RESEARCH PAPER

Selective DNA extraction with microparticles in segmented flow

Bert Verbruggen • Karen Leirs • Robert Puers •

Jeroen Lammertyn

Received: 20 February 2014 / Accepted: 26 May 2014 / Published online: 8 June 2014

� Springer-Verlag Berlin Heidelberg 2014

Abstract Droplet-based segmented flow microfluidic

systems have proven their potential for high throughput

detection and quantification of analytes. However, the

required sample preparations are often performed off-chip,

as on-chip methods are lacking. Microparticles are espe-

cially suited for the extraction and purification of target

molecules from a sample and are successfully used in other

microfluidic systems and in laboratory-scale methods. The

current magnetic separation methods in segmented flow

microfluidics are limited in their function to purify, as only

a limited part of the original droplet volume can be

removed from the particles. In this paper, we report the

implementation of a selective DNA extraction assay with

microparticles in a segmented flow microfluidic system.

The combination of magnetic separation with asymmetric

droplet splitting allows the removal of 90 % or even 95 %

of the original sample volume in a single separation step. It

is shown that the hybridization and capture efficiency of

the particles are identical for off-chip and on-chip methods.

Next, the effect of the particle separation efficiency on the

extraction efficiency is tested for different splitting

regimes. When up to 90 % of the droplet volume is

removed, nearly all particles are correctly separated and the

non-separated particle fraction remains below 5 %. Only if

95 % of the original volume is removed, the unseparated

fraction becomes significant ([10 %). Finally, the impact

of separation at a higher splitting ratio for the repeated

washing of the particles is discussed. With this novel sys-

tem, more complex and relevant bioassays can be imple-

mented completely in a droplet-based segmented flow

context.

Keywords Magnetic microparticles � DNA extraction �Droplet-based segmented flow � Segmented flow

microfluidics � On-chip magnetic separation

1 Introduction

Since the first reports of laboratory-on-a-chip technologies

and micro total analysis systems, more than 20 years ago,

the field has grown strongly and diversified into different

categories (Whitesides 2006). Transferring bioassays from

the laboratory to the microfluidic scale has plenty of

advantages, most notably the reduced sample and reaction

volumes and a shorter diffusion time (Huebner et al. 2008).

In segmented flow or droplet microfluidics, the reaction

volumes are separated by an immiscible fluid forming

discrete droplets or plugs and thus preventing cross-con-

tamination. This method combines the general microfluidic

advantages with a forced internal mixing and the ability to

generate droplets at rates between 1 Hz and 100 kHz. This

allows the high throughput screening of multiple samples

sequentially or a single sample in varying dilutions, by

gradually changing the sample flow rate. Many discrete

repetitions allow for statistical information at an unseen

short timescale (Song and Ismagilov 2003). The high

throughput and small volumes also make segmented flow

especially suited for digital assays, where readout is not

based on the signal intensity itself, but on the number of

droplets that generate a signal. An excellent example is the

B. Verbruggen � K. Leirs � J. Lammertyn (&)

MeBioS - Biosensor Group, Department of Biosystems,

KU Leuven - University of Leuven, Willem de Croylaan 42,

3001 Louvain, Belgium

e-mail: jeroen.lammertyn@biw.kuleuven.be

R. Puers

Department of ESAT - MICAS, KU Leuven - University

of Leuven, Kasteelpark Arenberg 10, 3001 Louvain, Belgium

123

Microfluid Nanofluid (2015) 18:293–303

DOI 10.1007/s10404-014-1433-8

digital qPCR (Beer et al. 2007), already commercially

available for Raindance Technologies (USA). All these

characteristics make segmented flow microfluidics a

promising microfluidic subcategory with the potential to

change the way analytical laboratories work (Whitesides

2011).

An indispensable part of most detection or quantification

methods is the sample preparation, and more specifically,

the target molecule extraction and purification. In case of

DNA-based assays, the DNA is captured on a solid support

through hybridization in order to remove the sample matrix

(Berensmeier 2006). Microparticles are popular as solid

support due to a high surface-to-volume ratio, which allows

the concentration of a large number of capture probes in a

small volume. Often superparamagnetic microparticles are

used, adding the potential of noninvasive magnetic sepa-

ration. With the general trend toward microfluidic systems,

the microparticles are also used in microfluidic environ-

ments. Indeed, solid-phase DNA hybridization on micro-

particles was first reported more than 20 years ago (Fan

et al. 1999). Many applications of magnetic microparticles

in microfluidic chip and the manipulations of the micro-

particles have been reported, and the topic has been well

reviewed (Gijs et al. 2010; Gijs 2004; Pamme 2006, 2012;

Verpoorte 2003).

Over the years, many authors have contributed to the

toolbox of basic droplet operations: Droplet formation by

flow-focusing or T-junction (Anna et al. 2003; Thorsen

et al. 2001), sample mixing and incubation (Song et al.

2003), sorting (Baroud et al. 2006; Tang et al. 2009),

retention (Huebner et al. 2009), splitting (Link et al. 2004)

and merging of droplets (Christopher et al. 2009; Niu et al.

2008). We previously reported on a novel droplet splitting

system to dynamically control the droplet splitting ratio

with an additional oil flow. Reliable droplet splitting could

be achieved for splitting ratios ranging from 1:1 up to 1:20

(Verbruggen et al. 2013).

