septins stabilize mitochondria in tetrahymena thermophila · proteins (51). septins were discovered...

EUKARYOTIC CELL, Aug. 2008, p. 1373–1386 Vol. 7, No. 81535-9778/08/$08.00�0 doi:10.1128/EC.00085-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Septins Stabilize Mitochondria in Tetrahymena thermophila�†D. Włoga,1 I. Strzyzewska-Jowko,2 J. Gaertig,1* and M. Jerka-Dziadosz2*

Department of Cellular Biology, University of Georgia, Athens, Georgia 30602-2607,1 and Polish Academy of Sciences,M. Nencki Institute of Experimental Biology, Department of Cell Biology, 3 Pasteur Street, 02-093 Warsaw, Poland2

Received 8 March 2008/Accepted 18 June 2008

We describe phylogenetic and functional studies of three septins in the free-living ciliate Tetrahymenathermophila. Both deletion and overproduction of septins led to vacuolization of mitochondria, destabilizationof the nuclear envelope, and increased autophagy. All three green fluorescent protein-tagged septins localizedto mitochondria. Specific septins localized to the outer mitochondrial membrane, to septa formed duringmitochondrial scission, or to the mitochondrion-associated endoplasmic reticulum. The only other septinsknown to localize to mitochondria are human ARTS and murine M-septin, both alternatively spliced forms ofSep4 (S. Larisch, Cell Cycle 3:1021–1023, 2004; S. Takahashi, R. Inatome, H. Yamamura, and S. Yanagi, GenesCells 8:81–93, 2003). It therefore appears that septins have been recruited to mitochondrial functions inde-pendently in at least two eukaryotic lineages and in both cases are involved in apoptotic events.

Septins are conserved GTP-binding and filament-formingproteins (51). Septins were discovered in Saccharomyces cer-evisiae and later found to be ubiquitous in metazoans (39, 53).The cellular functions of septins are diverse and include par-ticipation in cytokinesis (22, 40), establishment of diffusionbarriers for proteins and mRNAs during cell division (16, 75),vesicle trafficking, exocytosis (7, 28, 33, 37), and apoptosis (29,49). Accordingly, cellular localizations of septins are diverseand include the bud neck (14), division furrow (1), presynapticvesicles (86), dendritic spines (73, 85), and mitochondria (50,74). Septins interact with microtubules (45, 71) and microfila-ments (46, 56) as well as the endoplasmic reticulum (ER) andfilaments emanating from the Golgi network (54, 71). Re-cently, the diverse patterns of septins were classified into types:projections, partitions, and dispersal over whole cells (52). Themolecular functions of septins remain unclear (reviewed inreference 81). So far, septins have been studied only for fungiand metazoans. Since septins are known to be involved incytoskeletal organization and membrane remodeling events,we anticipated that Tetrahymena thermophila septins are in-volved in partitions of distinct domains in the structurally elab-orate cell cortex of ciliates, in particular during cytokinesis,when the cortex undergoes longitudinal segmentation. Surpris-ingly, we have found that septins of Tetrahymena thermophilalocalize to mitochondria and regulate mitochondrial dynamics.

MATERIALS AND METHODS

Bioinformatics. Protein sequences of the known septins were obtained fromthe following databases: Saccharomyces cerevisiae, Schizosaccharomyces pombe,Nannochloris bacillaris, Strongylocentrotus purpuratus, Danio rerio, and human

sequences from NCBI (National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/); Drosophila melanogaster sequences from FlyBase (http://flybase.bio.indiana.edu/); Caenorhabditis elegans sequences from the SangerInstitute (http://www.sanger.ac.uk/Projects/C_elegans/); and Chlamydomonas re-inhardtii sequences from JGI (http://genome.jgi-psf.org/Chlre3/Chlre3.home.html). To search for septin sequences in the genomes of protists, we used S.cerevisiae and human septin sequences to perform tblastn or blastp searches forGiardia lamblia (http://www.giardiadb.org/giardiadb/), Toxoplasma gondii (http://www.toxodb.org/toxo/home.jsp), Plasmodium falciparum (http://tigrblast.tigr.org/er-blast/index.cgi?project�pfa1), Trypanosoma brucei (http://www.sanger.ac.uk/cgi-bin/blast/submitblast/t_brucei/), Tetrahymena thermophila (http://seq.ciliate.org/cgi-bin/blast-tgd.pl), and Paramecium tetraurelia (http://paramecium.cgm.cnrs-gif.fr/tool/blast). The domain analysis of predicted septins was performedusing SMART (http://smart.embl-heidelberg.de/). Coiled-coil domains were pre-dicted using COILS (http://www.ch.embnet.org/software/COILS_form.html) andCoiled-Coil Prediction (http://www.russell.embl-heidelberg.de/cgi-bin/coils-svr.pl) (55). The transmembrane domains were predicted using THMMH (http://www.cbs.dtu.dk/services/TMHMM/) and DAS (http://www.sbc.su.se/�miklos/DAS/). The molecular weight was calculated at http://ca.expasy.org/tools/pi_tool.html. The mitochondrial targeting signals were detected using PREDOTAR(http://urgi.versailles.inra.fr/predotar.html) and MITOPROT (http://ihg2.helmholtz-muenchen.de/ihg/mitoprot.html). For phylogenetic analyses, septinsequences were aligned using ClustalX 1.82 and manually corrected using theSeaView program (26). The alignment of the central core of the septin proteinswas used to calculate a neighbor-joining phylogenetic tree with the PHYLIPpackage (23), as described before (83).

Cell culture. Cells were grown axenically as described previously (15). Strainswere maintained in 7-ml aliquots of 1% proteose-peptone, 0.1% yeast extract.For most experiments, cells were grown in PPYGFe medium (2% proteose-peptone, 0.2% yeast extract, 0.5% glucose, 9 � 10�5 M iron chelate) (61) in50-ml volumes in 250-ml Erlenmeyer flasks at 29°C with reciprocal shaking.Growth curves were calculated as described previously (84).

Studies of expression of septin genes. Total RNA and cDNA were preparedfrom growing, conjugating, and cilium-regenerating cells as described previously(35). The following primers were used for reverse transcription PCR: forwardprimers Sep1-F (GAGAAAAAGGCAGTGAGAAAAGAAAATGGAATAACTTTG), Sep2-F (GTAACTGGCATTCGTACTGA), and Sep3-F (GATTGACACTCTTGGTTATGG) and reverse primers Sep1-R (TTGGTAAACATCAGCCAATTTAATGAGTTTTGTGCT), Sep2-R (GTTAGTTTCTTAAGATCAGCG), and Sep3-R (CTTCAACAGATTTATACAAAT).

Knockouts of septin genes. To prepare targeting plasmids, with the neo3cassette under the control of the 0.9-kb MTT1 promoter, we amplified septincoding regions with 5� and 3� untranslated regions (UTR) from the genomicDNA. A 6.5-kb fragment of SEP1 was amplified with primers 5�-GGCAGTCTTTAGATAACTTTGCAT-3� and 5�-CTTGAAATGAGTGGATAACACAAC-3�. A 5.8-kb fragment of SEP2 was amplified with primers 5�-ACAATCAAAGAGTTCCATTTCC-3� and 5�-AGAACGACTATAACTTAGCTTCAG-3�. A4.9-kb fragment of SEP3 was amplified with primers 5�-GATTAAATGATACT

* Corresponding author. Mailing address for J. Gaertig: Depart-ment of Cellular Biology, University of Georgia, Athens, GA 30602-2607. Phone: (706) 542-3409. Fax: 48 22 822 53 42. E-mail: [email protected]. Mailing address for M. Jerka-Dziadosz: Polish Academyof Sciences, M. Nencki Institute of Experimental Biology, Departmentof Cell Biology, 3 Pasteur Street, 02-093 Warsaw, Poland. Phone: 48 225892 233. Fax: (706) 542-4271. E-mail: [email protected].

† Supplemental material for this article may be found at http://ec.asm.org/.

� Published ahead of print on 27 June 2008.

