanistic pathway .............................................................................................. 95
7.4 Clinical disease association studies ................................................................................................... 98
References .................................................................................................................................................. 99
![Page 8: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/8.jpg)
viii
List of Figures
Figure 1 Gene map and minimum deleted regions at 13q14 in human cancer ........................................... 9
Figure 2 Human CHC1L transcript isoforms ................................................................................................ 10
Figure 3 Human CHC1L protein structure ................................................................................................... 18
Figure 4 The Ran cycle and its role in nucleocytoplasmic transport .......................................................... 21
Figure 5 Role of RanGTPase during mitosis ................................................................................................ 22
Figure 6 Chc1L gene targeting strategy and generation of knockin mice .................................................. 51
Figure 7 PCR and RT-PCR strategies ............................................................................................................ 52
Figure 8 Knockout of Chc1L in mice does not result in PC .......................................................................... 53
Figure 9 Tumor incidence observed by gross pathology ............................................................................ 56
Figure 10 Tumor incidence per organ ......................................................................................................... 57
Figure 11 Incidence of multiple organ tumors ............................................................................................ 58
Figure 12 Tumor cell morphology and pathological findings ..................................................................... 61
Figure 13 Spleen H+E .................................................................................................................................. 62
Figure 14 Lymph node H+E ......................................................................................................................... 63
Figure 15 Liver H+E ..................................................................................................................................... 64
Figure 16 Small Intestine H+E ..................................................................................................................... 64
Figure 17 Lymph node IHC .......................................................................................................................... 68
Figure 18 Spleen IHC ................................................................................................................................... 69
Figure 19 Liver IHC ...................................................................................................................................... 70
Figure 20 Other IHC findings ....................................................................................................................... 71
Figure 21 Circulating plasma cells ............................................................................................................... 74
Figure 22 Cell cycle analysis and viability.................................................................................................... 76
Figure 23 Human cell line analysis of CHC1L expression ............................................................................ 97
![Page 9: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/9.jpg)
ix
Figure 24 siRNA transfection optimization ................................................................................................. 97
![Page 10: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/10.jpg)
x
List of Tables
Table 1 PCR primer details .......................................................................................................................... 37
Table 2 PCR buffer and master mix recipes ................................................................................................ 38
Table 3 Antibodies used for flow cytometry ............................................................................................... 42
Table 4 Western Blotting antibodies .......................................................................................................... 42
Table 5 Tumor distribution ......................................................................................................................... 55
Table 6 Summary of histopathological analyses ......................................................................................... 64
Table 7 Summary of peripheral blood cell populations measured by flow cytometry .............................. 72
![Page 11: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/11.jpg)
xi
List of abbreviations
aa: amino acid
AKT: protein kinase B
ARLTS1: ADP-ribosylation factor-like 11
Arf: Alternate Reading Frame tumor
suppressor, aka p16
ATP: adenosine triphosphate
BCL: B cell lymphoma
BCL2: B cell lymphoma 2
BOB.1: POU domain, class 2, associating
factor 1
Blimp1: B lymphocyte-induced maturation
protein 1
BRCA1: Breast Cancer 1, early onset
BRCA2: Breast Cancer 2, early onset
BTB/POZ: Broad Complex, Tram-Trac,
Bric-a-Brac/Pox virus and Zinc finger
CCND1: cyclin D1
CD: Cluster of Differentiation
CDR: Commonly deleted region
CEBPβ: CCAAT-enhancer-binding protein
β
CHC1L: Chromosome Condensation 1-Like
CLL: Chronic Lymphocytic Leukemia
CML: Chronic Myelogenous Leukemia
COP9: constitutive photomorphogenic
homolog 9
COPS4: COP9 signalosome complex
subunit 4
CRM1: Chromosome region maintenance
protein-1
CSN: COP9 signalosome
CUL: Cullin
DICE1: deleted in cancer cells 1
DLEU1: deleted in lymphocytic leukemia 1
DLEU2: deleted in lymphocytic leukemia 2
DLEU7: deleted in lymphocytic leukemia 7
Dmp1: dentin matrix acidic phosphoprotein
1
DU145: human prostate cancer cell line
E2A: ITF1 Immunoglobulin enhancer
binding, aka Transcription factor 3
EBF1: Transcription factor COE1
ECH: ECHIDNA protein
ENU: N-ethyl-N-nitrosourea
ERK: mitogen activated protein kinase
Ex4-F, Ex5-R: Primers for detection of
Chc1L transcript
F4/80: EGF-like module-containing mucin-
like hormone receptor-like 1
![Page 12: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/12.jpg)
xii
FISH: Fluorescent In Situ Hybridization
FL: Follicular Lymphoma
Ink4a: Cyclin dependent kinase inhibitor
2A, aka p16
FOXOA1: Forkhead in human
rhabdomyosarcoma A1
FRET: Fluorescence resonance energy
transfer
GAP: GTPase activation protein
GATA1: GATA binding factor 1
GATA2: GATA binding factor 2
GEF: Guanine nucleotide exchange factor
GFP: Green fluorescent protein
GM-CSF: Granulocyte-macrophage colony-
stimulating factor
H+E: hematoxylin and eosin
HA tag: human Influenza hemagglutinin
HAL: Histiocyte-Associated Lymphoma
HE: Heterozygote
HECT: Homologous to the E6-
AP Carboxyl Terminus
HeLa: cervical cancer cell line
HepG2: liver cancer cell line
HERC: Homologous to the E6-
AP Carboxyl Terminus and Regulator of
Chromosome Condensation-1 protein
HS: Histiocytic Sarcoma
HURP: hepatoma up-regulated protein
IgK: immunoglobulin κ
IHC: Immunohistochemistry
Int4-F, Int4-R: primers for detection of WT
locus
JH: immunoglobulin heavy chain joining
region
KCNRG: Potassium channel regulator
Keap-1: Kelch-like ECH-associated protein
1
Ki67: antigen identified by monoclonal
antibody Ki-67
KMS11: myeloma cell line
KO: Knockout
LNCaP: prostate cancer cell ine
LOH: Loss of Heterozygosity
LPS: lipopolysaccharide
M-CSF: macrophage colony stimulating
factor
Mac-2: Cyclophilin C-associated protein
MDM2: murine double minute 2
MDR: Minimally Deleted Region
MEF: mouse embryonic fibroblast
MEK: mitogen activated protein kinase
kinase
MGUS: monoclonal gammopathy of
undetermined significance
![Page 13: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/13.jpg)
xiii
miR15/16: microRNA cluster 15a/16-1
MM: Multiple Myeloma
MTT: (3-(4,5-Dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide
MY5: myeloma cell line
Nedd8: Neural precursor cell expressed,
developmentally down-regulated 8
Neh2 domain: Nrf2-ECH homology domain
NF-κB: nuclear factor kappa-light-chain-
enhancer of activated B cells
NLS: nuclear localization signal
NOD-SCID: nonobese diabetic/severe
combined immunodeficiency
Nrf2: Nuclear factor (erythroid-derived 2)-
like 2
NZB: new Zealand black
Oct2: POU domain, class 2, transcription
factor 2
p27: Cyclin-dependent kinase inhibitor 1B
p53: protein 53
Pax5: Paired box protein 5
PC: Prostate Cancer
PC3: prostate cancer cell line
PCLI: plasma cell labeling index
PHF11: Plant homeodomain finger protein
11
PI3K/Akt pathway: phosphoinositide 3-
kinase/Protein Kinase B pathway
RanBP1: Ran binding protein 1
RanBP2: Ran binding protein 2
RanGDP: Ran in GDP-bound form
RanGTP: Ran in GTP-bound form
RanGAP: RanGTPase Activating Protein
RanGEF: RanGTP Exchange Factor
RanQ69L: constitutively active Ran mutant
RanT24N: constitutively inactive Ran
mutant
RB1: Retinoblastoma-1
RCBTB1: Regulator of chromosome
condensation and BTB domain-containing
protein 1
RCC1: Regulator of Chromosome
Condensation 1
RFP2: Ret finger protein 2
RING: Really Interesting New Gene
RLD: RCC1-like domain
RNASEH2B: ribonuclease H2, subunit B
RT-PCR: reverse transcription-polymerase
chain reaction
SAF: spindle assembly factor
SCDR: Smallest Commonly Deleted Region
SETDB2: Su(var) 3-9, enhancer-of-zeste,
trothorax domain-containing protein
possessing potential histone H3K9
methyltransferase activity
SMM: smoldering multiple myeloma
![Page 14: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/14.jpg)
xiv
TC-F, TC-R: primers for detection of
knockout allele
TNF: Tumor Necrosis Factor
TSG: tumor suppressor gene
TPX2: Targeting protein for Xenopus plus
end-directed kinesin-like protein
TUNEL: Terminal deoxynucleotidyl
transferase dUTP nick end labeling
U266: myeloma cell line
WHO: World Health Organization
WNT3A: wingless type mouse mammary
tumor virus integration site family, member
3A
WT: Wild-type
ZHX-2: Zinc fingers and homeoboxes
protein 2
![Page 15: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/15.jpg)
1
Chapter 1: Introduction
1.1 The burden of cancer
Every year, approximately 12 million people are diagnosed with cancer worldwide
(Jemal et al. 2011). Eventually, these 12 million newly diagnosed patients will contribute to the
almost 8 million annual cancer-caused deaths, making the disease the second most prevalent
cause of death in developing countries, and the leading cause in the developed world (Jemal et
al. 2011).
Hematopoietic neoplasms account for approximately 8% of new cancer diagnoses within
the developed world (Jemal et al. 2011). They can be divided into three main types: lymphoma,
which presents as a solid tumor of lymphocytes typically affecting the lymph nodes; leukemia, a
cancer of circulating malignant hematopoietic cells, affecting the blood and bone marrow;
Multiple Myeloma, a cancer of the plasma cell, which often aggregate within bone causing
deleterious effects on bone marrow hematopoiesis, amongst other symptoms. As with other
cancers, hematopoietic neoplasms are treated with various combinations of chemotherapy,
radiotherapy, and immunotherapy. Additionally, they are often treated by bone marrow stem cell
transplantation, whereby the patient’s malignant cell population as well as his/her body’s normal
bone marrow stem cells are destroyed and replaced with the patient’s own hematopoietic stem
cells (autologous), or those of an appropriate donor (allogeneic).
![Page 16: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/16.jpg)
2
Although much progress has been made in understanding cancer and its pathogenesis,
many forms remain incurable. This is largely due to heterogeneity between cancers. While
virtually any cell in the human body may become neoplastic, even cancers of the same cell type
retain a remarkable heterogeneity, and thus effective treatments remain elusive for many cancer
subtypes. Part of the reason for this is the variety of genetic lesions that may promote cancer
development. Molecular profiling of cancer subtypes is a quickly emerging field dedicated to
grouping cancers of a particular tissue type into subgroups that bear similar expression profiles.
This has recently been performed in considerable detail for breast cancer (Curtis et al. 2012).
The goals of this endeavour are the identification of the affected pathways common to various
subgroups that may be therapeutically targetable, and with an improved understanding of the
cancer’s molecular biology will also come improved screening approaches, and more accurate
prognostic evaluation.
The subgrouping of cancer types relies on the identification of frequently occurring
mutations and changes in gene expression of particular genes, which implicates the pathways
that these genes act upon in neoplastic development. Once recognized, novel molecular pathways
may be targeted therapeutically. For example, the characterization of the Philadelphia
Chromosome in 1960 (Nowell and Hungerford 1961) and the fusion protein bcr-abl lead to the
discovery of drugs like Gleevec that were able to block the ATP binding site (Takimoto CH
2008) of the constitutively active tyrosine kinase, greatly improving the odds of survival for
patients suffering from Chronic Myelogenous Leukemia (CML).
The laboratory mouse is a powerful model organism for the validation of gene function as
it relates to cancer pathogenesis. Originally, mice were used to study cancer through examination
![Page 17: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/17.jpg)
3
of tumor xenograft and carcinogenesis models. However, the establishment of the first transgenic
mouse lines reiterating activating mutations in proto-oncogenes (Brinster et al. 1984; Stewart et
al. 1984), which were eventually complemented by gene targeting technology to knock out
tumor suppressor genes (Donehower et al. 1992; Jacks et al. 1992), allowed a reversal in how
genes involved in cancer were studied: Mutations frequently observed in human cancer through
the conventional forward genetics approach could be mirrored in an animal model, validating the
proneoplastic effects of the mutation if the genetically engineered strain developed cancer.
Changes in expression levels of other genes can be measured using microarray chips to identify
downstream effector pathways leading to neoplastic progression. Additionally, if the cancer
pathogenesis in a genetically engineered model closely recapitulates the human form of the
disease, the mouse model may be used for detailed analysis of tumor progression, as well as
screening of therapeutic compounds.
1.2 Chromosome 13q14 harbors putative tumor suppressor genes
1.2.1 13q14 deletions in CLL, MM and PC
Chronic Lymphocytic Leukemia:
Chronic lymphocytic leukemia (CLL) is a highly heterogenous B cell neoplasm
comprising many genomic profiles and clinical courses (Chiorazzi et al. 2005). It is the most
common adult leukemia is the Western world (Dohner et al. 2000).
![Page 18: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/18.jpg)
4
The most common genomic lesions are deletions within chromosome arms 13q, 11q, 17p
and 7q, as well as trisomy of chromosome 12, which collectively occur in approximately 80% of
patients (Dohner et al. 2000). Deletions affecting the 13q arm are highly heterogenous, but the
most common is deletion of region 13q14, affecting a single allele in approximately 70% of
cases, while biallelic deletions occur in 19% of CLL patients (Dewald et al. 2003). Patients with
a large percentage of 13q-deleted nuclei and/or large deletions that include the RB1 locus have a
shorter time-to-treatment, and often require an aggressive clinical course (Dal Bo et al. 2011).
Despite these associations, as the sole abnormality, monoallelic 13q14 deletion as
determined by fluorescent in situ hybridization (FISH) remains associated with a good prognosis
compared to CLL with no cytogenetic abnormalities (Chena et al. 2008).
Multiple Myeloma:
Multiple myeloma (MM) is presently an incurable hematopoietic neoplasm of plasma
cells. It is characterized by several common genetic changes, including deletion of 13q14 (40-
50% of patients) (Fonseca et al. 2004), amplification of 1q21 (~40% of patients) (Hanamura et
al. 2006), deletion of 17p13 (~20% of patients) (Fonseca et al. 2003), and IgH translocations
(Fonseca et al. 2009).
Del(13q14) is strongly associated with an elevated plasma cell labelling index (PCLI)
(Hose et al. 2011; Li et al. 2011), which is itself an important independent prognostic factor in
newly diagnosed MM. Additionally, the proportion of plasma cells carrying deletion within 13q
is observed to increase as the disease progresses from Monoclonal Gammopathy of
Undetermined Significance to Smoldering Multiple Myeloma, and finally to MM (Lopez-Corral
![Page 19: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/19.jpg)
5
et al. 2011). Del(13q14) remains a negative predictor of remission (Schilling et al. 2008). 13q14
loss has also been correlated with increased bone marrow microcirculation, and this should be
taken into account when considering therapies with antiangiogenic activity (Schreiber et al.
2000; Hillengass et al. 2008). However, the prognostic implications of 13q deletions remain to
be fully elucidated in MM. Originally thought to imply a worsened prognosis (Zojer et al. 2000),
13q14 deletions remain associated with shortened overall and event-free survival by univariate
analysis, which considers a single variable in relation to prognosis (Avet-Loiseau et al. 2007).
However, as 13q14 deletion often co-occur with other mutations, when multiple genetic lesions
are considered and related to prognosis (multivariate analysis), only del(17p) and t(4:14) are
independent genetic prognostic indicators (Avet-Loiseau et al. 2007).
Prostate Cancer:
Prostate cancer (PC) is the most commonly diagnosed men’s cancer in the developed
world, accounting for an estimated 29% of newly diagnosed cases and 11% of cancer-related
deaths in 2011 (Siegel et al. 2011). The molecular etiology of this disease is unknown, however
several genomic changes are well recorded: common losses occur with chromosome arms 6q, 8p,
10q, 13q, 16q, and 18q and gains frequently occur at 1q, 2p, 7, 8q, 18q, and Xq (Nupponen and
Visakorpi 2000).
Deletions in the q arm of chromosome 13 have long been known to occur in human PC.
13q deletions in PC are associated with advanced stages (Afonso et al. 1999; Yin et al. 1999; Lu
et al. 2006). Approximately one third of cases demonstrate loss of heterozygosity (LOH) at
13q14 (Cooney et al. 1996). Loss of this region is particularly responsible for the clinical
![Page 20: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/20.jpg)
6
significance of advanced prostate cancers compared to other regions of 13q (Dong et al. 2001;
Misumi et al. 2010), and for early biochemical relapse (Brookman-Amissah et al. 2007).
1.2.2 Minimally deleted regions at 13q14
The high frequency of 13q14 deletions in these cancers suggests the existence of one or
more tumor suppressor genes within this region. As the affected region is highly heterogenous
between patients, identification of the commonly affected chromosomal location would point to
genes that are being preferentially targeted for deletion due to their cancer inhibiting function.
Chronic Lymphocytic Leukemia:
Ouillette et al. have defined two general types of 13q14 deletion (Ouillette et al. 2008)
(Figure 1). This grouping of deletion-types is supported by other data indicating two molecularly
distinct groups of deletion (Mosca et al. 2010). Type 1 deletions comprise 60% of all 13q14
deletions. Type 1a deletions encompass a minimally deleted region (MDR) that overlaps with the
miR15a/16-1 cluster within the DLEU2 gene, plus DLEU1. Type 1b deletions encompass the
same region as Type 1a, but the centromeric breakpoint may occur anywhere up to, but
excluding, RB1. Type 2 deletions, making up the remaining 40% of cases, are the largest of
13q14 deletions, and do involve loss of RB1. They possess the same telomeric breakpoints as
Type 1, occurring at 51.2-51.5 Mbp physical position, however breaks extending closer to the
telomere are documented (Parker et al. 2011).
![Page 21: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/21.jpg)
7
Multiple Myeloma:
Mapping of 13q deletions in MM found that D13S272 and D13S31, microsatellite
markers within the 13q14 region, are the most commonly deleted markers of the 13q arm,
deleted in 70% and 64% of cases, respectively (Shaughnessy et al. 2000). This indicated the
presence of a putative tumor suppressor gene within the vicinity of 13q14.2-.3. Further, these
deletions are homozygous in 12% of patients (Shaughnessy et al. 2000), while LOH has been
reported in 26% of heterozygous patients (Ahmed et al. 2003).
The region affected by this deletion has not been mapped in as great detail as in CLL. As
with CLL, there is great heterogeneity in long arm chromosome 13 deletions in MM, but it was
initially very difficult to study because cytogenetic analysis originally required the analysis of
metaphase spreads, which are less commonly found in MM (Chang et al. 1999). However, with
the development of FISH, which allows for analysis of both metaphase and interphase nuclei
(Haines 1995), the MDR has been mapped to a 350kb sequence overlapping with DLEU1,
DLEU2, and RFP2, among other genes not shown (Elnenaei et al. 2003) (Figure 1).
Prostate Cancer:
A large-scale genetic linkage analysis of over 1, 200 families suggested one or more
susceptibility loci for Familial Prostate Cancer at 13q14 (Xu et al. 2005). 13q14 deletion is the
region of 13q most commonly affected in PC (Afonso et al. 1999; Latil et al. 1999; Ueda et al.
1999; Yin et al. 1999), within which the most commonly deleted region occurs between markers
D13S153 and D13S273 (Ueda et al. 1999). As D13S153 is located within the RB1 locus, this
heavily implicated its activity as a tumor suppressor gene in PC, which was not surprising due to
![Page 22: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/22.jpg)
8
its well-known involvement in cell cycle regulation. However, these allelic imbalances did not
correlate with low levels of RB1 expression, indicating the existence of another tumor suppressor
gene in the region (Cooney et al. 1996; Li et al. 1998; Latil et al. 1999). Further mapping
indicated that the candidate tumor suppressor was located telomeric to RB1 (Afonso et al. 1999;
Yin et al. 1999). High resolution mapping of 13q14 LOH events in PC eventually revealed a
MDR at 13q14.2, overlapping with CHC1L (Latil et al. 2002) (Figure 1).
![Page 23: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/23.jpg)
9
Figure 1 Gene map and minimum deleted regions at 13q14 in human cancer
In PC, the MDR of LOH overlaps with the CHC1L locus (Latil et al. 2002). The two main types of 13q14 deletion in CLL are shown (Ouillette et al. 2008). In MM, a 350kb MDR extends from RFP2 to within the DLEU2 locus
(Elnenaei et al. 2003).
![Page 24: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/24.jpg)
10
1.2.3 Putative tumor suppressors at 13q14
miR15a/16-1:
Existing within introns of DLEU2, a gene that does not demonstrate tumor suppressor activity
(Bullrich et al. 2001; Migliazza et al. 2001; Calin et al. 2002; Mertens et al. 2002), the
miR15a/16-1 (hereafter referred to as miR15/16) cluster is expressed at high levels in normal B
cells, suggesting the importance of these miRNAs in B cell homeostasis (Calin et al. 2002). A
study by Ouillete et al. identified only 2 of 171 CLL cases with 13q14 deletions shorter than
Type 1a, implying a MDR spanning miR15/16 and DLEU2 , supportive of findings from several
other projects (Bouyge-Moreau et al. 1997; Kalachikov et al. 1997; Kapanadze et al. 2000;
Kitamura et al. 2000; Migliazza et al. 2001; Wolf et al. 2001; Calin et al. 2002; Hammarsund et
al. 2004; Pfeifer et al. 2007). Further investigation has shown that the miRNAs are
downregulated or deleted in most CLL cases (Calin et al. 2002; Calin and Croce 2006; Nicoloso
et al. 2007) as well as in other cancers (Bottoni et al. 2005; Bonci et al. 2008). Indeed, in CLL,
several other genes in the area of miR15/16 were unaffected by 13q14 deletion (Bullrich et al.
