secondary structure design of multi-state dna machines based on sequential structure transitions...
TRANSCRIPT
![Page 1: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/1.jpg)
Secondary Structure Design ofMulti-state DNA Machines Based on
Sequential Structure Transitions
Hiroki Uejima
Masami Hagiya
![Page 2: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/2.jpg)
OverviewBackground and related work Thermo-dynamical model of DNA secondary structures DNA nanomachines
Hairpin-based multi-state machine Basic idea Conformational addressing of molecular memory
Sequence design Selectivity Ordinality (sequentiality)
Prediction of transition paths Analysis and improvement of Morgan-higgs heuristics
![Page 3: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/3.jpg)
Background and related work
![Page 4: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/4.jpg)
Thermo-dynamical model of DNA secondary structures (1)
Secondary structures are made of base pairs. They are stable with respect to free energy.
Nearest neighbor model (Zimm et al., 1964) Summing up stacking energies of adjacent base pairs an
d mismatched pairs
Folding problem (Zuker et al., 1981)
5’ 3’TTC…GCA
3’5’Base sequence
(linear structure)
Secondary structure
folding
inverse folding
![Page 5: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/5.jpg)
Thermo-dynamical model of DNA secondary structures (2)
Inverse folding problem (Hofacker et al., 1994) Optimization with the fold function for evaluation
Search for sub-optimal structures (Wuchty et al., 1999) Enumeration of (sub-optimal) structures whose energy is unde
r mfe+Computation of the partition function (McCaskill, 1990)
Computation of the frequency of a structure
Estimation of the energy barier between structures (Flamm et al., 2000)
![Page 6: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/6.jpg)
DNA nanomachines
Various DNA nanomachine DNA motor by B-Z transiton
(Seeman et al., 1999) molecular tweezer
(Yurke et al., 2000) three-state machine
(Simmel et al., 2002) PX-JX2
(Yan et al., 2002) Hybridization inhibition by bulge loop
(Tuberfield et al., 2003)
Designing DNA sequence with bistable structures (Flamm et al., 2001)
![Page 7: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/7.jpg)
Yurke’s DNA Tweezers
![Page 8: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/8.jpg)
![Page 9: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/9.jpg)
Simmel’s 3-state machine
![Page 10: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/10.jpg)
PX-JX2 by Yan
![Page 11: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/11.jpg)
HybridizationInhibition byBulge loops(Tuberfield et al.,2003)
![Page 12: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/12.jpg)
Hairpin-based multi-state machine
![Page 13: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/13.jpg)
Molecular machine that allowssuccessive state transitions
input1
input2
input3
2
1
2
3
1
3
3 3
2
2
……
……
……
Input order sensitive
![Page 14: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/14.jpg)
Prototype of multi-state molecular machine and its application
……
……
![Page 15: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/15.jpg)
![Page 16: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/16.jpg)
Conformational addressing ofHierarchical molecular memory
Kameda et al.
![Page 17: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/17.jpg)
Using bulge loops to inhibit hybridization (comparison)
More robust than
our machine
Our machine is simpler Consisting of only
a single strand If it works robustly,
then it can be used as
yet another kind of
building block for DNA machines.
![Page 18: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/18.jpg)
More complexexample ofhairpin-basedmachine(not discussedin the paper)
![Page 19: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/19.jpg)
![Page 20: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/20.jpg)
![Page 21: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/21.jpg)
![Page 22: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/22.jpg)
Sequence design
![Page 23: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/23.jpg)
Design criteria
A hairpin is opened only by a corresponding input oligomer --- selectivity if its predecessor has been opened --- ordinality (sequentiality)
Input oligomer
hairpin
Stickyend
![Page 24: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/24.jpg)
Reduction of the design criteria
Two criteria Selectivity Ordinality (sequentiality)
These criteria should be satisfied by any number of hairpin sequences concatenated in any order.But Only combinations of a sticky end and a hairpin are nec
essary to be verified to guarantee the selectivity. Only combinations of two hairpin sequences are neces
sary to be verified to guarantee the ordinality.