1373

on January 24, 2021 by guesthttp://ec.asm

.org/D

ownloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/EC.00085-08&domain=pdf&date_stamp=2008-08-01

http://ec.asm.org/

ATCAAGA-3� and 5�-TCAGTTGAATCGTCTAGGTCA-3�. The fragmentswere ligated into pGEM-T Easy (Promega). The SEP1-T Easy plasmid wasdigested with SalI, and blunt ends were made with Klenow DNA polymerase andself-ligated to remove a HincII site of T Easy. The neo3 cassette was inserted ina reverse orientation between the HincII and NsiI sites. The SEP2-T Easyplasmid was digested with EcoRV and SnaBI, dephosphorylated, and ligated toa blunt-ended neo3 cassette inserted in a reverse transcriptional orientation. TheSEP3-T Easy plasmid was digested with BglII, and blunt ends were made withKlenow DNA polymerase, digested with SpeI, and ligated with the neo3 cassette(digested with ClaI, polished with Klenow DNA polymerase, and digested withXbaI). The neo3 cassette was inserted in the reverse orientation. Before biolistictransformation, the targeting plasmids were digested with the following enzymesto separate the targeting fragment from the rest of the plasmid: SEP1-neo3 andSEP2-neo3 with EcoRI and SEP3-neo3 with ApaI and SalI. Conjugating CU428and B2086 cells were transformed biolistically, as described previously (12), andtransformants were selected with 100 �g/ml paromomycin and 2.0 �g/ml cad-mium chloride. Strains lacking all three SEP genes were constructed by standardcrosses and PCR-based typing of progeny, as described previously (69).

GFP tagging. We used a total-cDNA (35) and a walking-primer PCR approachto verify the TIGR software-based prediction (Tetrahymena Genome Database,http://www.ciliate.org/) of 5� and 3� ends of the septin gene transcribed regions.We determined that the likely coding region for Sep3p is shorter than theprediction (TTHERM_00989350). To overexpress septins with an N-terminalgreen fluorescent protein (GFP) tag, we amplified the likely coding region withor without a fragment of the 3� UTR from the genomic DNA, with the addition

of restriction sites, by using the following primers. The SEP1 coding region wasamplified, with the addition of MluI and XhoI restriction sites (underlined), withprimers 5�-ATAAACGCGTCGAGAACAATAGATGTGAT-3� and 5�-TTTATCTCGAGTTAGTTTTTTAGAATTTTGTATA-3�. The SEP2 coding regionfollowed by 0.34 kb of the 3� UTR was amplified, with the addition of MluI andXhoI restriction sites (underlined), with primers 5�-AATTACGCGTCATGGACAATCAAAGAGTTC-3� and 5�-TATTACTCGAGATTCATTTCCTTCAATAAGTTG-3�. The SEP3 coding region followed by 0.6 kb of the 3� UTR wasamplified, with the addition of MluI and BamHI sites (underlined), with primers5�-AATAAACGCGTCATGGACAGCTTTTATACTACT-3� and 5�-AATAATGGATCCTCATGAATGCTACTGCTAACA-3�. The SEP3 PCR fragment wasdigested with MluI and BamHI endonuclease restriction enzymes and ligatedinto pMTT1-GFP plasmid digested with the same enzymes. To clone SEP1 andSEP2 PCR fragments, we modified pMTT1-GFP by introducing a SalI sitebetween the MluI and BamHI restriction sites. The SEP1 and SEP2 PCR frag-ments were digested with MluI and XhoI and ligated into the modified pMTT1-GFP digested with MluI and SalI. The resulting pMTT1-GFP-Sep1, pMTT1-GFP-Sep2, and pMTT1-GFP-Sep3 plasmids were digested with SacII and ApaIand used to transform CU522 cells (from Donna Cassidy-Hanley, Cornell Uni-versity) as described previously (35). Transformed cells were selected with 20 �Mpaclitaxel. To induce overexpression of GFP-tagged septins, transformants weregrown overnight in PPYGFe medium without paclitaxel to the mid-log phase(about 2 � 105 cells/ml) and induced with cadmium chloride (2.5 �g/ml).

To express Sep1p as a C-terminal GFP fusion under the native promoter, theentire SEP1 coding region was amplified from the genomic DNA with the

FIG. 1. (A) Neighbor-joining phylogenetic tree based on conserved central domains of septins. Septins indicated in red are known to be associatedwith mitochondria. The following sequences were used: Tetrahymena thermophila (Tt) Sep1p TTHERM_00994080, Sep2p TTHERM_00316560, andSep3p TTHERM_00989350; Paramecium tetraurelia (Pt) Sep1 GSPATP00027315001, Sep2 GSPATP00020551001, Sep3 GSPATP00037648001, andSep4 GSPATP00017403001; Chlamydomonas reinhardtii (Cr) 148151; Nannochloris bacillaris (Nb) BAD42341.1; Saccharomyces cerevisiae (Sc)Cdc3 NP_013418.1, Cdc12 NP_011975.1, Cdc10 NP_009928.1, Cdc11 NP_012610.1, Spr28 NP_010504.1, Shs1 NP_010056.1, and Spr3NP_011573.1; Schizosaccharomyces pombe (Sp) Spn1 NP_594754.1, Spn2 NP_593159.1, Spn3 P48008, Spn4 NP_593566.1, Spn5 NP_594040.1, Spn6NP_588214.1, and Spn7 O60165; Caenorhabditis elegans (Ce) Unc59 NP_493388.1 and Unc61 NP_872156.1; Drosophila melanogaster (Dm) PnutP40797, Sep1 NP_523430.1 (CG1403-PA), Sep2 NP_524417.1 (CG4173-PA), Sep4 NP_728003.1 (CG9699-PA), and Sep5 NP_651961.1 (CG2916-PB); Strongylocentrotus purpuratus (Sp) Sep2 XP_788114.2, Sep3 XP_795119.2, Sep4 XP_001180939.1, Sep6 XP_790953.2, and Sep7XP_001175696.1; Danio rerio (Dr) Sep2 AAH67625.1, Sep3 NP_001019589.1, Sep4a XP_001343014.1, Sep4b NP_001032456.1, Sep4cNP_001076284.1, Sep5 NP_956282.1, Sep6 NP_997791.1, Sep7 XP_001340758.1, Sep8 AAH55257.1, Sep9 NP_944593.1, Sep10 NP_001017557.1,and Sep12 XP_693022.2; and Homo sapiens (Hs) Sep1 NP_443070.1, Sep2 NP_004395.1, Sep3 NP_663786.1, Sep4 NP_004565.1, Sep5NP_002679.2, Sep6 NP_665798.1, Sep7 NP_001779.3, Sep8 XP_034872.5, Sep9 AAF23374.1, Sep10 AAH20502.1, Sep11 NP_060713.1, Sep12AAH35619.1, and Sep13 XP_001133108.1. The numbers at the branches represent bootstrap support values above 50%. (B) Domain analysis ofseptins. The following types of domains and motifs are marked: variable N-terminal domain (dark blue) followed by polybasic and hydrophobicresidues implicated in membrane interactions (red), GTPase domain (light blue) followed by septin unique sequence (marine blue), transmem-brane domain (green), coiled-coil domain (violet), and variable C-terminal domain (light green). aa, amino acids.

1374 WŁOGA ET AL. EUKARYOT. CELL


.org/D

ownloaded from

http://ec.asm.org/

addition of SacII and MluI sites at the 5� and 3� ends, respectively, and clonedinto pMTT1-Nrk2-GFP (83), digested with the same enzymes. The resultingpSEP1-GFP plasmid was digested with SacII and EcoRV, and the SEP1-GFPfragment followed by 0.6 kb of a 3� BTU1 fragment was cloned into the neo3plasmid with a 0.9-kb MTT1 promoter (pTvec-neo3) digested with SacII andSmaI to produce pSEP1-GFP-3� BTU1-neo3. Next, 2.15 kb of the SEP1 3� UTRwas amplified from the genomic DNA with addition of ClaI and SacI sites at the5� and 3� ends, respectively, and cloned into pSEP1-GFP-3� BTU1-neo3 plasmid.Twenty micrograms of the resulting pSEP1-GFP-3� BTU1-neo3-SEP1-3� UTRplasmid was digested with SacI and SacII and used to transform CU428 cells.Transformants were selected in PPYGFe medium with 80 �g/ml of paromomycinand 2 �g/ml of cadmium chloride.

