sars brian j ward mdcm mcgill division of infectious diseases
Post on 19-Dec-2015
216 views
TRANSCRIPT
SARSBrian J Ward MDCM
McGill Division of Infectious Diseases
Epidemic - World
Parry J . BMJ 2003 Apr 19;326(7394):839 SARS shows no sign of coming under control.
Severe Acute respiratory Syndrome (SARS)
Epidemic - World II Severe Acute respiratory Syndrome (SARS)
China officiallyAcknowledgesSARS problem
Epidemic - World III Severe Acute respiratory Syndrome (SARS)
China - May 6, 2003May 5, 2003 - 138 new cases
4,409 confirmed2,646 suspected
Epidemic - Canada Severe Acute respiratory Syndrome (SARS)
Severe Acute Respiratory Syndrome (SARS)
Chronology of EventsNov 27, 2002 Mainland China - severe ‘flu’ notedNov 02 - Feb 03 Cases appearing in Guangdong province
No official reports until Feb 2003Feb 02, 2003 First HC posting (FluWatch)
Acute respiratory syndromeFeb 11, 2003 Guangdong Dept Health - unknown virus
305 cases & 5 deathsFeb 13-23, 2003 Elderly TO couple in Metropole Hotel
Woman dies March 5, 2003 (ON1)Feb 23, 2003 Hanoi outbreaks - index is American
20 HCW develop symptomsFeb 24, 2003 Son of TO woman admitted (ON2)
Chronology of Events (con’t)Feb 28, 2003 Hanoi - SARS identified by Dr C UrbaniFeb 12-Mar 2, 2003 Recognition of Metropole Hotel outbreak
Prince of Wales Hosp (HK) outbreak in HCWMar 3, 2003 Daughter of ON1 develops symptomsMar 5, 2003 Wife of ON2 develops symptomsMar 6, 2003 BC resident (stayed at Metropole) admittedMar 7, 2003 Second son of ON1 develops symptomsMar 9, 2003 MD who cared for ON1-3 now sickMar 12, 2003 70 HCW at PoW Hospital (HK) sickMar 17, 2003 WHO mobilizes 11 labs in 10 countriesMa 18, 2003 German ID - metapneumovirus (MPV) by EMMar 20, 2003 53 cases admitted to PoW Hospital (HK)Mar 21, 2003 NML finds MPV in 6/8 casesMar 23, 2003 Scarborough Grace closesMar 25, 2003 Metropole records - 168 Canadians at riskMar 27, 2003 HK finds coronavirus - CDC confirmsMar 29, 2003 HK chief MO hospitalized, Dr Urbani diesApr 3, 2003 WHO team gets permission to enter ChinaApr 7, 2003 Amoy Gardens - entire complex in quarantine
Chronology of Events (con’t II)Apr 9, 2003 Travel advisories - increased restrictionsApr 11, 2003 NML finds coronavirus proteins by TMSApr 12, 2003 Michael Smith Genome Ctr - SARS genomeApr 14, 2003 Singapore reports 80% decrease air trafficApr 15, 2003 Questions raised wrt ribavirin (HK Rx)Apr 16, 2003 WHO announces ‘new’ pathogenApr 17, 2003 Risk/benefit warning wrt ribavirinApr 19, 2003 WHO announces droplet spread
TO cases in HCW despite protective gearApr 20, 2003 Sunnybrook trauma/ICU closesApr 21, 2003 Finally - Chinese gov’t official recognition Apr 22, 2003 CDC announces SARS can survive 24 hours
CDC announces travel alert to TOChina reports SARS in poor, inland sites
Apr 23, 2003 WHO includes TO in travel advisoryApr 30,2003 CDN national meeting in TO re SARSMay 1, 2003 Nature - ribavirin dangerous
Chronology of Events (con’t)Feb 28, 2003 Hanoi - SARS identified by Dr C UrbaniFeb 12-Mar 2, 2003 Recognition of Metropole Hotel outbreak
Prince of Wales Hosp (HK) outbreak in HCWMar 3, 2003 Daughter of ON1 develops symptomsMar 5, 2003 Wife of ON2 develops symptomsMar 6, 2003 BC resident (stayed at Metropole) admittedMar 7, 2003 Second son of ON1 develops symptomsMar 9, 2003 MD who cared for ON1-3 now sickMar 12, 2003 70 HCW at PoW Hospital (HK) sickMar 17, 2003 WHO mobilizes 11 labs in 10 countriesMa 18, 2003 German ID - metapneumovirus (MPV) by EMMar 20, 2003 53 cases admitted to PoW Hospital (HK)Mar 21, 2003 NML finds MPV in 6/8 casesMar 23, 2003 Scarborough Grace closesMar 25, 2003 Metropole records - 168 Canadians at riskMar 27, 2003 HK finds coronavirus - CDC confirmsMar 29, 2003 HK chief MO hospitalized, Dr Urbani diesApr 3, 2003 WHO team gets permission to enter ChinaApr 7, 2003 Amoy Gardens - entire complex in quarantine
