section h cloning vectors molecular biology course

Section H Cloning Vectors

Molecular Biology Course

vectorsCloning vectors:

to clone a gene in a vectorExpression vectors:

allowing the exogenous DNA to be inserted, stored, and manipulated mainly at DNA levelIntegration vectors:

allowing the exogenous DNA to be inserted, stored, and expressed.

Introduction

Cloning vectors

H1 Plasmid vectersH2 Bacteriophage vectorsH3 Cosmids and YACs H4 Eukaryotic vectors

H1 Design of Plasmid Vectors

H1-1 A plasmid vector for cloning

H1-2 A plasmid vector for gene expression

Cloning vectors

1. autonomously replicating independent of host’s genome.

2. Easily to be isolated from the host cell. (Plasmid preparation)

3. Selective markers: Selection of cells (1) Containing vector: one marker is

enough (2) Containing ligation products:

# twin antibiotic resistance # blue-white screening

4. Contains a multiple cloning site (MCS)

H1-1 A plasmid vector for cloning


Ampicillin resistant? yes yesTetracycline resistant? No yes

B X B

B

B

XAmpr

ori

Ampr

Tcr

ori

pBR322

Ampr Tcr

ori

Screening by insertional inactivation of a resistance gene

Replica plating: transfer of the colonies from one plate to another using absorbent pad or Velvet ( 绒布 ).

transfer of colonies

+ampicillin + ampicillin+ tetracycline

these colonies have bacteria with recombinant plasmid


Blue white screening

Ampr

ori

pUC18(3 kb)

MCS (Multiple cloning sites,多科隆位点）

Lac promoter

lacZ’

Screening by insertional inactivation of the lacZ gene

The insertion of a DNA fragment interrupts the ORF of lacZ’ gene, resulting in non-functional gene product that can not digest its substrate x-gal.


lacZ encode enzyme b-galactosidase

lacZ’: a shortened derivative of lacZ, encoding N-terminal a-peptide of b-galactosi

dase. Host strain for vectors containing lacZ’:

contains a mutant gene encoding only the C-terminal portion of b-galactosidase which can then complement the a-peptide to produce the active enzyme

IPTG

X-gal (substrate of the enzyme)

lac promoter

Blue product

The expression of active b-galactosidase has to be vector dependent for the selection purpose


Recreated vector: blue transformantsRecombinant plasmid: containing inserted DNA: white transformants

Recreated vector (no insert)

Recombinant plasmid (contain insert)


Multiple cloning sitesMultiple restriction sites enable the convenient insertion of target DNA into a vector

Ampr

ori

pUC18(3 kb)


Lac promoter

lacZ’

…ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA…

. T h rA s n S er S e r Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser…

EcoRI SacI KpnISmaIXmaI BamHI XbaI

SalIHincIIAccI PstI SphI

Lac Z


H1-2 A plasmid vector for gene expression

Expression vectors: allowing the exogenous DNA to be inserted, stored and expressed.

1.Promoter and terminator for RNA transcription are required.

2.Intact ORF and ribosomal binding sites (RBS) are required for translation.


• Some cloning vector can be used to transcribe a gene. (pUC vectors)

• Special transcriptional vectors: pGEM series containing promoters from bacteriophages T7 and SP6 for in vitro transcription with the corresponding polymerases.

• Expression vector (transcription & translation).


Ampr

ori

pUC18(3 kb)


Lac promoter

lacZ’

1.The ORF of the inserted gene has to be in the same direction as that of the lacZ

2.A fusion protein contains the N-terminal sequence of lacZ and the inserted ORF will be produced


Expression vector (transcription & translation).

Promoters1. lacUV-5: a mutant lac promoter

which is independent of cAMP receptor protein. (constitutive expression)

2. lPL promoter

3. Phage T7 promoter

Fused proteins

Individual proteins


T7 promoterRBS

Start codon

MCS

Transcription terminator

Ampr

ori

T7 expression

vector


Fused proteins

Lac fusions: (discussed)His-tag fusions: A sequence encodes His-tag was inserted at the N- terminus of the target ORF, which allows purification of the fusion protein to be purified by binding to Ni2+ column.