Fluorescence microscopy. MitoTracker Red (Molecular Probes) and MitoRed (Fluka) were used at 20 to 200 nM. Cells were incubated for 30 min in thegrowth medium, washed with 10 mM Tris-HCl, pH 7.4, suspended in thickmethylcellulose (76), and observed under a fluorescence microscope in theTRITC (tetramethyl rhodamine isothiocyanate) (excitation, 540 nm; emission,590 nm) channel. Alternatively, the MitoTracker Red-labeled cells were fixed in2% paraformaldehyde; washed in phosphate-buffered saline (PBS), 2% bovineserum albumin (BSA), 0.1% Tween 20; and mounted in Citifluor (Citifluor Ltd.,London, United Kingdom).

Cells were analyzed with a Leitz Wetzlar epifluorescence microscope or aLeica confocal microscope equipped with LAS AS software. Optical sections of0.5 �m were recorded, and images were processed with Adobe Photoshop 7.0.For detection of Sep1p-GFP expressed under the native promoter in live cells,we used an epifluorescence microscope equipped with a narrow-band G-excita-tion filter (excitation, 530 to 550 nm, and emission, 590 nm; Olympus AmericaInc., Melville, NY).

Electron microscopy. Cells were washed with 10 mM Tris-HCl buffer, pH 7.4,and fixed for 1 h with a cold mixture of 2 parts of 0.05 M cacodylate buffer (pH7.4), 1 part of 4% osmic acid, and 1 part of 6% glutaraldehyde on ice. After beingwashed three times for 20 min with cold 0.05 M cacodylate buffer, pH 7.4, cellswere embedded in agar blocks, dehydrated in an ethanol series, and embeddedin Durcupan (Sigma), as described previously (36). Ultrathin sections werecontrasted with Reynolds lead citrate and uranyl acetate and observed under aJEOL 1200 EX electron microscope.

Postembedding immunogold labeling of cells with septins tagged with GFP.Cells expressing GFP-tagged septins were washed with 10 mM Tris-HCl buffer,pH 7.4, and fixed with a mixture of 4% paraformaldehyde (Sigma) and 0.025%glutaraldehyde in 0.05 M cacodylate buffer, pH 7.4, for 1.5 h on ice. After fourwashes in cold 0.05 M cacodylate buffer, pH 7.4, cells were dehydrated in a seriesof ethanol and embedded in LR White resin (London Resin Company). Afterpolymerization, embedded cells were cut into 80- to 100-nm sections and placedon nickel grids freshly covered with Formvar and coated with carbon. Sectionswere incubated in 3% BSA in PBS for 1.5 h and incubated with the anti-GFPantibodies (Santa Cruz) diluted 1:200 in 3% BSA in PBS for 1.5 h at roomtemperature. After two washes with 3% BSA in PBS and two washes with 1.5%BSA in PBS, grids were incubated overnight with anti-rabbit immunoglobulinG–10 nm gold-conjugated secondary antibodies (Sigma) at a 1:100 dilution in 3%BSA in PBS at 4°C. After several washes in PBS, grids were contrasted inaqueous saturated uranyl acetate mixed 1:1 with ethanol for 30 min. Sectionswere analyzed with a JEOL 1200 EX electron microscope.

Western blot analysis. The GFP-tagged cells were grown in flasks to a densityof 2 � 105 cells/ml. To extract total protein, 107 cells were collected by centrif-ugation, washed with 10 mM Tris-HCl, pH 7.5, and resuspended in cold 10 mMTris-HCl, pH 7.5, with protease inhibitors (1 �M leupeptin, 1 mM phenylmethyl-sulfonyl fluoride, 1 mM benzamidine, 1 mg/ml pepstatin A; Sigma Chemical Co.)to a 150-�l final volume. Next, the cell suspensions were boiled in 5� sodiumdodecyl sulfate sample buffer for 5 min. Proteins were separated on 8% sodiumdodecyl sulfate-polyacrylamide gels, transferred to a nitrocellulose membrane,blocked in 5% nonfat milk in TBST (150 mM NaCl, 20 mM Tris-HCl, pH 7.5,0.05% Tween 20) for 1 h, and incubated with polyclonal anti-GFP antibodies(Santa Cruz) diluted 1:3,000 in 1% nonfat milk in TBST overnight at 4°C. Aftera wash in 5% nonfat milk in TBST, the membrane was incubated for 1 h insecondary horseradish peroxidase-conjugated antibody (Bio-Rad) diluted1:10,000 in 1% nonfat milk in TBST. The blot was developed using an ECL kit(GE Healthcare).

RESULTS

Septin genes of Tetrahymena thermophila. We used se-quences of known septins from Saccharomyces cerevisiae and

mammals to search for related genes in the recently sequencedmacronuclear genomes of free-living ciliates Tetrahymena ther-mophila (18) and Paramecium tetraurelia (5). Three septin-encoding genes were identified in Tetrahymena (SEP1, SEP2,and SEP3), and four genes and a single pseudogene werefound in Paramecium (L. Sperling, personal communication).

The phylogenetic tree (Fig. 1A) calculated based on theconserved GTP-binding core domain of septins revealed sev-eral statistically supported clades. Most of these clades contain

FIG. 2. GFP-tagged septins colocalize with mitochondria in livecells. (A to I) GFP images (A, D, and G), corresponding MitoTrackerRed images (B, E, and H, respectively), and corresponding mergedimages (C, F, and I, respectively) are shown. (A to C) A GFP-Sep1p-overproducing cell. The stars show bright foci of GFP fluorescencewhich do not stain with MitoTracker Red. The arrows show bright,vesicular structures. (D to F) A GFP-Sep2-overproducing cell. Thearrows mark rods which do not colocalize with mitochondria. (G to I)A GFP-Sep3-overproducing cell. The arrows in panel I indicate theanterior region of the cell where a reduction in the density of mito-chondria is seen. (J and K) GFP fluorescence in a WT cell (J) and a cellexpressing Sep1-GFP under the native promoter (K). (L) A GFP-Sep1-overexpressing cell imaged at a higher magnification to show anintracytoplasmically located aggregate of mitochondria (g). Arrow-heads point to cortically located mitochondria. Bar � 10 �m.

VOL. 7, 2008 SEPTINS STABILIZE MITOCHONDRIA IN T. THERMOPHILA 1375


.org/D

ownloaded from

http://ec.asm.org/

septins of invertebrates and vertebrates and some also containfungal proteins, as earlier reported (39, 64). However, all cil-iate septins belong to a clade that contains only protist se-quences, including Chlamydomonas and Nannochloris.

The sequences of the three predicted Tetrahymena septinsare 29 to 31% identical (46 to 50% similar) to those of septinsof metazoans or fungi. The Tetrahymena proteins have most ofthe conserved septin features (Fig. 1B). The core domains havethe GDP/GTP exchange G1 (GxxxxGKS/T), G3 (DxxG), andG4 (xK/RxD) motifs, but the polybasic sequence is not appar-ent (see Fig. S1 in the supplemental material). A coiled-coildomain was predicted with high probability in Sep1p and withlower probability in Sep2p, but in contrast to that of fungal andmetazoan septins, this domain was located near the N termi-nus. Surprisingly, a C-terminal transmembrane domain waspredicted for all Tetrahymena septins as well as for Nannochlo-ris and Chlamydomonas septins (Fig. 1B). None of the fungalor mammalian septins has a predicted transmembrane domain,but a putative transmembrane domain was predicted near theN-terminal end of the Unc61 septin of C. elegans (data notshown). Based on reverse transcription PCR, all three Tetra-hymena septins are expressed in growing, conjugating, andcilium-regenerating cells (see Fig. S2A and B in the supple-mental material).