Published online - Lancet Apr 8, 2003Peiris JSM, et al. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 2003;361:1319 • 50 cases • coronavirus isolated from 2/50 • serology and/or PCR positive in 45/50 • no coronavirus in controls
Epidemiology - Initial DataSevere Acute respiratory Syndrome (SARS)
• initial information limited due to Chinese policies• data from Hanoi, HK, Toronto, Taiwan - HCW at markedly increased risk - barrier precautions appeared to be effective - mask (N95), gowns, gloves & visors - quarantine• little evidence of airborne transmission• ‘droplet’ transmission suspected• nothing known about environment• nothing known about infectiousness - very sick more infectious (? ‘superspreaders’) - probably not infectious before symptomatic
Epidemiology - Amoy GardensSevere Acute respiratory Syndrome (SARS)
• Amoy Gardens Appartment Complex (Hong Kong)• 131 cases of SARS (block E residents)• 241 asymptomatic residents quarantined• ariborne, droplet, water, environmental (cockroaches), etc
• early index case with diarrhea• lived on top floors
• virtually all subsequent cases on same ‘side’ of complex (same elevator, banisters, air ducts, etc)• apparently ‘leak’ in sewage pipes so feces from index ‘dried’ on pipes and ?? blown into building
There are only 3 certainties in life ...
• Death• Taxes• That rents have gone down at the Amoy Gardens Apartment Complex
EtiologySevere Acute respiratory Syndrome (SARS)
• initial report (CDN NML) - metapneumovirus (PCR) - 6 of first 8 cases - seen occasionally by other laboratories - metapneumovirus activity in Hong Kong• report of Chlamydia spp from Germany• subsequent reports by US CDC & HK (EM) - morphologically consistent with coronavirus - rapid development of culture systems & PCR - confirmed presence of a coronavirus in most (but not all) patients
Etiology - IISevere Acute respiratory Syndrome (SARS)
• CDN National Microbiology Laboratory - coronavirus isolation or PCR positive (respiratory)
75
50
25
0 SARSconfirmed
SARS probable
Non-SARS
Etiology - IIISevere Acute respiratory Syndrome (SARS)
• Various laboratories- Early isolation from respiratory tract (~50%)- >85% isolation from feces later in infection- Shedding of virus for ? days after resolution
• Erasmus University- two monkeys (Rhesus macaques)- intra-tracheal Vero cell supernatant- 1/2 animals developed ‘viral pneumonia’- ? satisfies Koch’s postulates
- currently being replicated at NML & CDC among others - ? Animal model for SARS
Coronaviridae - VirologySevere Acute respiratory Syndrome (SARS)
• enveloped, single-stranded• + sense RNA viruses• largest RNA viruses (27-32 kb)• 2 genera - coronavirus - torovirus• 3 antigenic coronavirus groups• difficult to isolate - happiest on primary cells• genetically labile• normally narrow host & tissue specificity• replicate in cytoplasm
Coronaviridae - Virology IISevere Acute respiratory Syndrome (SARS)
Group IHCoV-229E human human respiratory coronavirusTGEV, PRCoV pig porcine transmissible gastroenteritis virusCCoV dog canine respiratory coronavirusFECoV cat feline enteric coronavirusFICoV cat feline infectious peritonitis virusRbCoV rabbit rabbit respiratory coronavirus
Group IIHCoV-)C43 human human respiratory coronavirusMHV mouse murine hepatitis virusSDAV rat sialodacryoadenitis virusHEV pig porcine hemagglutinating virusBCoV cow bovine respiratory coronavirusTCoV turkey turkey respiratory coronavirus
Group IIIIBV chicken avian bronchitis virusTCoV turkey turkey respiratory coronavirus
Coronaviridae - Virology IIISevere Acute respiratory Syndrome (SARS)
• 66% of genome devoted to polymerase gene (2 overlapping ORFs)• produce nested set of mRNAs• Spike, E and HE embedded in lipid bilayer (surface proteins)• M also embedded (3 loops through bilayer)• S binds to host cell receptor & induces fusion• antibodies against S neutralize virus• HE only in some sero-group II viruses• HE has 30% homology to influenza C hemagglutinin (HA)
3’5’
leader(65-98nt)
5’ UTR
Polymerase
Spike
E
M
N
3’ UTR
AA….