2001; Migliazza et al. 2001; Pekarsky et al. 2005). Interestingly, these miRNAs are
underexpressed in a transgenic murine model of CLL (Pekarsky et al. 2005). NZB mice, which
are predisposed to development of CLL, possess a point mutation in the miR15/16 locus, and
these miRNAs are expressed at low levels in NZB lymphoid tissues (Raveche et al. 2007).
Perhaps the strongest demonstration of the tumor suppressing effects of miR15/16 is that
conditional deletion of miR15/16 in mouse B cells is sufficient to cause development of CLL
(Klein et al. 2010).
Figure 2: Map of 13q14
13q deletions frequently affect 13q14. In PC, the smallest common region of LOH overlaps with the CHC1L locus. The three
types of deletion found in CLL are shown. The minimally deleted region in CLL targets the miR15a/16-1 cluster (MDR). In MM,
a 350kb minimal commonly deleted (CDR) extends from RFP2 to within the DLEU2 locus.
![Page 25: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/25.jpg)
11
In MM, miR15/16 have been shown to functionally regulate proliferation of MM cells
both in vitro and in vivo through inhibition of members of the Akt and MAPK pathways
(Roccaro et al. 2009). MiR15/16 levels can be affected by the bone marrow microenvironment,
where bone marrow stromal cells cause decreased expression of this microRNA cluster through
IL-6 signalling (Hao et al. 2011). Suppression of miR15/16 in MM cells results in increased drug
resistance, while ectopic expression causes G1/S checkpoint arrest (Hao et al. 2011).
In advanced prostate tumors, miR15/16 are significantly underexpressed, whereas the
levels of their targets are abnormally high (Bonci et al. 2008). Delivery of antagomirs targeting
miR15/16 to normal mouse prostates resulted in hyperplasia, and in vitro knockdown increased
survival, proliferation and invasiveness of healthy prostate cells, which became neoplastic in
NOD-SCID mice (Bonci et al. 2008). Ectopic expression of miR15/16 resulted in arrest of
growth, induction of apoptosis, and regression in a prostate cancer xenograft model (Bonci et al.
2008).
The mechanism of CLL pathogenesis beginning with 13q14 deletion had remained
elusive until the miR15/16 cluster was identified as a likely contributor in the tumor suppressing
effects of this region. Analysis into potential targets revealed a well-known oncoprotein, BCL2,
as a target (Cimmino et al. 2005). BCL2 is an oncogene frequently overexpressed in CLL
(Kitada et al. 1998). In a small fraction (<5%) of CLL cases, this overexpression is achieved by a
translocation placing BCL2 under the IgH enhancer (Adachi et al. 1990), but, as miR15 and 16
have both been shown to target BCL2, miR15/16 deletion may also contribute to BCL2
overexpression.
![Page 26: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/26.jpg)
12
Fabbri et al. recently found evidence of a feedback loop, whereby TP53 binds upstream
of miR15/16 and activates their expression, decreasing BCL2 levels (Fabbri et al. 2011). They
also found that miR15/16 represses TP53, and so miR15/16 and TP53 co-regulate through
mutual repression. TP53 binds upstream of another miRNA cluster, miR34b/34c, activating its
expression (Corney et al. 2007). This cluster is found at chromosomal location 11q, another
region deleted in CLL. MiR34b/34c targets ZAP70, a protein overexpressed in aggressive CLL.
Fabbri et al. proposed a mechanism whereby, in cancer-free conditions without loss of
13q14, miR15/16 are expressed normally, and BCL2 is kept at normal levels, so apoptosis will
occur as expected, while miR15/16 and TP53 co-regulate. TP53 transactivates miR34b/34c,
which downregulate their target ZAP70, keeping it at normal levels and preventing development
of aggressive CLL.
However, in indolent CLL where 13q14 is deleted and miR15/16 are lost, levels of BCL2
elevate, allowing evasion of apoptosis. Loss of miR15/16 also releases TP53 from repression.
This overactivates the miR34 pathway, causing decreased expression of ZAP70, and reduction of
its effector pathways. By keeping levels of ZAP70 and apoptosis low, the CLL remains indolent
yet has a capacity to proliferate if there are subsequent mutations, such as deletion of 11q
(containing miR34b/34c) or 17p (containing TP53). Once either of these deletions occur, ZAP70
will be overexpressed. Indeed, del(11q) and del(17p) are found in 18% and 7% of cases,
respectively, and are associated with aggressive CLL (Dohner et al. 2000; Dewald et al. 2003).
![Page 27: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/27.jpg)
13
KCNRG and RFP2:
Despite the wealth of information suggesting the role of the miR15a/16-1 cluster as the
elusive tumor suppressors existing within 13q14, there is evidence for other important genes lost
in this common deletion, the roles of which remain to be uncovered. KCNRG and RFP2 are both
found within the MDR of MM and are affected in Type 1b and Type 2 deletions in CLL. In vitro
models have shown the capacity of KCNRG to suppress division and to promote apoptosis
(Birerdinc et al. 2010). RFP2 has recently demonstrated the ability to enhance apoptosis via
ubiquitin ligase activity, which causes degradation of MDM2 and AKT, resulting in enhanced
p53 signalling (Joo et al. 2011).
DICE1, FOXOA1, and ARLTS1:
Several genes located at 13q14, but outside of the MDR, may be PC tumor suppressors.
Low expression of DICE1 is found in PC cell lines DU145 and LNCaP as a result of promoter
hypermethylation, and the same hypermethylation has been found in patient tumors (Ropke et al.
2005). FOXO1A is deleted in approximately one third of prostate cancers (Dong et al. 2006).
Ectopic expression inhibited cell survival and proliferation, inhibiting androgen- and androgen
receptor-mediated gene regulation (Dong et al. 2006). As a PI3K/Akt signalling pathway
inhibitor (Biggs et al. 1999), the activity of FOXO1A as a tumor suppressor is consistent with its
known functions. An ARLTS1 variant (Cys148Arg) has been associated with prostate cancer and
breast cancer (Siltanen et al. 2008). In a larger study, it was confirmed that the variant had a
higher incidence in PC patients, and was associated with an increased risk of diagnosis and of
cancer aggressiveness (Siltanen et al. 2011). The variant was accompanied by lowered
![Page 28: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/28.jpg)
14
expression of the gene, and significantly lowered expression of ARLTS1 was found in clinical
samples as well as in previously published microarray data (Siltanen et al. 2011).
Other genes with tumor suppressive activity:
The heterogeneity in the size of 13q14 deletions due to the existence of many breakpoints
clustering in this region implicates many different genes as putative tumor suppressors. Parker et
al. have found that 15 genes are typically deleted in Type 1b CLL deletions, 14 of which are
located within a 1Mb region (49.2-50.2Mb physical position) between miR15/16 and RB1
(Parker et al. 2011), which includes SETDB2, PHF11 and RCBTB1. Interestingly, RCBTB1 is a
paralogue of CHC1L, and the two have been shown to heterodimerize (Plafker et al. 2009).
There is evidence that genes telomeric to miR15/16 may play roles in CLL as well. A
mouse model with B cell-specific DLEU2-miR15/16 deletion has been used for validation of the
causative role of the MDR, showing that it is sufficient to induce CLL pathogenesis (Klein et al.
2010). More recently, the same group has generated a strain to reiterate larger 13q14 deletions
that extend telomerically, named the commonly deleted region (CDR) (Lia et al. 2012). Mice
with heterozygous deletion of the CDR have a similar penetrance of lymphoproliferations
compared to +/- MDR mice, however the impact of the larger deletion was toward a more
aggressive disease course (Lia et al. 2012).Three genes of interest reside in this region: DLEU1,
DLEU7, and RNASEH2B.
Expression of DLEU7 (51.285Mb position) is frequently lost or reduced in CLL as a
result of promoter methylation (Hammarsund et al. 2004; Palamarchuk et al. 2010) or deletion
(Ouillette et al. 2008). Overaction of the NF-κB pathway as a cause of CLL has been described
![Page 29: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/29.jpg)
15
using transgenic mice (Planelles et al. 2004). DLEU7 has been shown to inhibit the NF-κB
pathway by inhibiting Tumor Necrosis Factor (TNF) receptors (Palamarchuk et al. 2010). The
authors of this pathway propose a mechanism for CLL development whereby minimal deletion
of 13q14, abrogating miR15/16 and DLEU7 expression, leads to overactivation of BCL2 and the
NF-κB pathway, which is consistent with a double transgenic mouse model which overexpresses
Bcl2 and a TNF receptor-associated factor, causing development of B cell lymphoma which
leads to leukemia (Zapata et al. 2004).
RNASEH2B is a subunit of RNase H, which coordinates hydrolysis of RNA in
DNA:RNA hybrids formed during normal cellular processes, as well as removing
misincorporated ribonucleotides during DNA synthesis, thus maintaining genomic integrity
(Reijns et al. 2011). DLEU1 expresses a noncoding RNA with over 20 different splice variants
(Wolf et al. 2001), however no function has been proposed. No role in preventing tumorigenesis
has been demonstrated for either, although it is conceivable for RNASEH2B to play a tumor
suppressive role based on its function.
Chromosome Condensation 1-Like:
Mapping of LOH events in PC puts CHC1L inside the MDR. CHC1L expression was
decreased at least 2-fold in 58% of all tumors studied, as well as in the three prostate cancer cell
lines LNCaP, DU145, and PC3, compared to normal prostate epithelial cell lines (Latil et al.
2002). When considering only tumors with LOH at 13q14, CHC1L is significantly down-
regulated in 78% of tumors (Latil et al. 2002). Only CHC1L and three other genes appear to be
targets of 13q14 deletion in PC based on altered expression patterns (Latil et al. 2003).
![Page 30: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/30.jpg)
16
Importantly, although RB1 is also located adjacent to the MDR, its expression levels do not
correlate with LOH at 13q14, suggesting it is not a critical component of 13q14 deletion for
prostate tumorigenesis (Cooney et al. 1996; Li et al. 1998; Latil et al. 1999; Latil et al. 2002).
Although CHC1L lies outside of the MDR in MM, low expression levels of CHC1L are
frequently observed in MM patients (Legartova et al. 2010). Through comparative gene
expression profiling of CD138-purified cells from newly diagnosed myeloma patients vs healthy
controls, expression levels of three genes were simultaneously significant in determining
prognosis (Harousseau et al. 2004). Patients with high RAN expression had increased risk of
event, while patients with high ZHX-2 or high CHC1L had lowered risk. Since expression of
each gene has independent prognostic significance, the collective expression of the three genes
was shown to be a strong predictor of event-free survival. The coefficient of determination (R2)
using the three gene model was 66%, compared to the 30% R2 of clinical models used at the time
the study was published (Harousseau et al. 2004).
Collectively, this data indicates that multiple tumor suppressor genes reside within
13q14, with evidence suggesting membership of CHC1L in this group.
1.3 Chromosome Condensation 1-like: Structure and putative function
1.3.1 CHC1L: Gene structure, mRNA isoforms, and protein product
Chromosome Condensation 1-Like, CHC1L, is located within 13q14 (Devilder et al.
1998), and is a candidate tumor suppressor gene in B cell chronic lymphocytic leukemia
![Page 31: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/31.jpg)
17
(Ouillette et al. 2008), multiple myeloma (Schreiber et al. 2000), and prostate cancer (Misumi et
al. 2010). The human gene is 30 kb in length, and contains 14 exons, ubiquitously expressing 4
alternatively spliced mRNA isoforms of approximately 3 kb (Figure 2). Isoforms A and B
possess exon 3, which contains an ATG start codon at position 229, suggesting a protein 551
amino acids in length. mRNAs C and D, lacking exon 3, have a first in frame start codon at
nucleotide position 301, within exon 4 (Devilder et al. 1998). This is consistent with a protein
product of 526 amino acids for both C and D isoforms.
Figure 2 Human CHC1L transcript isoforms
CHC1L encodes four mRNA isoforms, producing protein isoforms of 551 and 526 amino acids. mRNA isoform A contains all exons, and initiates translation of the 551aa protein from a start codon in exon 3. Isoform B also initiates translation from exon 3, but exon 2 is spliced out. mRNA isoforms C and D both lack exon 3, and produce the 526aa protein from a start codon in exon 4. Isoform C possesses exon 2, whereas this exon is spliced out of isoform D.
![Page 32: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/32.jpg)
18
Recently, tissue-specific expression of two classes of mRNA isoforms was studied in
detail in the mouse (Wang et al. 2012). Expression of the long isoform was found in the testes,
while the short isoform was expressed in all other tissues examined (heart, brain, spleen, lung,
liver, kidney, ovary and seminal vesicle), with the exception of smooth muscle. Protein
expression was found in the heart and testes only, revealing a protein of 61kDa, with cross-
reaction at 25kDa in the brain, and 50kDa in the liver. GFP-tagged CHC1L localizes to vesicles
at the surface of the nuclear envelope, indicating that it may be in close association with Ran,
which traverses the nuclear envelope regularly.
The identifying characteristics of the human CHC1L protein are the presence of 6 RCC1-
like (Regulator of Chromosome Condensation 1-like) repeats on the N terminus, and two
BTB/POZ (Broad Complex TramTrac Bric-a-Brac/Pox virus and Zinc finger) domains toward
the C terminal end (Devilder et al. 1998; Solomou et al. 2003) (Figure 3).
Figure 3 Human CHC1L protein structure
The 551aa isoform of CHC1L possesses 6 RCC1-like repeats on its N-terminal, and may be involved in interaction with Ran. There are two BTB/POZ domains toward the C-terminal end. BTB domains are often involved in protein-protein interactions.
![Page 33: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/33.jpg)
19
1.3.2 Function of CHC1L RCC1-like domain
Putative Guanine Nucleotide Exchange Factor activity
The RCC1-like domains (RLDs) are 52-53 amino acid domains, and show significant
homology to the domains of the RCC1 protein, which are responsible for interaction with Ran
(Renault et al. 1998). RCC1 is a well-known regulator of RanGTPase. Ran is responsible for
nuclear protein import as well as spindle assembly, nuclear envelope dynamics, and control of
cell cycle transitions (Figures 4 and 5) (Clarke and Zhang 2008). RCC1 is the main Ran Guanine
Nucleotide Exchange Factor (RanGEF), catalyzing the exchange of GDP for GTP (Clarke and
Zhang 2008). RanGTPase Activating Protein (RanGAP) is responsible for activating Ran’s
intrinsic GTPase activity, thus hydrolyzing GTP, rendering Ran inactive. RanGAP is located
cytoplasmically, whereas chromatin-bound RCC1 is within the nucleus, maintaining
concentrations of Ran bound to GTP (RanGTP) within the nucleus and bound to GDP (RanGDP)
within the cytosol (Solomou et al. 2003). This sequestering of Ran in its two states is an integral
aspect of its ability to import and export proteins with nuclear localization and nuclear export
signals, respectively. This is achieved through interaction of RanGTP with importins carrying
proteins destined for the nucleus, causing dissociation of the cargo. Interaction with
chromosome-region maintenance protein-1 (CRM1) causes RanGTP to form export complexes
carrying proteins with nuclear export sequences, which dissociate upon hydrolysis of GTP in the
presence of cytoplasmic RanGAP (Clarke and Zhang 2008). During mitosis, the nuclear
membrane dissolves, and the discrete sequestering of RanGTP from RanGDP is lost (Clarke and
Zhang 2008). A concentration gradient is formed, with the GTP-bound form at highest
![Page 34: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/34.jpg)
20
concentration proximal to the chromosomes due to RCC1’s association with chromatin. This
causes release of spindle assembly factors, proteins with nuclear localization signals, from their
carrier importin proteins, allowing their association and proper formation of the spindles close to
the chromosomes.
![Page 35: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/35.jpg)
21
Figure 4 The Ran cycle and its role in nucleocytoplasmic transport
a. The RanGTP-GDP cycle. In the presence of RCC1, GDP is exchanged for GTP, and Ran is able to interact with Karyopherin, a transport factor of the importin-β superfamiliy. Ran’s intrinsic GTPase activity is activated by RanGAP1 and RanBP1 or 2, hydrolyzing GTP to GDP.
b. Ran’s function in nucleocytoplasmic transport. In the presence of RCC1, which is located in the nucleus, Ran is bound to GTP. This causes Ran to associate with importin-β, causing release of proteins containing a nuclear localization signal (NLS). Similarly, Ran bound to GTP interacts with chromosome region maintenance protein-1 (CRM1), promoting the assembly of export complexes that carry proteins with nuclear export signals into the cytosol. Within the cytosol, associated with the nucleopore, RanGTP is hydrolyzed by RanGAP1 in the presence of RanBP1 or 2, resulting in hydrolysis of GTP and dissociation of the export complex. RanGDP re-enters the nucleus and the cycle continues.
![Page 36: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/36.jpg)
22
Figure 5 Role of RanGTPase during mitosis
During mitosis, the nuclear envelope dissolves, and the discrete partitioning of RanGTP from RanGDP is lost. Since RCC1 is chromatin-bound, a gradient of RanGTP is created. Since RanGTP concentration is highest near the chromosomes, spindle assembly factors (SAFs) may be released from importin shuttling proteins, resulting in spindle formation near the chromosomes.
![Page 37: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/37.jpg)
23
There are 5 groups of proteins containing RLDs, and only in the case of RCC1 has
RanGEF activity been shown (Hadjebi et al. 2008). The amino acid residues necessary for
forming the seven-bladed propeller structure of an RCC1-repeat are highly conserved across
RCC1-like family members, but there is room for specific variation within each individual RLD.
For example, RCC1 itself contains an extra β wedge between the third and fourth β strands of
propeller blade three (Hadjebi et al. 2008). This wedge is critical for destabilizing the interaction
between Ran and GDP (Renault et al. 1998), allowing GTP to be incorporated, and conferring
GEF activity to RCC1, and is not found in other RLDs (Hadjebi et al. 2008). Family member-
specific structural motifs, analogous to RCC1’s β wedge, likely confer specific functions to each,
and so a RanGEF activity may not be present in all proteins containing RLDs since they do not
possess this β wedge.
The other subgroups of the RCC1 family have varying functions. The RLDs of CHC1L
share significant homology with those of HERC1+3 (Devilder et al. 1998), members of the
HERC subgroup of the RCC1-like protein family. The HERC subgroup has the common
function of acting as ubiquitin ligases (Hadjebi et al. 2008), targeting various proteins for
degradation. This function is achieved through the HECT domains on the C terminal of these
proteins, which catalyze formation of a thioester bond with ubiquitin before transferring it to a
target substrate (Hochrainer et al. 2005).
Putative E3 ligase substrate adaptor activity
Through proteome-scale studies of the human protein-protein interactome using high
throughput yeast two-hybrid technology, it was shown that CHC1L can interact with COPS4.
![Page 38: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/38.jpg)
24
COPS4 is the fourth subunit of the COP9 signalosome (CSN). The CSN is a highly conserved
regulator of cullin E3 ubiquitin ligases, the largest family of E3 proteins (Lyapina et al. 2001).
E3 ligases are the final enzymes in a coordinated cascade required for polyubiquitylating a target
molecule. Ubiquitin is first linked to the E1 enzyme, which then transfers the ubiquitin moiety to
E2, which interacts with E3, bringing it into proximity of a target molecule, and subsequently
transferring multiple ubiquitin moieties onto the target through action of E3 ligase. This process
results in degradation of the target by the 26S proteasome, and is key for regulating cell cycle
progression (Pines 2006), as well as DNA repair and gene expression (Wolf et al. 2003). The
CSN possesses Nedd8 isopeptidase activity (Cope et al. 2002), which removes Nedd8 from the
cullin subunit of the cullin-RING family of E3 ubiquitin ligases (Schwechheimer et al. 2001).
The nature of CSN regulation of E3 is somewhat paradoxical: neddylation increases the
recruitment of E2 ligases and promotes ubiquitin transfer to the target molecule (Saha and
Deshaies 2008). However, this increased activity can also lead to auto-ubiquitination, leading to
self-destruction (Enchev et al. 2010). Therefore, while deneddylation by CSN decreases
ubiquitin-transfer to substrates destined for proteasomal degradation, it also serves to protect the
CSN complex from self-desctruction, thereby serving as a positive regulator of E3 ligases in vivo
(Schwechheimer et al. 2001; Wolf et al. 2003).
CHC1L possesses two BTB/POZ domains close to its C terminus. Cullins (CUL), the
catalytic cores of E3 ligases, are able to act on target molecules through intermediate substrate
adaptor proteins (Willems et al. 2004). The common characteristic of CUL3, one of 8 types of
cullins found in humans, is that its substrate adaptors possess a BTB domain (Xu et al. 2003).
The BTB domain interacts with CUL3, and the other end of the protein often contains a protein-
protein interaction motif, specifying target molecules (Plafker et al. 2009).
![Page 39: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/39.jpg)
25
RCBTB1, the paralogue of CHC1L whose locus is also found at 13q14.3, associates with
CUL3 in vitro through interaction of its BTB domain with the substrate adaptor binding domain
of CUL3 (Plafker et al. 2009), providing evidence for its activity as an E3 ligase substrate
adaptor. Through yeast two-hybrid analysis, protein pulldown, and co-localization studies, this
group has also shown that RCBTB1 and CHC1L can homo- and heterodimerize (Plafker et al.