Tagged Tetrahymena septins colocalize with mitochondria.We expressed the predicted septin coding regions as GFPfusions under the cadmium-responsive promoter MTT1(68). Based on Western blot analysis, fusion proteins were

detectable after 1.5 h of cadmium treatment (see Fig. S2C inthe supplemental material) and their levels remained ele-vated for at least 24 h (data not shown). The rate of growthwas reduced in all septin-overproducing strains in the pres-ence of cadmium (see Fig. S2D in the supplemental mate-rial). Observations of live cells immobilized in methylcellu-lose revealed that all GFP-tagged septins localized primarilynear the cell cortex (Fig. 2). Colabeling with MitoTrackerRed showed that all GFP-tagged septins colocalized withmitochondria, although the patterns were not identical. Inboth wild-type (WT) cells (see Fig. 6A and B) and GFP-tagged septin-overproducing cells (Fig. 2), the majority ofmitochondria were localized in the proximity of the cellsurface and were aligned along the ciliary rows (4, 48). Someseptin-overproducing cells had mitochondria inside the cellbody in the form of grapelike aggregates, and GFP-taggedseptins also colocalized with these mislocalized internal mi-tochondria (Fig. 2A, C, and L). The cell body aggregatesof Sep1-GFP produced an intense GFP signal, while theMitoTracker signal was relatively faint (Fig. 2B and C),indicating a reduced membrane potential in internal mito-chondria (65).

The GFP-Sep1p and GFP-Sep3p patterns closely matchedthe patterns of mitochondrial outlines revealed by Mito-Tracker Red (Fig. 2A, B, G, and H), while the GFP-Sep2plocalization was distinct (Fig. 2D). In addition to mitochondrialoutlines, the GFP-Sep2p signal was organized into rodlikestructures and small patches in the proximity of mitochondria

FIG. 3. Mitochondria are affected in septin-overproducing and septin-deficient cells. (A and B) Subcortical mitochondria in WT cells. Scissionsites (s), intramitochondrial filamentous inclusions (f), and TMs are marked. (B) The scission sites are accompanied by flat ER cisternae. A Golgistack (G) and a vesicular mitochondrion (vm) are indicated. (C) Abnormal morphotypes of mitochondrion in the Sep1-GFP strain. (D) Quan-titative analysis of the ultrastructure of mitochondria in cells that either overproduce or are deficient in specific septins. The distributions of threemorphotypes of mitochondria, swollen, vesicular, and normal, were determined on TEM sections. KO, knockout.



.org/D

ownloaded from

http://ec.asm.org/

FIG. 4. GFP-tagged septins colocalize to and affect mitochondria and the ER. (A, C, E, and F) Standard TEM of strains overproducing septins.(B, D, G, and H) Postembedding immunogold electron microscopy of GFP-tagged septins. (A) In a GFP-Sep1p-overproducing cell, subcorticalmitochondria (m) have an abnormally abundant associated ER. (B1 and B2) White arrows indicate gold grains corresponding to GFP-Sep1p,



.org/D

ownloaded from

http://ec.asm.org/

(Fig. 2D to F). The pattern of rods resembles the knownpattern of transverse microtubule ribbons (TMs). The patternof patches resembles the pattern of the Golgi apparatus (48).

We also tagged Sep1p with GFP at the C terminus by tar-geting the endogenous locus. The pattern of distribution ofSep1p-GFP expressed under its own promoter closely resem-bled the pattern of ectopic GFP-Sep1 (Fig. 2J and K). Thus,the mitochondrial localization of Sep1p is not an artifact ofoverexpression and is not affected by the precise location ofGFP within the tagged protein.

Tetrahymena septins localize to endomembranes associatedwith mitochondria, and their overproduction destabilizes mi-tochondria. Transmission electron microscopy (TEM) showedthat, in WT cells, mitochondria were located mainly near thecell surface along ciliary rows (Fig. 3A and B). As describedpreviously (4, 44), the interior of the mitochondria was occu-pied by tubular cristae formed by the inner mitochondrialmembrane (Fig. 3A and B). Rodlike inclusions that were pre-viously identified as aggregates of the 14-nm filament protein(62) were seen in the matrix (Fig. 3A). Mitochondria wereaccompanied by the ER, with ribosomes located at the cyto-plasmic side (Fig. 3B). Often, mitochondria were seen closelyapposed to the alveolar membrane, especially those locatedunder the longitudinal microtubules or TMs. Whenever two ormore mitochondria were closely apposed, they were separatedby flat cisternae of the ER (Fig. 3A and B). Dictyosomes of theGolgi apparatus consisting of one or two stacked cisternaeaccompanied by the transitional ER were found near corticalmitochondria (Fig. 3B), as described previously (24, 25, 48).Apparent dividing mitochondria with what appeared to besepta (44) were found in cells approaching cytokinesis (cellswith an increased number of duplicating basal bodies). In suchmitochondria, the invagination of the outer mitochondrialmembrane was accompanied by ER membranes near the scis-sion site (Fig. 3A and B).

In addition to having normal mitochondria, WT cells occa-sionally had vesicles which resembled mitochondria based ontheir size but did not have internal tubular structures (Fig. 3B).These types of vesicles occasionally had rodlike filaments char-acteristic of mitochondria (data not shown). We suspect thatthese vesicles represent “old” mitochondria that undergo deg-radation.

TEM analysis revealed that the addition of cadmium to WTcells did not change the ultrastructure (results not shown).However, GFP-tagged septin-overproducing cells showed se-vere alterations, primarily in the morphology of mitochondriaand the associated ER. All three types of septin-overproducingcells had numerous vesicles smaller than mitochondria butlarger than peroxisomes (Fig. 3C; see also Fig. 5 and Fig. S4 inthe supplemental material). It appears that these structurescorrespond to vesicles with brightly labeled outlines seen in livecells (compare Fig. 2A and C and 3C) and represent remnants

of degraded mitochondria prior to enclosure in autophagicvesicles. Depending on which GFP-tagged septin was overpro-duced, 30 to 40% of the mitochondria were swollen and/or inthe process of degradation of tubules (Fig. 3D). Severe alter-ations in the morphology of the ER were found, especially inGFP-Sep1p- and GFP-Sep3p-overproducing cells (Fig. 4).Many Sep1p-GFP cells had a dilated ER (Fig. 4A). In GFP-Sep2p-overproducing cells, the ER appeared less abundantaround cortical mitochondria. However, concentric stacks ofthe ER were present around abnormal mitochondria (see Fig.S4 in the supplemental material). In addition to having flatcisternae, the tubular ER was more abundant than that incontrol cells. These results are reminiscent of ER expansion incells subjected to severe stress (8).

Strikingly, GFP-Sep2p-overproducing cells had numerousmitochondria with an apparent septum which appeared as afibrogranular material “squeezed in” between adjacent outermembranes (Fig. 4E). No such structures were found in WTcells, in cells expressing GFP-Sep1p or GFP-Sep3p, or inknockout cells lacking SEP2 (see below). In GFP-Sep3p-over-expressing cells, ectopic or abnormal mitochondrial fissionevents were observed (Fig. 4C).

Quantitative immunogold labeling with anti-GFP antibodiesconfirmed that tagged septins colocalized with mitochondria (seeFig. S3 in the supplemental material). However, each septin wastargeted to a distinct set of sites (Fig. 4; see also Fig. S3 in thesupplemental material). GFP-Sep1p colocalized mostly with theouter mitochondrial membrane (Fig. 4B1 and B2). GFP-Sep2plocalized to the outer membrane as well as to scission sites (thatwere induced by its overexpression) and TMs (Fig. 4F and H),while GFP-Sep3p localized primarily to the mitochondrial outermembrane (MOM) and the ER (Fig. 4D).

A characteristic feature of cells overproducing each of thethree septins was an increased number of autophagic vacuoles(Fig. 5) containing mitochondria in the course of degradation.Using the autophagic vacuole marker monodansylcadaverine(6, 60), we found that the number of cells containing more thanfive autophagosomes increased from 5% in WT cells (n � 100)to 30% in GFP-Sep1-overproducing cells (n � 100) (I.Sokolowska and M. Jerka-Dziadosz, unpublished data).

Septins are required for normal stability of mitochondriaand nuclei. Single knockouts of the SEP2 or the SEP3 gene didnot affect the rate of cell multiplication, but cells lacking SEP1grew more slowly (see Fig. S2E in the supplemental material).Furthermore, cells lacking SEP1 showed increased mortalitywhen isolated. Among 53 clones, only 12 gave thriving cultures.The rates of cell motility of septin-deficient cells were similarto those for the WT (results not shown).

