saint cecilia church · 6/7/2020 · saint cecilia church will reopen saturday, june 13 with the...
TRANSCRIPT
![Page 1: Saint Cecilia Church · 6/7/2020 · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses](https://reader033.vdocument.in/reader033/viewer/2022042413/5f2d6bca3adfe320b71a5584/html5/thumbnails/1.jpg)
Saint Cecilia Church
Saint Cecilia Church Trinity Sunday June 7, 2020
![Page 2: Saint Cecilia Church · 6/7/2020 · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses](https://reader033.vdocument.in/reader033/viewer/2022042413/5f2d6bca3adfe320b71a5584/html5/thumbnails/2.jpg)
#179 2
NEW MASS SCHEDULE
Sunday Vigil 5:00pm (Saturday)
6:30 and 10:00am
Monday through Friday 6:30 and 8:30 am
Saturday 8:30 am
OFFICES
Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Marcia Mason School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130
Website: www.stceciliafc.org
School: scsfoxchase.org
CYO Facebook: Saint Cecilia Catholic Youth Organization
Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.
Saint Cecilia Church 535 Rhawn Street
Philadelphia, Pennsylvania 19111
PASTOR Reverend Charles E. Bonner
PASTOR EMERITUS Reverend Msgr. Francis X. Dreger
PAROCHIAL VICAR Reverend Robert Lucas
PERMANENT DEACON Deacon Patrick Diamond
PRINCIPAL Sister Jane Mary Carr, IHM
VICE PRINCIPAL Sister Joan Felicia O’Reilly, IHM
SACRAMENTS
All sacraments are currently postponed.
Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240.
Marriage Couples must contact a priest six months prior to the wedding.
Reconciliation Saturdays from 4:00 to 5:00pm
Homebound Visitation Please contact the Rectory.
This past Wednesday and Thursday, Saint Cecilia Church was
professionally cleaned by Southampton Window Cleaning and
Janitorial Service, Inc. Floors and pews were scrubbed,
polished and sanitized.
Saint Cecilia Church will reopen Saturday, June 13 with the
8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on
Saturday. Sunday Masses will be 6:30am and 10:00am.
In addition to parishioners attending the 10:00am Mass live in
Church, we will also live-stream it for those who wish not to
come to Church in person.
The Archbishop has suspended Sunday obligations until further
notice.
Weekday Masses will begin Monday, June 15 at 6:30 & 8:30am.
GUIDELINES
Parishioners must wear masks while in church.
Social distancing is encouraged (6 ft. apart)
No missalettes or music issues will be in pews. You are
welcome to bring a prayer book or your device to follow
along with the readings.
Two doors will remain open to enter church.
Ushers will help with seating, communion and exiting.
The Crying Room and Restroom will be closed until further
notice.
Confessions will resume Saturday, June 13 (4:00-5:00pm).
Confessionals will not be used. A kneeler will be placed at
the front altar and the priest will be seated in the sanctuary.
![Page 3: Saint Cecilia Church · 6/7/2020 · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses](https://reader033.vdocument.in/reader033/viewer/2022042413/5f2d6bca3adfe320b71a5584/html5/thumbnails/3.jpg)
#179 3
We love our Advertisers Please patronize the businesses
who advertise in our
church bulletin every week.
REFLECTION: Who is this God who is so revelatory
to Moses? Who is this God who is about to take the Isra-
elites, a broken and recalcitrant people and make them
new again? This is the God who chooses to be with us,
despite our own unworthiness.
This is the God who comes in a cloud, who may not be
seen, but certainly is experienced. And what do Moses
and the people experience of this God? How shall they
"name" God? Judging from today’s story God is: patient
and compassionate; takes the initiative to reach out to us;
is not dissuaded by our sins; is faithful to us, even when
we have built our own idols to worship; can take a bro-
ken people and make them whole again.
So we ask ourselves:
From my present experience: What name would I
give God?
Has the reality of God changed for me in recent
years?
What events in my life influenced that change?
Solemnity of The Most Holy Trinity June 7, 2020
The Liturgy of the Word
First Reading A reading from the Book of Exodus
Early in the morning Moses went up Mount Sinai as the Lord had commanded him, taking along the two stone tablets.
Having come down in a cloud, the Lord stood with Moses there and proclaimed his name, “Lord.” Thus the Lord passed before him and cried out, “The Lord, the Lord, a mer-ciful and gracious God, slow to anger and rich in kindness and fidelity.” Moses at once bowed down to the ground in worship. Then he said, “If I find favor with you, O Lord, do come along in our company. This is indeed a stiff-necked people; yet pardon our wickedness and sins, and receive us as your own.”
