section h: cloning vectorsyang xu, college of life sciences section h host and vector h1...

Section H: Cloning Vectors Yang Xu, College of Life Sciences

Section H Host and Vector H1 E.coli/Plasmid Vectors H2 E.coli/Bacterophage Vectors H3 Yeast/YAC and E.coli/BAC H4 Eukaryotic Host/Vectors


H1 E.coli/Plasmid Vectors

• E.coli/pBR322 plasmid

• E.coli/pUC plasmid vectors

• Multiple cloning sites

• E.coli/pGEM

• E.coli/T7 Expression vectors


Ligation products

Ligation products:• Recombinant plasmid: With a target fragment.• Recreated vectors: When ligating a target fragment into a

plasmid vector, the most frequent unwanted product is the recreated vector plasmid

Screening of ligation products:• Agarose gel electrophoresis: For mini-preparations from a

number of transformed colonies. Screening by digestion and agarose gel electrophoresis;

• Specially developed vectors: For large scale preparations. Now more efficient methods based on specially developed vectors have been devised (see below).

AE

B


E.coli/pBR322 plasmid

Mechanisms--Insertional inactivation of the resistance genes: If a target DNA fragment is ligated into the coding region of tet A, the gene will become insertionally inactivated.

B

tetAampr

Ori

pBR322

+B B

X

+

B

tetAampr

Ori

X

B

B


Twin antibiotic resistance screening

1. Transformant plating: • Recombinant: can only grow in ampicillin plates;• Recreated vectors: can grow in ampicillin and tetracycline plates2. Replica plating: The colonies grown on a normal ampicillin

plate are transferred, using an absorbent pad, to a second plate containing tetracycline.

transfer

Ampicillin only Ampicillin and tetracycline

Recombinant

Comparison


Blue-white screening• Example--pUC18 plasmid: This one contains an ampr and a lac

Z gene, which encodes the -galactosidase, and is under the control of the lac promoter.

• Mechanisms--Insertional inactivation of the lac Z gene:

Under the effect of -galactosidase, the substrate X-gal will produce a blue product.

1. The blue colonies: probably contain recreated vector.

2. The white colonies: have no expressed -galactosidase and are hence likely to contain the inserted target fragment.

ampr/X-gal plate

Blue: no insert

White: insertampr

Ori

lacZ’

lac promoter

MCS

pUC18


GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCT

EcoRI SacI KpnI BamHI XbaI SalI PstI SphI HindIII

SmaI

XmaIAccI HincII

Multiple cloning sites• The first vectors which used blue-white selection also pioneered

the application of multiple cloning site (MCS).

Definition: The pUC series contain an engineered lacZ‘ gene, which has multiple restriction enzyme sites within the first part of the coding region of the gene, which is known as “MCS”.

Function: The insertion of target DNA in any of these sites, will inactivates the lac Z’ gene, to give a white colony.

LacZ’


T7expressional

vector

E.coli/T7 expression vectors• Definition of expression vectors:

Cloned geneexpression vector hostfusion protein.

• Structure– T7 promoter: a strong promoter; – RBS: ribosome binding site;– ATG: translation initiation condon – MCS: Multiple cloning sites – TT: transcription terminator.– ampr,. ori,

• His-tag: Some expression vectors are designed to have six histidine codons that encode a hexahistidine tag at the N terminus of the expressed protein, which allows one-step purification on an affinity column containing Ni2+.

T7

RBS MCS

TTATG


H2 Bacterophage Vectors

• Bacteriophage • E.coli/ Replacement vectors

• E.coli/Cosmid vectors

• E.coli/M13 phage vectors

• E.coli/pBluescript vectors

• Hybrid plasmid-M13 vectors


Bacteriophage (life cycle)Process of phage infecting E. coli: In brief,

1. Phage injects its linear DNA into E.coli, then ligates into a circle. 2. The circle DNA may replicate to form many “phage particles”, 3. which are released from the cell by lysis and cell death (lytic

phase), or integrate into the host genome (lysogenic phase).

Lytic life Lysogeniclife

UV induce


Bacteriophage

Coat protein

Liner DNA

Phage

5’-CG GGGCGGCGACCTCG-3’

3’-GCCCCGCCGCTGGA GC-5’

5’-CGGGGCGGCGACCTCG-3’

3’-GCCCCGCCGCTGGAGC-5’

Cos end


E.coli/ Replacement vectors Examples: EMBL3 and DASH. A representative scheme for cloning:

1. The vector DNA is cleaved with BamH1 and the long (19 kb) and short (9 kb) arms (p116 Fig. 1) are purified;

2. The target fragments are prepared by digestion, also with BamH1 or a compatible enzyme (Sau3A);

3. The target fragments are treated with alkaline phosphatase to prevent them ligating to each other;

4. The arms and the target fragments are ligated together at relatively high concentration to form long linear products.

B B

20kb

B

Can notParking

infectE.coli

Long armLong armShort Short

armarmReplace.