The magnetic manipulation of microparticles has been

combined with segmented flow microfluidics, as the mi-

croparticles are separated from the droplet to extract cap-

tured targets from the sample matrix (Lee et al. 2012;

Lombardi and Dittrich 2011; Pan et al. 2011). However, the

current methods of particle separation in segmented flow

remain insufficient, as only half of the original droplet

volume is removed. The other half remains with the sep-

arated microparticles, thus failing to meet the purification

requirements of many bioassays. Improved systems are

clearly needed to bridge the gap with magnetic separation

on macroscale and on continuous microfluidic systems

(Lacharme et al. 2009) and EWOD-based digital micro-

fluidic platforms (Sista et al. 2008).

Recently, we reported on the development of a novel

microfluidic and magnetic setup to separate

superparamagnetic microparticles from sample droplets

(Verbruggen et al. 2014). First, the conditions for particle

aggregation, attraction and immobilization were determined

and used to predict good separation conditions. Second, the

magnetic forces at the splitting T-junction were simulated

for different magnet orientations and positions. Next, the

most promising setups were tested and compared. Finally,

we were able to remove 90–95 % of the volume with a

single particle separation step, which is a significant

improvement compared to previously reported systems.

However, the DNA extraction efficiency of the micro-

fluidic system goes beyond the efficiency of the particle

separation and is a combination of the capture efficiency of

the microparticles and the separation efficiency of the

microfluidic setup. Furthermore, the practical implemen-

tation of selective DNA extraction in the droplet-based

segmented flow system is more than the miniaturization of

macroscale protocols. In this work, we report for the first

time the practical implementation of microparticle-based

selective DNA extraction in a segmented flow microfluidic

chip. First, the capture efficiency and underlying DNA

hybridization reaction are experimentally determined,

using both off-chip and on-chip methods. Next, the

extraction efficiency at different splitting regimes is stud-

ied. Finally, the impact of the improved splitting system for

the repeated washing of the particles is discussed. An

overview of the DNA extraction assay is given in Fig. 1.

2 Experimental

2.1 Reagents and buffer solutions

109 SSC buffer solution (1.5 M NaCl, 1.50 9 10-1 M

Trisodiumcitrate, pH 7.0) and 29 Tris–HCl buffer solution

(1.0 9 10-2 M Tris–HCl, 1.0 9 10-3 M EDTA, 2.0 M

NaCl, pH 7.5) were prepared from analytical grade

reagents (Sigma-Aldrich, Bornem, Belgium) using auto-

claved and deionized water. All DNA was custom syn-

thesized and purified by Integrated DNA Technologies

(Haasrode, Belgium). The various sequences used in this

work are listed in Table 1.

M-280 superparamagnetic microparticles with a strep-

tavidin coating were purchased from Dynal Biotech

(Invitrogen, Carlsbad, USA). All experiments were per-

formed in DNA Lobind tubes (Eppendorf, Hamburg, Ger-

many) to minimize sticking of DNA.

HFE-7500 fluorocarbon oil was obtained from 3 M

(Zwijndrecht, Belgium) and contained 1 % (w/w) of a

custom-made polytetrafluoroethylene–polyethyleneglycol

block–copolymer surfactant (PFPE–PEG–PFPE) kindly

provided by the Weitz lab at Harvard University, USA

(Holtze et al. 2008). It had a viscosity of 1.24 9 10-3 Pa s,

294 Microfluid Nanofluid (2015) 18:293–303

123

a density of 1,614 kg m-3 and the surface tension between

the oil and pure water was 3.5 9 10-3 N m-1.

2.2 Fabrication of the microfluidic system

The poly-dimethylsiloxane (PDMS) chip was fabricated

using the softlithographic methods described by Duffy et al.

(1998). Summarized, a layer of SU-8 epoxy resin (Micro-

chem, USA) was spin-coated on a 3-in. wafer, baked and

exposed to UV-light through a photomask with the design.

After developing the SU-8, a 3D negative mold of the

microfluidic system was obtained. To improve PDMS liftoff,

a thin PTFE layer (DuPont, USA) was spin-coated over the

mold. Next, a 0.5-mm Sylgard 184 PDMS (Dow Corning,

USA) layer was spin-coated on the mold and baked. Using

plasma oxidation a thicker slab of PDMS was sealed locally

above the tube connections to prevent leakage, without

covering the rest of the chip. Finally, the complete chip was

sealed to a glass wafer, closing the channels.

2.3 Design of the microfluidic system

The microfluidic design used in this work was based on the

system developed in Verbruggen et al. (2013) and is

schematically represented in Fig. 2. All channels were

60 lm high, and the width of the main channel was

200 lm, while the particle and sample inlets were 100 lm

Fig. 1 Overview of the DNA extraction assay. Top Immobilization

of capture probes: The superparamagnetic microparticles coated with

streptavidin are mixed with an excess of biotinylated capture probes

and incubated for 20 min allowing the immobilization of the probes.

Then, the microparticles are magnetically separated from the unbound

probes. Bottom left On-chip extraction: The microparticles and a

sample containing ssDNA targets are injected into one droplet. While

the droplet is transported through the channel for 1 min, the

microparticles and targets are mixed and hybridize spontaneously.