The word of the Lord. Thanks be to God.
Responsorial Psalm Glory and praise forever!
Second Reading A reading from the second Letter of St.
Paul to the Corinthians
Brothers and sisters, rejoice. Mend your ways, encourage one another, agree with one another, live in peace, and the God of love and peace will be with you. Greet one another with a holy kiss. All the holy ones greet you. The grace of the Lord Jesus Christ and the love of God and the fellowship of the Holy Spirit be with all of you.
The word of the Lord. Thanks be to God.
Gospel A reading from the holy Gospel according to John
God so loved the world that he gave his only Son, so that everyone who believes in him might not perish but might have eternal life. For God did not send his Son into the world to condemn the world, but that the world might be saved through him. Whoever believes in him will not be con-demned, but whoever does not believe has already been condemned, because he has not believed in the name of the only Son of God.
The Gospel of the Lord. Praise to you, Lord Jesus Christ.
Focus: God is one and yet three—a Trinity of pure love.
Today’s feast is a celebration of God’s self-revelation to us through the mystery of the Incarnation. For it is in Christ that we come to know that within the Godhead there is a Trinity of three divine persons to whom belong all glory, praise, and honor, and from whom all life flows.
Liturgy of the Word: On Mount Sinai, Moses encounters
the God of Israel as the God of compassion and kindness. Saint Paul urges the Corinthians to live in fellowship and peace as brothers and sisters, children of the one God. In the Gospel, Jesus teaches that his mission is grounded in the total love of the Father for all of creation.
Mass Schedule for Weekend ~ June 13-14
Saturday (Vigil) Celebrant: Fr. Bonner
5:00pm Lector: Dale Tan
6:30am Celebrant: Fr. Bonner
Lector: Anne Corcoran
10:00am Celebrant: Fr. Lucas
Lector: Colleen Demusz
https://www.facebook.com/St-Cecilia-Church-Fox-Chase
If you feel uncomfortable visiting our church in person for Sunday Mass, we understand. However, it is still important to keep holy the Lord’s Day. We will continue to livestream Mass at 10:00am on Sundays.
![Page 4: Saint Cecilia Church · 6/7/2020 · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses](https://reader033.vdocument.in/reader033/viewer/2022042413/5f2d6bca3adfe320b71a5584/html5/thumbnails/4.jpg)
#179 4
Let us continue praying for . . . .
Those who are sick with the coronavirus and all their caregiv-ers, nurses, doctors, EMTs, scientists, essential workers, government officials, firefighters, law enforcement—especially our police officers, military, students, teachers, parents and those staying at home.
The Pope’s Monthly Intentions
The Way of the Heart
We pray that all those who suffer may find their way in
life, allowing themselves to be touched by the Heart of
Jesus.
Let us pray for the souls of all the faithful departed, especially
Wendy A. Feilke
Barbara Walters
Anna Thackray
Looking for a Job or Career Change? Ascension Press, an Exton based Catholic publishing and
media company has several positions available, such as
General Manager, Podcast Coordinator, and other future
opportunities. Ascension Press has been providing quality
Catholic faith formation resources to parishes, schools,
families and individuals since 1998. We are recognized by
Catholic leaders, educators and laity for our ground-
breaking and award-winning Catholic study programs. If
you would like to bring your talents and skills to our team,
please visit
https://study.ascensionpress.com/pages/about_us/careers
Let us especially pray for all that is happen-ing throughout our city and country
Lord God, crime is on the increase within our city and our
country.
From the depths of our hearts we pray that you will comfort,
heal, and bless all victims of crime.
We ask that you protect all people from the evil of crime and
violence.
We pray especially for life-changing conversion for all crim-
inals and the violent—
remove all evil from their hearts, fill them with your good-
ness and love that they may cease their evil works and that
our city and land be free from the scourge of crime and vio-
lence.
We pray also for the grace to purge ourselves of all vio-
lence—
in our own thoughts and actions,
in our family life,
in our friendships,
in relationships with others
Lord, I personally commit to refrain from violent acts or
words and to settle conflicts.
I further swear to teach others, especially our youth, that
violence is too quick an answer that produces irreparable,
life-long and threatening results.
Amen.
Arise: Restoring Our ‘In Person’ Encounter with
Christ in the Mass
This is a summary of the video by Fr. Eric Banecker, Parochial Vicar at St. Pius X Parish in Broomall and
printed in the Parish Bulletin with his permission.