2009), a characteristic common to CUL3 substrate adaptors (McMahon et al. 2006). This
dimerization may act to specify targets for degradation, however none have yet been identified.
Based on its homology to and capacity to interact with RCBTB1, as well its association
with the CSN, there is good evidence to suggest that CHC1L acts as a substrate adaptor protein
for E3 ubiquitin ligases, specifying other proteins for degradation, thereby regulating molecular
processes within the cell. However, if it is acting as an E3 adaptor, its overall function depends
on which proteins it is silencing.
Keap-1 is a BTB domain-containing CUL3 substrate adaptor, responsible for regulating
Nrf2, a transcription factor that promotes survival following oxidative stress (Cullinan et al.
2004). Through its N terminal BTB domain, Keap-1 has been shown to homodimerize and
interact with CUL3 (Zipper and Mulcahy 2002). Once dimerized, the C terminal Kelch domain
binds to the Neh2 domain of Nrf2 (Li et al. 2004), causing it to become tethered to the E3
complex, both sequestering it in the cytosol away from the nucleus, and leading to its
degradation (Li et al. 2004). Keap-1’s target specificity is thus determined by its other protein
interaction domain. Therefore, it is reasonable to propose that the substrate specifying capability
of BTB domain-containing proteins rests in the other structural motifs of the adaptor. Since the β
wedge of the RCC1 repeats found on the original RCC1 protein is necessary for exchanging
![Page 40: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/40.jpg)
26
GDP for GTP (Renault et al. 1998), and it is not found on other RCC1-like domains (Hadjebi et
al. 2008), it is possible that the RLD repeats on the N terminal of CHC1L are only able to
interact with Ran without causing guanine nucleotide exchange, and therefore CHC1L may
regulate Ran activity not by acting as a GEF, but by targeting it for degradation.
Whether CHC1L acts as a GEF for RanGTPase or specifies it for ubiquitin-mediated
degradation, if it does indeed interact with Ran, has important implications. As a GEF, loss of
CHC1L would decrease levels of activated Ran. As a ubiquitin ligase adaptor protein targeting
Ran, it would increase total levels of Ran. Since RanGDP is functionally inert, the functional
effect of excess Ran would arguably be an increase in RanGTP.
1.3.3 RanGTPase and cancer
Ran is widely overexpressed in human cancer (Xia et al. 2008), and its overexpression is
associated with poor prognosis in ovarian cancer (Ouellet et al. 2005; Ouellet et al. 2006), breast
cancer (Papaconstantinou et al. 2006), and multiple myeloma (Legartova et al. 2010). Data
suggests that RanGTP-triggered pathways are exploited by cancer cells. Several of its
downstream effectors are differentially expressed in cancer: the kinase Aurora A (Giet et al.
2005), and a microtubule-associated protein HURP (Koffa et al. 2006), for example. Its silencing
in cultured tumor cells results in dramatic defects in mitotic spindle assembly and apoptosis (Xia
et al. 2008). One of its effectors, survivin, a negative regulator of apoptosis (Altieri 2006), is
depleted following Ran knockdown .This downregulation of survivin is required for Ran
knockdown-induced apoptosis (Xia et al. 2008). In comparison, Ran knockdown is well-
tolerated in normal cells (Xia et al. 2008). This may indicate a cancer cell dependence on Ran-
![Page 41: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/41.jpg)
27
directed cell division. The concept of oncogene addiction, in which cancer cells, but not normal
cells, have a major reliance on a specific growth-promoting pathway (Weinstein and Joe 2006)
has also been seen for other proteins, particularly cell division kinases (Landis et al. 2006; Liu et
al. 2006; Xia et al. 2008). It is not presently known why overactivation of and dependence on the
Ran pathway would promote cellular transformation, but it may be related to its role in
chromosome segregation during mitosis, in which deregulation may promote chromosomal
instability (Xia et al. 2008). Indeed, the Ran targets TPX2 and Aurora A have been identified in
a chromosomal instability gene signature associated with poor prognosis in multiple cancer types
(Carter et al. 2006). Additionally, it has been suggested that altered localization of tumor
suppressors and oncoproteins due to faulty nucleocytoplasmic transport may promote
tumorigenesis (Kau et al. 2004). Commonly overactive cell signaling pathways such as the
PI3K/Akt and Ras/MEK/ERK pathways exert their effects by altering subcellular localization of
transcription factors (Kau and Silver 2003; Grant 2008). Ran activity has been shown to be
activated by the PI3K/Akt and growth factor signalling pathways (Ly et al. 2010). Tumor cells
with a highly overactive PI3K/Akt signalling pathway are particularly susceptible to apoptosis
through Ran silencing (Yuen et al. 2012), suggesting Ran-targeted therapy as a potentially
effective course of treatment.
![Page 42: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/42.jpg)
28
1.4 Histiocytic Sarcoma
As our mouse gene knockout study of Chc1L demonstrated that knockout mice have a
higher incidence of Histiocytic Sarcoma (HS), I would like to give a detailed background
introduction to HS.
The term histiocyte has undergone many transformations, and is currently used to
describe cells of the monocyte/macrophage lineage and well as those of the Langerhans
cell/dendritic cell series (Cline 1994). HS is a rare and poorly understood hematopoietic
neoplasm, representing <1% of all non-Hodgkin’s lymphomas (Jaffe ES 2001). It affects adult
men and women equally, with average age at diagnosis between 46 and 55 years (Pileri et al.
2002; Hornick et al. 2004), and more rarely affecting children (Buonocore et al. 2005; Kumar et
al. 2011; Mainardi et al. 2011). It may present as a localized disease in the lymph nodes, skin
and intestinal tract, or may be disseminated to multiple organs (Weiss LM 2001; Pileri et al.
2002). Historically, it has been a difficult cancer to recognize due to inconsistencies in
terminology and diagnostic criteria (Vos et al. 2005).
As knowledge of cellular differentiation markers improved, many tumors originally
diagnosed as HS turned out to be a spectrum of neoplasms including B- and T-cell lymphomas
(Morris and Davey 1975; Isaacson et al. 1985; Stein et al. 1985; van der Valk et al. 1990; Arai et
al. 1993; Egeler et al. 1995), but particularly diffuse large B cell lymphomas (Jaffe ES 2001).
After this elucidation, in 2001, the World Health Organization (WHO) declared the requirements
for diagnosis of HS: the presence of immunophenotypic characteristics of the histiocyte lineage
and the absence of markers found on cells of other large cell malignancies such as lymphomas
(Jaffe ES 2001). However, the distinction between HS and lymphoma broke down as increasing
![Page 43: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/43.jpg)
29
evidence of lymphocyte plasticity became apparent. In one of the first studies on the topic, a
study of 8 patients with both HS and Follicular Lymphoma (FL), Feldman et al. (Feldman et al.
2008) provided evidence for trans- or de-differentiation from FL into HS. Using Fluorescent In
Situ Hybridization (FISH), the group identified the presence of t(14:18), the genetic hallmark of
FL, within the histiocytic tumors of 6 of the 8 patients (FISH was not possible in the other two
patients). The two patients in which FISH could not be successfully performed had other
characteristics of FL present in both the HS and FL tumors; BCL2/JH and immunoglobulin
rearrangements with identical breakpoints in the paired tumors. In addition to this, other rare
cases of HS containing immunoglobulin gene rearrangements, specific to B cell maturation
(Weiss et al. 1985; Hanson et al. 1989; Feldman et al. 2008; Chen et al. 2009), including cases
of HS where past and concurrent diagnoses of lymphoma were excluded (Chen et al. 2009), have
been found.
Expression of B cell markers in HS has also been explored. Oct2 is a transcription factor
involved in B cell development. Oct2 is expressed at high levels in B cells, and at lower levels in
T cells, cells of the central nervous system, and in kidney and testis (Stoykova et al. 1992;
Pfisterer et al. 1994; Matthias 1998; Luchina et al. 2003). Oct2 expression is responsible for
activity of many B cell-specific genes including the Ig locus (Thevenin et al. 1993; Corcoran and
Karvelas 1994). Expression in B cells ranges from low levels in pro- and pre-B cells to high
levels in mature B cells (Staudt et al. 1988; Miller et al. 1991). In a study by Chen et al. (Chen et
al. 2009), 4 out of 7 HS patients without concurrent or previous diagnosis of lymphoma had
tumor cells expressing Oct2, with none expressing B cell markers Pax5, CD20, or BOB.1. 6 of
the 7 possessed IgH rearrangement, and 4 had IgK rearrangements. Oct2 expression has been
![Page 44: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/44.jpg)
30
detected in other cases as well (Chen et al. 2009; Wang et al. 2010). The significance of Oct2
expression is unknown, but may be indicative of the HS cells’ B cell origin.
This evidence indicates a complex relationship between the neoplasms and may represent
the lymphocytic origins of some cases of HS. Following these discoveries, in 2008 the WHO
removed the requirement of B cell-specific trait exclusion in diagnosis of HS. Since then, similar
data has emerged supporting lineage infidelity in development of HS (Zhang et al. 2009; Wang
et al. 2010; Wang et al. 2011; Zeng et al. 2011), including evidence of T cell transdifferentiation
(Castro et al. 2010).
1.4.1 Murine HS
A good animal model of HS is required to better understand the etiology of this disease.
Incidence of HS in the mouse varies greatly according to sex, age and strain, being most
common in C57/BL6J mice with an incidence of 22.2% in 24 month-old males and 10.4% in
females (Frith 1990; Lacroix-Triki et al. 2003). In mice, liver and uterus are typically affected,
but most other organs may also be involved (Frith CH 2001). More recent experimental models
have found the spleen to be the primarily affected organ, with the lymph nodes as the first site of
dissemination, and the liver being a commonly affected non-lymphoid organ (Hao et al. 2010).
The bone marrow may also present features of malignant histiocytes (Mashima et al. 2010).
Extramedullary hematopoiesis in the spleen (Frith 1990) and liver (Lacroix-Triki et al. 2003) is
another common feature of murine HS. In a study of 41 cases of spontaneous mouse HS (Hao et
al. 2010), expression of histiocyte markers (Mac-2, lysozyme, F4/80) and germline configuration
of B cell immune receptor loci were characteristic of HS. Increased expression of F4/80 is
![Page 45: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/45.jpg)
31
known to correlate with maturation of the monocyte/macrophage lineage (Lee et al. 1985;
McKnight et al. 1996; Schaller et al. 2002). F4/80 expression was observed at higher levels in
HS cells of round morphology, compared to those of spindle morphology, and cases displaying
transition from round cell-type to spindle shape indicate that the two forms are developmentally
related (Hao et al. 2010). In general, murine histiocytes are negative for B and T cell markers
(Hao et al. 2010). Strictly defined, true HS in the mouse is also negative for Ig and T cell
receptor translocations (Morse et al. 2001; Hao et al. 2010). However, in a study by Hao et al.
(Hao et al. 2010), 2 cases of spindle cell HS contained histiocytes positive for Pax5, suggestive
of lineage infidelity, similar to that seen in some human cases. Although this confounds the
suggestive importance of Pax5 for maintaining B cell commitment seen in humans, this may
represent a difference between the two species, or an alternate pathway of trans-/de-
differentiation in the mouse.
1.4.2 Pathway involvement in HS pathogenesis
Several models of murine HS have been generated to study genes involved in HS
development. Infection of mice with malignant histiocytosis sarcoma virus (MHSV) resulted in
the accumulation of mononuclear phagocytes, originally characterized as malignant macrophages
(Franz et al. 1985; Lohler et al. 1987). However, consistent with the trend of misdiagnosis in
humans, recent re-evaluation of the model has shown that not only macrophages, but dendritic
cells and precursor cells of the bone marrow were affected by the Ras-expressing virus, and this
results in a malignancy that is more heterogenous than originally believed (Leenen et al. 2010).
The affected cells demonstrate a dendritic cell or macrophage-like phenotype, and this phenotype
seems to depend on the microenvironment characteristic of the tissue to which they have homed.
![Page 46: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/46.jpg)
32
The heterogeneity in this mouse model is reminiscent of the plasticity and heterogeneity seen in
human cases (Pileri et al. 2002), with fewer cases than initially suspected representing true HS.
Functional knockout of Cdkn2a, which encodes the tumor suppressors p16Ink4a and
p14Arf, results in elevated frequency of lymphomas and fibrosarcomas early in life through
altered regulation of the Rb1 and p53 pathways (Serrano et al. 1996). Infection of Cdkn2a-/-
mice
with Moloney murine leukemia virus (MoMuLV) was performed to identify loci whose
disruption synergizes with knockout of Cdkn2a in tumor development (Lund et al. 2002). In
addition to an increased frequency of lymphoma, there was a 55% incidence of HS affecting the
spleen and liver. 40% of cases were a mixture of lymphoma and HS, and 15% were exclusively
diagnosed as HS. 6 loci were identified as common insertion sites specifically for HS,
representing either activated proto-oncogenes or inactivated tumor suppressor genes: Hcph,
ZNF220 mouse orthologue, Dgke, Kif13a, as well as 2 expressed sequence tags located on mouse
chromosomes 13 and 17. 17 loci were identified as being involved in both lymphoma and HS.
These sequences may represent genes involved in HS pathogenesis, and their involvement in the
PI3K pathway indicates the potential importance of this pathway in preventing HS.
In a smaller study, primary hematopoietic stem/progenitor cells were transduced with a
retrovirus encoding the large tumor antigen of simian virus 40, which, like Cdkn2a, also
inactivates Rb1 and p53 (Li et al. 2007). These cells were found to differentiate into malignant
histiocytes or other neoplastic cells of the myeloid lineage. This study also implicated several
other genes in development of HS.
Studies of Cdkn2a and Pten double knockout mice (Carrasco et al. 2006) indicate the
importance of these genes in suppressing HS and display an altered pattern of expression during
![Page 47: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/47.jpg)
33
pathogenesis of the disease. Cdkn2a-/-
mice develop B and T cell marker-expressing
biphenotypic lymphomas, with a low frequency of HS. However, Cdkn2a-/-
Pten+/-
mice had
expanded populations of biphenotypic B220+, CD117+ myelolymphoid cells which preceeded
development of HS at an elevated frequency compared to controls, while frequency of B and T
cell lymphomas compared to Cdkn2a-/-
mice remained unaltered. The lack of histiocytic
hyperplasia in Pten+/-
mice and low frequency in Cdkn2a-/-
mice compared to Cdkn2a-/-
Pten+/-
mice indicates a potentially important cooperative effect. Furthermore, almost all cases of HS
had subsequent LOH of Pten and were associated with aberrant activation of the PI3K/Akt and
Ras/MAPK pathways. In a translational study, the group similarly found Cdkn2a and Pten to be
genetically or epigenetically inactivated in human HS.
Dok-1, Dok-2, and Dok-3 proteins are substrates that inhibit protein tyrosine kinase
pathways (Lemay et al. 2000; Yamanashi et al. 2000; Songyang et al. 2001; Mashima et al.
2009), such as the Bcr-Abl pathway found in acute myelogenous leukemia. Dok-1,2,3 associate
with the p120 ras GTPase activator protein (Carpino et al. 1997; Yamanashi and Baltimore
1997). Machima et al. (Mashima et al. 2010) knocked out all three genes in mice and found a
severe neoplastic phenotype, whereas Dok-1-/-
and Dok-2-/-
Dok-3-/-
mice did not develop
aggressive tumors. Triple knockout mice initially develop abnormal macrophage accumulation in
the lung and eventually succumb to HS spreading to multiple organs without elevated incidence
of other tumors. The tumors are transplantable into lethally irradiated mice. In vitro, triple
knockout macrophages show a higher than normal proliferative response to M-CSF and GM-
CSF, while Dok-1-/-
and Dok-2-/-
:Dok-3-/-
mice also have a high response, though significantly
lower than the triple knockouts. As these proteins interact with Ras, which has many downstream
mediators including MAPK, several pathways may be involved in the genesis of HS. Further
![Page 48: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/48.jpg)
34
evidence for the importance of these genes in inhibiting HS stems from studies of the Lyn
protein. Lyn is required for phosphorylation and activation of Dok-1 and 3. Lyn knockout in
vitro gives macrophages an enhanced growth potential in response to M-CFS and GM-CSF, and
deficiency in a murine model caused development of macrophage tumors that may bear
similarities to HS, supporting the role of this pathway in HS development (Harder et al. 2001).
Although it is also a rare disease in dogs, some breeds have a predisposition to
development of HS, indicating the importance of the genetic component. Several deleted
genomic regions in HS that may host tumor suppressor genes have been identified, and support
the involvement of the pathways implicated in murine HS. The Arf and Ink4a/b locus is affected
in 62.8% of HS found in Burnese Mountain Dogs and Flat-Coated Retievers (Hedan et al. 2011).
Deletions of the regions containing Rb1 and Pten were found in 55.8% and 40.7% of cases,
respectively.
![Page 49: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/49.jpg)
35
Chapter 2: Research aims and hypotheses
The aim of this project is to better understand the mechanism by which 13q14 deletion
contributes to tumorigenesis. Specifically, we will elucidate the role of CHC1L deletion in
promoting cancer pathogenesis. I hypothesize that CHC1L is a tumor suppressor gene, and that
deletion of its locus promotes tumorigenesis through a pathway involving altered regulation of
RanGTPase and/or disrupted degradation of other proteins as a potential ubiquitin ligase adaptor
protein.
The evidence for its tumor suppressive activity stems from clinical observations. CHC1L
is located within chromosome 13q14, which is a common site of deletion in CLL, MM, and PC.
Within 13q14, it is located at a LOH hotspot in PC, appearing to be the main target of deletion.
Its expression is reduced significantly in poor prognosis cases of PC and MM suggesting that
loss of CHC1L activity promotes neoplasticity.
In order to examine the putative tumor suppressor role of CHC1L, a murine knockout
model has been created in our lab. Since our model possesses deletion of the Chc1L locus, we
may infer its function by the phenotype that arises in its absence.
We wish to confirm that loss of Chc1L confers susceptibility to tumorigenesis. By
determining the incidence of tumorigenesis, we will better understand the significance of this
deletion in developing cancer. Further, by studying the spectrum of disease, we will see if its loss
is associated with a specific cancer phenotype or with tumorigenesis in general.
![Page 50: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/50.jpg)
36
Chapter 3: Materials and Methods
3.1 Mice and gene knockout strategies
Mice were backcrossed and maintained on a C57/BL6J background, and housed at the
Animal Resource Facility of the Princess Margaret Hospital.
The mouse Chc1L gene is located on chromosome 14. It spans a genomic region of 40 kb
with 16 exons. The start codon ATG is located on exon 4. The complete cDNA of Chc1L is 3 kb.
Since a codon of methionine (ATG) is identified in exon 5, this ATG was prevented from
potentially initiating translation by designing targeting strategies to delete both exons 4 and 5.
Our targeting strategy (Figure 6) is based on targeting vector pSC22 using a 7.6 kb 5’-arm and a
4 kb 3’-arm with homology to murine Chc1L. Because of the limit of cloning size, exons 4 and 5
were cloned separately and ligated together in deleting more than 6 kb of intron 4. Two loxP
sites were inserted before and after exon 4 and 5 in the same direction. This vector system
employs neo as a positive selection marker. Next, the targeting vector was electroporated into ES
cells and ~600 neo-resistant clones were screened by Southern Blotting. The targeting event can
be screened by a 5’-probe with EcoRI digestion. It detects a 20 kb band in the wild-type locus,
but a 14 kb band in the targeted locus. From this screen, 5 targeted ES cell clones were identified
and microinjected into embryos that were then implanted into pseudopregnant females. The
resulting chimeras were bred for germline transmission of the targeting vector. Mice possessing
germline insertion were bred to mice expressing Cre recombinase in the germ line, under the
action of the Blimp1 promoter, to generate mice with non-conditional deletion of Chc1L.
![Page 51: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/51.jpg)
37
Knockout of exons 4 and 5 was confirmed by RT-PCR using two separate primer pairs. The
resulting amplicons were sequenced to confirm specificity for exons 4 and 5.
3.2 Genotyping
Murine ear tissue was taken and submerged in 100uL protease K solution (2µg Protease
K in PCR buffer) and incubated at 55˚C overnight. 2µL of dissolved tissue solution containing
DNA was diluted into 8µL autoclaved ddH2O in a 200µL PCR tube. The PCR tube was placed in
a thermocycler (Eppendorf Thermocycler PCR MasterCycler 5332) and kept at 95ºC for 10
minutes to denature protease K. 20µL PCR master mix was added to the tube, mixed, and briefly
spun to bottom of tube. The PCR reaction program is indicated in Table 1. PCR buffer and
master mix recipes are found in Table 2.
Table 1 PCR primer details
Primer
ID Sequence (5'-3')
Annealing
Temperature
PCR reaction
conditions
Int4-F1 GTGTTACTTTTGCCCGTGGT
58˚C
1. 93˚C for 03:00
2. 93˚C for 00:30
3. Annealing temp. for
00:45
4. 70˚C for 01:00
5. Repeat steps 2-4 40
times
6. 70˚C for 10:00
7. Hold 4˚C
Int4-
R1 GTGACAGGGCAAACCAAGTT
Int4-F2 GCATAGGGCTTGCAACTAGC
58˚C Int4-
R2 TGACCTCATGCCCACATAAA
TC-F TTCGCTACCTTAGGACCGTTA 58˚C
TC-R GGGTACCGAATTCCTCGAC
Ex4F2 AGGGACTGCACAGGACTGAT 60˚C
Ex5R2 CAAGCCTGACGAATCAACTG
Ex4F3 TGGAAGAAGAAGTGCCTGGT 60˚C
Ex5R3 GGCCACTTTCCCACATCTAA
![Page 52: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/52.jpg)
38
3.3 Gel purification
DNA fragments were purified from agarose gel using QIAquick Gel Extraction Kit
(Qiagen, cat. no. 28704). Briefly, DNA bands wer excised from the gel with a scalpel. Each gel
slice was massed and three volumes of dissolution buffer were added. One volume of
isopropanol was added, and the tube was briefly centrifuged through a DNA-binding column at
13, 000rpm. Washing buffer was then added, and column was briefly centrifuged. DNA was
eluted by adding water to column, and collected into a microcentrifuge tube via centrifugation.