At the T-junction, the microparticles are magnetically separated from

the droplet, extracting the target DNA from the sample. Part of the

original droplet volume remains with the particles. Bottom right Off-

chip extraction: The microparticles and target are mixed in a tube,

incubated for 1 min and the particles a magnetically extracted

Table 1 Used DNA sequences

Short biotinylated

probe

Bt-50TTCGCACACACGGACTTACG30

Short fluorescent

and biotinylated

probe

Bt-50TTCGCACACACGGACTTACG

30-6FAM

Long free strand 50TCGCACATTCCGCTTCTACCGGGGCAC

GTTTATCCGTCCCTCCTAGTGGCGTGC

CCCTTACGTAAGTCCGTGTGTGCGAA30

Forward primer

qPCR

50TCGCACATTCCGCTTCTACC30

Reverse primer

qPCR

50TTCGCACACACGGACTTACG30

Microfluid Nanofluid (2015) 18:293–303 295

123

wide. Two aqueous solutions were jointly injected into the

oil flow (1), forming a single droplet and mixed rapidly due

to the internal circulating flow profile. After 5.5 cm in the

channel, corresponding to 60 s of incubation, the main

channel narrowed down to 50 lm at the splitting zone (2),

elongating the droplets and thus limiting the variation on

the splitting ratio. Behind the splitting T-junction, the two

channels broadened back to 100 lm and were reconnected

to equalize the pressure and avoid oscillating splitting

ratios (3). A line of pillars (50 lm) prevented the droplets

from changing channel. In the lower branch of the split, an

additional channel (50 lm) was used to regulate the split-

ting ratio (4). Control of the oil flow rate through this oil

inlet also permitted control of the total flow rate and

pressure in branch B. This in turn allowed steering of the

flow rates at the split (2) and thus the asymmetric droplet

splitting (Verbruggen et al. 2013).

An external magnet was placed on top of the thin PDMS

layer, 0.5 mm above the extra oil channel, at 1 mm dis-

tance from the main channels and the loop, to collect the

magnetic particles in the small daughter droplet. Without

the controlling oil flow, the droplets split equally, as is the

case in any regular T-junction droplet splitting. With the

additional oil flow, the droplets split asymmetrically, with

the smallest daughter droplet going to outlet 1 and the

largest droplet going to outlet 2.

2.4 Setup of the microfluidic system

The inlets of the microfluidic chip were connected to glass

syringes (Hamilton, Switzerland) by FEB tubes (IDEX,

Germany), while PHD 2000 syringe pumps (Harvard

Apparatus, USA) were used to precisely control the flow rate

in the channels. A 5-mm NdFeB cubic permanent magnet

(Supermagnete, Germany) was used to separate the magnetic

particles. During the hybridization experiments, the system

was installed on a temperature controlled hotplate.

2.5 Capture probe immobilization on magnetic

particles

For the capture probe immobilization, biotinylated

ssDNA stands and streptavidin-coated microparticles

were used, following the manufacturer’s protocol. In a

reaction, volume of 1 mL Tris–HCl buffer 1 mg of

particles was incubated with the biotinylated probes at

room temperature for 20 min. To remove any unbound

probes, the particles were washed three times in 1 mL of

the Tris–HCl buffer. Unless otherwise mentioned, an

excess of 10-6 M probes was used to saturate 1 mg of

particles. Particles of multiple batches were mixed to

remove any batch effect.

The number of capture probes in an experiment was

varied by varying the number of microparticles, while

keeping the surface density of probes constant at saturation.

To facilitate the calculation of efficiencies and Kd of the

hybridization reactions, the concentrations were always

expressed in M, as opposed to surface densities, absolute

number of probes or average probes per particle.

2.6 Target capture efficiency of the functionalized

microparticles

First, the microparticles with immobilized probes were

diluted to 0.5, 0.1 or 0.02 mg/mL and magnetically sep-

arated from the Tris–HCl buffer solution in about 30 s.

Next, the particles were washed three times in the 109

SSC hybridization buffer to remove any trace of the

Fig. 2 Schematic overview of the microfluidic design. 1 Sample

solutions and particle suspensions are jointly injected into the oil flow,

forming droplets. 2 At the T-junction, the channel is narrowed to

improve the split. 3 The loop and pillar system is used to equalize

pressure in both branches of the split, removing oscillating variability

during the split. 4 A second oil flow is used to control the droplet

splitting ratio. The magnet is placed on top of this channel, to attract

the magnetic microparticles into the lower branch of the split. This

results in the collection of the particles in the smaller daughter droplet

296 Microfluid Nanofluid (2015) 18:293–303

123

immobilization buffer. The target ssDNA was diluted in

the hybridization buffer and heated to 94 �C for 2 min.

Next, the target ssDNA was added to the particles and

temperature was reduced to 53�. Keeping the temperature

constant, the suspended particles were incubated for

1 min, allowing hybridization. Subsequently, the super-

natant was removed and the particles were washed three

times with the SSC buffer. All fractions and washing

volumes were collected for analysis.

The reference method, off-chip, used a volume of

100 lL in LoBind Eppendorfs, to minimize DNA sticking.

After adding the target ssDNA to the microparticles, the

mixture was stirred with a vortex for 5 s and placed in a

heating block at 53 �C. For the on-chip extraction exper-

iments, the microparticle suspension and target DNA

solution were pumped into the dual sample inlet and

injected in the oil flow together, forming a droplet. On

average, 150, 30 or 6 microparticles were encapsulated

per droplet, using the 0.5, 0.1 or 0.02 mg/mL dilutions,

respectively. Inside the droplets, the particles and target

strands were mixed rapidly. Incubation happened during

the 1-min transport to the splitting zone. After the split,

droplets were collected at both outlets for 3 min, corre-

sponding to about 180 droplets. The droplets were col-

lected in 100 lL water and shaken to break the droplets.