Based on confocal imaging with MitoTracker, knockout cells(similarly to overexpressing cells) had an increased number ofmitochondria located inside the cell body compared to that forthe WT (compare Fig. 6C, E, G, I, K, and M to A). In some

associated with the outer mitochondrial membrane, ER, and cristae. (C and D) Subcortical mitochondria in GFP-Sep3p-overproducing cells. Inpanel C, arrows point to scission sites in the mitochondrion. In panel D, gold grains in immunolabeled cells (indicated by white arrows) arelocalized near the ER and the MOM. (E and F) TEM of subcortical mitochondria in Sep2-GFP-overproducing cells. (E) Abnormal scission events(s). Note the presence of electron-dense material in the septa. (F) TM overlying the mitochondrion adjacent to the scission figure (s). (G and H)Specific immunogold labeling at scission structures (s). bb, basal body; f, filament. Bar � 200 nm.



.org/D

ownloaded from

http://ec.asm.org/

FIG. 5. Overexpression of GFP-Sep2 leads to an excessive number of mitochondria and autophagic vacuoles containing remnants of mito-chondria (compare Fig. S6 in the supplemental material). Abundant mitochondria are visible both near the cell cortex and as subectoplasmic andendoplasmic groupings (arrowheads). Vesicular, apparently in situ-degraded mitochondria are also present, as is an excessive ER. AV, autophagicvacuole; bb, basal body; vm, vesicular mitochondrion. Bar � 200 nm.

1379


.org/D

ownloaded from

http://ec.asm.org/

cells lacking SEP1, the mitochondria appeared smaller andmore numerous (Fig. 6K and L). Thus, in subtle ways, theabsence of septins alters the organization and morphology ofmitochondria.

Cells lacking septin genes showed abnormalities in the struc-ture of nuclei, based on Hoechst staining. In the WT (Fig. 7),97% of cells had a normal nuclear composition, with onemacronucleus (Mac) and one micronucleus (Mic). In strainslacking SEP1, 44% of cells lacked a detectable Mic (Fig. 6I and

K), which correlates with the high clonal mortality of thisstrain, as the presence of a Mic is needed for viability (31). Incells lacking SEP2, amicronucleate cells were not seen, but15% of cells had more than one Mic. In cells lacking SEP3,about 50% of cells had various nuclear abnormalities (Fig. 7).

TEM analysis of septin knockout strains revealed frequentdefects in mitochondria. Cortical mitochondria with apparentfission sites were more frequent than in the WT (Fig. 8A to C).Many mitochondria in knockout strains were round and

FIG. 6. Cells lacking septins display abnormalities in the morphology and localization of mitochondria. Growing WT cells (A and B) and septinknockout (KO) cells (C to P) were fixed in paraformaldehyde and labeled with Mito Red (mitochondria) and Hoechst stain (nuclei) and observedwith a confocal microscope. Twenty to 25 sections 0.5 �m thick were recorded for each cell. Pairs of images represent sets of optical sectionscovering the cell interior (A, C, E, G, I, K, and M) and the ventral cortical layer (B, D, F, H, J, L, N, O, and the dorsal site [P]). In panels A, C,E, G, and M, arrows mark the Mic; in panels O and P, arrows point to abnormally long mitochondria. Cells lacking SEP1 (I to L) have a swollenMac and lack a discernible Mic. Bar � 10 �m.



.org/D

ownloaded from

http://ec.asm.org/

slightly swollen, and the tubular cristae were rarified, resultingin an “empty” interior (Fig. 8D; see also Fig. S5 and S6 in thesupplemental material); these mitochondria were similar toswollen mitochondria in overexpressing cells (compare sm inFig. S4 in the supplemental material). Vesicular mitochondriawith an “empty” interior were frequent (Fig. 8E). The mor-phological features of damaged mitochondria were similar inall types of septin-deficient strains but were particularly severein cells lacking Sep2p, where normal mitochondria comprisedonly 35% of the whole population (Fig. 3D; see also Fig. S6 inthe supplemental material). Autophagic vacuoles with rem-nants of mitochondria, micronuclei (Fig. 8F and I), and occa-sionally cilia or basal bodies were encountered in all studiedseptin knockout strains. The morphology of the autophagicvacuoles resembled those described previously for ageing andstarved Tetrahymena cells (21). TEM also revealed abnormalnuclei in septin knockout cells. Cases of decomposition of thenuclear envelope in Macs and Mics were seen (Fig. 8G, H, J,and K). The micronuclear envelope could be disrupted at mul-tiple sites, and some Mics were swollen. Instead of the darklycontrasted chromatin bodies seen in the WT (see Fig. S7 in thesupplemental material), the nuclear contents appeared as finethreads and no discernible chromatin bodies were present (Fig.8H and J). Even in Mics engaged in mitosis, the nuclear en-velope membrane was sometimes disrupted (Fig. 8K). Thesedamaged Mics were sometimes enclosed in an autophagic vac-uole or incorporated into a larger vacuole containing otherorganelles, such as mitochondria and cilia (Fig. 8F and I). Onsome sections, partially decomposed macronuclear envelopeswere seen. In Macs with a missing envelope, the peripheralnucleoli were not present and mixing of the nucleoplasm withcytoplasmic organelles was observed (Fig. 8G).

To test the possibility that Tetrahymena septins are function-ally overlapping, we used crosses to create a strain that lacksSEP1, SEP2, and SEP3. Surprisingly, the growth and motilityrate of this strain were similar to those of the WT (see Fig. S2Ein the supplemental material). Labeling of mitochondria withMitoTracker and nuclei with Hoechst stain (Fig. 6M to P) didnot reveal any obvious difference compared to the singleknockouts, except for the occasional presence of unusuallylong and thin mitochondria (Fig. 6O and P). About 8% of cells(n � 109) had an abnormal composition of nuclei (Fig. 7).

TEM of triple knockout strains showed that about 20% ofmitochondria were abnormal and swollen and lacked internaltubules and that 10% of mitochondria were in a process of insitu degradation (n � 293) (Fig. 3D and 9B). The ultrastruc-ture of affected mitochondria resembled that of single knock-outs, i.e., most were swollen, with rarified internal tubules.Thin, long mitochondria were located in the subcortical re-gions (Fig. 9A) and appeared as if the final splitting of dividingmitochondria was inhibited. Abnormal micronuclei were rare,and their morphology was similar to that of affected micronu-clei in single knockouts but with less-severe membrane damage(compare Fig. 9B and 8H and J). Abundant autophagosomessimilar to those found in single gene knockouts were present inall cells with affected mitochondria. It thus appears that theeffects of individual knockouts are not synergistic. Moreover,in some respects, the single knockout strains showed morepronounced defects than the triple knockout strain.

DISCUSSION

Until recently, septin proteins were known to be present infungi and metazoans but not in higher plants or parasitic pro-tists, like Giardia (78) or Plasmodium fasciculatum (17). How-ever, septin genes were recently found in the green algaeChlamydomonas reinhardtii and Nannochloris spp. (78). Here,we report the presence of septin genes in the free-living ciliatesTetrahymena thermophila and Paramecium tetraurelia. We com-plement earlier phylogenetic studies (51, 59, 64) by showingthat septins of ciliates and green algae form a separate clade.Moreover, our functional studies support the proposed phy-logeny by showing that ciliate septins have evolved uniquefunctions.

Septins of fungi and metazoans have a well-established rolein cytokinesis. Thus, it was surprising that none of the taggedTetrahymena septins colocalized with the fission furrow, knownto contain a filamentous structure (36). Instead, the Tetrahy-mena septins were found to be associated with mitochondria. Itwill be important to investigate whether septins of otherfree-living protists, such as Chlamydomonas reinhardtii, alsoparticipate in mitochondrial functions. The Tetrahymenaand Chlamydomonas (but not Paramecium) septins have apredicted transmembrane domain, and this feature could

FIG. 7. Cells lacking septin genes (knockout, KO) have abnormalities in the composition of nuclei (either supernumerary or absent Mics).Samples of growing cultures were fixed and labeled with Hoechst stain. The numbers of cells with one Mac and one Mic (normal), one Mac andtwo or three Mics (abnormal), and one Mac but no Mic (abnormal) were scored on slides. Bars represent the percentages of differentsubpopulations in five studied strains. The numbers on top of the bars represent the sample sizes.