3.4 RNA extraction and cDNA synthesis
Tissues were collected in RNase-free conditions and snap frozen using liquid N2. RNA
was collected using QIAGEN RNeasy Plus (QiagenTM
, Cat. No. 74134) mini kit according to
Table 2 PCR buffer and master mix recipes
![Page 53: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/53.jpg)
39
manufacturer’s protocol. Briefly, 30mg of tissue was added to a lysis buffer (Buffer RLT) and
disrupted by sonication. The lysate was transferred to a gDNA Eliminator column and
centrifuged a 8, 000g for 30 seconds. An equal volume of ethanol was then added to the flow-
through, and mixed. Each sample was then transferred to RNeasy spin column and centrifuged.
The flow-through was discarded, and buffer RW1 was added to the spin column and spun, again
discarding the flow-through. Two more washes of the spin column were performed with buffer
RPE. The RNA was then collected into a 1.5mL collection tube by elution with RNase-free
water. RNA integrity was verified on an Agilent 2100 Bioanalyzer.
RNA was reverse transcribed using Applied Biosystems’ High Capacity cDNA Reverse
Transcription Kit (Applied BiosystemTM
, 4368814) according to manufacturer’s instructions.
1µL cDNA was diluted 1:10 in RNase-free ddH20, and master mix was added (recipe in Table
2), using primers Ex4F2 and Ex5R2 or Ex4F3 and Ex5R3. The PCR program is displayed in
Table 1.
3.5 Histological preparation
All tissues were collected into 10% neutral-buffered formalin, and fixed overnight.
Tissues were subsequently embedded in paraffin, sectioned, and stained by hematoxylin and
eosin. For immunohistochemistry (IHC) using antibodies for Mac-2 and B220, standard tissue
sections were deparaffinized and rehydrated, then post-fixed in 10% neutral-buffered formalin
for 1 hour and washed 5 minutes in PBS. Sections were soaked in 10mM citrate buffer (pH6.0)
at 85ºC for 3 hours (for Mac-2 only). Slides were air-dried for 10 minutes, and washed in PBST
for 5 minutes. Slides were soaked in 3% hydrogen peroxide in methanol for 30 minutes, and
![Page 54: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/54.jpg)
40
washed 3 times in PBST for 5 minutes each wash. Each slide was blocked using Dako protein
block serum free (Dako: catalogue number X0909) for 30 minutes. 1:100 diluted rat anti-Mac-2
(Cedarlane: catalogue number CL8942AP) or rat anti-B220 (BD Bioscience: catalogue number
550286) was pipetted onto slide surface and incubated overnight at 4ºC. The slides were washed
3 times in PBST, and 1:100 anti-rat IgG-biotin (Vector Labs: catalog number BA-4001) was
pipetted onto surface, and incubated at room temperature for 60 minutes. Slides were washed 3
times in PBST. A and B from kit ABC (Vector Labs: catalogue number PK-6100) were pipetted
onto slide surfaces, and incubated 30 minutes room temperature, then washed 3 times in PBST
for 5 minutes each. Slides were immersed in DAB colour development solution, then washed in
distilled water for 5 minutes. Slides were then counterstained with hematoxylin for 30 second.
Slides were dipped in 1% acid alcohol, then immersed in Scott’s tap water for 30 seconds.
Finally, slides were dehydrated and cleared, then coverslipped with Permount.
3.6 Histological analysis
All histological analyses were performed by service from the Toronto Center for
Phenogenomics. The pathologist was blinded to genotype during histological analysis. Diagnosis
of HS and HAL or HS co-occurring with BCL was performed based on previously outlined
morphological features of these tumor cells (Hao et al. 2010), those being cells varying from
round to spindle-shaped in morphology, containing large amounts of lightly staining cytoplasm
and pleiomorphic nuclei, while also taking into account the distribution of affected organs and
other findings associated with tumorigenesis such as extramedullary hematopoiesis and the
presence of multinucleated giant cells. HAL was diagnosed in cases consistent with HS and
![Page 55: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/55.jpg)
41
possessing large number of lymphocytes. To confirm the accuracy of this diagnostic approach,
IHC for histiocyte-specific and B cell-specific markers (Mac-2 and B220, respectively) was
performed on representative tumors, whereby HS is diagnosed as Mac-2+/B220-, HAL is Mac-
2+/B220+, an HS and BCL composite is Mac-2+/B220+, and BCL is Mac-2-/B220+, as outlined
by Hao, Fredrickson et al. (2010).
3.7 Flow cytometry
Blood was collected from the lateral tail vein. Each mouse was heated by a lamp to
increase blood flow to the tail if necessary. Mice were restrained in a box with a hole for the tail.
Using a 221/2
G needle, the lateral vein was punctured. As the blood droplet formed, it was
quickly pipetted into a tube containing PBS+2mM EDTA. Approximately 20µL was collected
into 180µL PBS/EDTA.
Approximate cell density was measured using flow cytometry. Cell solutions was
centrifuged at 300g for 10 minutes, and supernatant was then aspirated. The pellet was
resuspended to 107 nucleated cells/100µL flow buffer. 10µL anti-CD45-Vioblue (Miltenyi
Biotech, catalogue number 130-092-910) per 100µL cell suspension was added to stain
mononuclear cells, then mixed and incubated for 10 minutes at 4ºC. Alternatively, Ack lysis
buffer (0.15M NH4Cl, 10mM KHCO3, 0.1mM EDTA) was used to remove RBCs. Cells were
washed by adding 1mL FACS buffer, then spun down (300g for 10min), and supernatant was
aspirated. The solution was resuspended into 100µL FACS buffer. 3µL of antibody of interest
(Table 3) diluted 1:10 in FACS buffer was added. Solutions were mixed and incubated on ice for
![Page 56: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/56.jpg)
42
20 minutes. They were then washed with 1mL FACS buffer, and spun down (300g, 10 minutes).
Solutions were finally resuspended into 1mL FACS buffer prior to proceeding to flow cytometry.
Flow cytometry was performed on a MACSQuant Analyzer or BD FACSCalibur.
Approximately 20 000 cells were counted per stain.
3.8 Bone marrow and spleen primary culture
Bone marrow was collected from both femurs and tibia. After each mouse is dissected,
both hindlegs were removed and placed into a tube containing PBS. Leg bones were transported
on ice to the lab. Muscle tissue was removed, and the bone marrow aspirated from the femur and
tibia using a 25G needle into culture media (DMEM/10%FBS/1%Antibiotic).
Antibody Supplier Catalog Number
IgD-PE BD
Pharmingen 558597
CD3-FITC Abcam ab24947
CD4-PE BD
Pharmingen 561844
CD8-PE BD
Pharmingen 561950
IgM-APC BD
Pharmingen 561010
B220-PE BD
Pharmingen 561878
CD138-PE BD
Pharmingen 553714
cKit-APC BD
Pharmingen 553356
CD11b-APC
BD Pharmingen
561690
Table 3 Antibodies used for flow cytometry
![Page 57: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/57.jpg)
43
To obtain a splenocyte suspension, the spleen was removed and placed into culture media
for transport. The spleen was placed between two microscrope slides, which were pressed
together. The slides were rubbed together until only the lining of the spleen remained.
Splenocytes were continually transferred into culture media as the spleen was ground to pulp.
The cell suspension was pipetted up and down using the same needle and passed through
a 70µm cell strainer to remove clumps of cells. The resulting suspension was spun down
(500rpm for 2min), and the pellet resuspended into 2mL Ack lysis buffer and incubated for 2min
at room temperature. The cell suspension was washed and resuspended into 3mL culture media.
Cell concentration was calculated using a hemocytometer. The cell suspension was plated into a
6 well plate at 5x 106 cells/well and cultured in DMEM/10%FBS/1%Antibiotic +5µg/mL LPS
for splenocytes, or 100ng/mL LPS for bone marrow. Cells were cultured for 2 days.
3.9 MTT assay
Bone marrow cells were cultured in triplicate at 2x105 cells per well in a 96-well plate
with 200µL DMEM/10%FBS/1%Antibiotic + LPS for 48 hours. 10µL MTT solution (5mg/mL
MTT (InvitrogenTM
, catalogue number M-6494) in PBS) was added to each well, and cultured
for 4 hours. 100µL solubilization solution (10% SDS in ddH20+100µL of 37% HCl per 100 mL)
was added to each well, and cultured for 4 hours. OD was read at 570nm.
![Page 58: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/58.jpg)
44
3.10 PI staining
Cell suspension was pipetted into centrifuge tube, and centrifuged for 5 minutes at 500xg.
Supernatant was then aspirated. Cells were resuspended with 0.5mL of PBS. A labeled 15mL
Falcon Tube was prepared with 4.5mL of ice cold 70% ethanol for each sample. The
resuspended cells were added in a dropwise fashion to the 15mL Falcon Tube while
simultaneously mixing the tube to ensure that cells don’t clump.
Cells were fixed on ice at 4oC for 2 hours on a shaker in the cold room. Cells were
pelleted (centrifuge for 5 minutes at 500xg) at RT. Cells were then washed twice with 5mL of
PBS (centrifuge for 5 minutes at 500xg and discard supernatant). Cells were resuspended in 1mL
of 0.1% Triton X-100 in PBS. 10 µL of RNAse was added to each tube. Tubes were then
incubated at 37oC for 15 minutes. 20 µL of 2mg/mL PI was added and the suspension was
incubated for 20 minutes prior to proceeding to flow cytometry.
3.11 Protein lysate preparation
One half tablet Complete Mini Protease Inhibitor Cocktail (Roche Diagnostics, Cat. No.
11 836 170 001) was added to 1ml Lysis Buffer (0.05M TrisHCl, 1mM EDTA, 1%NP40, 0.15M
NaCl, adjusted to pH 7.4) to make 10x protease inhibitor in lysis buffer, which can be stored in
the -20˚C freezer. 10x protease inhibitor in lysis buffer was diluted 1:10 in lysis buffer, and the
serine protease inhibitor PMSF was added to a final concentration of 0.1ng/mL. The resulting
solution is the protease-complete lysis buffer.
Approximately 100mg of fresh tissue, stored at -80˚C, was placed into 2mL ice-cold
protease-complete lysis buffer. Tissue was homogenized using an electric homogenizer. Tissue
![Page 59: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/59.jpg)
45
homogenate was placed on ice for 30 minutes. For isolation of protein from cultured cells, cells
were washed in cold PBS, and 1mL (per 100mm culture dish at 70-95% confluency) ice-cold
protease-complete lysis buffer was washed over monolayer. Using a cell scaper, cells were
physically disrupted. The resulting solution was collected and incubated on ice for 30 minutes.
Lysates were then spun down at high speed for 20 minutes, and supernatant was collected.
Protein concentration was determined using the BCA protein assay. Reagent S was
diluted into reagent A at a ratio of 1:50, to form reagent A’. 5µL of standards (ranging from 0 to
2mg/mL) and 5µL of samples (in triplicate) were pipetted into 96-well plate. 25µL A’ and
200µL reagent B were added to each well. Plate was agitated and incubated at room temperature
for 15 minutes. Absorbance was read at 750nm.
3.12 Polyacrylamide gel electrophoresis
An 8% polyacrylamide resolving gel was made according to the following recipe: 4.2mL
ddH2O, 1.6mL 40% acrylamide, 2mL 1.5M Tris pH 8.8, 80µL 10% SDS, 80µL 10% APS, 8µL
TEMED. A 4% polyacrylamide stacking gel was made with the following recipe: 3.1mL ddH2O,
0.5mL 40% acrylamide, 1.25mL 0.5M Tris pH6.8, 50µL 10% SDS, 50µL 10% APS, 5µL
TEMED.
20µL of 5x SDS sample buffer (10% SDS, 10mM DTT, 20% glycerol, 0.2M TrisHCl pH
6.8, 0.05% Bromophenol blue) was mixed with 80µL tissue lysate. The resulting mixture was
boiled for 5 minutes. The polyacrylamide gel was immersed in Running Buffer (25mM Tris,
200mM glycine, 0.1% SDS in ddH2O). 50ng of total protein was used per well, and the gel was
run at 100-150V for 1.5 hours.
![Page 60: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/60.jpg)
46
Prior to transferring to a nitrocellulose membrane, the membrane, gel, filter paper and
sponges were all soaked in Transfer Buffer (25mM Tris, 200mM glycine in 20% methanol) for
20 minutes. The gel and membrane were then sandwiched together and placed in the transfer
apparatus, which was run overnight at 22V within a 4˚C fridge.
3.13 Western Blotting
The transferred nitrocellulose membrane was washed 3 times in TBST (20mM Tris,
0.138M Nacl, 0.05% Tween20, buffered to pH 7.6) for 5 minutes each to remove residual
transfer buffer. The membrane was then blocked using 5% milk in TBST for 2 hours at room
temperature. The membrane was briefly washed to remove excess blocking solution. Anti-Chc1L
antibody is diluted 1:500 in blocking buffer (Table 4). Membrane was submerged in antibody
solution and incubated at 4˚C for 8 hours or overnight. The membrane was washed 3 times in
TBST for 5 minutes each. Goat-anti-rabbit-HRP was diluted 1:5000 in blocking buffer. The
membrane was incubated in secondary antibody (Table 4) for 1 hour at room temperature.
Following secondary antibody incubation, the membrane was washed 4 times in TBST, then one
time in TBS, for five minutes each. The membrane was then exposed for approximately 5
minutes onto x-ray film (CL-XPosure Film, 8 x 10in., Thermo ScientificTM
, catalogue number
34091).
![Page 61: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/61.jpg)
47
3.14 Transfection protocol
HepG2 cells were plated at 1.8 x 105 cells/well in a 24-well plate containing
DMEM+10% FBS+antibiotics, and grown for 24 hours. Cells were transfected at ~70%
confluency using Lipofectamine 2000 (Invitrogen, Cat. No. 11668-019). Final concentrations
were optimized to: 0.12µM siRNA, 8ng/µL lipofectamine.
60 pmol siRNA was added to 50µL Extreme MEM. 4µg Lipofectamine 2000 was added
to 50µL Extreme MEM and incubated for 5 minutes at room temperature. The 50µL siRNA and
Lipofectamine 2000 solutions were combined, and incubated for 20 minutes to allow
siRNA/Lipofectamine complex formation. Media was removed from cells, and the monolayer
was washed twice in PBS. 400µL of Extreme MEM was added to each well, followed by slow
addition of the 100µL siRNA/Lipofectamine complex solution. Cells were incubated at 37˚C for
Antibody name Supplier Catalog number
RCBTB2 monoclonal antibody (M01), clone 2G4 Abnova H00001102-
M01
RCBTB2 polyclonal antibody (A01) Abnova H00001102-
A01
CHC1L Antibody (N-term) Abgent AP6741a
Peroxidase-AffiniPure Goat Anti-Mouse IgG, Light Chain-Specific
Jackson Immunoresearch
115-035-174
Rabbit anti-mouse IgG-HRP Santa Cruz
Biotechnology sc-358923
Table 4 Western Blotting antibodies
![Page 62: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/62.jpg)
48
24 hours, at which point the transfection media was removed and replaced with DMEM
containing FBS and antibiotics.
3.15 Statistical methods
P values for determining significance of tumor incidence in each genotype compared to
one another were calculated using the Chi-squared test.
The two-tailed homoscedastic student’s T test was used to calculate significance of
peripheral blood population count changes and MTT cell survival differences.
![Page 63: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/63.jpg)
49
Chapter 4: Results
4.1 Generation of Chc1L gene knockout mice
To examine whether Chc1L suppresses tumor formation in vivo, knockout mice were
generated using homologous recombination (Figure 6). In deleting more than 6kb of intron 4 of
the murine orthologue, a targeting vector was created that incorporated two unidirectional loxP
sites flanking exons 4 and 5, both of which contain an ATG methionine codon. By removing the
two potential start codons, initiation of translation will be deleted. The targeting vector was
electroporated into murine ES cells, using neomycin resistance as a selection marker. Successful
targeting was confirmed with Southern Blotting to detect the 6kb length difference of the
targeted and non-targeted alleles, following EcoRI digestion. Gene-targeted ES cells were
microinjected into mouse embryos, which were transplanted into pseudo-pregnant females,
generating chimeric mice. Mice were then bred to homozygosity, detecting knockin again using
Southern Blot.
Gene-targeted knockin mice (Chc1LloxP/+
) were then crossed to a strain expressing Cre
recombinase under the Blimp1 promoter. Blimp1 was originally identified for its capacity as a
master regulator of plasma cell differentiation (Shaffer et al. 2002). Additionally, it is
responsible for germ cell determination in the mouse embryo, and is thus active in primordial
germ cells (Ohinata et al. 2005; Vincent et al. 2005). By crossing exon 4 and 5-floxed knockin
mice to Blimp1-Cre transgenic mice, progeny possessing germ-line deletion of both exons were
![Page 64: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/64.jpg)
50
generated. Interbreeding of germ-line deletion-carrying mice gave offspring with nonconditional
deletion. These mice were interbred to generate WT, HET and KO mice, with no need for Cre
expression in any tissues.
A genotyping method was developed based on the presence of intron 4 in the WT allele.
Primers that target sequences within intron 4 were used to detect the WT allele, whereas primers
that target introns 3 and 5, which are brought into proximity upon deletion, detected the KO
locus (Figure 7A). Successful knockout of gene product was detected by RT-PCR. Two sets of
forward and reverse primers were designed to complement sequences in exons 4 and 5,
respectively (Figure 7B) (Primer IDs: Ex4F2-Ex5R2 and Ex4F3-Ex5R3, see Table 1 for primer
sequences). A PCR amplified product was detectable using cDNA generated from wild-type
tissues (Figure 7C). No amplification was detectable in the knockout lanes. The amplified
products from both PCR primer pairs were gel-purified and sequenced, confirming their
specificity for exons 4 and 5 of Chc1L.
![Page 65: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/65.jpg)
51
Figure 6 Chc1L gene targeting strategy and generation of knockin mice
A. A targeting vector containing loxP-flanked exons 4 and 5 was used for gene targeting of Chc1L. (a) A targeting vector was constructed by purifying and subcloning exons 4 and 5 into a vector containing loxP sites, thereby flanking the exons with unidirectional loxP sequences. The “floxed” exons were then ligated into a targeting vector containing 5’ and 3’ Chc1L homology arms, allowing homologous recombination to occur. (b) The resulting knockin locus contains exons 4 and 5 flanked by loxP sites, and the neomycin resistance gene. (c) In the presence of Cre recombinase, active in germ cells, the ATG-containing exons 4 and 5 are deleted. B. Successfully targeted ES cells were selected for neomycin resistance, and the knockin locus was detected as a 14 kb sequence by Southern blot. C. Chimeric mice were generated by microinjecting successfully targeted ES cells into embryos, which were transplanted into pseudopregnant mothers. D. Chimeric mice were bred and germline transmission was detected and confirmed by Southern Blot.
![Page 66: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/66.jpg)
52
Figure 7 PCR and RT-PCR strategies
A. The WT allele was detected using primers that recognize intron 4 (Int4-F and Int4-R). The KO allele is detected using primers specific for sequences flanking the recombined loxP locus (TC-F and TC-R). In the WT allele, these sequences are too far apart to amplify by conventional PCR. B. The RT-PCR strategy uses primers designed to target exons 4 and 5, which are not present in the KO transcript. C. Knockout of Chc1L expression was detected by RT-PCR in various tissues, showing expression of the WT transcript in WT lanes only. The bands were purified and sequenced to confirm successful deletion of exons 4 and 5.
![Page 67: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/67.jpg)
53
4.2 HET and KO mice succumb to Histiocytic Sarcoma and Histiocyte-Associate
Lymphoma
Wild-type (WT), heterozygote (HET) and knockout (KO) mice were bred from a
C57/BL6J background and born at expected Mendelian frequency. HET and KO mice have
normal embryonic development and do not develop prostate cancer (Figure 8). Two cases had
features of plasma cell lymphoma, indicating with may suggest it is a component of the disease
spectrum of these mice.
Figure 8 Knockout of Chc1L in mice does not result in PC
The H+E staining of Chc1L knockout prostates demonstrated normal histological structure.
![Page 68: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/68.jpg)
54
In order to track cancer development, we performed preliminary analyses on young mice.
5 knockout mice, age 8-12 weeks, were necropsied. No visible pathology was observed.
Histopathological analysis was performed on spleen, lymph nodes, and liver, however no
evidence of early neoplastic events was present.
To allow more time for neoplastic progression, mice were sacrificed between the ages of
20-26 months, and detailed necropsies were performed. Tissues with gross abnormalities were
documented and fixed in formalin whenever possible. Table 5 summarizes all tumors identified
based on gross pathological analyses.