The water and perfluoroil were separated by gravity within

1 min, and the magnetic particles were magnetically

separated. Both the hybridized targets on the microparti-

cles and the free target in the aqueous fraction were

analyzed with qPCR and this for both outlets.

2.7 Microparticle separation efficiency

of the microfluidic system

The efficiency of the magnetic separation of particles

during the droplet splitting was determined with com-

pletely saturated and washed particles. First, 0.1 mg/mL

magnetic particles—corresponding to 30 particles per

droplet and 1.6 9 10-8 M immobilized capture probes—

were incubated with 1.6 9 10-7 M target probes, in

100 lL 109 SSC buffer, completely saturating the capture

probes. Next, the particles were washed three times in 109

SSC buffer to remove all unbound target strands. This

particle suspension was then used in the microfluidic

magnetic separation system and separated at various

splitting regimes. The particles were collected at both

outlets for 3 min and analyzed as described above. The

ratio of captured target concentrations in each outlet was

used to calculate the microparticle separation efficiency of

the splitting regime. Denaturation of the hybridized target

during transport in the microfluidic system was not an issue

as the free target concentrations in the droplets remained

below the detection limit of the qPCR.

2.8 Quantification of DNA

As the capture probes immobilized on the surface of the

microparticles cannot be directly quantified using qPCR,

fluorescent capture probes (Table 1) were used for a satu-

ration experiment. Every probe concentration was analyzed

three times with a SpectraMax spectrophotometer (molec-

ular Devices, USA) and this for both the immobilized and

the unbound capture probes.

Target concentrations were analyzed using qPCR on a

Rotorgene Q HRM (Qiagen, Belgium) using the protocol

described by Janssen et al. (2012). Two microliter of

sample was mixed with 15 lL of PerfeCTa SYBR green

fast mix (Quanta, USA), 9 lL of water and 2 lL of each

primer (5 lM) to a total of 30 lL. Following manufac-

turer’s recommendations, the polymerase was activated at

95 �C for 2 min. Subsequently, the thermal cycling started

with annealing and extension at 60 �C for 30 s and dena-

turing at 95 �C for 5 s. This cycle was repeated 50 times.

To quantify captured targets, hybridized to the capture

probes, the microparticles were resuspended in 100 lL

deionized water and heated to 95 �C to cause dehybridization,

releasing the target DNA strand. The experiments were

repeated three times to cover variability. All samples and

standards solutions were analyzed twice and averaged. Blank

samples were used as a no template control (NTC) to deter-

mine the cycle number where false positive results occur, as

eventually the primers will create product on themselves.

2.9 Kd of the hybridization reaction

The Kd of the hybridization reaction of two complementary

DNA strands in free solution can be estimated using the

nearest neighbor method (SantaLucia 1998). In short, the

order of nucleotides, the number of matches and the total

length of the overlap between the strands will determine

the overall binding strength of the double strand. For the

sequences used in this work, the estimated Kd in function of

the temperature is presented in Fig. 3. The theoretical

melting temperature in free solution, where half the strands

are hybridized, is at 69 �C.

This theoretical estimation assumes free diffusion of

both strands in a standard buffer solution. The actual Kd

can be several orders of magnitude higher when immo-

bilized strands are used, highly depending on the packing

density of the immobilized ssDNA (Erickson et al.

2003). However, the temperature dependency is expected

to be similar for experimentally determined Kd values. In

this work, the term of apparent Kd is used and the Kd

determination was not performed in ideal conditions. The

experimental apparent Kd was fitted using MATLAB

(Mathworks, USA) surface fitting tool at standard

settings.

Microfluid Nanofluid (2015) 18:293–303 297

123

3 Results and discussion

3.1 Immobilization of the capture probes

According to the manufacturer’s specifications, 1 mg of

streptavidin-coated microparticles can bind up to 200 pmol

of biotin-coupled short oligonucleotides. This value is seen

as an upper boundary, and actual values vary between

batches and depend on the nucleotide sequence and buffer

conditions. However, knowing the exact number of the

immobilized capture probes is necessary to interpret the

results of hybridization experiments. A saturation experi-

ment was used to determine the binding capacity of the

particles and the concentration of capture probes needed to

achieve maximum immobilization. Figure 4 shows the

results of the saturation experiment. The binding was linear

up to 1.2 9 10-7 M and needed an initial capture probe

concentration of at least 5 9 10-7 M to reach saturation at

1.6 9 10-7 M immobilized probes.

To avoid variation on the number of immobilized

probes, an excess of 10-6 M is used to saturate the mi-

croparticles completely. Also, multiple batches of the mi-

croparticles with immobilized capture probes were mixed

and all experiments were done with the same stock solu-

tion. Storage was not a problem, as the streptavidin–biotin

bond is known to be very stable (DeChancie and Houk

2007) and no dissociation was observed over time.