H2 Bacteriophage vectorTow examples:H2-1 λ phage bacteriophageλ λ replacement vector H2-2 M13 phage M13 phage vector Cloning in M13 Hybrid plasmid-M13 vectors

Cloning vectors

• viruses that can infect bacteria. •48.5 kb in length•Linear or circular genome (cos ends)

λ phage

Lytic phase (Replicate and release)

Lysogenic phase (integrate into host genome)

H2 Bacteriophage vector

DNAProtein coat

cos cosNonessential region

Long (left)arm

short (right)arm

Exogenous DNA(~20-23 kb)

H2-1λ phage


5‘-CGGGGCGGCGACCTCG-3’

3’-GCCCCGCCGCTGGAGC-5’

Cleavage Ligation(during packaging) (after infection)

GGGCGGGCGACCTCG-3’

5’-CG + GC-5’

3’-GCCCCGCCGCTGGA

The phage λ cos ends

Circular form

Linear form


λ phage


λ replacement vector

• Replace the nonessential region of the phage genome with exogenous DNA (~ 20 kb)

• high transformation efficiency (1000-time higher than plasmid)


λ replacement vector

2. Packing with a mixture of the phage coat proteins and phage DNA-processing enzymes

1. Ligation

3. Infection and formation of plaques


Plaques: the clear areas within the lawn where lysis and re-infection have prevented the cells from growing.

Recombinant DNA may be purified from phage particles from plaques or from liquid culture.


Genes or foreign sequences may be incorporated essentially permanently into the genome of E.coli by integration of a vector containing the sequence of interest.

lysogens in cloning techniques


• A filamentous phage• Phage particles contain a 6.7kb circular single strand of DNA.•After infection of a sensitive E.coli host,the complementary strand is synthesized,and the DNA replicated as a double-stranded circle,the replicative form(RF) with about 100 copies per cell. •Contrasting to phage ,the cell are not lysed by M13,but continue to grow slowly,and single-stranded forms are continuously packaged and released from the cells as new phage particles.

H2-2 M13 phageH2 Bacteriophage vector

M13 phage vectors1. Replication form (RF, dsDNA) of M13 pha

ge can be purified and manipulated like a plamid.

2. Phage particles (ssDNA): DNA can be isolated in a single-stranded form

• DNA sequencing (Topic J2)• Site-directed mutagenesis (Topic J5)

Cloning (RF, like plasmid) transfection (recombinant DNA) growth (plating on a cell lawn) plaques formation (slow growth)


Blue-white selection

• Small plasmid vectors (pBluescript) being developed to incorporate M13 functionality• Contain both the plasmid and M13 origin of replication• Normally propagate as true plasmids• Can be induced to form single-stranded phage particles by infection of the host cell with a helper phage.

Hybrid plasmid-M13 vectors


H3 Cosmids and YACs

H3-1 Cloning large DNA fragments （ > 20 kb)

H3-2 Cosmid vectorsH3-3 YAC vectorsH3-4 Selection in S. cerevisiae ( 啤

酒酵母）

Cloning vectors

Analysis of eukaryotic genes and the genome organization of eukaryotes requires vectors with a larger capacity for cloned DNA than plasmids or phage .

Human genome (3 x 109 bp): large genome and large gene demand vectors with a large size capacity.

H3-1 Cloning large DNA fragments

(Eukaryotic Genome project)

H3 Cosmids and YACs

H3-2 Cosmid vectors

1. Utilizing the properties of the phage l cos sites in a plasmid vector.

2. A combination of the plasmid vector and the COS site which allows the target DNA to be inserted into the l head.

3. The insert can be 37-52 kb.

H3 Cosmids and YACs

Digestion

Ligation

C) Packaging and infect

Formation of a cosmid clone

Cloning in a cosmid vector

cosB

SmaI

B BS S

cos cos

cos

B

B

H3 Cosmids and YACs

Essential components of YAC vectors :• Centromers (CEN), telomeres (TEL) and autonomous replicating sequence (ARS) for proliferation in the host cell. • ampr for selective amplification and markers such as TRP1 and URA3 for identifying cells containing the YAC vector in yeast cells. • Recognition sites of restriction enzymes (e.g., EcoRI and BamHI)