Hemagglutinin-Esterase (HE)
Virology IVSevere Acute respiratory Syndrome (SARS)
• mutations spread evenly throughout genome• NOT an obvious recombination virus• a ‘new’ agent
Murine Hepatitis Virus ML-11Murine Hepatitis Virus
Murine Hepatitis Virus - Strain 2Murine Hepatitis Virus
Murine Hepatitis Virus - Strain JHM
Bovine coronavirus
Bovine coronavirus
SARS agent - HK isolate
Avian infectious bronchitis virus
Avian infectious bronchitis virus - Strain CK
Transmissible gastroenteritis virus
Human coronavirus 229E
Porcine epidemic diarrhea virus
Peiris JSM et al. Lancet 2003
Coronaviridae - BiologySevere Acute respiratory Syndrome (SARS)
• normally highly host- & tissue-specific• likely that many mammals have coronavirues - implications for ‘search’ for SARS reservoir species• stability of coronaviruses? - BCoV vaccine (1980’s) still works - RNA virus (~1 error/10,000 bases or 3 errors/replication) - tissue culture passage (MHV) relatively few mutations - antibody pressure many more mutations• recombination possible (in vitro and in nature) - TGEV ‘evolved’ to PRCoV in Europe in 1980s - large deletion in S protein gene - similarly FECoV ‘evolved’ into FIPV
Coronaviridae - Biology IISevere Acute respiratory Syndrome (SARS)
• recombination accomplished by - discontinuous transcription - polymerase ‘jumping’
pol
ATTCCAGATTATCGATTAGCGGATGenomic Virus A
GGCAATTATATCGGACTTAGAACCGAGenomic Virus B
pol
ATTCCAGATTGACTTAGAACCGAChimeric A/B Virus
Coronaviridae - ImmunitySevere Acute respiratory Syndrome (SARS)
• Adults have partial protection from coronaviruses• Vaccines have been developed for other viruses• Role of immune response in ‘disease’ unknown
• Timing of vaccine development effort• If virus has just ‘jumped’ to man - expect rapid mutation to adapt to human host - mutations could go in any direction • less pathogenic
• more pathogenic• different pathogenesis
Clinical DiseaseSevere Acute respiratory Syndrome (SARS)
Case Definition • measured temperature of >100.4°F • At least one finding of respiratory disease - cough, SOB, difficulty breathing, hypoxia, Xray) • travel within 10 days of symptom onset to at risk area - excluding areas with secondary spread only to HCW & household contacts • Contact within 10 days of symptom onset with traveller returned from risk area and respiratory illness or case of suspected SARS
Clinical FeaturesSevere Acute respiratory Syndrome (SARS)
(first 10 cases) Fever 100% Nonproductive cough 100% Dyspnea 80% Malaise 70% Diarrhea 50% Chest pain 30% Headache 30% Myalgias 20% Vomiting 10% Infiltrate on CXR 90% Oxygen saturation <95% 78%
Poutanen SM et al. NEJM Apr 2003
Children may beLess affected by SARS than adults
SARS
AP showing extensive bilateral ground-glass Opacities and poorly defined nodular pattern.
Nicolaou S et al. AJR Am J Roentgenol. 2003;180:1247-9
55-year-old healthy man with history of recent travel to Hong Kong.