3.2 qPCR standard curve

To quantify the target concentration in the various fractions

of the extraction experiments, a logarithmic calibration

curve was built for every experiment, using 5 9 10-8 M,

5 9 10-10 M, 5 9 10-12 M, 5 9 10-14 M and

5 9 10-16 M (Fig. 5). A fluorescent threshold value to

determine the threshold cycle numbers (CT) was automat-

ically selected by the software for an optimal R2 of the

calibration curve, which was always above 0.997 in this

work. The slope (M) of -3.333 in the calibration curve

(Fig. 5) corresponds to a multiplication factor of 1.995 per

round or an efficiency of 99.5 %. The efficiency was

always between 97 and 101 %, with 100 % being the

theoretical ideal system with a DNA multiplication factor

of 2 per round.

The earliest NTC crosses the threshold value at 36

cycles or later, corresponding to about 2 9 10-17 M and

thus concentrations around this value cannot be quantified.

Therefore, all samples with a concentration below

5 9 10-16 M (the fifth point of the standard curve) were

considered blank and were not used in any conclusion or

result. Concentrations above the upper limit of linear range

(5 9 10-8 M) were diluted and analyzed again.

3.3 Temperature and hybridization rate

The high salt concentration of the 109 SSC hybridization

buffer ensures good hybridization conditions. To avoid

changing the surface tension and other fluid properties of

Fig. 3 Calculated theoretical Kd for free hybridization of the used

sequences as a function of the temperature. The order of magnitude of

this value is marked in red for 25, 37, 53, 63 and 95 �C, temperatures

used in the experiments

Fig. 4 Immobilized probes on 1 mg/mL particles, in function of the

initial probe concentration. The curve depicts the fitted binding model

and puts the saturation at 1.6 9 10-7 M (red dotted line). Each point

was measured three times, with error bars representing one standard

deviation

Fig. 5 Left Typical standard curves for qPCR analyses plotting

normalized fluorescence intensity versus the thermal cycle number:

a = 5 9 10-8 M, b = 5 9 10-10 M, c = 5 9 10-12 M,

d = 5 9 10-14 M, e = 5 9 10-16 M, f = 0 M (NTC). Right The

calibration curve plotting the cycle number at threshold value (CT)

versus the log DNA concentration. The dotted part of the line

indicates the NTC value and was not used for quantification

298 Microfluid Nanofluid (2015) 18:293–303

123

the microfluidic system, no additional surfactants or addi-

tives, such as Tween or BSA, were added to the hybrid-

ization buffer. Settling or sticking of the microparticles was

not observed inside the droplets.

As the typical residence time in the microfluidic system

ranges from several seconds up to 1 or 2 min, hybridization

should reach equilibrium within this short time. The effect

of temperature on the hybridization speed and capture

efficiency was examined in an off-chip setup, at four

temperatures, corresponding to room temperature (25 �C),

physiological temperature (37 �C), the optimal PCR tem-

perature (53 �C) and a higher temperature (63 �C). Fig-

ure 6 shows the target capture efficiency of the magnetic

microparticles at the different temperatures after 1, 2 and

3 min, as longer reaction times proved unnecessary.

Attempts to analyze reaction times below 1 min proved

very unreliable, and they were therefore not used. The off-

chip separation of microparticles from the matrix solution

takes up to 30 s and the hybridization reaction obviously

continues during this time, probably causing the variability

of short reaction times.

1.6 9 10-8 M of both immobilized capture probes and

free target were used in 100 lL hybridization buffer. At 25

and 37 �C, hybridization reached equilibrium within

3 min, while at higher temperatures, it was already reached

within 1 min. Only around 40 % of the DNA strands are in

the hybridized state at 63 �C, and thus, this is close to

melting temperature of these DNA strands. This data cor-

responds well with literature and the solid-phase hybrid-

ization model of Erickson et al. (2003).

The effect of temperature on hybridization speed and

efficiency was clearly a trade-off between the reaction

speed and the capture efficiency. At 53 �C, equilibrium

was reached within 1 min and the capture efficiency was

still above 94 %, meaning 94 % of the target ssDNA was

captured within a minute with an equal target and probe

concentration of 1.6 9 10-8 M. This temperature was used

for all following solid-state hybridization experiments.

3.4 On-chip hybridization

The first parameter studied to compare off-chip and on-

chip extraction methods was the apparent Kd of the

hybridization reaction. The on-chip experiments were

performed both in a 60/40 and in a 90/10 splitting regime.

Three concentrations of targets were incubated with three

concentrations of capture probes to obtain nine different

measuring points (Table 2). Each individual experiment

was repeated three times to reveal variation in the capture

efficiency. Next, the particles with the captured target were

extracted and both captured and unbound targets were

separately quantified with qPCR. All data points combined

allowed the reliable fitting of the hybridization Kd, using

the least squares method. Figure 7 represents the capture

efficiency for the different combinations of capture probe

and target concentrations and the fitted Kd for each method.

Some of the initial target ssDNA was not accounted for

after all steps (10 ± 4 %), assumed lost due to sticking to

tubes and pipets. This number was identical in both off-

chip and on-chip experiments. As these strands did not

participate in the equilibrium, experimental results were

adjusted for this loss.

The overall fitted apparent Kd of the hybridization

reaction was about 3 9 10-10 M in the off-chip experi-

ments and 8 9 10-10 and 6 9 10-10 M in the 60/40 and

90/10 on-chip splitting regimes, respectively. As the dif-

ference was very small and no statistically significant dis-

tinction could be made, the switch toward the microfluidic

environment was considered successful. Potential inhibi-

tors such as the perfluor surfactants or the oil–water

interface appeared to have no measurable effect on the

hybridization reaction.