H3-3YAC vectorsCan accommodate genomic DNA fragments of more than 1 Mb, and can be used to clone the entire human genome, but not good in mapping and analysis

H3 Cosmids and YACs

Yeast selection

H3 Cosmids and YACs

Cloning in YAC vector

insertion site for red-white selection

SUP4:

CEN4ARSTRP1

TEL B B TEL

SnaB

Digest with BamHI/SnaI

Ligate with blunt ends

Transfect into yeast

H3 Cosmids and YACs

1.Saccharomyces cerevisiae selectable markers do not confer resistance to toxic substances

2.Growth of yeast on selective media lacking specific nutrients can serve for selection. Auxotrophic yeast mutants ( 营养缺欠型 ) are made as host strains for plasmids containing the genes complementary to the growth defect .

For example: TRP1 mutants can’t make tryptophan, and can only grow on media supplemented with tryptophan. The presence of a plasmid containing gene encoding tryptophane enables the cell to grow on media without tryptophan.

H3-4 Selection in S.cerevisiae

H3 Cosmids and YACs

H4 Eukaryotic Vectors

• Transfection of eukarotic cells• Shuttle vectorsH4-1 Yeast episomal plasmids (Yeasts)H4-2 Agrobacterium tumefaciens ( 农杆菌 )

Ti plasmid (Plants)H4-3 Baculovirus (Insects)H4-4 Mammalian viral vectors (Mammalia

n)

Cloning vectors

The take-up of DNA into eukaryotic cells

Transfection:

1. more problematic than bacterial transformation

2. Much lower efficiency in the progress

3. Transfection methods• Electroporation• Microinjection• liposome


Shuttle vectors

Vectors contain sequences required for replication and selection in both E. coli and the desired host cells, so that the construction and many other manipulation of the recombinant plasmids can be completed in E. coli.

Most of the eukaryotic vectors are constructed as shuttle vectors


MCS

A Shuttle vectorH4 Eukaryotic Vectors

H4-1 Yeast episomal plasmids (YEps)

Vectors for the cloning and expression of genes in Saccharomyces cerevisiae.1. Based on 2 micron (2m) plasmid

which is 6 kb in length.• One origin • Two genes involved in replication• A site-specific recombination protein

FLP, homologous to l Int.2. Normally replicate as plasmids, and

may integrate into the yeast genome.


Insert Figure 1

MCS

A YEp vectorH4 Eukaryotic Vectors

Replicate as plasmid from 2m origin

integrate by recombinantion

YEp vector


H4-2 Agrobacterium tumefaciens Ti plasmid

Ti plasmid 200kb

T-DNA

plant chromosome

Integrated T-DNA

Gene induce crown gall


crown gall or tumor


Recombinant Ti plasmid

1. Place the target gene in the T-DNA region of a Ti plasmid, then transform the recombinant Ti plasmid. (WT is not good because of the crown gall formation)

2. Recombinant T-DNA transformed into the A. tumefaciens cell carrying a modified Ti plasmid without T-DNA (T-DNA that are responsible for crown gall formation. The deleted T-DNA is called disarmed T-DNA shuttle vector).


Plant gene engineering using T-DNA vector


H4-3 Baculovirus

1. Infects insect cells2. The strong promoter expressing polyhe

drin protein can be used to over-express foreign genes engineered. Thus, large quantities of proteins can be produced in infected insect cells.

3. Insect expression system is an important eukaryotic expression system.


H4-4 Mammalian viral vectors

1. SV40: 5.2 kb, can pack DNA fragment similar to phage l.

2. Retroviruss: • single-stranded RNA genome, which co

py to dsDNA after infection.• Have some strong promoters for gene e

xpression• Gene therapy


Gene transfer

Genes may be transiently or permanently introduced into cultured eukaryotic cells without the use of vector in strict sense.

• Transient expression• Integration


section h cloning vectors molecular biology course

Documents

vector expression vectors

plasmid preparation

resistance gene slide

introduction slide

insert recombinant plasmid

dna level integration

multiple cloning site

recreated vector