![Page 25: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/25.jpg)
Selectivity
For any combinations of A sticky end and a hairpin, and An input oligomer (also a sticky end and a hairpin)
It is checked whether the mfe (minimum free energy) structure is similar to the target structure.
1-a, 2-a and 2-b in the next slide are exhaustively checked. 1-a: The hairpin is opened. 2-a, 2-b: The hairpin is not opened.
1-b is checked with respect to the ordinality
![Page 26: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/26.jpg)
1-a
2-a
1-b
2-b
1
2
a b
![Page 27: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/27.jpg)
Taking the sub-optimal structures into account
In addition to the condition that the target structure is similar to the mfe structure,
The total frequency of the structures similar to the target should be maximized.
![Page 28: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/28.jpg)
The sub-optimal structures that should be taken into account
mfeδ
Secondary structure
Free energy
Set of sub-optimal secondary structures
Target structure
The frequency of this region is maximized.
![Page 29: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/29.jpg)
Computing the total frequency
Let T be the target structure for sequence xCompute the sub-optimal structures,S1, S2, …, Sn, of x Use the subopt_pf function, which is derived from
the subopt function of the Vienna package
Compute the frequency F(S) of the structure S User pf_fold and energy_of_struct of Vienna
The distance d(S, T) between structures, S and T, is the size of the symmetric difference of S and T, i.e., d(S, T) = |(ST)∖(ST)|Compute the sum of P(Si) such that d(Si, T) ≤ D
![Page 30: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/30.jpg)
Ordinality (Sequentiality)
The hairpin should be opened
neither by (A) nor (B).
(A) (B)
![Page 31: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/31.jpg)
Problem on ordinality
() ()
In general, () is more stable than ().
We should measure the tendency of the transition.
![Page 32: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/32.jpg)
Mountain height and valley depth
()()
The mountain should be as high as possible and the valley should be as shallow as possible
G1 = 3.06 [kcal/mol] , G2 = 4.05[kcal/mol]
G1
G2
![Page 33: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/33.jpg)
When the hairpin is opened
(') (')
The mountain should be as low as possible, and the valley should be as deep as possible
G1 = 1.20 [kcal/mol] , G2 = 15.60 [kcal/mol]
G1
G2
![Page 34: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/34.jpg)
Condition for oligomer invasion:mountain height and valley depth
(α)
(β)
G1
G2
Mountain height G1>B=4.0 and valley depth G2<V=3.0
How to obtain G1: The heuristics for predicting the transition path with the minimum G1 (Morgan and Higgs 1998) is run multiple times, and the minimum value of G1 is adopted. Explained later.
![Page 35: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/35.jpg)
Overview of sequence design
1. Generate the required number of sequences for hairpin structures, using the inverse_fold function of the Vienna package (sequence generation)
2. Validate ordinarity and selectivity for all combinations of sequences (sequence validation)
a) If a condition is not satisfied, related sequences are replaced with newly generated ones
b) If the conditions are satisfied, compute the total frequency of the structures similar to the target, and output the sequence set
![Page 36: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/36.jpg)
Flowchart of sequence designStart Genereate hairpin sequences
When oligomer invadesbarrier height>B and valley depth<V
Validate selectivity
Sequences hold selectivity
Output the successful frequences of selectivity and ordinality
Goal
No
No
Yes
Yes
![Page 37: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/37.jpg)
Example of a sequence set
ordinality min barrier height: 4.369999
ordinality max valley depth: 2.650002
((((((((((((((((((((.......))))))))))))))))))))
CGAATACTCCTAACGTTGCGCGTTTGACGCAACGTTAGGAGTATTCG -23.440001
CTTTGAACACGTGAGTGGCATTACGAGTGCCACTCACGTGTTCAAAG -23.879999
CTTGTCCACCACGTTATGTTTCCGGGTAACATAACGTGGTGGACAAG -22.090000
selectivity (open): 0.767506 0.868699
selectivity (closed): 0.486210 0.733504
ordinality: 0.000384 0.022198
![Page 38: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/38.jpg)
Prediction of secondary structure transition paths
![Page 39: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/39.jpg)
Structure transition path
G1
G2
Secondary structure
Manimize G1
fast transition⇒
Need for prediction of transition paths
Free energy
![Page 40: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/40.jpg)
Various kinds of transition paths
One step in a transition path addition or deletion of a base pair
Direct path --- shortest path
Locally optimized direct path In each step, the transition with the minimum
energy increment (maximum decrement) is taken.