The apparent Kd of both off-chip and on-chip experi-

ment was two orders of magnitude higher than the theo-

retically calculated value for free hybridization at 53 �C

(10-12 M). This difference was expected as the conditions

for the experimental and theoretical Kd were different: the

diffusion speed of immobilized capture probes is lower

than that of free capture probes. The hybridization also

depends on the packing density of the probes (Erickson

Fig. 6 Solid-phase hybridization at 25, 37, 53 and 63 �C. Both the

initial capture probe and the target ssDNA concentration were

1.6 9 10-8 M. At 53 �C (red) and 63 �C, equilibrium is reached

within 1 min, the lower temperatures equilibrate between 2 and

3 min. Error bars show one standard deviation of three repetitions

Table 2 Ratio of capture probes over targets

Target concentration (M) Capture probe concentration (M)

8.0 9 10-8 1.6 9 10-8 3.2 9 10-9

1.6 9 10-8 5 1 0.2

3.2 9 10-9 25 5 1

6.4 9 10-10 125 25 5

Microfluid Nanofluid (2015) 18:293–303 299

123

et al. 2003), as the alignment between target and probe can

be spatially hindered.

3.5 Capture efficiency and saturation

The Kd is the best constant to compare the intrinsic reaction

properties of the hybridization reaction in off-chip and on-

chip conditions. However, in order to capture a maximum

of target strands, a low Kd is necessary, but not sufficient.

The capture efficiency also depends on the concentration of

target molecules and capture probes. The capture efficiency

and the saturation of the probes are shown in Fig. 8.

First and most importantly, the difference between off-

chip and on-chip methods for any of the used combinations

is smaller than the variation between repetitions and is thus

insignificant. The capture efficiency is thus independent of

the used separation system and even independent of the

splitting regime. While this is not unexpected, it is

important for all future applications of DNA extraction in

this segmented flow system. Secondly, Fig. 8 also illus-

trates that the capture efficiency is obviously dependents on

the concentration of capture probes and target DNA. It is

clear that for good capture efficiencies, the saturation of the

capture probes has to remain low (Fig. 9). A fivefold

excess of capture probes appears sufficient to bind nearly

all targets, but even equal concentrations of probe ssDNA

and target ssDNA lead to about 80 % hybridization. A

moderate excess thus appears sufficient when the target

extraction is used to purify a concentrated sample. How-

ever, to quantify an unknown target concentration, satura-

tion might be harder to avoid. This can be avoided in a

segmented flow framework, as the ratio of sample and

particle suspensions can be gradually changed and a whole

range of target and capture probe concentrations can be

combined in one run.

3.6 Microparticle separation and total DNA extraction

efficiency

The separation efficiency of the off-chip method approa-

ched 100 %, as practically all particles could be retained.

In the on-chip methods, however, part of the particles was

not separated to the correct daughter droplet during the

split. For all three particle concentrations, working at

splitting regimes between 50/50 and 90/10, the separation

efficiency was very good, respectively, 98 and 96 %.

Increasing the split ratio to 95/5 resulted in a separation

efficiency of 83 %. As the extraction efficiency of target

DNA from the sample is determined by the target capture

efficiency and the microparticle separation efficiency, the

total DNA extraction efficiency of the 95/5 splitting regime

was thus lower as well. Figure 10 illustrates this for

1.6 9 10-8 M capture probes and 3.2 9 10-9 M target, a

condition with a capture efficiency of 97 %. Increasing the

Fig. 7 Hybridization results for

the off-chip method and the on-

chip method at two splitting

regimes: 60/40 and 90/10.

Hybridized targets are plotted

over the total quantified targets

for three different probe

concentrations. The markers

express the adjusted

experimental values, while the

dotted lines show the values

calculated with the overall fitted

apparent Kd

300 Microfluid Nanofluid (2015) 18:293–303

123

Fig. 8 Capture efficiency for

the off-chip method and the on-

chip method at two splitting

regimes: 60/40 and 90/10. Each

of the nine combinations was

repeated three times, and the

error bars show one standard

deviation

Fig. 9 Saturation of the probes

for the off-chip method and the

on-chip method at two splitting

regimes: 60/40 and 90/10. Each

of the nine combinations was

repeated three times, and the

error bars show one standard

deviation

Microfluid Nanofluid (2015) 18:293–303 301

123

splitting ratio further was not possible in this system, as

some droplets ceased to split (Verbruggen et al. 2013).

In absolute numbers, the 60/40 and 90/10 regimes

extracted equal numbers of targets. Yet, the purpose of the

increasingly asymmetric splitting during the particles sep-

aration was obviously the removal of more of the original

sample matrix. Using the 60/40 splitting regime, the target

was concentrated 245 % (98 % of targets in 40 % of the

volume) and the 90/10 regime concentrated 950 %. Even

with a significantly lower extraction efficiency, the 95/5

splitting regime concentrated most at 1,577 %.

However, for some future applications, this might not be

sufficient as high purification of the extracted target is needed.

Coupling multiple splitting systems sequentially to wash the

particles in order to improve the purification has already been

reported for a fixed splitting regime of about 60/40 (Pan et al.

2011) and could be applied for this separation system as well.