12 hours later
Clinical Disease - Imaging
Mortality Rate?Severe Acute respiratory Syndrome (SARS)
Don’t Really Know • estimates between 2-8% • Canada among the highest estimates • USA - expect at least 3 deaths but 0/53 • Need serologic (or other) test for denominator • Hospital-based outbreak (CDN) will increase estimate • Community-based (HK) or sporadic (US) will lower • Rate in children may be lower • Even if 2% is true estimate
0.02 (5x10 )= 1x10 deaths9 8
SARS & RibavirinPrimum non nocere (first, do no harm)
Severe Acute respiratory Syndrome (SARS)
• second … beware of 20/20 hindsight• enormous pressure to ‘do something’• first ‘bugs’ = metapneumovirus & Chlaydia spp• ribavirin/antibiotics appropriate• ?? of ARDS made ribavirin-steroid combo ‘logical’• ribavirin acts vs coronaviruses only at toxic doses• recommendation note to use - end April, 2003
Therapeutic OptionsSevere Acute respiratory Syndrome (SARS)
• progression variable• symptoms pronounced• some have ‘saddleback’ presentations - apparent recovery - subsequent decline - ARDS-like presentations• ?? viral pneumonia vs immune attack?? - no anti-viral know to be effective - do not use ribavirin - steroids probably a bad idea (unless ARDS likely)• supportive care
Epidemiology - Current DataSevere Acute respiratory Syndrome (SARS)
• coronavirus can live 24-48 hours on objects• can live in feces for at least 2 days (diarrhea - 4 days)• most respiratory route but mucosa possible• ?? initial viremia with widespread distribution• both gut and respiratory epithelium infected• many subjects shed virus from respiratory tissues• virtually all subjects shed virus in feces• shedding (after recovery) can be prolonged• ?? epidemiology in HIV-infected subjects• incubation period 2-10 days• inoculum effect - high dose, early & bad disease• some procedures very high risk - intubation in conscious patient
Current Status (World)Severe Acute respiratory Syndrome (SARS)
• SARS controlled everywhere except China• complicated blizzard of travel advisories - new visa requirements - exclusions - ‘alerts’ vs ‘advisories’ vs bans - all levels of ‘authority’ have made pronouncements• China now apparently more ‘transparent’• WHO actions may paradoxically decrease compliance - but they had no choice - only real criticism wrt Canada was timing (ie: slow)• most experts believe SARS now ‘endemic’ in China
Current Status (China)Severe Acute respiratory Syndrome (SARS)
• massive increases in SARS cases - Beijing: 37 cases 10 days ago - Beijing: almost 3,000 cases (May 6, 2003)• rapid spread (or acknowledgement of presence) - rural provinces (migrant workers escaping Beijing) - south to north - coast to Mongolia• WHO teams now in Guangdong, Beijing and northern province (? Herxe) due to explosive growth of case reports• widespread panic, rural communities establishing own quarantine, killing pets
Current Status (Canada)Severe Acute respiratory Syndrome (SARS)
• SARS controlled in BC & Toronto• First SARS meeting (April 30 - May 1, 2003)• Major recommendations - create National Public Health Authority - create National Public Health capacity (CDC-like) - need resources to be mobilized faster than CIHR - human resources pitifully limited - need trainees at all levels - need National (research) SARS think ‘tank’ - research priorities organized
• immediate• medium term• long-term vaccine
Current Status (Science)Severe Acute respiratory Syndrome (SARS)
• coronavirus likely to be etiologic agent• knowing reservoir would be helpful• need (small) animal model• need rapid diagnostic test (extent of disease, mortality) - classical EIA - antigen-detection• ?? immunity & immunopathogenesis ?? - antibodies are produced & can neutralize (others) - role of cell-mediated immunity (help or harm) - immunologic memory (vaccines possible for others) - above will dictate vaccine development• novel anti-virals possible - polymerase can be targeted
Current Status (McGill)Severe Acute respiratory Syndrome (SARS)
• RVH designated as SARS site (if needed)• Has the most negative-pressure rooms• SARS ‘team’ - infection control - infectious diseases - respiratory medicine• Clinics encouraged to screen by phone & questions• Possible cases sent to ER at RVH (or other sites)• Barrier precautions (immediate) + environmental decontamination• Immediate involvement of public health