Restoring Our “In Person” Encounter with Christ in the Mass
by Fr. Eric Banecker, Parochial Vicar, St. Pius X, Broomall (Summary)
I Corinthians 10:16-17
“Presiding at Mass is my favorite part of being a priest.” Every
week the pews are filled as we gather to worship the living God, believing that Jesus Christ is risen from the dead and truly pre-
sent to us in our midst in the Eucharist. It is a great pain for us, a necessary pain to protect the health and well being of others,
that we cannot gather as a community of faith. The Eucharist fulfills our spiritual desires to encounter Christ.
Fr. Banecker shares his profound experience of visiting Jerusa-
lem and walking in the footsteps of Jesus and his mother Mary on the road to Calvary and visiting the Church of the Holy Sep-
ulcher where the Passion, Death and Resurrection of our Lord
took place. The sad division of our Church is apparent in the separate Greek Orthodox and Roman Catholic altars on the
erected on Rock of Calvary. As he placed his hand in the ex-posed rock underneath the Greek Orthodox altar, the actual
spot where the Cross of Christ was placed, he heard these words, “This is the Chalice of my Blood, the Blood of the new
and eternal Covenant which will be poured out for you and
many,” recited by a priest celebrating Mass in Spanish a few feet away at the Roman Catholic altar.
Jesus’ death and Resurrection is not just some historical event.
It becomes reality for us again in the Mass. Jesus Christ is pre-sent to us again in the form and under the appearance of bread
and wine at every Mass celebrated around the world just as he was on Calvary 2000 years ago.
Many of us have taken advantage of the tools of technology and
online Masses for which we are grateful but let us never take for granted the experience of being physically present at Mass or
the experience of receiving Holy Communion. Let’s never take
the sacraments, our community of faith and the life of the Church for granted again. Let’s ask the Lord to restore in us a
great love and devotion for Jesus in the Eucharist and through that grace bring the mercy of Christ to the world through the
spiritual and corporal works of mercy that many people now and in the weeks and months ahead will need.
![Page 5: Saint Cecilia Church · 6/7/2020 · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses](https://reader033.vdocument.in/reader033/viewer/2022042413/5f2d6bca3adfe320b71a5584/html5/thumbnails/5.jpg)
#179 5
Saint Cecilia School 525 Rhawn Street, Philadelphia, PA 19111
A Christ-Center Community Committed to Academic Excellence
Extra Curricular Activities
Student Council
Future Cities Team
Forensics
Mathletes
Altar Servers
Service Commission
School Band/Strings Program
CYO Sports
Scouting
Reading Olympics
Looking for a great school ~ Here we are!
Registration for Pre-K through grade 7 now being accepted
Academics
Religious Education
Archdiocesan Elementary Curriculum
Honors Math
Science Lab Program
Technology
Music Education
Physical Education/Health
Fine Arts
Special Services
CARES (after school program)
CORA (Educational & Counseling Services)
SHALOM Program
NDS Program (we offer FREE break-fast and lunch for students)
Catapult (Title 1 Reading, ELL, Family Counseling )
Middle States Accreditation PA Licensed Early Childhood Program & Afternoon School Care
To register for 2020-2021,
please call the school’s main office at 215-725-8588.
For tuition information, please email Lisa Hnat at
![Page 6: Saint Cecilia Church · 6/7/2020 · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses](https://reader033.vdocument.in/reader033/viewer/2022042413/5f2d6bca3adfe320b71a5584/html5/thumbnails/6.jpg)
179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING
Masonry ContractorsSince 1922
215.533.1934215.533.1934
www.RENTAGRANDSON.org
Office: 215-606-3550cell: 215-990-6770
Ma GiesFounder
RENT A GRANDSON PROPERTY SERVICES
ROOFINGROOFINGSERVICING YOUR PARISH
FOR OVER 20 YEARSA+ Rating/BBB Cert. • 24/7 Emer. Svc.
Financing AvailableCall today for your FREE ESTIMATE
215215--726726--17701770www.libertyroofi ngpa.com
Archdiocesan Member
20% Discounton Labor for all Mechanical Work
15% Cash Paidfor Accident Referrals
$39.00+tax
Inspection & Emissions
$19.95Oil Change
(Most Cars)
Auto Body & Repair Shop
612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com
Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed
In Our 4th Decade of Quality Service
French Drains • Foundation Repair • Mold Remediation
215-639-8500www.morganbasementwaterproofing.com
All Work Guaranteed
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly
payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four
season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103
• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care
ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE
10400 Roosevelt Blvd.Philadelphia, PA
215-698-5600www.stnrehab.org
BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -
P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !
Rafferty Roofi ng215-281-0771
PA062531
For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured
20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF
MASSES FOR THE WEEK OF June 8
MONDAY, June 8 6:30am – Vincenzo & Lucia DiSandro
8:30am – Margaret Lewis
TUESDAY, June 9 6:30am – Catherine Dowrick
8:30am – Edward Urewich
WEDNESDAY, June 10 6:30am – Pasquale & Rosina Liberatore
8:30am – Richard Findley
THURSDAY, June 11 6:30am – Joseph & Catherine Chenntski 8:30am – Dec’d members Mealey & Bocchicchio Families
FRIDAY, June 12 6:30am – Thanksgiving for Prayers Answered 8:30am – Bill Fischer
SATURDAY, June 13 8:30am – Harry Lemly
5:00pm – George R. Bronisz
Remember Our Sick and Suffering
Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Rita Kravitz Maki Turner Kirsten Hosack-Edling Helen Flood Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Linda Reinboth Gregory Farrell Ed MacNew Timothy Martin John Smykal Roseanne Gallagher Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Amanda Gleason Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Frank Basil Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Kathleen Hogan
![Page 7: Saint Cecilia Church · 6/7/2020 · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses](https://reader033.vdocument.in/reader033/viewer/2022042413/5f2d6bca3adfe320b71a5584/html5/thumbnails/7.jpg)
179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
FOX CHASE WINDOWS & DOORSSALES - INSTALLATION
Please Call ... 215-725-4211
FREE ESTIMATES
Parish Member
ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member
G.J. ROSSI & SONELECTRICIANS
Now In Our 3rd Generation
PATRICK J. FOY(215) 281-9656
Interior & Exterior PaintingWallpapering & Scraping
FREE Estimates • Reliable • Honest
309 Central Ave., Cheltenham379-0881
JOSEPH P. FARLEYPLUMBING & HEATING
Alterations-Jobbing
Reg. No. 3121P.A. 043294
Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242
*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )
Sweeney’sVerree Tavern
KITCHEN OPEN FROM 11 AM TO MIDNIGHT
The all new Kim’s Crab CakesPhilly’s Largest Wings
All Soups & Chili HomemadeTAKE OUT AVAILABLE
All Major Sporting Events With 6 Colored TV’s
Finest Tavern Food Now Available in our
New Private Dining Room
7968 VERREE RD.215–725-3366
Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated
2000
Christenings, Weddings & Parties
ROCKLEDGE FIRE HOUSE505 HUNTINGDON PIKE
215-379-8373215-379-8373
Hall RentalsHall Rentals
SENIOR CITIZEN DISCOUNTS
ReliableFull Service Plumber
PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE
INSURED • FREE ESTIMATES215-722-6783215-379-8300
SERVING ENTIRE CITY & SUBURBS
CITY VIOLATIONS CORRECTED
SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED
DIGGING & EXCAVATION SPECIALISTS
Reg. Master Plumber #4287Michael Zalewski
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
Leslie AitaVocalist
Parishioner
Visit Us At Our New Location
Rockledge Plaza Huntingdon Pike
408 Huntingdon PikeRockledge, PA 19046215-379-2100
Family Ownedand Operated
Since 1948
$350Off Any New Stairlift With This Ad
• FREE in home evaluations• Family owned & operated for more than 20 years
1.888.900.8883
www.Tri-StateStairlifts.com
Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”
7450 Oxford Ave Phila, PA 19111 215-728-1050
David G RichardsonSupervisor/Owner
Cher l A Webb-RichardsonManager & LCBA Insurance Rep
Parishioner
richardsonsfuneralhome.com Councilman Brian O’Neill
Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438
FreeNotaryPublic
Free copies
& Faxes
Karon MassadoReal Estate Salesperson
o 267.435.8015 m [email protected]
1601 Market St.- Fl. 19, Phila, PA
Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111
www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director
Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900
www.BirthRight.org
“It is the right of every pregnant woman to give birth, and the right of every child to be born.”