Actually, this is similar to off-chip methods, consisting of one

extraction step followed by several washing steps. Each

additional splitter requires one additional water inlet to wash

the particles, one additional oil flow to control the splitting

regime and one additional outlet to remove the waste. This

could rapidly become unstable in practice.

If, for example, 99 % of the original matrix needs to be

removed, the 60/40 splitting regime would need to be

repeated five times, while the 90/10 regime can reach this

in two repetitions. The 95/5 splitting regime would do even

better, but as the particle separation efficiency is low, this

might not add value compared to the 90/10 regime. The

cumulative extraction efficiency, the fraction of extracted

DNA after repeated separation, decreases considerably

(Fig. 11). Coupling three 95/5 splits would remove

99.99 % of the matrix, but only extract about half of the

target DNA. Reducing the splitting ratio to 90/10 would

still remove 99.9 % of the matrix solution while extracting

86 % of the target.

4 Conclusions

In this paper, we investigated the transfer of a solid-state

DNA hybridization assay on microparticles from a typical

laboratory-scale volume to a segmented flow microfluidic

system. A temperature of 53 �C was chosen to achieve

hybridization equilibrium within 1 min, an acceptable

residence time inside the microfluidic system. Nine com-

binations of capture probe and target concentrations were

mixed and incubated using both the off-chip and on-chip

method. The capture efficiencies and the apparent Kd very

closely matched, and there was no significant difference

between off-chip and on-chip strategies. Using the

hybridization assay in the segmented flow setup resulted in

very similar loss of target strands (10 ± 4 %) compared to

the reference method, confirming the good selection of oil,

surfactants and surface coating.

The capture efficiency of the magnetic particles was equal

at different splitting regimes, but the separation of the par-

ticles did change. Splitting the droplets at ratios between

60/40 and 90/10 resulted in high particle separation effi-

ciencies of 97 %. Increasing the ratio to 95/5 resulted in a

higher particle loss and a separation efficiency of 83 %. The

best method obviously depends on the application, as a trade-

off exists between maximal extraction and maximal matrix

Fig. 10 Capture, separation and extraction efficiency at three differ-

ent splitting regimes, using 0.1 mg/mL microparticles. The capture

probe and target concentration are 1.6 9 10-8 and 3.2 9 10-9 M,

respectively. Error bars show the standard deviation of three

repetitions. The red line illustrates the splitting ratio, marking the

volume percentage of the small daughter droplet that contains the

separated microparticles

Fig. 11 Sequential splitting

with 60/40, 90/10 and 95/5

splitting regimes. Left the

remaining percentage of the

original sample matrix. Right

the cumulative extraction

efficiency. The extraction

efficiency of the 95/5 splitting

regime is practically too low to

couple sequentially

302 Microfluid Nanofluid (2015) 18:293–303

123

removal. This effect becomes more pronounced when

sequentially coupled separation systems are considered.

Using a low splitting ratio to wash the particles is impractical

as the number of separations and thus additional inlets and

outlet is too high. Higher ratios rapidly remove the original

matrix, but at 95/5, the separation efficiency is probably too

low for many applications.

The novel approach to separate the magnetic particle into

a smaller droplet, thus improving the washing capacities of

microparticles in segmented flow, will facilitate the devel-

opment of true digital laboratory-on-a-chips. In particular,

the combination with digital qPCR is very promising.

Acknowledgments The research leading to the reported results has

received funding from the European Commission’s Seventh Frame-

work Programme (FP7/2007-2013) under the grant agreement BIO-

MAX (Project No. 264737) (TT and MC), the Institute for the

Promotion of Innovation through Science and Technology in Flanders

(IWT-SB 83166) and the Fund for Scientific Research Flanders

(Project No. G.0997.11).

References

Anna SL, Bontoux N, Stone HA (2003) Formation of dispersions

using ‘‘flow focusing’’ in microchannels. Appl Phys Lett 82:364.

doi:10.1063/1.1537519

Baroud CN, Delville J-P, Gallaire F, Wunenburger R (2006)

Thermocapillary valve for droplet production and sorting. Phys

Rev E Stat Nonlinear Soft Matter Phys 75:046302. doi:10.1103/

PhysRevE.75.046302

Beer NR, Hindson BJ, Wheeler EK et al (2007) On-chip, real-time,

single-copy polymerase chain reaction in picoliter droplets. Anal

Chem 79:8471–8475. doi:10.1021/ac701809w

Berensmeier S (2006) Magnetic particles for the separation and

purification of nucleic acids. Appl Microbiol Biotechnol

73:495–504. doi:10.1007/s00253-006-0675-0

Christopher GF, Bergstein J, End NB et al (2009) Coalescence and

splitting of confined droplets at microfluidic junctions. Lab Chip

9:1102–1109. doi:10.1039/b813062k

DeChancie J, Houk KN (2007) The origins of femtomolar protein-

ligand binding: hydrogen-bond cooperativity and desolvation

energetics in the biotin-(strept)avidin binding site. J Am Chem

Soc 129:5419–5429. doi:10.1021/ja066950n

Duffy DC, McDonald JC, Schueller OJ, Whitesides GMG (1998)

Rapid prototyping of microfluidic systems in poly(dimethylsi-

loxane). Anal Chem 70:4974–4984. doi:10.1021/ac980656z

Erickson D, Li D, Krull UJ (2003) Modeling of DNA hybridization

kinetics for spatially resolved biochips. Anal Biochem

317:186–200. doi:10.1016/S0003-2697(03)00090-3

Fan ZH, Mangru S, Granzow R et al (1999) Dynamic DNA

hybridization on a chip using paramagnetic beads. Anal Chem

71:4851–4859. doi:10.1021/ac9902190

Gijs MAM (2004) Magnetic bead handling on-chip: new opportuni-

ties for analytical applications. Microfluid Nanofluidics 1:22–40.

doi:10.1007/s10404-004-0010-y

Gijs MAM, Lacharme F, Lehmann U (2010) Microfluidic applica-

tions of magnetic particles for biological analysis and catalysis.