Prevalence for gross pathology was evident in HET (55.6%, n=18) and KO (80.0%,
n=25) mice, compared to wild-type controls (22.2%, n=9) (Figure 9). The difference between
tumor incidence in WT and KO mice was significant using the Chi-square test (p=0.02). These
pathologies were enlargements of the spleen, mesenteric lymph nodes and liver, as well as
masses appended to an organ, all classified as tumors. Tumors were concentrated in the spleen,
lymph nodes of the mesentery, liver and intestines/colon (Figure 10). Interestingly, although
tumor incidence in HE’s was lower than that of KO mice, HET mice tended to have more organs
affected (Figure 11). These may represent metastases from a primary tumor which may arise in
the spleen or lymph node, based on the frequent observation of tumors in these tissues. However,
without demonstrating common clonality of the tumor cells, it is not possible to confidently state
that tumors found in multiple locations within the same individual do not represent independent
proliferations.
![Page 69: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/69.jpg)
55
Table 5 Tumor distribution
Each row represents a mouse in which at least one tumor was found. Commonly affected organs in HET and KO mice were the spleen, lymph node and liver.
![Page 70: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/70.jpg)
56
Figure 9 Tumor incidence observed by gross pathology
Tumor incidence by genotype. Incidence of observable tumors was highest in HET and KO mice (WT: 22%, HET: 56%, KO: 80%). WT vs KO: p=0.02; WT vs HET: p=0.10; HET vs KO: p=0.09.
![Page 71: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/71.jpg)
57
Figure 10 Observable tumor incidence by organ
Tumors were found most often in the spleen, mesenteric lymph nodes and liver.
![Page 72: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/72.jpg)
58
Figure 11 Incidence of multiple organ tumors
HET mice typically had multiple tumor-bearing organs.
![Page 73: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/73.jpg)
59
To gain insight into the nature of these tumors, conventional histopathological studies,
with a focus on commonly affected organs, were performed by an experienced veterinary
pathologist.
The spleen and mesenteric lymph nodes were frequently enlarged due to proliferations of
transformed cells, which expanded the tissues and destroyed their normal architecture (Spleen:
Figure 13; lymph node: Figure 14). The liver was often involved, and many cases demonstrated
proliferations of neoplastic cells emanating from blood vessels (Figure 15). Tumors found on the
lower gastrointestinal tract often caused destruction of the mucosal surface (Figure 16). This
appears to be due to abnormal proliferations affecting the Peyer’s patches, lymphoid nodules
found within the ileum.
The morphology of the tumor cells in question varies from round to spindle-shaped, with
abundant eosinophilic cytoplasm and pleiomorphic (round, oval and folded) nuclei (Round:
Figure 12a; Spindle: Figure 12b). Tumor cells of a single morphology (round or spindle shaped)
were found existing either discretely within a proliferation, or a mixture of cells of each
morphology were found admixed in the same tumor (Figure 12c). In the mixed cell-type tumors,
the round and spindle-shaped cells are often intermingled, and these groups of cells appear to
transition from one morphology to the other. These features are consistent with the morphology
of malignant histiocytes.
Often, large proliferations of lymphocytes were found co-occurring in the histiocyte-rich
neoplasms (Figure 12d). Occasionally, Mott cells, plasma cells defective in immunoglobulin
secretion, were found associated with the lymphocytes (Figure 12d). Sometimes admixed in
populations of tumor cells were large numbers of multinucleated giant cells (Figure 12e). Mitotic
![Page 74: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/74.jpg)
60
figures and apoptotic bodies were also abnormally prevalent. Extramedullary hematopoiesis was
recurrently observed in the liver as well as the spleen (Figure 12f).
Tumors within the commonly affected tissues (spleen, lymph node, liver) were collected
from HET and KO mice (HET: n=8; KO: n=11), and compared to the same tissues of age- and
sex-matched WT mice (WT: n=4). However, not every organ was analyzed for histopathology.
Most of these findings, namely cell morphology, affected organs, presence of giant cells,
and extramedullary hematopoiesis, are indicative of HS. Additionally, the large numbers of
lymphocytes in some cases may indicate the co-existence of B cell lymphoma (BCL) a common
neoplasm in C57/BL6 strains, along with HS. An alternative possibility to the concurrent
pathogenesis of these two cancers is that these mice are succumbing to Histiocyte-Associated
Lymphoma (HAL).
Table 6 summarizes the histological findings in tissues collected for analysis. Of the eight
HET mice examined, two cases were diagnosed as HS, and five cases were differentially
diagnosed as either HAL or a composite of HS and BCL. Of tumors extracted from eleven KO
mice, six were diagnosed as HS and three as HAL or HS+BCL. Other diagnoses for HET and
KO mice were cystadenoma and follicular BCL of the lymph node. One KO case had age-related
inflammation resulting in lymph node enlargement, and was classified as “no significant
findings.” Four WT mice were chosen as histological controls. Of the four WT mice studied,
one case of HAL or HS+BCL was found in the intestine. However, the enlarged spleen and
lymph node from one WT was used for other applications, and not studied for its histopathology.
![Page 75: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/75.jpg)
61
Figure 12 Tumor cell morphology and pathological findings
(a) HS, round cell morphology. Pale eosinophilic cytoplasm is abundant and ranges from smooth to coarse. Nuclei
are mainly large with open chromatin pattern and prominent eccentric nucleoli. Cells have a low nucleus: cytoplasm
ratio. (b) HS, spindle cell morphology. Nuclei are elongated and convoluted. Cells are elongated and appear in
sheets. (c) HS, round (thin arrow) and spindle cell composite (bold arrow). (d) Mott cell admixed with histiocyte-
resembling cells and lymphocytes. Note displaced crescent nucleus, bright pink cytosol. (e) Multinucleated giant
cells are admixed throughout HS proliferation. Mitotic figures are abundant. (f) Extramedullary hematopoiesis in the
liver, consisting of proliferations of precursor cells and neutrophils.
![Page 76: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/76.jpg)
62
+/+ -/-
Figure 13 Spleen H+E
Comparison of WT and representative KO spleen at 4x, 20x, 100x. HET and KO spleens were often enlarged, with normal structure obliterated by proliferations of tumor cells with abundant, eosinophilic cytoplasm, and irregular nuclei with open chromatin and prominent nucleoli.
![Page 77: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/77.jpg)
63
+/+ -/-
Figure 14 Lymph node H+E
Comparison of WT and representative mesenteric lymph node at 4x, 20x, 100x. HET and KO lymph nodes were frequently enlarged, with normal structure displaced by tumor cells with morphology as described in the spleen.
![Page 78: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/78.jpg)
64
+/+
WT
+/-
HE
Figure 15 Liver H+E
Comparison of WT and representative liver at 4x, 20x, 100x. Frequently, multifocal areas of tumor cell infiltration that destroy the hepatic parenchyma were observed in HET and KO mice.
Figure 16 Small Intestine H+E
WT compared to representative intestine at 4x, 20x, 60x. Peyer’s patch is severely enlarged by tumor cells which have destroyed the mucosa.
Table 6 Summary of histopathological analyses
Representative tumors were harvested and analyzed for histopathology, and compared to WT organs.
![Page 79: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/79.jpg)
65
+/+ +/-
Figure 16 Small Intestine H+E
WT compared to representative intestine at 4x, 20x, 60x. Peyer’s patch is severely enlarged by tumor cells which have destroyed the mucosa.
![Page 80: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/80.jpg)
66
![Page 81: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/81.jpg)
67
While normally necessary to definitively diagnose HS and HAL or concurrent HS+BCL,
IHC for histiocyte marker Mac-2 and B cell marker B220 was performed on representative
tumors from two HET and one KO mouse rather than on all tumors collected as a method of
confirming our histopathological findings. IHC was also performed on one WT control mouse.
Figure 17, panels c and d show a lymph node tumor with cells stained positive for Mac-2
admixed with B220-positive cells. The case may be either HAL/HS+BCL. Panels e and f display
a lymph node tumor containing Mac-2-positive tumor cells only, and is definitively diagnosed as
HS. Figure 18 shows a tumor occurring within a spleen, in which tumor cells abnormally express
Mac-2, which has a different expression profile in the normal spleen, due to macrophages that
are normally present in this organ. In the liver (Figure 19), Mac-2-positive histiocytes were
observed in proximity to a blood vessel and were distributed throughout the tissue, in
comparison to control liver, which has less frequent Mac-2-expressing Kupffer cells. Figure 20
illustrates the remaining IHC findings.
Although IHC analysis was not performed on every HS and HAL/HS+BCL case
observed, these results indicate that our diagnoses based on the histopathological appearances of
tumors stained by H+E are accurate.
![Page 82: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/82.jpg)
68
Mac-2 B220
Control
HAL or
HS+HAL
HS
Figure 17 Lymph node IHC
a+b: Wild-type mesenteric lymph node. Non-neoplastic, Mac-2 positive macrophages are present between follicles.
B220 positive cells are present in cortical region.
c+d: Enlarged mesenteric lymph node from heterozygous mouse. The normal cortical structure is blurred by
heterogenous population of mixed round and spindloid cells. Nearly 30-40 % of the cortical cells and numerous
cells within the medullary sinuses are Mac-2 positive. Nearly 60-70 % of the cortical cells are B220 positive.
Differential diagnoses: Histiocyte-Associated Lymphoma or composite of HS and B cell lymphoma.
e+f: Enlarged mesenteric lymph node from a separate heterozygote. Cortical structure is obliterated: lymphatic
nodules have been replaced by spindle shaped cells positive for Mac-2, which are invading the cortical region.
Erythroid myeloid cells are abundant. Neoplastic cells are negative for B220. Diagnosis: HS and erythroid leukemia.
![Page 83: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/83.jpg)
69
Mac-2 B220
Control
HS
Figure 18 Spleen IHC
a+b: Wild-type spleen. Healthy Mac-2 positive macrophages are evenly spread throughout cortical red pulp. Occasional cells stain positive for B220.
b+c: Enlarged heterozygote spleen. The splenic white pulp is replaced by large numbers of heterogenous spindle-shaped cells. The red pulp is expanded by erythroid myeloid cells. Megakaryocytic cells are also markedly increased in number. Nearly 90% of the cells within the white pulp proliferation are positive for Mac-2. Approximately 40-50% of the cells in the red pulp have strong cytoplasmic Mac-2 expression. Scattered cells within the proliferation are positive for B220. Diagnosis: Histiocytic Sarcoma and erythroid leukemia.
![Page 84: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/84.jpg)
70
Mac-2 B220
Control
HS
Figure 19 Liver IHC
a+b: Wild-type liver. Organ appears histologically normal. Occasional Kupffer cells and other macrophages stain positive for Mac-2, with slight background positivity. All cells are negative for B220.
c+d: Heterozygote liver. Mac-2 positive cells are evenly spread throughout organ. Heavily activated cells are strongly positive for Mac-2, and located adjacent to blood vessels. Diagnosis: Metastatic Histiocytic Sarcoma.
![Page 85: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/85.jpg)
71
Mac-2 B220
HS
HAL or
HS+HAL
HS
Figure 20 Other IHC findings
a+b: HS tumor of the testis. c+d: HAL or HS+BCL in the kidney. e+f: HS cell accumulation in the lung.
![Page 86: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/86.jpg)
72
4.3 Peripheral blood cell populations are unaffected by loss of Chc1L
In order to detect circulating tumor cells, peripheral blood cell populations were
measured by flow cytometry on mice aged two years. Age- and sex-matched WT and KO mice
were compared. Antibodies for the following markers were used: CD3+CD8, cytotoxic T cells;
CD3+CD4, T helper cells; IgM/IgD/B220, B cells; CD138, plasma cells; cKit, hematopoietic
stem cells; CD11b, monocytes. This data is summarized in Table 7.
No significant differences between WT and KO mice were detected. However, a
noticeable increase in CD138-positive cells was found in the peripheral blood of two KO mice
Table 7 Summary of peripheral blood cell populations measured by flow cytometry
No significant difference was detected. *Of the 3 pairs of mice analyzed, two KO mice had a distinctly increased CD138-positive population (see Figure 22).
![Page 87: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/87.jpg)
73
compared to age-, sex-matched WT controls. The third pair had a less severe increase in
circulating plasma cells. Data from these three pairs is shown in Figure 21.
![Page 88: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/88.jpg)
74
Figure 21 Circulating plasma cells
In two pairs of mice (A and C), a distinct increase in CD138-positive cells was detected. The other pair (B) had a slight increase.
Note: Data for C was collected with MACSQuant Analyzer, while data for other dotplots was collected using BD FACSCalibur.
![Page 89: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/89.jpg)
75
4.4 Splenocytes and bone marrow cells from young mice have increased viability
ex vivo
At 8-12 weeks, no visible pathology was observed in KO mice. However, in order to
determine whether a difference in cell cycle progression or viability exists in KO cells at this
age, PI staining of bone marrow cells and MTT assay-based analysis of bone marrow and spleen
cells were performed on age- and sex-matched pairs.
Splenocytes and bone marrow cells from WT and KO mice were plated at equal densities
and cultured for two days in the presence of LPS to promote B cell proliferation in the spleen and
maturation of dendritic cells in the bone marrow.
PI staining of primary bone marrow cultures did not demonstrate any differences between
WT and KO cell cycle progression (Figure 22A; n=3).
However, using the MTT assay, a consistent increase in KO cell survival was seen for
splenic and bone marrow KO cell suspensions, compared to WT (Splenocyte fold-survival
(KO/WT)=1.45±0.29, p<0.05; Bone marrow fold-survival (KO/WT)=1.26±0.11, p<0.01; n=3 for
both assays) (Figure 22B).
![Page 90: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/90.jpg)
76
Figure 22 Cell cycle analysis and viability
A. PI staining of bone marrow cells did not show a significant difference in cell cycle progression. A representative cell cycle assay is shown (n=3). B. KO splenocytes and bone marrow cells have increased viability as determined by MTT assay (n=3).
![Page 91: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/91.jpg)
77
Chapter 5: Conclusions
In conclusion, we have successfully generated Chc1L gene knockout mice using an
embryonic stem cell based gene targeting strategy. In this study, we have characterized the null
mutation. Chc1L gene knockout does not affect embryogenesis as wild-type, heterozygote and
knockout mice are born at expected frequency. We have not observed development of prostate
cancer or multiple myeloma in knockout mice at two years of age. However, we have observed
increased peripheral blood CD138 plasma cell populations in some knockout mice, as well as
some cases of plasma cell lymphoma, which may indicate a myeloma-like phenotype as part of
the disease spectrum.
At 8-12 weeks of age, Chc1L knockout mice do not develop cancer. However, knockout
splenocytes and bone marrow cells cultured ex vivo have increased viability compared to wild-
type. Importantly, we observed an increased incidence in development of Histiocytic Sarcoma
and Histiocyte-Associated Lymphoma in knockout mice. These findings provide the first direct
evidence that CHC1L may be a tumor suppressor gene, suggesting that deletion of CHC1L at
13q14 as seen in human cancer may initiate and promote cancer development. These findings
also suggest that mutation of CHC1L alone is not sufficient to induce myeloma and prostate
cancer, and that the combination of other genetic changes might be necessary for development of
these cancer types.
However, our results are mainly based on analysis of two year old mice. By analyzing
mice at an earlier age in future studies, we will provide stronger evidence for development of
Histiocytic Sarcoma. Analyzing all tumors observed upon necropsy will help confirm the
![Page 92: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/92.jpg)
78
increased incidence of this cancer. Furthermore, it is important that we also perform a detailed
analysis of the incidence of other cancers observed in this model. Several cases of B cell
lymphoma and plasma cell lymphoma were observed in combination with Histiocytic Sarcoma
or discretely, but a detailed investigation of their incidence remains to be completed.
Our studies support that CHC1L is a tumor suppressor gene. Through further
characterization the mouse gene knockout mutation and associated molecular mechanisms, we
may identify and validate pathways involving CHC1L as therapeutic targets for the treatment of
Histiocytic Sarcoma.
![Page 93: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/93.jpg)
79
Chapter 6: Discussion
6.1 Knockout strategy
This project studied the function of Chc1L through a reverse genetics approach. Using
gene targeting, Chc1L was nonconditionally deleted in a C57/BL6J mouse strain. By analyzing
Chc1L knockout mice, we are able to infer its role in tumorigenesis.
Based on our analyses, knockout of Chc1L appears to be successful. Deletion did not
affect embryonic viability, indicating that it is not necessary for early development. Removal of
exons 4 and 5 was verified by DNA-based methods, using PCR primers specific for the deletion
allele in combination with primers specific for the wild-type allele. These primers were then used
for genotyping.
I was unable to confidently confirm loss of CHC1L protein production by Western Blot.
Several different primary antibodies were used to probe for CHC1L (see Table 4). A discrete 60-
62kDa band (the predicted size of CHC1L) was not detectable in WT protein lysates collected
from various tissues. Frequently, nonspecific bands were present, which may have overlapped
with and obscured CHC1L. The commercially available antibodies are targeted against the
human orthologue of CHC1L, and this may have reduced its specificity. Two of the antibodies
used were raised in mouse, resulting in an immunoglobulin smear at 55kDa, which was often so
large that it could have masked a band at 60kDa. Very recently, a group studying CHC1L
![Page 94: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/94.jpg)
80
localization during spermatogenesis performed Western Blot on an array of adult mouse tissues
(Wang et al. 2012). However, they produced primary antibodies by cloning the N terminal and C
terminal portions of the mouse homologue themselves, producing His-tagged recombinant
proteins in vitro, which were shipped to a commercial organization for generation of rabbit
antisera. Since these antibodies are generated against the mouse orthologue of CHC1L, they are
likely more specific than the antibodies used in this project, which are specific for the human
orthologue. In the future, we may consider using these antibodies to confirm successful
knockout.
Since these antibodies were not available at the time of this study, knockout was verified
using an RT-PCR based approach. To confirm that exons 4 and 5 are deleted from the Chc1L
transcript, we designed two separate primer pairs that amplify a sequence across the two exons.
We found that Chc1L mRNA is expressed in all WT and HET tissues examined, but not in KO
tissue (Figure 7C). The amplified products were sequenced to confirm their identity.
These results demonstrate at the DNA and RNA levels that Chc1L was successfully
targeted in our strain. The murine Chc1L transcript does not possess an in-frame ATG sequence
in its 5’UTR, nor are there any within the coding sequence of the remaining exons following
recombination. It should not, therefore, be possible for translation to initiate through recruitment
of a different ATG as a start codon. If this were to occur from another ATG sequence, it would
result in a frameshift and a non-functional protein. However, in the future, to definitively
demonstrate successful knockout at the protein level, showing knockout at the protein level is
necessary.
![Page 95: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/95.jpg)
81
6.2 Early phenotype
To detect a phenotype in early development, five knockout mice were necropsied at 8-12
weeks of age. No visible pathologies were observed by gross pathological analysis. Tissues were
collected and analyzed for histopathology, and no lesions were detected.
As we frequently observed splenomegaly, and the bone marrow is the source of
monocytes, spleen cells and bone marrow was aspirated from three pairs of young mice and
cultured in cell media containing LPS. LPS, a component of the outer membrane of gram-
negative bacteria, acts as a mitogen for inducing proliferation of B cells (Smithwick et al. 2003).
LPS also induces maturation of dendritic cells in primary bone marrow cultures (Granucci et al.
1999).
After two days of culture, cell survival was measured using the MTT assay. A significant
increase in cell survival was demonstrated for cells isolated from both tissues. This suggests that
B cells of the spleen, and dendritic cells from the bone marrow of KO mice are displaying an
exaggerated proliferative response. Based on this information, even though mice at 8-12 weeks
have not developed cancer, splenic B cells and possibly immature B cells resident to the bone
marrow are capable of hyperproliferating in response to mitogens. Additionally, dendritic cells
that have undergone maturation from bone marrow progenitor cells in the presence of LPS are
also hyperproliferative.
To better understand the increase in survivability, cell cycle analysis of bone marrow
cells was performed by flow cytometric analysis of DNA content. However, relative proportions
of cells in each phase did not change significantly. It was expected that if an excess of KO cells
![Page 96: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/96.jpg)
82
were leaving a quiescent state to enter cell division, there would be a marked increase in G2/M
and S phase cells. Also, if fewer cells were undergoing apoptosis or senescence, a difference in
cells with subdiploid DNA content would have been observed. It is possible that the increase in
survival is due to faster cell division due to unchecked cell cycle transitions, which would result
in a larger number of cells, but not necessarily change the proportion of cells in each phase.
The MTT assay relies on the reduction of MTT by mitochondrial reductase, which is
present in living cells. Therefore, another interpretation of these results is that mitochondrial
metabolism is increased in bone marrow and spleen cells of young KO mice. However, it has
long been understood that cancer cells rely on glycolytic energy production, and mitochondrial
metabolism is typically reduced, a phenomenon known as the Warburg effect (Warburg 1930).
Since the cells have not progressed to a malignant stage, the Warburg effect may not have
initiated. Also, it is possible that an increase in mitochondrial replication resulting in a larger
number of active mitochondria could have caused this effect. Indeed, some cancer cells have
been shown to have heightened mitochondrial replication (Shapovalov et al. 2011).
Since the MTT assay is a colourimetric representation of the number of living cells, to
definitively demonstrate increased proliferation of KO splenocytes and bone marrow cells, the
Ki67 assay should be used, which specifically measures proliferation.
In the future, a more defined cell population would also be beneficial in understanding
the effects of Chc1L knockout on B cells and histiocytes. Here, the use of total bone marrow and
spleen populations may have diluted the effects on the cell types of interest. In the case of B
cells, purification from total spleen homogenate will improve the meaningfulness of our results.
Also, as we only studied the changes of dendritic cell growth, complementing this study by
![Page 97: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/97.jpg)
83
measuring macrophage proliferation in the presence of macrophage growth factors M-CSF and
GM-CSF will help us define the changes in histiocyte growth following Chc1L knockout.