~Birthright Charter7986 Oxford Avenue
Philadelphia, PA 19111215-728-0385
A Blessing from God
John DeCristofaroROOFING
Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts
215-379-2953 Member of St. Cecilia
A Tompkins Community BankFormerly Madison Bank
8000 Verree Rd., Philadelphia(215) 722-4566
www.risingsunhomecare.org
Providing The Highest Quality Care
Parishioner of St. Cecilia
215-605-9555
catering For your next event, call ahead to order
- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1
Eric McHughParishioner
CYO Volunteer OFFERING AUTO, HOME, LIFE,
& BUSINESS INSURANCE Call for a quote
215-328-9990 x7001 or email [email protected]
210 Huntingdon Pike, Rockledge
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-
To all those essential workers keeping us safe, your
service is invaluable &
appreciated.
grte
& Logitrtststtsttttsttttt uctur
nformatioCommunity- Critical Man
ical al Services - Defens
e - Commercial Facis - Residential & Shelte
& Facilities - Hygiene Prod
yourmunity munity cal Mancal Ma
service is& Hazardou& Hazardou
invaluable &Commercial FaciCommercial Faci
appreciatedesidential & Shelte& Shelteies - Hygiene Prodies - Hygiene Prod
esrvic
overnmacturateteee
ivate & Public Healthcanforcement, Public Safe
ponders -lture - Energy Se
Waterwaste - Trans - Public WoCommunic
y
To all thoseivate & Publicivate & nforcement Pubnforcement Pub
ssentialFirst RespFirst Resp
workersWaterwaste Waterwaste
eepings - PublicuCommunCommun
s safe,chnologychnolog
Lacare - L- -- - - - --- - -- - afety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficecececececececececececececece
- Fooooooooooood & d &d &d &d &d &d &d &d &d & d &d & d & d & d & AAAAAAAAAAgrAAAAASector r rrrr rr rr rrrr r - Wa- Wa- Wa WW WaWaWa WaWaWa- Wa- WaWWasstes
ansportattattattatattattattattattattattattattattation ion ionion onon on onononon on ion on on & L&&&&&&Wooooooorks & - Infrffffffffff astststtsttstastastststtstststicatatatatatttttatattatattioionionionsionsionionionionionionioionsionion & I&&&&&&&&&& nf
y Workeorkerkekekekekekekeorkekeorkekekeorkers -rs -rs -rs -rs -rsrs -rs -rs -rs -rs rs -rs -rs -s - Coment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkers -
uring -g ----g ---g -g ---g -- CheCheCheCheCheheCheCheCheCheheCheCheChehemicteteteteteeeeeeeeeeerialrrrrrrr s FiFFiFiFiFFFiFiFiFFiFiFiFinancanaaanannanannancancaan ial
dustristristristristritrtritristristristristristristrtrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Basase asa -esssssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkekkkkkekerskekkkekekkk -
cesicescescescescescesicesicesicescesicesicescesces & F
e,gygy
thank
you
yg&&&& S&&&&& SS&& SS&& S& SS& SServierervvvivieerervivvrvvrrr ir iee ces - Private & Pu
tthcacattt aat aat aaacat at at ct re -re re -reree -erere -rerrerrerr LLLawLaLawLawLawLawawwLL wL wLaaLaawwLLaLLLLLLLLLL ww EnfEnfEEnfEnEnfnfEnfEnfnffEnfEEnfEnE fffEnfEnE orceorceorceorceorceorceorceoo cecorceo eorceeementmmmmmmmmm , Puy yyy -yyy -yyyy OffiOOOfOfOffOffiOOOOOOOOOOOO fifificcererccccccc s &&&&&&&&&&&&&& FirsFirsFiriiFirsirsirsiii t Ret Ret Rt RRRRRRRRRtt Rtt R sponsponsponpsppp ddddd
ygS
Local, trusted, proven, effective, supportive, referrrals, relationships, affordable, repetitous, versatile, lasting. This describes the power of...
ve, supuuuu portive, refefefefefefefferrrals, relationshipsppppppp ,,,, affordable, rererererepetitous, versatile, last
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN! Call 1.800.333.3166!
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my
name?” before entering their vehicle to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson#WHATSMYNAME
![Page 8: Saint Cecilia Church · 6/7/2020 · Saint Cecilia Church will reopen Saturday, June 13 with the 8:30am Mass. We will also celebrate the 5:00pm Vigil Mass on Saturday. Sunday Masses](https://reader033.vdocument.in/reader033/viewer/2022042413/5f2d6bca3adfe320b71a5584/html5/thumbnails/8.jpg)
179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Schmidt’s Florist 700 Solly Ave., Phila., PA 19111
www.schmidtsfl orist.com 215-745-6234
LAW OFFICES
PAUL A. COGHLAN437 RHAWN STREET
PHILADELPHIA, PA 19111(215) 725-5998
FAX (215) 725-3904
Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge
Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.
Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com
Stewart and McGowanATTORNEYS-AT-LAW
6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800
S W D ’ E
WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies
The Original
Pizza6500 Rising Sun Ave. • 215-745-9992
Nora McCloskeyParishioner
Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103
www.bloomingartiststudio.comwww.bloomingartiststudio.com
PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING
SENIOR CITIZEN DISCOUNTFREE ESTIMATES
Ph: (215) 728-1482Fax: (215) 742-7098
8675 Torresdale Ave.Philadelphia, PA 19136
WWW.BILLFRUSCO.COM
O’Donnell PaintingInterior and Exterior
House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854
THOMAS A. CUNNINGHAM, ESQ.Attorney At Law
AUTO ACCIDENT — PERSONAL INJURYWILLS — DIVORCE — REAL ESTATE
109 Huntingdon Pike • Rockledge, PA 19046215-722-6230
Traveling Hair DresserServicing Men, Women & Children
Parishioner for 48 years
215-806-8187
Krissy Tamaro
Reichwein
JOHN F. GIVNISH(3rd Generation)
JOHN F.X. GIVNISH, III(4th Generation)
Serving the Archdioceseof Philadelphia with
grace and dignity since 1928
1-800-GIVNISH
Each Offi ce Independently Owned and Operated
Larry AitaREALTOR®
Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.
Regency Realty
Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!
2018 Outstanding
Agentof the Year
s.
Parishioner
We Care and It Shows
10400 Roosevelt Blvd., Philadelphia215-698-5600 • www.stnrehab.org
Physical, Occupational & Speech Th erapy • Short & Long Term Care • Dementia Unit (IMC) • Memory Care (SJN) • Adult Daycare (SJN)
We Acknowledge -We Appreciate
Occupational & Speech Th erapy • Short & Long Term Care • Dementia Unit (IMC) • Memory Care (SJN) • Adult DayBeautiful On-Site Chapel with Daily Mass Respite Stay Available
2990 Holme Ave., Philadelphia215-335-2100 • www.imrehab.org
Over “105 Years” in Real Estate SalesOver “105 Years” in Real Estate Sales4½% Sales Commission*Free Home Analysis*Multiple Listing Broker*No Sale Sign Required*No Franchise Fees*Free Notary Service
Contact JOE FASY 215-745-85007219 Rising Sun Avenue • Philadelphia, PA 19111
JOSEPH F.X. FASYBroker of Record
Serving Families Since 1900
Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013
Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.
215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.
JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish
Professionals Serving Professionals
Jay B. ComlyBuilding & Offi ce Maintenance
w/an A+ Rating
Commercial • AutomotiveResidential • Safes
Fully Equipped RadioDispatched Mobile Trucks
7936 Oxford Ave. 215-745-5007
Full Service Locksmith Since 1978Member of Parish
VERREEPHARMACY
7960 VERREE RD.(AT RHAWN)Free Delivery
M-F 9AM - 8PMSat. 9AM - 6PM
Sun. 9AM - 1 PM215-342-0100
Mitchell Spivack, R. PH.
Independent LivingPersonal CareSkilled Nursing
Short-Term Rehabilitation9896 Bustleton Ave. • Philadelphia, PA • 215.934.3009 • www.paulsrun.org
HandymanElectric, PlumbingOdd jobs... Just Ask!
From McCloy’s TV 267-231-8785
A Heavenly Hair Salon215-379-1880
Angel Cuts
See You Soon!930 Fox Chase Road, Rockledge
Tax & AccountingFrancis J. McConnell CPA
Tax Preparation • Individual & Business(Across from St. Williams)
Call (215) 742-3428 for Appointments
Charles P. Elliott, PC 110 Central Ave
Cheltenham, PA 19012
215-663-2500We Make House Calls
Complimentary InitialConsultation
We are here for all your tax, IRS, fraud investigations,
& inheritance tax.
RENEE ROACHEREALTOR ~ PARISHIONER
FOX CHASE SPECIALISTBuying or Selling a Home?
Call Today!
Office 215-961-6000 Cell [email protected]
EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE
A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children
7950 Bustleton Ave., Philadelphia, PA215-821-3522
Cochrane Construction LLC
ROOFINGSIDING * GUTTERS
Chimney Restorations & RepairsLicensed & Insured PA # 154589
Senior Citizen Discounts • Free Est.215-839-4317
www.cochraneconstruction.org