Chem Rev 110:1518–1563. doi:10.1021/cr9001929

Holtze C, Rowat AC, Agresti JJ et al (2008) Biocompatible

surfactants for water-in-fluorocarbon emulsions. Lab Chip

8:1632–1639. doi:10.1039/b806706f

Huebner A, Sharma S, Srisa-Art M et al (2008) Microdroplets: a sea

of applications? Lab Chip 8:1244–1254. doi:10.1039/b806405a

Huebner A, Bratton D, Whyte G et al (2009) Static microdroplet

arrays: a microfluidic device for droplet trapping, incubation and

release for enzymatic and cell-based assays. Lab Chip

9:692–698. doi:10.1039/b813709a

Janssen KPF, Knez K, Spasic D et al (2012) Multiplexed protein

detection using an affinity aptamer amplification assay. Anal

Bioanal Chem 404:2073–2081. doi:10.1007/s00216-012-6252-8

Lacharme F, Vandevyver C, Gijs MAM (2009) Magnetic beads

retention device for sandwich immunoassay: comparison of off-

chip and on-chip antibody incubation. Microfluid Nanofluidics

7:479–487. doi:10.1007/s10404-009-0424-7

Lee H, Xu L, Ahn B et al (2012) Continuous-flow in-droplet magnetic

particle separation in a droplet-based microfluidic platform. Micro-

fluid Nanofluidics 13:613–623. doi:10.1007/s10404-012-0978-7

Link DR, Anna SL, Weitz DA, Stone HA (2004) Geometrically

mediated breakup of drops in microfluidic devices. Phys Rev

Lett 92:054503. doi:10.1103/PhysRevLett.92.054503

Lombardi D, Dittrich PS (2011) Droplet microfluidics with magnetic

beads: a new tool to investigate drug-protein interactions. Anal

Bioanal Chem 399:347–352. doi:10.1007/s00216-010-4302-7

Niu X, Gulati S, Edel JB, DeMello AJ (2008) Pillar-induced droplet

merging in microfluidic circuits. Lab Chip 8:1837–1841. doi:10.

1039/b813325e

Pamme N (2006) Magnetism and microfluidics. Lab Chip 6:24–38.

doi:10.1039/b513005k

Pamme N (2012) On-chip bioanalysis with magnetic particles. Curr

Opin Chem Biol 16:436–443. doi:10.1016/j.cbpa.2012.05.181

Pan X, Zeng S, Zhang Q et al (2011) Sequential microfluidic droplet

processing for rapid DNA extraction. Electrophoresis 32:1–7.

doi:10.1002/elps.201100078

SantaLucia J (1998) A unified view of polymer, dumbbell, and

oligonucleotide DNA nearest-neighbor thermodynamics. Proc

Natl Acad Sci USA 95:1460–1465

Sista RS, Eckhardt AE, Srinivasan V et al (2008) Heterogeneous

immunoassays using magnetic beads on a digital microfluidic

platform. Lab Chip 8:2188–2196. doi:10.1039/b807855f

Song H, Ismagilov RF (2003) Millisecond kinetics on a microfluidic

chip using nanoliters of reagents. J Am Chem Soc

125:14613–14619. doi:10.1021/ja0354566

Song H, Tice JD, Ismagilov RF (2003) A microfluidic system for

controlling reaction networks in time. Angew Chemie

115:792–796. doi:10.1002/ange.200390172

Tang SKY, Li Z, Abate A et al (2009) A multi-color fast-switching

microfluidic droplet dye laser. Lab Chip 9:2767–2771. doi:10.

1039/b914066b

Thorsen T, Roberts RW, Arnold FH, Quake SR (2001) Dynamic

pattern formation in a vesicle-generating microfluidic device.Phys Rev Lett 86:4163–4166. doi:10.1103/PhysRevLett.86.4163

Verbruggen B, Toth T, Atalay YT et al (2013) Design of a flow-

controlled asymmetric droplet splitter using computational fluid

dynamics. Microfluid Nanofluidics 15:243–252. doi:10.1007/

s10404-013-1139-3

Verbruggen B, Toth T, Cornaglia M, Puers R, Gijs MAM, Lammer-

tyn J (2014) Separation of magnetic microparticles in segmented

flow using asymmetric splitting regimes. Microfluid Nanofluid.

doi:10.1007/s10404-014-1409-8

Verpoorte E (2003) Beads and chips: new recipes for analysis. Lab

Chip 3:60N–68N. doi:10.1039/b313217j

Whitesides GMG (2006) The origins and the future of microfluidics.

Nature 442:368–373. doi:10.1038/nature05058

Whitesides GMG (2011) What comes next? Lab Chip 11:191–193.

doi:10.1039/c0lc90101f

Microfluid Nanofluid (2015) 18:293–303 303

123