.org/D

ownloaded from

http://ec.asm.org/

play a role in the mitochondrial functions of some protistanseptins. This protein topology enables targeting of proteinsto the ER and the MOM (9, 10). Tagged Tetrahymena sep-tins localized to the MOM and the neighboring ER orformed septumlike structures.

Among the known septins, mitochondrial localization is rare(39, 52). Two splice variants of Sep4, ARTS and M-septin,localize to mitochondria in mammalian cells (41, 49). ARTShas a proapoptotic activity (50). Deletion of ARTS in miceresulted in abnormal sperm development, with affected mito-chondria (34). M-septin plays an undefined role in apoptosis ofneural cells (74). A comparison of ARTS and M-septin withseptinlike proteins of Tetrahymena revealed no significant se-quence homology besides the central core domain that is con-served in all septins (Fig. 1B; see also Fig. S1 in the supple-mental material). Moreover, it appears that ciliate andmammalian septins have nonidentical mitochondrial functions.First, unlike ARTS and M-septins, ciliate septins lack a mito-chondrial targeting signal. Second, while ARTS has a proapop-totic activity, ciliate septins appear to protect against apopto-sis-like damage of mitochondria and nuclear envelopes. Wepropose that the mitochondrial association of Tetrahymena andmammalian septins has resulted from the recruitment of sep-tins to mitochondria, which has occurred independently in thelineages of protists and mammals. Studies of Tetrahymena haverecently revealed a case of convergent evolution of anothertype of membrane-associated GTPases, dynamins. Elde andcolleagues showed that the adaptation of some dynamins toendocytosis has occurred independently in the lineages of cil-iates and metazoans (20).

In contrast to mammalian and yeast cells, where the mito-chondrial population is in constant flux, driven by organellefusion and fission (30), genetic studies of Paramecium tetra-urelia indicate that in this ciliate, mitochondria do not undergofusion events (66). Several observations reported here indicatethat, in Tetrahymena, septins play a role in fission of mitochon-dria. The disintegrating mitochondria in the single septinknockouts (Fig. 8D and E; see also Fig. S6 in the supplementalmaterial) and abnormally long cortical mitochondria in tripleknockouts (Fig. 9A and B) most likely are manifestations ofdefects in mitochondrial fission. In addition, the abnormalscission events in Sep3-overexpressing cells (Fig. 4C) and theinduction of apparent mitochondrial septa (Fig. 4E and F), aswell as the presence of clusters of small grapelike aggregates ofmitochondria in septin-overproducing cells (Fig. 2A and L and5), are consistent with the involvement of septins in mitochon-drial fission. In Trypanosoma brucei, the parasitic protist thatlacks septin sequences in the genome, the dynamics of mito-chondria are regulated by another GTPase, dynamin. Deletionof the single dynamin gene in Trypanosoma inhibited bothmitochondrial fission and endocytosis (13). Dynamins havebeen implicated in both fission and fusion of mitochondria inother organisms (30). Tetrahymena has several dynamin-re-lated proteins. While some of these proteins participate inendocytosis at the parasomal sac, Drp7p dynamin localizes tosubcortical mitochondria (20). This observation opens the pos-sibility that, in Tetrahymena, septins and a subset of dynaminswork together in the regulation of mitochondrial dynamics.This could explain why Tetrahymena cells lacking all septinsremain viable.

Mitochondria play a critical role in the induction of apop-tosis in vertebrates by providing a source of apoptosis-inducingagents, such as cytochrome c (for a review, see references 47and 77). The permeabilization of mitochondria and the result-ing activation of cysteine proteases leading to cell death havebeen described for the unicellular eukaryote Leishmania major(2) and for Dictyostelium discoideum (3). While Tetrahymenadoes not appear to undergo cell apoptosis, the Mac undergoeselimination at the end of mating via an apoptosis-like mecha-nism (programmed nuclear death [PND]). It has been sug-gested that a mitochondrial endonuclease similar to humanendonuclease G is involved in PND (42). Also, a caspaselikeactivity may be involved in PND in Tetrahymena (19, 42). We,however, were not able to find an obvious caspase or an en-donuclease G-encoding sequence in the Tetrahymena genome(results not shown). This does not rule out the possibility thatTetrahymena has apoptotic cysteine proteases and endonucle-ases that are divergent. In addition, calpain proteases havebeen implicated in apoptosis (80) and the Tetrahymena ge-nome encodes calpain homologs (18). On the other hand, AIF(apoptosis-inducing factor), when released from mitochondria,is sufficient to induce apoptosis of isolated nuclei indepen-dently of caspases (72). AIF is normally localized inside mito-chondria and translocates to the nucleus when apoptosis isinduced (71). The Tetrahymena genome encodes a protein withhigh homology to human AIF (TTHERM_00622710).

We hypothesize that, in Tetrahymena, deficiencies in septinfunctions induce permeabilization of mitochondria and leak-age of proapoptotic factors, causing damage to the nuclearenvelope. The fact that both overexpression and depletion ofseptins lead to similar defects in mitochondria and nuclei sug-gests that a specific concentration of septins stabilizes mito-chondria. An RNA interference knockdown of the Septin2gene in Paramecium tetraurelia gave a nuclear phenotype sim-ilar to the gene knockout phenotypes described here for Tet-rahymena (M. Jerka-Dziadosz and J. K. Nowak, unpublishedobservations).

In starved Tetrahymena cells, a small fraction of mitochon-dria showed signs of autophagic degradation (43). This obser-vation suggests that a turnover of mitochondria exists and thatdamaged or old mitochondria are moved away from the cor-tical region. In septin knockout cells (Fig. 6), the internalpresence of mitochondria increases, suggesting that septinsplay a role in the turnover of mitochondria.

The fact that septinlike proteins associate with the ER nearmitochondria is, to our knowledge, a novel observation. It isknown that mitochondrion-associated ER domains haveclearly defined functions in the transfer of lipids between theER and mitochondria. For example, the glycosylphosphatidyl-inositol biosynthetic pathway is confined to these ER domains(79) and a disruption of ER function also contributes to cel-lular apoptosis (11, 63, 82). Other studies revealed that defectsin the ER affect the reorganization of the nuclear membraneduring division (27, 32, 57). The ER stress is coupled to themitochondrial intrinsic apoptotic pathway through BH-3 fam-ily proteins (67). We propose that depletion of septins in theER contributes to the apoptosis-like events in mitochondriaand nuclei by destabilizing the turnover of mitochondrial mem-brane.

It was surprising that the Tetrahymena knockout strains lack-



.org/D

ownloaded from

http://ec.asm.org/



.org/D

ownloaded from

http://ec.asm.org/

ing single or multiple septins were viable. Moreover, somesingle knockout strains had more-severe defects than the tripleknockout strain lacking septin functions entirely (Fig. 3D).However, septins form heteropolymers in vivo (70). It is pos-sible that some phenotypic changes in the single knockoutstrains result from the accumulation of septins that cannot be

incorporated into a heteropolymer. Nevertheless, all septin-deficient strains are viable. However, the detrimental effects ofthe lack of septins on mitochondria, possibly resulting in therelease of nuclear-damage-inducing factors, could be compen-sated by massive induction of autophagic vacuoles. In otherspecies, autophagy provides an important surveillance mecha-

FIG. 8. TEM reveals autophagic and apoptosis-like changes in septin gene knockout strains. (A to C) Mitochondrial scission sites (s) in cellslacking Sep1p (A), Sep2p (B), and Sep3p (C), which morphologically do not differ from WT cells (Fig. 3A and B). (D) A swollen mitochondrion(sm) in a SEP1 knockout (KO) cell. (E) A vesicular mitochondrion (vm) adjacent to a normal mitochondrion (m) closely apposed to the TM ina SEP2 knockout cell. (F) An autophagic vacuole (AV) in the SEP1 knockout cell, with remnants of nuclear material (nu) and compactmitochondria. (G) A Mac with a disrupted nuclear envelope (NE) (arrows). Remnants of the envelope are visible on the right side of the image.(H) A decomposing Mic in a SEP2 knockout cell. Arrows indicate regions missing the nuclear envelope. Arrowheads point to nuclear pores. (I) Adecomposing Mic that appears to be in the process of incorporation into an autophagic vacuole. Arrows point to membranes of the formingautophagosome. (J) A decomposing Mic in a cell lacking SEP2. (K) A Mic in early mitotic prophase with a decomposed nuclear envelope (arrows)in a SEP3 knockout cell; the arrowhead indicates the autophagosome membrane. NPC, nuclear pore. Bar � 200 nm.