Globally optimized direct path
Globally optimized path
![Page 41: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/41.jpg)
Computation of transition paths
In order to be used for evaluating sequences, structure transition paths should be computed accurately and efficiently Simple search is not tractable
Locally optimized direct path (LDP) Easily computed by the definition
Globally optimized direct path (GDP) Direct paths are generated by M-H heuristics (Morgan
et al., 1998) and the path with the minimum G1 is taken as an approximate solution
Globally optimized path (GP) Currently not available
![Page 42: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/42.jpg)
Morgan and Higgs’s Heuristics
Base pairs in B
Incompatible base pairs in A
6 1,27 28 39 3,410 4,5
Among base pairs in B, choose the pair with the minimum number of incompatible base pairs in A
![Page 43: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/43.jpg)
Among base pairs in B, choose the pair with the minimum number of incompatible base pairs in ADelete the incompatible base pairs in A and add the base pair in BIf more base pairs in B can be added, do soLet the resulting structure be B'Unless B' is identical to A, repeat the procedure on B'
Morgan and Higgs’s Heuristics
![Page 44: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/44.jpg)
6 1,2
7 28 39 3,
410
4,5
6 1
8 39 3,
410
4,5
6 1
9 410
4,5
6 1
10
5 10
5
6 178 39 3,
410
4,5
6 1
89 410
4,5
6 1
910
5
6
10
5 10
0 0 0
0 0 0
1 1 1
1 1
![Page 45: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/45.jpg)
Representation of M-H heuristicsas a graph algorithm
6
7
8
9
10
1
2
3
4
5
B A
1. Delete a vertex in A
2. Delete edges incident to the delete vertex
3. If a vertex in B has no incident edge, then delete the vertex
4. Repeat the above procedure until all the vertices are deleted
Base pair as vertex, incompatibility as edge bipartite graph
![Page 46: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/46.jpg)
Decomposition intoconnected components
6
7
8
9
10
1
2
3
4
5
B A 1. Delete a vertex in A
2. Delete edges incident to the delete vertex
3. If a vertex in B has no incident edge, then delete the vertex
4. Repeat the above procedure until all the vertices are deleted
Base pair as vertex, incompatibility as edge bipartite graph
Each connected component can be handled separately
![Page 47: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/47.jpg)
The order to processconnected components
Connected component can be classified as follows
hh
f
hf
Do first, then , and finally Among --- small h first, and (among equal h) large f first Among --- arbitrarily Among --- large h first, and (among equal h) small f first
![Page 48: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/48.jpg)
A counter example for whichM-H fails
![Page 49: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/49.jpg)
Structures corresponding to the counter example
1234
5 6 7
89
101112
13
14
(A) (B)
![Page 50: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/50.jpg)
Prediction of globally optimized direct paths
Direct paths are randomly generated by M-H, and the path with the minimum G1 is taken as an approximate solution M-H only cares the number of base pairs
In the case of hairpin-based machines, the energy mountaintop height of LDP is close to and often a bit smaller than GDP approximated by M-HJudging from this result, the energy landscape around such simple structural transformation seems relatively smooth
![Page 51: Secondary Structure Design of Multi-state DNA Machines Based on Sequential Structure Transitions Hiroki Uejima Masami Hagiya](https://reader030.vdocument.in/reader030/viewer/2022032806/56649efc5503460f94c0fdfb/html5/thumbnails/51.jpg)
Future work
Generalize the criteria for sequence design make the programs applicable to various design
problems
Verification of the validity of the criteria Comparison with experimental results Comparison with computer simulations Comparison with thermo-dynamical analyses
More detailed analysis of structure transition paths Kinetic analysis --- analysis of nucleation
Incorporation of other aspects of structures Various physical properties of double strands can
inhibit hybridization