6.3 HS and HAL pathogenesis
While no tumors were found in 8-12 week old mice, aged KO mice sacrificed at
approximately 2 years of age had a significantly greater incidence of tumorigenesis compared to
WT. Tumors from the most commonly affected organs, the spleen, mesenteric lymph nodes, and
liver, as well as several tumors found in other tissues, were collected for histopathological
analysis. Diagnosis of HS was made based on the morphological appearance of the tumor cells,
as outlined previously (Hao et al. 2010): cells round to spindle-shaped in morphology,
containing large amounts of lightly staining cytoplasm and pleiomorphic nuclei. HAL or tumors
that may have been composites of HS and BCL were diagnosed based on these same
morphological characteristics of histiocytes, plus the appearance of large populations of
lymphocytes within tumor cell foci. The cellular morphology, frequent co-occurrence of
multinucleated giant cells within tumors, extramedullary hematopoiesis occasionally occurring
within the liver and spleen of affected mice, as well as the distribution of affected organs were all
symptoms highly suggestive of HS. Several histiocyte-rich neoplasms also contained abnormal
proliferations of B lymphocytes. These may represent cases of BCL co-occurring with HS, or
may be instances of HAL. Currently, there is no way to differentiate between HS+BCL vs HAL
as no marker for malignant histiocytes has been discovered.
![Page 98: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/98.jpg)
84
As described in the legend of Table 6, not every organ was analyzed for histopathology,
and, therefore, instances of tumorigenesis not observable upon gross pathology may have been
missed. However, the 22% tumor incidence observed by gross pathological analysis parallels
literature incidence of HS for C57/BL6 mice, which ranges from 10.4% in females to 22.2% in
males at two years of age (Frith 1990; Lacroix-Triki et al. 2003). Also, the number of HS cases
occurring in KO mice represents an incidence already greater than that predicted by literature.
Based on current diagnostic criteria to definitively diagnose HS (Hao et al. 2010), IHC
for histiocyte markers must be performed. The current WHO standards for HS diagnosis no
longer require the absence of B cell markers due to evidence of transdifferentiation from B cell
to histiocytes. While two cases of Pax5-expressing HS cells have been described in the mouse
(Hao et al. 2010), these observations are preliminary, and in the vast majority of murine cases,
HS cells do not express B cell markers in the mouse. Therefore, to confirm our diagnostic
method, IHC for a histiocyte marker (Mac-2) and a B cell marker (B220) was performed on
several representative tumors to validate our H+E-based diagnostic approach.
Three representative cases diagnosed as HS or HAL/HS+BCL were chosen to confirm
the accuracy of the diagnoses made based on analysis of H+E tumor sections. The IHC results
were in accordance with the initial diagnoses, and revealed instances of HS and HAL/HS+BCL
occurring in the spleen, lymph nodes, liver, testis, kidney and lung.
As mentioned previously, to conclusively differentiate HS from B cell neoplasms, IHC
analysis must be performed on each tumor. Not every tumor diagnosed by conventional H+E
histopathology was stained for cellular markers. However, the IHC analysis performed on
representative tumors has thus far confirmed our diagnosis of HS and HAL/HS+BCL. In the
![Page 99: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/99.jpg)
85
future, IHC will be performed on all tumors to confidently diagnose each. Additionally, we will
use a larger panel of B cell and histiocyte markers to validate our findings. In order to track
development of the malignant processes, detailed evaluation of circulating histiocytes and B cells
needs to be performed at earlier time points.
Based on this data, loss of Chc1L in mice predisposes to HS development. The frequent
occurrence of HAL/HS+BCL may be explained by the common finding that mouse models of
HS often develop B cell lymphomas at a similar frequency (Martin-Caballero et al. 2001;
Carrasco et al. 2006; Mashima et al. 2010), and the two may be found occurring together.
Perhaps this is suggestive of a common mechanism of pathogenesis that parallels evidence of a B
cell precursor to HS cells found in humans (Weiss et al. 1985; Hanson et al. 1989; Feldman et al.
2008; Chen et al. 2009).
6.4 Prostate Cancer and Multiple Myeloma
Since CHC1L falls within the MDR of 13q14 in human PC, and low levels of expression
have been correlated with prostate tumorigenesis, special attention was also paid toward prostate
cancer pathology. However, in the 21 male HET and KO mice (8 HEs, 13 KOs) in which tumors
were observed, no cases of prostate tumorigenesis were detected via gross pathology or
histopathology (Figure 8). Therefore, Chc1L deletion does not influence prostate cancer
pathogenesis, contrary to literature findings in human disease.
Based on literature findings, particular attention was paid to the presence of myeloma-
like features. Two mice possessed malignant cells resembling plasma cells, which made up the
![Page 100: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/100.jpg)
86
majority of the tumor composition, suggestive of plasma cell lymphoma or late stage, germinal
center-derived B cell lymphoma. Histiocytes were a minor component within these tumors.
Another case had Mott cells occasionally distributed through a tumor engulfing the intestine.
Mott cells are plasma cells defective in their secretory pathway, staining brightly eosinophilic
due to immunoglobulin buildup within the cytosol, which causes displacement of the nucleus to
the cell’s periphery. In addition to being associated with MM, Mott cells may be found in BCL,
and this finding could be attributed to B cell proliferations as were frequently observed.
However, the possibility of myeloma-like features in Chc1L KO mice parallels clinical data
where low CHC1L expression correlates with poor prognosis (Harousseau et al. 2004).
Indeed, flow cytometry of peripheral blood detected an increase in circulating plasma
cells in some mice. In two of the three pairs examined, a distinct CD138-positive population
increase was found, while the third pair had a slight increase. High levels of circulating plasma
cells may be due to MM-related processes as seen in the cases discussed about, or, alternatively,
they may have formed from the B lymphocyte component of HAL/HS+BCL tumors. Therefore,
there is some evidence to suggest that MM or a myeloma-like process may be a component of
the disease spectrum, however at a much lower incidence than HS and HAL/HS+BCL.
The lack of PC development and relatively low incidence of MM features compared to
HS or HAL/HS+BCL may be due to retained activity of other genes found at 13q14, loss of
which may preferentially promote these cancers. Alternatively, in MM and PC patients where
CHC1L expression was decreased or the gene itself was deleted, unrelated mutations may have
also predisposed to these particular phenotypes. In futures studies, this area may be explored by
![Page 101: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/101.jpg)
87
crossing Chc1L KO mice with strains possessing other mutations seen in MM and PC, and
detecting the synergy of these genetic changes in promoting development of these cancers.
6.5 Penetrance and haploinsufficiency
While only 22% of wild-type mice had visible signs of pathology, the incidence of
tumors in HET and KO mice was remarkably high, suggesting a powerful role for Chc1L in
inhibiting tumorigenesis. 56% of HET mice had at least one tumor upon gross necropsy, while
the incidence was, as expected, even higher in KO mice (80%). Despite not reaching significance
compared to WT incidence, the tumor incidence in HET mice is intermediate between WT and
KO incidences, and therefore may be an accurate representation of tumor occurrence for mice of
this genotype. This could be validated using a larger sample size of both WT and HET mice.
The severity of the HET phenotype was surprising. The incidence was dramatic for a
heterozygous genotype, and most HET mice had multiple affected organs. Knudson’s two-hit
hypothesis defines a tumor suppressor gene as being haplosufficient (Knudson 1985). Many
well-known tumor suppressors are associated with familial cancer susceptibility syndromes.
These patients are born with germ-line mutations in one allele of a tumor suppressor gene. The
remaining functional copy is sufficient to regulate cell growth, but when the second allele is
targeted by mutation, proliferation becomes abnormal and results in tumorigenesis. By this
definition, CHC1L does not appear to encode a tumor suppressor gene. However, since the two-
hit hypothesis was originally proposed, its requirement as a tumor suppressor characteristic is no
longer absolute. Tumor suppressor genes (TSGs) are thought to exist on a spectrum of ranging
![Page 102: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/102.jpg)
88
from totally haplosufficient to haploinsufficient (Cook and McCaw 2000). BRCA1 and 2 are
well-studied tumor suppressors that are considered totally haplosufficient. Germline
heterozygosity for BRCA1 and 2 is known to confer susceptibility to breast and ovarian cancer
(Lancaster et al. 1996; Lengauer et al. 1998). In vitro, MEFs heterozygous for BRCA2 show no
difficulty in performing DNA repair (Lancaster et al. 1996). This functional capacity underscores
the primary characteristic of a Knudson two-hit tumor suppressor gene. The inability of
heterozygous BRCA1 and BRCA2 cells to undergo clonal expansion is likely what makes these
mutations rare in sporadic cancers (Quon and Berns 2001), since the initial mutation of one allele
is unlikely to provide a selective advantage to the cell. It is this trait that characterizes
haplosufficient tumor suppressor genes.
A single hit in a haploinsufficient tumor suppressor gene will provide enough of a
proliferative advantage for the affected cell to clonally expand, thus increasing the target cell
population available for the multistep genetic pathway to tumorigenesis. Dmp1+/-
mice are prone
to an array of tumors at two years of age (Inoue et al. 2001). Indeed, the affected target genes are
dysregulated similarly to Dmp1-/-
(Mallakin et al. 2010). Other tumor suppressor genes are
haploinsufficient only under certain circumstances, such as p27+/-
mice that are challenged by
gamma irradiation or chemical carcinogenesis (Fero et al. 1998). In fact, homozygous loss of
p27 has not been documented in human cancers (Pietenpol et al. 1995). In these cases, the
malignant cells retained the functional copy of the gene of interest, indicating that LOH is not
necessary for transformation. Some have argued that haploinsufficiency is due to the requirement
for abnormally high levels of gene product, and that haploinsufficiency arises under conditions
of insufficient levels of a certain protein (Deutschbauer et al. 2005).
![Page 103: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/103.jpg)
89
However, in both of the p27 and Dmp1 models, homozygously deleted mice had a more
severe phenotype than the heterozygotes. The second allele must retain some amount of activity
such that its deletion will further promote cancer development. This suggests that even Dmp1
and p27 are not completely haploinsufficient. In fact, most TSGs probably fall at an intermediate
position on the continuum of haplosufficiency-haploinsufficiency. This study resembles these
findings in that HET mice display an obviously increased incidence in tumorigenesis compared
to WT mice, implying a degree of haploinsufficiency, yet the tumorigenic response to loss of
both alleles is measurably higher, suggesting the presence of a single wild-type allele has tumor
suppressive activity.
The data presented here suggests that Chc1L lies toward the haploinsufficient end of the
continuum. As both heterozygous losses at 13q14 occur in MM, CLL and PC (Latil et al. 1999;
Hanlon et al. 2009; Hanlon et al. 2009), there is evidence to suggest some degree of
haploinsufficiency of CHC1L in human cancer. Studies of CHC1L expression in MM correlate
low expression with a severe prognosis (Harousseau et al. 2004). This suggests a dose-dependent
effect of CHC1L on disease phenotype, where lower expression levels may be promoting disease
progression.
LOH analyses of Chc1L+/-
tumors would improve our understanding of the degree to
which Chc1L is haploinsufficient. If the remaining copy is still functional in highly malignant
tumors, this would imply that although Chc1L may be acting as a tumor suppressor, it is
profoundly haploinsufficient. In vitro studies of the effects of low, moderate and high levels of
CHC1L will increase our understanding of the functional capacity of CHC1L protein.
![Page 104: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/104.jpg)
90
6.6 Transdifferentiation
Several mice displayed a cancer phenotype consistent with both HS and B cell
lymphoma. Many of these mice have likely succumbed to HAL. HAL represents a diversity of
histiocyte-rich lymphomas, wherein normal histiocytes are either admixed with malignant
populations of lymphocytes with clonal Ig rearrangements (B cell lineage HAL), OR admixed
with cells possessing Ig and TCR rearranged loci (HAL with B and T cell lineages) (Morse et al.
2001). However, it has been proposed that some cases of HAL may in fact be composites of both
HS and B or T cell lymphomas (Hao et al. 2010). While Mac-2 is a marker for both malignant
and normal histiocytes and is useful for detecting these cells in tumors as well as healthy tissue,
the lack of established phenotypic or genotypic features for differentiating malignant histiocytes
and normal histiocytes means it is presently impossible to definitively diagnose a tumor as HAL
or HS and lymphoma co-occurring. Further characterization of HS cells will prove or disprove
the existence of these composites.
If some of the tumors described here are indeed HS co-occurring with BCL, it may
suggest a relationship between the two cancers. Indeed, the first data suggesting
transdifferentiation from malignant B lymphocytes to HS cells comes from studies of HS co-
occurring with lymphoma (Weiss et al. 1985; Hanson et al. 1989; Feldman et al. 2008; Chen et
al. 2009). In these studies, B cell genotypes as well as expression of B cell markers were found
in the HS cells. Presently, there is very little evidence for transdifferentation from BCL into HS
in the laboratory mouse. There have been no studies of murine HS that revealed a genotype
suggestive of lymphocytic lineage, however a pair of cases of HS cells expressing the B cell
transcription factor Pax5 have been identified (Hao et al. 2010). Nevertheless, it is interesting
![Page 105: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/105.jpg)
91
that knockout of a gene involved in B cell neoplasms would produce this phenotype. This finding
may be due to Chc1L’s tumor suppressive functions in a range of cell types, but the possibility
for transdifferentiation is worth further analysis.
The plasticity of hematopoietic cell lineages has been a topic of great interest in recent
years (Graf 2002). Recent discoveries demonstrating the plasticity of cells of the hematopoietic
system suggest three mechanisms: dedifferentiation, transdifferentiation, or a combination of the
two (Xie and Orkin 2007). B cell lineage commitment is established by the expression of three
genes, E2A, EBF1, and Pax5. Failure to express any one of these genes will halt B cell
development at an early stage (Busslinger 2004). The effects of loss of Pax5 expression in
development of macrophage and other myeloid phenotypes are well studied. B cell
lymphopoiesis will proceed up until a progenitor-B cell stage in adult Pax5-/-
mice (Nutt et al.
1997), and Pax5-/-
pro-B cells maintain the ability to differentiate into macrophages under in
vitro ectopic expression of myeloid transcription factors CEBPα(Heavey et al. 2003), β(Xie et al.
2004) and GATA-1,2 and 3 (Heavey et al. 2003), with proceeding expression of myeloid genes
and repression of B cell genes (Heavey et al. 2003). Enforced expression of C/EBPα and β in
mature B cells also leads to loss of Pax5 expression, downregulation of its target CD19 and
development of a myeloid phenotype (Xie et al. 2004). Pax5-/-
pro-B cells are unable to
differentiate into mature B cells unless Pax5 expression is restored retrovirally (Nutt et al. 1999).
Further, conditional deletion of Pax5 in mature B cells causes dedifferentiation into uncommitted
precursors, and subsequent T lymphopoiesis in T cell deficient mice (Cobaleda et al. 2007). This
data suggests that Pax5 is required for commitment to and differentiation along the B cell
lineage, and that cells of the B lineage lacking Pax5 may acquire an uncommitted potential.
Recent data from patients with B cell genotypic HS show that the malignant histiocytes are
![Page 106: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/106.jpg)
92
negative for Pax5 (Vos et al. 2005; Chen et al. 2009; Hayase et al. 2010; Hure et al. 2012).
Based on this information, loss of Pax5 expression may be an important event in trans-/de-
differentiation into a histiocyte-like tumor cell. However, the existence of cases of murine HS
with tumor cells that express Pax5 may be due to alternative pathways of lineage plasticity or a
cross-species difference (Hao et al. 2010).
We have crossed Chc1LloxP/+
mice to a strain expressing Cre recombinase under a B cell-
specific promoter to generate conditional knockout in B cells. HS pathogenesis in this model
would provide strong evidence for transdifferentiation. Additionally, further IHC analyses of the
nonconditional knockout strain using primary antibodies for stage-specific B cell markers may
provide evidence for transdifferentiation.
![Page 107: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/107.jpg)
93
Chapter 7: Future Directions
7.1 Validate increased prevalence of HS
This study has provided evidence for the tumor suppressing activity of CHC1L.
Specifically, Chc1L knockout appears to increase incidence of HS in two year old mice. Our
primary objective for future investigation is to validate the results presented here. We have
already bred two new generations of Chc1L knockout mice, and plan to study tumorigenesis at 6
months and 1 year of age. Each group will consist of 30 mice split evenly amongst WT, HET and
KO genotypes. Mice will be sacrificed collectively at each time point, and all organs will be
collected for histopathological analysis, with special interest in spleen, mesenteric lymph node,
liver and bone marrow pathology, based on their frequent involvement in HS and HAL. We will
also search for macrophage accumulation in the lungs as a precursor to HS development, as seen
in a previous triple knockout model of HS (Mashima et al. 2010). For these future studies, every
organ, including WT and healthy-looking HET and KO organs, will be collected and analyzed
for histopathology. Therefore, cases of early tumorigenesis that are not observable during
necropsy will be accounted for. This will allow for a more accurate quantitative analysis of
tumor incidence and disease spectrum. Also, by studying disease progression at an earlier age, an
elevated incidence of tumorigenesis will be more meaningful because age-related neoplasias will
be reduced.
![Page 108: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/108.jpg)
94
Immunohistochemical staining will be applied to all tumor sections to definitively diagnose
neoplasms. Antibodies for Mac-2 and CD163 will be used to detect histiocytes, and B220
antibodies for detection of B cells. To further characterize these tumors, other markers may be
probed. Expression of F4/80 is inversely correlated with histiocyte maturity (McKnight et al.
1996; Schaller et al. 2002; Hao et al. 2010), and staining for this marker will provide insight into
the degree of differentiation of malignant histiocytes. A panel of B cell-specific antibodies may
also be used to detect lineage infidelity in histiocytic proliferations: Oct2, Pax5, CD20 and
BOB.1.
Flow cytometric analyses of peripheral blood and bone marrow aspirates will be performed
prior to pathological analysis. Particular attention will be paid to levels of circulating B
lymphocytes, stained with B220, and histiocytes, stained with CD163. Also, cKit/Sca1 double
staining will be used to specifically detect circulating stem cells. T cells will again be detected
using CD3, CD4 and CD8 antibodies. At these younger ages, there will be less variation to due
age-related pathology.
As a single mutation in a single subset of cells may not be sufficient to induce
tumorigenesis in young mice, we may plan to use the mutagen N-ethyl-N-nitrosourea (ENU) to
initiate tumorigenesis in younger mice. Mice will be divided into two groups: Group A,
consisting equally of WT, HET and KO mice, will be injected with saline as controls; Group B,
also made up of WT, HEs and KOs, will be injected with low doses of ENU. These animals will
be necropsied and organs will be studied for histopathology. A significantly high incidence of
tumorigenesis in HET mice will promote our understanding of the degree of haploinsufficiency.
![Page 109: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/109.jpg)
95
7.2 Investigate B lymphocyte transdifferentiation and myeloma
We have crossed the Chc1LloxP
knockin locus to CD19/Cre mice and generated many
Chc1LloxP
-CD19/Cre mice. These mice will be used for conditional gene mutation in B cells.
Since only B cells will possess deletion, the development of HS in this model will provide strong
evidence of B lymphocyte transdifferentiation to a malignant HS cell.
Specific deletion of Chc1L in B cells may also result in B cell tumorigenesis or MM-
tumorigenesis, as MM stem cells have been shown to have features of memory B cells including
CD19 expression (Matsui et al. 2008; Delude 2011). Formation of MM will support clinical
evidence correlating low Chc1L expression with prognosis in MM patients (Harousseau et al.
2004). B cell tumorigenesis would suggest that loss of CHC1L at 13q14 in CLL promotes
pathogenesis. We may also use ENU mutagenesis to initiate tumor development if loss of Chc1L
in a single cell-type is not sufficient to induce tumorigenesis.
7.3 Investigation of mechanistic pathway
To elucidate the mechanism of CHC1L activity, the following experiments may be
performed in the future. To check for putative E3 ligase substrate adaptor functionality,
interaction with CUL3 ligase must first be demonstrated. Immunoprecipitation of CHC1L-
overexpressing lysates followed by Western blotting for CUL3 will be performed. Alternatively ,
CHC1L may be FLAG-tagged, and an antibody for the FLAG-tag can be used for co-
immunoprecipitation. HA-tagged CUL3 plasmids already exist (Plafker et al. 2009), and can be
co-transfected with Flag-CHC1L. Pulldown may similarly be performed to demonstrate
![Page 110: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/110.jpg)
96
interaction with Ran. Antibodies that bind Ran nonspecifically in both its forms may be used for
measuring changes in Ran protein levels when expression of CHC1L is altered. Shifts in
electrophoretic mobility due to polyubiquitylation in the presence of CHC1L may also be
detected using this method. Other potential substrates can be identified by yeast-two hybrid
analysis.
To look into Ran guanine exchange factor activity, Western Blot using antibodies
specific to the GDP or GTP-bound forms of Ran may demonstrate altered activity of RanGTPase
in conditions of CHC1L under- and over-expression. Fluorescence Resonance Energy Transfer
(FRET) can also be used to detect Ran activity using an antibody that binds to Ran and, upon
excitation, emits light of a particular wavelength in each of Ran’s guanine nucleotide-bound
states, thus allowing real-time dissection of CHC1L’s potential impact on Ran activity. Changes
in other major cell cycle pathways will also be explored by Affimetrix microarray, and
confirmed by RT-PCR and Western Blot.
To complement in vivo analyses, functional characterization of CHC1L will be performed
in vitro. I have already demonstrated using Western Blot that HepG2 cells express CHC1L, as
the antibodies were more specific for the human homologue (Figure 23). siRNA knockdown will
be performed, and the effects on cell cycle regulation, proliferation, and apoptosis will be
studied. I have previously screened a series of cancer cell lines for expression of CHC1L,
identified HepG2 as expressing high levels of CHC1L, and optimized the transfection protocol
using FAM-labelled siRNAs (Figure 24). Changes in cell cycle will be measured by propidium
iodide staining of synchronized, siRNA-transfected cells. The effects on proliferation and
apoptosis will be assessed using the MTT cell survival assay and, if necessary for validation,
![Page 111: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/111.jpg)
97
Ki67 and TUNEL staining. The same studies will be performed in the context of CHC1L
overexpression.