FIG. 9. Triple septin knockout (KO) cells have abnormal mitochondria. (A) Section of an abnormally long mitochondrion that spans five TMsof the ciliary row. (B) Section with many swollen and vacuolized mitochondria (sm and vm, respectively). The macronuclear and micronuclearenvelopes are discontinuous (arrows). Some autophagic vacuoles are located near damaged mitochondria. AV, autophagic vacuole; bb, basal body;f, filament; m, mitochondrion.



.org/D

ownloaded from

http://ec.asm.org/

nism which cells employ to degrade damaged or obsolete or-ganelles and proteins (38, 85) and autophagy has been shownto play a central role in the degradation of mitochondria (58).Thus, we suggest that, in ciliates and possibly other free-livingprotists, septins play a role in the maintenance of mitochondriaand that the deleterious consequences of their absence can becompensated by increased autophagy.

ACKNOWLEDGMENTS

We thank Linda Sperling (CGM, Gif-sur-Yvette) for annotations ofseptin genes in Paramecium. We also thank Linda Sperling, JanineBeisson (CGM, Gif-sur-Yvette), and Krzysztof Zablocki (The NenckiInstitute) for comments on the manuscript. We thank the staff of theEM and Confocal Microscopy Laboratories of the Nencki Institute forskillful technical assistance. We thank Michelle Momany (Universityof Georgia, Athens, GA) for advice on imaging of GFP in live cells.

This work was supported by statute grants from the Polish Ministryof Science and Higher Education to the Nencki Institute and by Na-tional Science Foundation grant MCB-033965 (to J.G.).

REFERENCES

1. Adam, J. C., J. R. Pringle, and M. Peifer. 2000. Evidence for functionaldifferentiation among Drosophila septins in cytokinesis and cellularization.Mol. Biol. Cell 11:3123–3135.

2. Arnoult, D., K. Akarid, A. Grodet, P. X. Petit, J. Estaquier, and J. C.Ameisen. 2002. On the evolution of programmed cell death: apoptosis of theunicellular eukaryote Leishmania major involves cysteine proteinase activa-tion and mitochondrion permeabilization. Cell Death Differ. 9:65–81.

3. Arnoult, D., I. Tatischeff, J. Estaquier, M. Girard, F. Sureau, J. P. Tissier, A.Grodet, M. Dellinger, F. Traincard, A. Kahn, J. C. Ameisen, and P. X. Petit.2001. On the evolutionary conservation of the cell death pathway: mitochon-drial release of an apoptosis-inducing factor during Dictyostelium discoideumcell death. Mol. Biol. Cell 12:3016–3030.

4. Aufderheide, K. 1979. Mitochondrial associations with specific microtubularcomponents of the cortex of Tetrahymena thermophila. I. Cortical patterningof mitochondria. J. Cell Sci. 39:299–312.

5. Aury, J. M., O. Jaillon, L. Duret, B. Noel, C. Jubin, B. M. Porcel, B.Segurens, V. Daubin, V. Anthouard, N. Aiach, O. Arnaiz, A. Billaut, J.Beisson, I. Blanc, K. Bouhouche, F. Camara, S. Duharcourt, R. Guigo, D.Gogendeau, M. Katinka, A. M. Keller, R. Kissmehl, C. Klotz, F. Koll, A. LeMouel, G. Lepere, S. Malinsky, M. Nowacki, J. K. Nowak, H. Plattner, J.Poulain, F. Ruiz, V. Serrano, M. Zagulski, P. Dessen, M. Betermier, J.Weissenbach, C. Scarpelli, V. Schachter, L. Sperling, E. Meyer, J. Cohen,and P. Wincker. 2006. Global trends of whole-genome duplications revealedby the ciliate Paramecium tetraurelia. Nature 444:171–178.

6. Bampton, E. T., C. G. Goemans, D. Niranjan, N. Mizushima, and A. M.Tolkovsky. 2005. The dynamics of autophagy visualized in live cells: from au-tophagosome formation to fusion with endo/lysosomes. Autophagy 1:23–36.

7. Beites, C. L., H. Xie, R. Bowser, and W. S. Trimble. 1999. The septinCDCrel-1 binds syntaxin and inhibits exocytosis. Nat. Neurosci. 2:434–439.

8. Bernales, S., K. L. McDonald, and P. Walter. 2006. Autophagy counterbal-ances endoplasmic reticulum expansion during the unfolded protein re-sponse. PLoS Biol. 4:e423.

9. Borgese, N., S. Brambillasca, and S. Colombo. 2007. How tails guide tail-anchored proteins to their destination. Curr. Opin. Cell Biol. 19:368–375.

10. Borgese, N., I. Gazzoni, M. Barberi, S. Colombo, and E. Pedrazzini. 2001.Targeting of a tail-anchored protein to endoplasmic reticulum and mito-chondrial outer membrane by independent but competing pathways. Mol.Biol. Cell 12:2482–2496.

11. Breckenridge, D. G., M. Germain, J. P. Mathai, M. Nguyen, and G. C. Shore.2003. Regulation of apoptosis by endoplasmic reticulum pathways. Onco-gene 22:8608–8618.

12. Cassidy-Hanley, D., J. Bowen, J. H. Lee, E. Cole, L. A. VerPlank, J. Gaertig,M. A. Gorovsky, and P. J. Bruns. 1997. Germline and somatic transforma-tion of mating Tetrahymena thermophila by particle bombardment. Genetics146:135–147.

13. Chanez, A. L., A. B. Hehl, M. Engstler, and A. Schneider. 2006. Ablation ofthe single dynamin of T. brucei blocks mitochondrial fission and endocytosisand leads to a precise cytokinesis arrest. J. Cell Sci. 119:2968–2974.

14. Chant, J. 1996. Septin scaffolds and cleavage planes in Saccharomyces. Cell84:187–190.

15. Cole, E., J. Frankel, and L. Jenkins. 1988. Interactions between janus andbcd cortical pattern mutants in Tetrahymena thermophila. An investigation ofintracellular patterning mechanisms using double-mutant analysis. RouxsArch. Dev. Biol. 197:476–489.

16. Dobbelaere, J., and Y. Barral. 2004. Spatial coordination of cytokineticevents by compartmentalization of the cell cortex. Science 305:393–396.

17. Douglas, L. M., F. J. Alvarez, C. McCreary, and J. B. Konopka. 2005. Septinfunction in yeast model systems and pathogenic fungi. Eukaryot. Cell4:1503–1512.

18. Eisen, J. A., R. S. Coyne, M. Wu, D. Wu, M. Thiagarajan, J. R. Wortman,J. H. Badger, Q. Ren, P. Amedeo, K. M. Jones, L. J. Tallon, A. L. Delcher,S. L. Salzberg, J. C. Silva, B. J. Haas, W. H. Majoros, M. Farzad, J. M.Carlton, R. K. Smith, Jr., J. Garg, R. E. Pearlman, K. M. Karrer, L. Sun, G.Manning, N. C. Elde, A. P. Turkewitz, D. J. Asai, D. E. Wilkes, Y. Wang, H.Cai, K. Collins, B. A. Stewart, S. R. Lee, K. Wilamowska, Z. Weinberg, W. L.Ruzzo, D. Wloga, J. Gaertig, J. Frankel, C. C. Tsao, M. A. Gorovsky, P. J.Keeling, R. F. Waller, N. J. Patron, J. M. Cherry, N. A. Stover, C. J. Krieger,C. del Toro, H. F. Ryder, S. C. Williamson, R. A. Barbeau, E. P. Hamilton,and E. Orias. 2006. Macronuclear genome sequence of the ciliate Tetrahy-mena thermophila, a model eukaryote. PLoS Biol. 4:e286.

19. Ejercito, M., and J. Wolfe. 2003. Caspase-like activity is required for pro-grammed nuclear elimination during conjugation in Tetrahymena. J. Eu-karyot. Microbiol. 50:427–429.