48.5 kb


Packaging and infection

The Recombinants that can not be packaged: 1. Ligated ends which do not contain an insert;2. The insert is much smaller or larger than the 20 kb;3. The recombinants with two left or right arms.

in vivo

B

Replication concata-mers

cleave individual genomesin vitroA mixture of phage coat proteins and the phage DNA-processing enzymes

Packaging:

Packaging

phage particles

Infection of E. coli109 recombinants per mg of vector DNA.


Formation of plaques Plaques are the analogs of single bacterial colonies. Formation:

The infected E.coli cells from a packaging reaction are spread on an agar plate,

The plate has been pre-spread with uninfected cells, which will grow to form a continuous lawn.

After incubation, phage-infected cells result in clear areas, that are plaques, where cycles of lysis and re-infection have prevented the cells from growing.

Recombinant DNA may be purified:• from phage particles isolated from plaques or • from the supernatant of a culture infected

with a specific recombinant plaque.

E.coli lawnPlaques


E.coli/Cosmid vectors• Structure:

1. a plasmid origin of replication (ori); 2. a selectable marker, for example ampr; 3. a cos site, for re-circulating; 4. a suitable restriction site for cloning .

B B

(32- 47kb)

37-52 kb

ampr

oriB

cos

5kb

Packaging into phage

Infection


RF

Bacteriophage M13Genome features: Size is small (6.7 kb); Single-stranded; Circular

genome; DNA; Positive-sense.

g3pg6p

g7p

g8p

g9p

Host enzymes

end

ini

Infection: M13 particles attach specifically to E.coli sex pili (encoded by a plasmid called F factor), through a minor coat protein (g3p). Binding of g3p induces a structural change in the major capsid protein. This causes the whole particle to shorten, injecting the viral DNA into the host cell.


E.coli/M13 phage vectors

Structure: The phage particles contain a 6.7 kb circular ssDNA. After infection of a sensitive E. coli host, the complementary strand is synthesized, like a plasmid, and the DNA replicated as a dsDNA, the replicative form (RF).

Features: The host cells can continue to grow slowly.

• ssDNA: The single-stranded forms are continuously packaged and released from the cells as new phage particles. ssDNA has a number of applications, including DNA sequencing and site-directed mutagenesis.

• dsDNA: The RF (dsDNA) can be purified in vitro and manipulated exactly like a plasmid.


Cloning in M13Purpose: When the single-stranded DNA of a fragment is

required, a M 13 vector can be used as a common cloning tool. Preparation of ssDNA: 1. Cloning: standard plasmid cloning method can be used to

incorporate recombinant DNA into M13 vectors;2. Transformation: the M13 then infects sensitive E. coli cells;3. Plating: the host cells grow to form the plaques; 4. Isolation: the ssDNA may then be isolated from phage

particles in the growth medium of the plate. Screening: Blue-white screening using MCSs and lacZ' has been

engineered into M13 vectors. Examples: The M13mpl8 and M13mp19, which are a pair of

vectors in which the MCS are in opposite orientations relative to the M13 origin of replication.


Hybrid plasmid-M13 vectors

Definition: A number of small plasmid vectors, for example pBlue-script, have been developed to incorporate M13 functionality.

Structure: They contain both plasmid and M13 origins of replication, but do not possess the genes required for the full phage life cycle.

Working ways: 1. Plasmid way: they normally propagate as true plasmids, and

have the advantages of rapid growth and easy manipulation of plasmid vectors;

2. Phage way: they can be induced to produce single-stranded phage particles by co-infection with a fully functional helper phage, which provides the gene products required for single-strand production and packaging.


H3 YAC and BAC

• Cloning large DNA fragments

• YAC vectors

• BAC vectors


Cloning large DNA fragments

• Problems: 1. The analysis of genome organization and the identification of

genes, particularly in organisms with large genome sizes (human DNA is 3 109 bp, for example) is difficult to use plasmid and bacteriophage vectors, since the relatively small size capacity of these vectors for cloned DNA means that an enormous number of clones would be required to represent the whole genome in a DNA library.

2. In addition, the very large size of some eukaryotic genes, due to their large intron sequences, means that an entire gene may not fit on a single cloned fragment.

• Solution: Vectors with much larger size capacity have been developed to solve these problems.


Yeast/YAC vectorsCEN4 is the centromere of chromosome 4 of

Yeast. The centromere will segregate the daughter chromosomes.

ARS is autonomously replicating sequence, its function is as a yeast origin of replication.

TRP1 and URA3 are yeast selectable markers, one for each end, to ensure the right reconstituted YACs survive in the yeast cells.

TEL is the telomeric DNA sequence, which is extended by the telomerase enzyme inside the yeast cell.

SUP4 is a gene, which is insertionally inactivated, for a red-white color test, like blue-white screening in E. coli.