Figure 23 Human cell line analysis of CHC1L expression
A panel of MM, PC, and liver cancer cell lines were analyzed for CHC1L expression to identify candidates for siRNA knockdown. The antibody used specific for the human orthologue, as this antibody did not work on mouse samples. HepG2 had the highest expression levels of CHC1L and was chosen for knockdown experiments.
Figure 24 siRNA transfection optimization
Figure shows successful transfection of FAM-labelled siRNA, which was optimum at 0.12uM siRNA, 8ng/uL Lipofectamine.
![Page 112: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/112.jpg)
98
7.4 Clinical disease association studies
If Chc1L’s tumor suppressive role in murine HS is confirmed, it will be important to
extend our findings to translational studies. Primary human HS samples will be acquired. Direct
sequencing will enable detection of CHC1L mutations. A tissue microarray will be constructed
from patient samples and IHC may be used for quantification of CHC1L expression. Mutation
frequency and expression levels will be compared to patient prognosis to evaluate the effects of
CHC1L on HS disease progression.
![Page 113: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/113.jpg)
99
References
Adachi, M., A. Tefferi, et al. (1990). "Preferential linkage of bcl-2 to immunoglobulin light chain gene in
chronic lymphocytic leukemia." J Exp Med 171(2): 559-64. Afonso, A., M. R. Emmert-Buck, et al. (1999). "Loss of heterozygosity on chromosome 13 is associated
with advanced stage prostate cancer." J Urol 162(3 Pt 1): 922-6. Ahmed, M., F. Giles, et al. (2003). "Use of plasma DNA in detection of loss of heterozygosity in patients
with multiple myeloma." Eur J Haematol 71(3): 174-8. Altieri, D. C. (2006). "The case for survivin as a regulator of microtubule dynamics and cell-death
decisions." Curr Opin Cell Biol 18(6): 609-15. Arai, E., W. P. Su, et al. (1993). "Cutaneous histiocytic malignancy. Immunohistochemical re-examination
of cases previously diagnosed as cutaneous "histiocytic lymphoma" and "malignant histiocytosis"." J Cutan Pathol 20(2): 115-20.
Avet-Loiseau, H., M. Attal, et al. (2007). "Genetic abnormalities and survival in multiple myeloma: the experience of the Intergroupe Francophone du Myelome." Blood 109(8): 3489-95.
Biggs, W. H., 3rd, J. Meisenhelder, et al. (1999). "Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1." Proc Natl Acad Sci U S A 96(13): 7421-6.
Birerdinc, A., E. Nohelty, et al. (2010). "Pro-apoptotic and antiproliferative activity of human KCNRG, a putative tumor suppressor in 13q14 region." Tumour Biol 31(1): 33-45.
Bonci, D., V. Coppola, et al. (2008). "The miR-15a-miR-16-1 cluster controls prostate cancer by targeting multiple oncogenic activities." Nat Med 14(11): 1271-7.
Bottoni, A., D. Piccin, et al. (2005). "miR-15a and miR-16-1 down-regulation in pituitary adenomas." J Cell Physiol 204(1): 280-5.
Bouyge-Moreau, I., G. Rondeau, et al. (1997). "Construction of a 780-kb PAC, BAC, and cosmid contig encompassing the minimal critical deletion involved in B cell chronic lymphocytic leukemia at 13q14.3." Genomics 46(2): 183-90.
Brinster, R. L., H. Y. Chen, et al. (1984). "Transgenic mice harboring SV40 T-antigen genes develop characteristic brain tumors." Cell 37(2): 367-79.
Brookman-Amissah, N., J. Nariculam, et al. (2007). "Allelic imbalance at 13q14.2 approximately q14.3 in localized prostate cancer is associated with early biochemical relapse." Cancer Genet Cytogenet 179(2): 118-26.
Bullrich, F., H. Fujii, et al. (2001). "Characterization of the 13q14 tumor suppressor locus in CLL: identification of ALT1, an alternative splice variant of the LEU2 gene." Cancer Res 61(18): 6640-8.
Buonocore, S., A. L. Valente, et al. (2005). "Histiocytic sarcoma in a 3-year-old male: a case report." Pediatrics 116(2): e322-5.
Busslinger, M. (2004). "Transcriptional control of early B cell development." Annu Rev Immunol 22: 55-79.
Calin, G. A. and C. M. Croce (2006). "Genomics of chronic lymphocytic leukemia microRNAs as new players with clinical significance." Semin Oncol 33(2): 167-73.
![Page 114: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/114.jpg)
100
Calin, G. A., C. D. Dumitru, et al. (2002). "Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia." Proc Natl Acad Sci U S A 99(24): 15524-9.
Carpino, N., D. Wisniewski, et al. (1997). "p62(dok): a constitutively tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells." Cell 88(2): 197-204.
Carrasco, D. R., T. Fenton, et al. (2006). "The PTEN and INK4A/ARF tumor suppressors maintain myelolymphoid homeostasis and cooperate to constrain histiocytic sarcoma development in humans." Cancer Cell 9(5): 379-90.
Carter, S. L., A. C. Eklund, et al. (2006). "A signature of chromosomal instability inferred from gene expression profiles predicts clinical outcome in multiple human cancers." Nat Genet 38(9): 1043-8.
Castro, E. C., C. Blazquez, et al. (2010). "Clinicopathologic features of histiocytic lesions following ALL, with a review of the literature." Pediatr Dev Pathol 13(3): 225-37.
Chang, H., D. Bouman, et al. (1999). "Frequent monoallelic loss of D13S319 in multiple myeloma patients shown by interphase fluorescence in situ hybridization." Leukemia 13(1): 105-9.
Chen, W., S. K. Lau, et al. (2009). "High frequency of clonal immunoglobulin receptor gene rearrangements in sporadic histiocytic/dendritic cell sarcomas." Am J Surg Pathol 33(6): 863-73.
Chena, C., J. S. Avalos, et al. (2008). "Biallelic deletion 13q14.3 in patients with chronic lymphocytic leukemia: cytogenetic, FISH and clinical studies." Eur J Haematol 81(2): 94-9.
Chiorazzi, N., K. R. Rai, et al. (2005). "Chronic lymphocytic leukemia." N Engl J Med 352(8): 804-15. Cimmino, A., G. A. Calin, et al. (2005). "miR-15 and miR-16 induce apoptosis by targeting BCL2." Proc
Natl Acad Sci U S A 102(39): 13944-9. Clarke, P. R. and C. Zhang (2008). "Spatial and temporal coordination of mitosis by Ran GTPase." Nat Rev
Mol Cell Biol 9(6): 464-77. Cline, M. J. (1994). "Histiocytes and histiocytosis." Blood 84(9): 2840-53. Cobaleda, C., W. Jochum, et al. (2007). "Conversion of mature B cells into T cells by dedifferentiation to
uncommitted progenitors." Nature 449(7161): 473-7. Cook, W. D. and B. J. McCaw (2000). "Accommodating haploinsufficient tumor suppressor genes in
Knudson's model." Oncogene 19(30): 3434-8. Cooney, K. A., J. C. Wetzel, et al. (1996). "Distinct regions of allelic loss on 13q in prostate cancer."
Cancer Res 56(5): 1142-5. Cope, G. A., G. S. Suh, et al. (2002). "Role of predicted metalloprotease motif of Jab1/Csn5 in cleavage of
Nedd8 from Cul1." Science 298(5593): 608-11. Corcoran, L. M. and M. Karvelas (1994). "Oct-2 is required early in T cell-independent B cell activation for
G1 progression and for proliferation." Immunity 1(8): 635-45. Corney, D. C., A. Flesken-Nikitin, et al. (2007). "MicroRNA-34b and MicroRNA-34c are targets of p53 and
cooperate in control of cell proliferation and adhesion-independent growth." Cancer Res 67(18): 8433-8.
Cullinan, S. B., J. D. Gordan, et al. (2004). "The Keap1-BTB protein is an adaptor that bridges Nrf2 to a Cul3-based E3 ligase: oxidative stress sensing by a Cul3-Keap1 ligase." Mol Cell Biol 24(19): 8477-86.
Curtis, C., S. P. Shah, et al. (2012). "The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups." Nature 486(7403): 346-52.
Dal Bo, M., F. M. Rossi, et al. (2011). "13q14 deletion size and number of deleted cells both influence prognosis in chronic lymphocytic leukemia." Genes Chromosomes Cancer 50(8): 633-43.
Delude, C. (2011). "Tumorigenesis: Testing ground for cancer stem cells." Nature 480(7377): S43-5.
![Page 115: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/115.jpg)
101
Deutschbauer, A. M., D. F. Jaramillo, et al. (2005). "Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast." Genetics 169(4): 1915-25.
Devilder, M. C., E. Cadoret, et al. (1998). "cDNA cloning, gene characterization and 13q14.3 chromosomal assignment of CHC1-L, a chromosome condensation regulator-like guanine nucleotide exchange factor." Genomics 54(1): 99-106.
Dewald, G. W., S. R. Brockman, et al. (2003). "Chromosome anomalies detected by interphase fluorescence in situ hybridization: correlation with significant biological features of B-cell chronic lymphocytic leukaemia." Br J Haematol 121(2): 287-95.
Dohner, H., S. Stilgenbauer, et al. (2000). "Genomic aberrations and survival in chronic lymphocytic leukemia." N Engl J Med 343(26): 1910-6.
Donehower, L. A., M. Harvey, et al. (1992). "Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours." Nature 356(6366): 215-21.
Dong, J. T., J. C. Boyd, et al. (2001). "Loss of heterozygosity at 13q14 and 13q21 in high grade, high stage prostate cancer." Prostate 49(3): 166-71.
Dong, X. Y., C. Chen, et al. (2006). "FOXO1A is a candidate for the 13q14 tumor suppressor gene inhibiting androgen receptor signaling in prostate cancer." Cancer Res 66(14): 6998-7006.
Egeler, R. M., L. Schmitz, et al. (1995). "Malignant histiocytosis: a reassessment of cases formerly classified as histiocytic neoplasms and review of the literature." Med Pediatr Oncol 25(1): 1-7.
Elnenaei, M. O., R. A. Hamoudi, et al. (2003). "Delineation of the minimal region of loss at 13q14 in multiple myeloma." Genes Chromosomes Cancer 36(1): 99-106.
Enchev, R. I., A. Schreiber, et al. (2010). "Structural insights into the COP9 signalosome and its common architecture with the 26S proteasome lid and eIF3." Structure 18(4): 518-27.
Fabbri, M., A. Bottoni, et al. (2011). "Association of a microRNA/TP53 feedback circuitry with pathogenesis and outcome of B-cell chronic lymphocytic leukemia." JAMA 305(1): 59-67.
Feldman, A. L., D. A. Arber, et al. (2008). "Clonally related follicular lymphomas and histiocytic/dendritic cell sarcomas: evidence for transdifferentiation of the follicular lymphoma clone." Blood 111(12): 5433-9.
Fero, M. L., E. Randel, et al. (1998). "The murine gene p27Kip1 is haplo-insufficient for tumour suppression." Nature 396(6707): 177-80.
Fonseca, R., B. Barlogie, et al. (2004). "Genetics and cytogenetics of multiple myeloma: a workshop report." Cancer Res 64(4): 1546-58.
Fonseca, R., P. L. Bergsagel, et al. (2009). "International Myeloma Working Group molecular classification of multiple myeloma: spotlight review." Leukemia 23(12): 2210-21.
Fonseca, R., E. Blood, et al. (2003). "Clinical and biologic implications of recurrent genomic aberrations in myeloma." Blood 101(11): 4569-75.
Franz, T., J. Lohler, et al. (1985). "Transformation of mononuclear phagocytes in vivo and malignant histiocytosis caused by a novel murine spleen focus-forming virus." Nature 315(6015): 149-51.
Frith, C. (1990). Histiocytic sarcoma, mouse. In: Monographs on Pathology Berlin, Springer-Verlag. Frith CH, W. J., Harleman JH, Stromberg PC, Halm S, Inoue T, Wright JA (2001). Sarcoma, Histiocytic. In:
International Classification of Rodent Tumors—The Mouse. Berlin, Springer-Verlag. Giet, R., C. Petretti, et al. (2005). "Aurora kinases, aneuploidy and cancer, a coincidence or a real link?"
Trends Cell Biol 15(5): 241-50. Graf, T. (2002). "Differentiation plasticity of hematopoietic cells." Blood 99(9): 3089-101. Grant, S. (2008). "Cotargeting survival signaling pathways in cancer." J Clin Invest 118(9): 3003-6. Granucci, F., E. Ferrero, et al. (1999). "Early events in dendritic cell maturation induced by LPS."
Microbes Infect 1(13): 1079-84.
![Page 116: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/116.jpg)
102
Hadjebi, O., E. Casas-Terradellas, et al. (2008). "The RCC1 superfamily: from genes, to function, to disease." Biochim Biophys Acta 1783(8): 1467-79.
Haines, J. (1995). Current Protocols in Human Genetics. New York. Hammarsund, M., M. M. Corcoran, et al. (2004). "Characterization of a novel B-CLL candidate gene--
DLEU7--located in the 13q14 tumor suppressor locus." FEBS Lett 556(1-3): 75-80. Hanamura, I., J. P. Stewart, et al. (2006). "Frequent gain of chromosome band 1q21 in plasma-cell
dyscrasias detected by fluorescence in situ hybridization: incidence increases from MGUS to relapsed myeloma and is related to prognosis and disease progression following tandem stem-cell transplantation." Blood 108(5): 1724-32.
Hanlon, K., S. Ellard, et al. (2009). "Evaluation of 13q14 status in patients with chronic lymphocytic leukemia using single nucleotide polymorphism-based techniques." J Mol Diagn 11(4): 298-305.
Hanlon, K., L. W. Harries, et al. (2009). "Evaluation of 13q14 status in multiple myeloma by digital single nucleotide polymorphism technology." J Mol Diagn 11(5): 450-7.
Hanson, C. A., W. Jaszcz, et al. (1989). "True histiocytic lymphoma: histopathologic, immunophenotypic and genotypic analysis." Br J Haematol 73(2): 187-98.
Hao, M., L. Zhang, et al. (2011). "Suppressing miRNA-15a/-16 expression by interleukin-6 enhances drug-resistance in myeloma cells." J Hematol Oncol 4: 37.
Hao, X., T. N. Fredrickson, et al. (2010). "The histopathologic and molecular basis for the diagnosis of histiocytic sarcoma and histiocyte-associated lymphoma of mice." Vet Pathol 47(3): 434-45.
Harder, K. W., L. M. Parsons, et al. (2001). "Gain- and loss-of-function Lyn mutant mice define a critical inhibitory role for Lyn in the myeloid lineage." Immunity 15(4): 603-15.
Harousseau, J. L., J. Shaughnessy, Jr., et al. (2004). "Multiple myeloma." Hematology Am Soc Hematol Educ Program: 237-56.
Hayase, E., M. Kurosawa, et al. (2010). "Aggressive sporadic histiocytic sarcoma with immunoglobulin heavy chain gene rearrangement and t(14;18)." Int J Hematol 92(4): 659-63.
Heavey, B., C. Charalambous, et al. (2003). "Myeloid lineage switch of Pax5 mutant but not wild-type B cell progenitors by C/EBPalpha and GATA factors." EMBO J 22(15): 3887-97.
Hedan, B., R. Thomas, et al. (2011). "Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior." BMC Cancer 11: 201.
Hillengass, J., C. M. Zechmann, et al. (2008). "Gain of 1q21 and distinct adverse cytogenetic abnormalities correlate with increased microcirculation in multiple myeloma." Int J Cancer 122(12): 2871-5.
Hochrainer, K., H. Mayer, et al. (2005). "The human HERC family of ubiquitin ligases: novel members, genomic organization, expression profiling, and evolutionary aspects." Genomics 85(2): 153-64.
Hornick, J. L., E. S. Jaffe, et al. (2004). "Extranodal histiocytic sarcoma: clinicopathologic analysis of 14 cases of a rare epithelioid malignancy." Am J Surg Pathol 28(9): 1133-44.
Hose, D., T. Reme, et al. (2011). "Proliferation is a central independent prognostic factor and target for personalized and risk-adapted treatment in multiple myeloma." Haematologica 96(1): 87-95.
Hure, M. C., C. P. Elco, et al. (2012). "Histiocytic sarcoma arising from clonally related mantle cell lymphoma." J Clin Oncol 30(5): e49-53.
Inoue, K., F. Zindy, et al. (2001). "Dmp1 is haplo-insufficient for tumor suppression and modifies the frequencies of Arf and p53 mutations in Myc-induced lymphomas." Genes Dev 15(22): 2934-9.
Isaacson, P. G., N. T. O'Connor, et al. (1985). "Malignant histiocytosis of the intestine: a T-cell lymphoma." Lancet 2(8457): 688-91.
Jacks, T., A. Fazeli, et al. (1992). "Effects of an Rb mutation in the mouse." Nature 359(6393): 295-300.
![Page 117: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/117.jpg)
103
Jaffe ES, H. N., Stein H, Vardiman JW (eds). (2001). Pathology and Genetics of Tumours of Haematopoietic and Lymphoid Tissues.
Jemal, A., F. Bray, et al. (2011). "Global cancer statistics." CA Cancer J Clin 61(2): 69-90. Joo, H. M., J. Y. Kim, et al. (2011). "Ret finger protein 2 enhances ionizing radiation-induced apoptosis via
degradation of AKT and MDM2." Eur J Cell Biol 90(5): 420-31. Kalachikov, S., A. Migliazza, et al. (1997). "Cloning and gene mapping of the chromosome 13q14 region
deleted in chronic lymphocytic leukemia." Genomics 42(3): 369-77. Kapanadze, B., N. Makeeva, et al. (2000). "Comparative sequence analysis of a region on human
chromosome 13q14, frequently deleted in B-cell chronic lymphocytic leukemia, and its homologous region on mouse chromosome 14." Genomics 70(3): 327-34.
Kau, T. R. and P. A. Silver (2003). "Nuclear transport as a target for cell growth." Drug Discov Today 8(2): 78-85.
Kau, T. R., J. C. Way, et al. (2004). "Nuclear transport and cancer: from mechanism to intervention." Nat Rev Cancer 4(2): 106-17.
Kitada, S., J. Andersen, et al. (1998). "Expression of apoptosis-regulating proteins in chronic lymphocytic leukemia: correlations with In vitro and In vivo chemoresponses." Blood 91(9): 3379-89.
Kitamura, E., G. Su, et al. (2000). "A transcription map of the minimally deleted region from 13q14 in B-cell chronic lymphocytic leukemia as defined by large scale sequencing of the 650 kb critical region." Oncogene 19(50): 5772-80.
Klein, U., M. Lia, et al. (2010). "The DLEU2/miR-15a/16-1 cluster controls B cell proliferation and its deletion leads to chronic lymphocytic leukemia." Cancer Cell 17(1): 28-40.
Knudson, A. G., Jr. (1985). "Hereditary cancer, oncogenes, and antioncogenes." Cancer Res 45(4): 1437-43.
Koffa, M. D., C. M. Casanova, et al. (2006). "HURP is part of a Ran-dependent complex involved in spindle formation." Curr Biol 16(8): 743-54.
Kumar, R., S. P. Khan, et al. (2011). "Pediatric histiocytic sarcoma clonally related to precursor B-cell acute lymphoblastic leukemia with homozygous deletion of CDKN2A encoding p16INK4A." Pediatr Blood Cancer 56(2): 307-10.
Lacroix-Triki, M., L. Lacoste-Collin, et al. (2003). "Histiocytic sarcoma in C57BL/6J female mice is associated with liver hematopoiesis: review of 41 cases." Toxicol Pathol 31(3): 304-9.
Lancaster, J. M., R. Wooster, et al. (1996). "BRCA2 mutations in primary breast and ovarian cancers." Nat Genet 13(2): 238-40.
Landis, M. W., B. S. Pawlyk, et al. (2006). "Cyclin D1-dependent kinase activity in murine development and mammary tumorigenesis." Cancer Cell 9(1): 13-22.
Latil, A., I. Bieche, et al. (1999). "Loss of heterozygosity at chromosome arm 13q and RB1 status in human prostate cancer." Hum Pathol 30(7): 809-15.
Latil, A., L. Chene, et al. (2003). "Extensive analysis of the 13q14 region in human prostate tumors: DNA analysis and quantitative expression of genes lying in the interval of deletion." Prostate 57(1): 39-50.
Latil, A., P. Morant, et al. (2002). "CHC1-L, a candidate gene for prostate carcinogenesis at 13q14.2, is frequently affected by loss of heterozygosity and underexpressed in human prostate cancer." Int J Cancer 99(5): 689-96.
Lee, S. H., P. M. Starkey, et al. (1985). "Quantitative analysis of total macrophage content in adult mouse tissues. Immunochemical studies with monoclonal antibody F4/80." J Exp Med 161(3): 475-89.
Leenen, P. J., G. I. Bechan, et al. (2010). "Heterogeneity in a mouse model of histiocytosis: transformation of Langerin+ dendritic cells, macrophages, and precursors." J Leukoc Biol 87(5): 949-58.
![Page 118: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/118.jpg)
104
Legartova, S., A. Harnicarova-Horakova, et al. (2010). "Expression of RAN, ZHX-2, and CHC1L genes in multiple myeloma patients and in myeloma cell lines treated with HDAC and Dnmts inhibitors." Neoplasma 57(5): 482-7.
Lemay, S., D. Davidson, et al. (2000). "Dok-3, a novel adapter molecule involved in the negative regulation of immunoreceptor signaling." Mol Cell Biol 20(8): 2743-54.
Lengauer, C., K. W. Kinzler, et al. (1998). "Genetic instabilities in human cancers." Nature 396(6712): 643-9.
Li, C., L. Chen, et al. (2011). "Plasma cell labeling index correlates with deletion of 13q14 in multiple myeloma." Leuk Lymphoma 52(2): 260-4.
Li, C., C. Larsson, et al. (1998). "Identification of two distinct deleted regions on chromosome 13 in prostate cancer." Oncogene 16(4): 481-7.
Li, X., D. Zhang, et al. (2004). "Crystal structure of the Kelch domain of human Keap1." J Biol Chem 279(52): 54750-8.
Li, Z., O. S. Kustikova, et al. (2007). "Insertional mutagenesis by replication-deficient retroviral vectors encoding the large T oncogene." Ann N Y Acad Sci 1106: 95-113.
Lia, M., A. Carette, et al. (2012). "Functional dissection of the chromosome 13q14 tumor-suppressor locus using transgenic mouse lines." Blood 119(13): 2981-90.
Liu, X., M. Lei, et al. (2006). "Normal cells, but not cancer cells, survive severe Plk1 depletion." Mol Cell Biol 26(6): 2093-108.
Lohler, J., T. Franz, et al. (1987). "Murine retrovirus-induced malignant histiocytosis, an experimental model for the disease in humans." Leukemia 1(1): 58-68.
Lopez-Corral, L., N. C. Gutierrez, et al. (2011). "The progression from MGUS to smoldering myeloma and eventually to multiple myeloma involves a clonal expansion of genetically abnormal plasma cells." Clin Cancer Res 17(7): 1692-700.
Lu, W., H. Takahashi, et al. (2006). "Allelotyping analysis at chromosome 13q of high-grade prostatic intraepithelial neoplasia and clinically insignificant and significant prostate cancers." Prostate 66(4): 405-12.
Luchina, N. N., I. V. Krivega, et al. (2003). "Human Oct-1L isoform has tissue-specific expression pattern similar to Oct-2." Immunol Lett 85(3): 237-41.
Lund, A. H., G. Turner, et al. (2002). "Genome-wide retroviral insertional tagging of genes involved in cancer in Cdkn2a-deficient mice." Nat Genet 32(1): 160-5.
Ly, T. K., J. Wang, et al. (2010). "Activation of the Ran GTPase is subject to growth factor regulation and can give rise to cellular transformation." J Biol Chem 285(8): 5815-26.
Lyapina, S., G. Cope, et al. (2001). "Promotion of NEDD-CUL1 conjugate cleavage by COP9 signalosome." Science 292(5520): 1382-5.
Mainardi, C., E. S. D'Amore, et al. (2011). "A case of resistant pediatric histiocytic sarcoma successfully treated with chemo-radiotherapy and autologous peripheral blood stem cell transplant." Leuk Lymphoma 52(7): 1367-71.
Mallakin, A., T. Sugiyama, et al. (2010). "The Arf-inducing transcription factor Dmp1 encodes a transcriptional activator of amphiregulin, thrombospondin-1, JunB and Egr1." Int J Cancer 126(6): 1403-16.
Martin-Caballero, J., J. M. Flores, et al. (2001). "Tumor susceptibility of p21(Waf1/Cip1)-deficient mice." Cancer Res 61(16): 6234-8.
Mashima, R., Y. Hishida, et al. (2009). "The roles of Dok family adapters in immunoreceptor signaling." Immunol Rev 232(1): 273-85.
Mashima, R., K. Honda, et al. (2010). "Mice lacking Dok-1, Dok-2, and Dok-3 succumb to aggressive histiocytic sarcoma." Lab Invest 90(9): 1357-64.
![Page 119: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/119.jpg)
105
Matsui, W., Q. Wang, et al. (2008). "Clonogenic multiple myeloma progenitors, stem cell properties, and drug resistance." Cancer Res 68(1): 190-7.
Matthias, P. (1998). "Lymphoid-specific transcription mediated by the conserved octamer site: who is doing what?" Semin Immunol 10(2): 155-63.
McKnight, A. J., A. J. Macfarlane, et al. (1996). "Molecular cloning of F4/80, a murine macrophage-restricted cell surface glycoprotein with homology to the G-protein-linked transmembrane 7 hormone receptor family." J Biol Chem 271(1): 486-9.
McMahon, M., N. Thomas, et al. (2006). "Dimerization of substrate adaptors can facilitate cullin-mediated ubiquitylation of proteins by a "tethering" mechanism: a two-site interaction model for the Nrf2-Keap1 complex." J Biol Chem 281(34): 24756-68.
Mertens, D., S. Wolf, et al. (2002). "Down-regulation of candidate tumor suppressor genes within chromosome band 13q14.3 is independent of the DNA methylation pattern in B-cell chronic lymphocytic leukemia." Blood 99(11): 4116-21.
Migliazza, A., F. Bosch, et al. (2001). "Nucleotide sequence, transcription map, and mutation analysis of the 13q14 chromosomal region deleted in B-cell chronic lymphocytic leukemia." Blood 97(7): 2098-104.
Miller, C. L., A. L. Feldhaus, et al. (1991). "Regulation and a possible stage-specific function of Oct-2 during pre-B-cell differentiation." Mol Cell Biol 11(10): 4885-94.
Misumi, T., Y. Yamamoto, et al. (2010). "Genetic alterations at 13q14 may correlate with differences in the biological behavior of prostate cancer between Japanese and Caucasian men." Urol Int 84(4): 461-6.
Morris, M. W. and F. R. Davey (1975). "Immunologic and cytochemical properties of histiocytic and mixed histiocytic-lymphocytic lymphomas." Am J Clin Pathol 63(3): 403-14.
Morse, H. C., 3rd, C. F. Qi, et al. (2001). "Combined histologic and molecular features reveal previously unappreciated subsets of lymphoma in AKXD recombinant inbred mice." Leuk Res 25(8): 719-33.
Mosca, L., S. Fabris, et al. (2010). "Integrative genomics analyses reveal molecularly distinct subgroups of B-cell chronic lymphocytic leukemia patients with 13q14 deletion." Clin Cancer Res 16(23): 5641-53.
Nicoloso, M. S., T. J. Kipps, et al. (2007). "MicroRNAs in the pathogeny of chronic lymphocytic leukaemia." Br J Haematol 139(5): 709-16.
Nowell, P. C. and D. A. Hungerford (1961). "Chromosome studies in human leukemia. II. Chronic granulocytic leukemia." J Natl Cancer Inst 27: 1013-35.
Nupponen, N. N. and T. Visakorpi (2000). "Molecular cytogenetics of prostate cancer." Microsc Res Tech 51(5): 456-63.
Nutt, S. L., B. Heavey, et al. (1999). "Commitment to the B-lymphoid lineage depends on the transcription factor Pax5." Nature 401(6753): 556-62.
Nutt, S. L., P. Urbanek, et al. (1997). "Essential functions of Pax5 (BSAP) in pro-B cell development: difference between fetal and adult B lymphopoiesis and reduced V-to-DJ recombination at the IgH locus." Genes Dev 11(4): 476-91.
Ohinata, Y., B. Payer, et al. (2005). "Blimp1 is a critical determinant of the germ cell lineage in mice." Nature 436(7048): 207-13.
Ouellet, V., M. C. Guyot, et al. (2006). "Tissue array analysis of expression microarray candidates identifies markers associated with tumor grade and outcome in serous epithelial ovarian cancer." Int J Cancer 119(3): 599-607.
Ouellet, V., D. M. Provencher, et al. (2005). "Discrimination between serous low malignant potential and invasive epithelial ovarian tumors using molecular profiling." Oncogene 24(29): 4672-87.
![Page 120: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/120.jpg)
106
Ouillette, P., H. Erba, et al. (2008). "Integrated genomic profiling of chronic lymphocytic leukemia identifies subtypes of deletion 13q14." Cancer Res 68(4): 1012-21.
Palamarchuk, A., A. Efanov, et al. (2010). "13q14 deletions in CLL involve cooperating tumor suppressors." Blood 115(19): 3916-22.
Papaconstantinou, A. D., I. Shanmugam, et al. (2006). "Gene expression profiling in the mammary gland of rats treated with 7,12-dimethylbenz[a]anthracene." Int J Cancer 118(1): 17-24.
Parker, H., M. J. Rose-Zerilli, et al. (2011). "13q deletion anatomy and disease progression in patients with chronic lymphocytic leukemia." Leukemia 25(3): 489-97.
Pekarsky, Y., G. A. Calin, et al. (2005). "Chronic lymphocytic leukemia: molecular genetics and animal models." Curr Top Microbiol Immunol 294: 51-70.
Pfeifer, D., M. Pantic, et al. (2007). "Genome-wide analysis of DNA copy number changes and LOH in CLL using high-density SNP arrays." Blood 109(3): 1202-10.
Pfisterer, P., A. Annweiler, et al. (1994). "Differential transactivation potential of Oct1 and Oct2 is determined by additional B cell-specific activities." EMBO J 13(7): 1654-63.
Pietenpol, J. A., S. K. Bohlander, et al. (1995). "Assignment of the human p27Kip1 gene to 12p13 and its analysis in leukemias." Cancer Res 55(6): 1206-10.
Pileri, S. A., T. M. Grogan, et al. (2002). "Tumours of histiocytes and accessory dendritic cells: an immunohistochemical approach to classification from the International Lymphoma Study Group based on 61 cases." Histopathology 41(1): 1-29.
Pines, J. (2006). "Mitosis: a matter of getting rid of the right protein at the right time." Trends Cell Biol 16(1): 55-63.
Plafker, K. S., J. D. Singer, et al. (2009). "The ubiquitin conjugating enzyme, UbcM2, engages in novel interactions with components of cullin-3 based E3 ligases." Biochemistry 48(15): 3527-37.
Planelles, L., C. E. Carvalho-Pinto, et al. (2004). "APRIL promotes B-1 cell-associated neoplasm." Cancer Cell 6(4): 399-408.
Quon, K. C. and A. Berns (2001). "Haplo-insufficiency? Let me count the ways." Genes Dev 15(22): 2917-21.
Raveche, E. S., E. Salerno, et al. (2007). "Abnormal microRNA-16 locus with synteny to human 13q14 linked to CLL in NZB mice." Blood 109(12): 5079-86.
Reijns, M. A., D. Bubeck, et al. (2011). "The structure of the human RNase H2 complex defines key interaction interfaces relevant to enzyme function and human disease." J Biol Chem 286(12): 10530-9.
Renault, L., N. Nassar, et al. (1998). "The 1.7 A crystal structure of the regulator of chromosome condensation (RCC1) reveals a seven-bladed propeller." Nature 392(6671): 97-101.
Roccaro, A. M., A. Sacco, et al. (2009). "MicroRNAs 15a and 16 regulate tumor proliferation in multiple myeloma." Blood 113(26): 6669-80.
Ropke, A., P. Buhtz, et al. (2005). "Promoter CpG hypermethylation and downregulation of DICE1 expression in prostate cancer." Oncogene 24(44): 6667-75.
Saha, A. and R. J. Deshaies (2008). "Multimodal activation of the ubiquitin ligase SCF by Nedd8 conjugation." Mol Cell 32(1): 21-31.
Schaller, E., A. J. Macfarlane, et al. (2002). "Inactivation of the F4/80 glycoprotein in the mouse germ line." Mol Cell Biol 22(22): 8035-43.
Schilling, G., T. Hansen, et al. (2008). "Impact of genetic abnormalities on survival after allogeneic hematopoietic stem cell transplantation in multiple myeloma." Leukemia 22(6): 1250-5.
Schreiber, S., J. Ackermann, et al. (2000). "Multiple myeloma with deletion of chromosome 13q is characterized by increased bone marrow neovascularization." Br J Haematol 110(3): 605-9.
![Page 121: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/121.jpg)
107
Schwechheimer, C., G. Serino, et al. (2001). "Interactions of the COP9 signalosome with the E3 ubiquitin ligase SCFTIRI in mediating auxin response." Science 292(5520): 1379-82.
Serrano, M., H. Lee, et al. (1996). "Role of the INK4a locus in tumor suppression and cell mortality." Cell 85(1): 27-37.
Shaffer, A. L., K. I. Lin, et al. (2002). "Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program." Immunity 17(1): 51-62.
Shapovalov, Y., D. Hoffman, et al. (2011). "Mitochondrial dysfunction in cancer cells due to aberrant mitochondrial replication." J Biol Chem 286(25): 22331-8.
Shaughnessy, J., E. Tian, et al. (2000). "High incidence of chromosome 13 deletion in multiple myeloma detected by multiprobe interphase FISH." Blood 96(4): 1505-11.
Siegel, R., E. Ward, et al. (2011). "Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deaths." CA Cancer J Clin 61(4): 212-36.
Siltanen, S., K. Syrjakoski, et al. (2008). "ARLTS1 germline variants and the risk for breast, prostate, and colorectal cancer." Eur J Hum Genet 16(8): 983-91.
Siltanen, S., T. Wahlfors, et al. (2011). "Contribution of ARLTS1 Cys148Arg (T442C) variant with prostate cancer risk and ARLTS1 function in prostate cancer cells." PLoS One 6(10): e26595.
Smithwick, L. A., A. Smith, et al. (2003). "Inhibition of LPS-induced splenocyte proliferation by ortho-substituted polychlorinated biphenyl congeners." Toxicology 188(2-3): 319-33.
Solomou, E. E., P. P. Sfikakis, et al. (2003). "13q deletion in chronic lymphocytic leukemia: characterization of E4.5, a novel chromosome condensation regulator-like guanine nucleotide exchange factor." Leuk Lymphoma 44(9): 1579-85.
Songyang, Z., Y. Yamanashi, et al. (2001). "Domain-dependent function of the rasGAP-binding protein p62Dok in cell signaling." J Biol Chem 276(4): 2459-65.
Staudt, L. M., R. G. Clerc, et al. (1988). "Cloning of a lymphoid-specific cDNA encoding a protein binding the regulatory octamer DNA motif." Science 241(4865): 577-80.
Stein, H., D. Y. Mason, et al. (1985). "The expression of the Hodgkin's disease associated antigen Ki-1 in reactive and neoplastic lymphoid tissue: evidence that Reed-Sternberg cells and histiocytic malignancies are derived from activated lymphoid cells." Blood 66(4): 848-58.
Stewart, T. A., P. K. Pattengale, et al. (1984). "Spontaneous mammary adenocarcinomas in transgenic mice that carry and express MTV/myc fusion genes." Cell 38(3): 627-37.
Stoykova, A. S., S. Sterrer, et al. (1992). "Mini-Oct and Oct-2c: two novel, functionally diverse murine Oct-2 gene products are differentially expressed in the CNS." Neuron 8(3): 541-58.
Takimoto CH, C. E. (2008). "Principles of Oncologic Pharmacotherapy" in Cancer Management: A Multidisciplinary Approach.
Thevenin, C., B. P. Lucas, et al. (1993). "Cell type- and stage-specific expression of the CD20/B1 antigen correlates with the activity of a diverged octamer DNA motif present in its promoter." J Biol Chem 268(8): 5949-56.
Ueda, T., M. Emi, et al. (1999). "Identification of a I-cM region of common deletion on 13q14 associated with human prostate cancer." Genes Chromosomes Cancer 24(3): 183-90.
van der Valk, P., J. W. van Oostveen, et al. (1990). "Phenotypic and genotypic analysis of large-cell lymphomas, formerly classified as true histiocytic lymphoma: identification of an unusual group of tumors." Leuk Res 14(4): 337-46.
Vincent, S. D., N. R. Dunn, et al. (2005). "The zinc finger transcriptional repressor Blimp1/Prdm1 is dispensable for early axis formation but is required for specification of primordial germ cells in the mouse." Development 132(6): 1315-25.
Vos, J. A., S. L. Abbondanzo, et al. (2005). "Histiocytic sarcoma: a study of five cases including the histiocyte marker CD163." Mod Pathol 18(5): 693-704.
![Page 122: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/122.jpg)
108
Wang, E., C. B. Hutchinson, et al. (2010). "Histiocytic sarcoma arising in indolent small B-cell lymphoma: report of two cases with molecular/genetic evidence suggestive of a 'transdifferentiation' during the clonal evolution." Leuk Lymphoma 51(5): 802-12.
Wang, E., J. Papalas, et al. (2011). "Sequential development of histiocytic sarcoma and diffuse large b-cell lymphoma in a patient with a remote history of follicular lymphoma with genotypic evidence of a clonal relationship: a divergent (bilineal) neoplastic transformation of an indolent B-cell lymphoma in a single individual." Am J Surg Pathol 35(3): 457-63.
Wang, J., M. E. Teves, et al. (2012). "Mouse RC/BTB2, a Member of the RCC1 Superfamily, Localizes to Spermatid Acrosomal Vesicles." PLoS One 7(6): e39846.
Warburg, O. (1930). The metabolism of tumors. Berlin, Springer. Weinstein, I. B. and A. K. Joe (2006). "Mechanisms of disease: Oncogene addiction--a rationale for
molecular targeting in cancer therapy." Nat Clin Pract Oncol 3(8): 448-57. Weiss LM, G. T., Muller-Hermelink HK, Stein H, Dura WT, Favara B, Pauli M, Feller AC (2001). Histiocytic
Sarcoma. Lyon, France, IARC Press. Weiss, L. M., M. J. Trela, et al. (1985). "Frequent immunoglobulin and T-cell receptor gene
rearrangements in "histiocytic" neoplasms." Am J Pathol 121(3): 369-73. Willems, A. R., M. Schwab, et al. (2004). "A hitchhiker's guide to the cullin ubiquitin ligases: SCF and its
kin." Biochim Biophys Acta 1695(1-3): 133-70. Wolf, D. A., C. Zhou, et al. (2003). "The COP9 signalosome: an assembly and maintenance platform for
cullin ubiquitin ligases?" Nat Cell Biol 5(12): 1029-33. Wolf, S., D. Mertens, et al. (2001). "B-cell neoplasia associated gene with multiple splicing (BCMS): the
candidate B-CLL gene on 13q14 comprises more than 560 kb covering all critical regions." Hum Mol Genet 10(12): 1275-85.
Xia, F., C. W. Lee, et al. (2008). "Tumor cell dependence on Ran-GTP-directed mitosis." Cancer Res 68(6): 1826-33.
Xie, H. and S. H. Orkin (2007). "Immunology: changed destiny." Nature 449(7161): 410-1. Xie, H., M. Ye, et al. (2004). "Stepwise reprogramming of B cells into macrophages." Cell 117(5): 663-76. Xu, J., L. Dimitrov, et al. (2005). "A combined genomewide linkage scan of 1,233 families for prostate
cancer-susceptibility genes conducted by the international consortium for prostate cancer genetics." Am J Hum Genet 77(2): 219-29.
Xu, L., Y. Wei, et al. (2003). "BTB proteins are substrate-specific adaptors in an SCF-like modular ubiquitin ligase containing CUL-3." Nature 425(6955): 316-21.
Yamanashi, Y. and D. Baltimore (1997). "Identification of the Abl- and rasGAP-associated 62 kDa protein as a docking protein, Dok." Cell 88(2): 205-11.
Yamanashi, Y., T. Tamura, et al. (2000). "Role of the rasGAP-associated docking protein p62(dok) in negative regulation of B cell receptor-mediated signaling." Genes Dev 14(1): 11-6.
Yin, Z., M. R. Spitz, et al. (1999). "Limiting the location of a putative human prostate cancer tumor suppressor gene at chromosome 13q14.3." Oncogene 18(52): 7576-83.
Yuen, H. F., K. K. Chan, et al. (2012). "Ran is a potential therapeutic target for cancer cells with molecular changes associated with activation of the PI3K/Akt/mTORC1 and Ras/MEK/ERK pathways." Clin Cancer Res 18(2): 380-91.
Zapata, J. M., M. Krajewska, et al. (2004). "TNF receptor-associated factor (TRAF) domain and Bcl-2 cooperate to induce small B cell lymphoma/chronic lymphocytic leukemia in transgenic mice." Proc Natl Acad Sci U S A 101(47): 16600-5.
Zeng, W., J. Meck, et al. (2011). "Histiocytic sarcoma transdifferentiated from follicular lymphoma presenting as a cutaneous tumor." J Cutan Pathol 38(12): 999-1003.
![Page 123: Roles of a Putative Tumor Suppressor Gene, Chc1L, in ... · Roles of a Putative Tumor Suppressor Gene, Chc1L, in Tumorigenesis David Spillane Master of Science 2012 Institute of Medical](https://reader034.vdocument.in/reader034/viewer/2022042414/5f2e9422df5b9e1c1633d760/html5/thumbnails/123.jpg)
109
Zhang, D., J. McGuirk, et al. (2009). "Histiocytic/dendritic cell sarcoma arising from follicular lymphoma involving the bone: a case report and review of literature." Int J Hematol 89(4): 529-32.
Zipper, L. M. and R. T. Mulcahy (2002). "The Keap1 BTB/POZ dimerization function is required to sequester Nrf2 in cytoplasm." J Biol Chem 277(39): 36544-52.
Zojer, N., R. Konigsberg, et al. (2000). "Deletion of 13q14 remains an independent adverse prognostic variable in multiple myeloma despite its frequent detection by interphase fluorescence in situ hybridization." Blood 95(6): 1925-30.