Function: YAC vectors can accept genomic DNA fragments of more than 1 Mb, and hence can be used to clone entire human genes.

B B

S

pYAC3

SnaBI

BamHI


E.coli/BAC vectors


H4 Other Eukaryotic Vectors

• Cloning in eukaryotes

• Transfection of eukaryotic cells

• Shuttle vectors

• Yeast/episomal plasmids

• Agrobacterium tumefaciens/Ti plasmid

• Insect cell/Baculovirus

• Mammalian cell/viral vectors


Cloning in eukaryotesReasons: • E. coli as host: Many eukaryotic genes and their

control sequences have been isolated and analyzed using gene cloning techniques based on E. coli as host.

• Eukaryotic Vectors: However, many applications of genetic engineering (see Section J) require vectors for the expression of foreign genes in different eukaryotic species, for example:1. Large-scale production of eukaryotic proteins;2. Engineering of new plants;3. Gene therapy for human.

• Such kinds of vectors designed for a variety of hosts are discussed in this topic.


Transfection of eukaryotic cells

Problem: The transfection of DNA into eukaryotic cells is more problematic than E.coli transformation, and efficiency of the process is much lower.

Reasons and solutions:• In yeast and plant cells, the cell wall must be digested,

which may then take up DNA easily. • Animal cells in culture take up DNA at low efficiency.

If it is treated on their surface with calcium phosphate, the efficiency may be increased.


Transfection of eukaryotic cellsOther transfection techniques:

• Electro-poration: By treatment of the cells with a high voltage, which opens pores in the cell membrane.

• Micro-injection: foreign DNA may be microinjected into cells, by using very fine glass pipettes.

• Micro-projectiles: DNA may be introduced by micro-projectiles which fire metallic coated with DNA at the target cells.


Shuttle vectors

Definition: They are the vectors that can shuttle between more than one host, for example, one is E. coli and the other is yeast.

Structure and function: Most of the vectors for use in eukaryotic cells are constructed as shuttle vectors.

• In E. coli: – This means that they can survive and

have the genes (ori and ampr ) required for replication and selection in E. coli.

• In the desired eukaryotic cells: – They can also survive in the desired

host cells, and let the target insert sequences take effects.

E.coli

Yeast


Yeast episomal plasmidsStructure of YEps

a ori: for replication in E.colia ampr: for selection in E. colia 2 origin: for replication in

yestLEU2: is homologous gene

and a selectable marker in yeast, involved in leucine synthesis.

X gene: a shuttle sequence.

ori

ampr

2 originLEU2X gene

Function of YEps• It replicates as plasmids• It integrates into a yeast

chromosome by homologous recombination.

YEps


Agrobacterium tumefaciens/Ti plasmid-I

Definition: Ti plasmid is a kind of plasmid which commonly used to transfer foreign genes into a number of plant species.

Function: The bacterium A. tumefaciens can infects and transfer foreign genes into: 1. Dicot plants: tomato, tobacco; 2. Monocot plants, for example rice.

Ti

T-DNA

expression

plant DNA


Improving: Disarmed T-DNA shuttle vectors– The recombinant T-DNA can be

constructed in a E. coli plasmid;– Then transform into the A.

tumefaciens cell carrying a modified Ti plasmid without T-DNA.

– Infecting plant cell culture with A. Tumefaciens.

– Plating transformed clones.– Regenerate plant using hormone

Ti plasmid

Modified Ti plasmid

In E.coli

In A. tumefaciens

Advantage: Integrate cloned genes easily, andThe recombinant plants can be

reconstituted from the transformed cells.

transform

Infection

Plating

Regeneration


Insect cell/BaculovirusDefinition: Baculovirus is an insect virus

which can be used for the overexpression of animal proteins in insect cell culture.

Mechanism: • Viral promoter: This viral gene has an

extremely active promoter. • Insect cell culture: The same promoter can be

used to drive the over-expression of a foreign gene engineered into the baculovirus genome.

Function: This method is being used increasingly for large-scale culture of proteins of animal origin, since the insect cells can produce many of the post-translational modifications of animal proteins, which a bacterial expression system cannot. Baculovirus-infected SF21 cells


Mammalian cell/viral vectors

• SV40: This virus can infect a number of mammalian species. The SV40 genome is only 5.2 kb in size.

• Since it has packaging constraints similar to phage , so it can be not used for transferring large fragments.


Mammalian cell/viral vectors• Retroviruses: They have a

ssRNA genome, which is copied into dsDNA after infection. The DNA is then stably integrated into the host genome by a transposition mechanism. They have some strong promoters, and they have been considered as vectors for gene therapy (see Topic J6), since the foreign DNA will be incorporated into the host genome in a stable

manner.


That’s all for Section H

section h: cloning vectorsyang xu, college of life sciences section h host and vector h1...

Documents