20. Elde, N. C., G. Morgan, M. Winey, L. Sperling, and A. P. Turkewitz. 2005.Elucidation of clathrin-mediated endocytosis in Tetrahymena reveals an evo-lutionarily convergent recruitment of dynamin. PLoS Genet. 1:e52.

21. Elliott, A. M., and I. J. Bak. 1964. The fate of mitochondria during aging inTetrahymena riformis. J. Cell Biol. 20:113–129.

22. Faty, M., M. Fink, and Y. Barral. 2002. Septins: a ring to part mother anddaughter. Curr. Genet. 41:123–131.

23. Felsenstein, J. 1997. An alternating least squares approach to inferringphylogenies from pairwise distances. Syst. Biol. 46:101–111.

24. Franke, W. W., W. A. Eckert, and S. Krien. 1971. Cytomembrane differen-tiation in a ciliate, Tetrahymena pyriformis. I. Endoplasmic reticulum anddictyosomal equivalents. Z. Zellforsch. Mikrosk. Anat. 119:577–604.

25. Franke, W. W., J. Kartenbeck, H. Zentgraf, U. Scheer, and H. Falk. 1971.Membrane-to-membrane cross-bridges. A means to orientation and interac-tion of membrane faces. J. Cell Biol. 51:881–888.

26. Galtier, N., M. Gouy, and C. Gautier. 1996. SEAVIEW and PHYLO_WIN:two graphic tools for sequence alignment and molecular phylogeny. Comput.Appl. Biosci. 12:543–548.

27. Germain, M., J. P. Mathai, H. M. McBride, and G. C. Shore. 2005. Endo-plasmic reticulum BIK initiates DRP1-regulated remodeling of mitochon-drial cristae during apoptosis. EMBO J. 24:1546–1556.

28. Gladfelter, A. S., L. Kozubowski, T. R. Zyla, and D. J. Lew. 2005. Interplaybetween septin organization, cell cycle and cell shape in yeast. J. Cell Sci.118:1617–1628.

29. Gottfried, Y., A. Rotem, R. Lotan, H. Steller, and S. Larisch. 2004. Themitochondrial ARTS protein promotes apoptosis through targeting XIAP.EMBO J. 23:1627–1635.

30. Hales, K. G. 2004. The machinery of mitochondrial fusion, division, anddistribution, and emerging connections to apoptosis. Mitochondrion 4:285–308.

31. Haremaki, T., T. Suqai, and M. Takahashi. 1995. The vegetative micronu-cleus has a critical role in maintenance of cortical structure in Tetrahymenathermophila. Cell Struct. Funct. 20:239–244.

32. Hetzer, M. W., T. C. Walther, and I. W. Mattaj. 2005. Pushing the envelope:structure, function, and dynamics of the nuclear periphery. Annu. Rev. CellDev. Biol. 21:347–380.

33. Hsu, S. C., C. D. Hazuka, R. Roth, D. L. Foletti, J. Heuser, and R. H.Scheller. 1998. Subunit composition, protein interactions, and structures ofthe mammalian brain sec6/8 complex and septin filaments. Neuron 20:1111–1122.

34. Ihara, M., A. Kinoshita, S. Yamada, H. Tanaka, A. Tanigaki, A. Kitano, M.Goto, K. Okubo, H. Nishiyama, O. Ogawa, C. Takahashi, S. Itohara, Y.Nishimune, M. Noda, and M. Kinoshita. 2005. Cortical organization by theseptin cytoskeleton is essential for structural and mechanical integrity ofmammalian spermatozoa. Dev. Cell 8:343–352.

35. Janke, C., K. Rogowski, D. Wloga, C. Regnard, A. V. Kajava, J. M. Strub, N.Temurak, J. van Dijk, D. Boucher, A. van Dorsselaer, S. Suryavanshi, J.Gaertig, and B. Edde. 2005. Tubulin polyglutamylase enzymes are membersof the TTL domain protein family. Science 308:1758–1762.

36. Jerka-Dziadosz, M., I. Strzyzewska-Jowko, U. Wojsa-Lugowska, W. Krawc-zynska, and A. Krzywicka. 2001. The dynamics of filamentous structures inthe apical band, oral crescent, fission line and the postoral meridional fila-ment in Tetrahymena thermophila revealed by monoclonal antibody 12G9.Protist 152:53–67.

37. Kartmann, B., and D. Roth. 2001. Novel roles for mammalian septins: fromvesicle trafficking to oncogenesis. J. Cell Sci. 114:839–844.

38. Kim, I., S. Rodriguez-Enriquez, and J. J. Lemasters. 2007. Selective degra-dation of mitochondria by mitophagy. Arch. Biochem. Biophys. 462:245–253.

39. Kinoshita, M. 2003. The septins. Genome Biol. 4:236.40. Kinoshita, M., and M. Noda. 2001. Roles of septins in the mammalian

cytokinesis machinery. Cell Struct. Funct. 26:667–670.41. Kissel, H., M. M. Georgescu, S. Larisch, K. Manova, G. R. Hunnicutt, and

H. Steller. 2005. The Sept4 septin locus is required for sperm terminaldifferentiation in mice. Dev. Cell 8:353–364.

42. Kobayashi, T., and H. Endoh. 2003. Caspase-like activity in programmed



.org/D

ownloaded from

http://ec.asm.org/

nuclear death during conjugation of Tetrahymena thermophila. Cell DeathDiffer. 10:634–640.

43. Kobayashi, T., and H. Endoh. 2005. A possible role of mitochondria in theapoptotic-like programmed nuclear death of Tetrahymena thermophila.FEBS J. 272:5378–5387.

44. Kolb-Bachofen, V., and W. Vogell. 1975. Mitochondrial proliferation in syn-chronized cells of Tetrahymena pyriformis. A morphometric study by electronmicroscopy on the biogenesis of mitochondria during the cell cycle. Exp. CellRes. 94:95–105.

45. Kremer, B. E., T. Haystead, and I. G. Macara. 2005. Mammalian septinsregulate microtubule stability through interaction with the microtubule-bind-ing protein MAP4. Mol. Biol. Cell 16:4648–4659.

46. Kremer, B. E., L. A. Adang, and I. G. Macara. 2007. Septins regulate actinorganization and cell-cycle arrest through nuclear accumulation of NCKmediated by SOCS7. Cell 130:837–850.

47. Kroemer, G. 1998. The mitochondrion as an integrator/coordinator of celldeath pathways. Cell Death Differ. 5:547.

48. Kurz, S., and A. Tiedtke. 1993. The Golgi apparatus of Tetrahymena ther-mophila. J. Eukaryot. Microbiol. 40:10–13.

49. Larisch, S. 2004. The ARTS connection: role of ARTS in apoptosis andcancer. Cell Cycle 3:1021–1023.

50. Larisch, S., Y. Yi, R. Lotan, H. Kerner, S. Eimerl, W. Tony Parks, Y.Gottfried, S. Birkey Reffey, M. P. de Caestecker, D. Danielpour, N. Book-Melamed, R. Timberg, C. S. Duckett, R. J. Lechleider, H. Steller, J. Orly,S. J. Kim, and A. B. Roberts. 2000. A novel mitochondrial septin-like pro-tein, ARTS, mediates apoptosis dependent on its P-loop motif. Nat. CellBiol. 2:915–921.

51. Leipe, D. D., Y. I. Wolf, E. V. Koonin, and L. Aravind. 2002. Classificationand evolution of P-loop GTPases and related ATPases. J. Mol. Biol. 317:41–72.

52. Lindsey, R., and M. Momany. 2006. Septin localization across kingdoms:three themes with variations. Curr. Opin. Microbiol. 9:559–565.

53. Longtine, M. S., D. J. DeMarini, M. L. Valencik, O. S. Al-Awar, H. Fares, C.De Virgilio, and J. R. Pringle. 1996. The septins: roles in cytokinesis andother processes. Curr. Opin. Cell Biol. 8:106–119.

54. Luedeke, C., S. B. Frei, I. Sbalzarini, H. Schwarz, A. Spang, and Y. Barral.2005. Septin-dependent compartmentalization of the endoplasmic reticulumduring yeast polarized growth. J. Cell Biol. 169:897–908.

55. Lupas, A., M. Van Dyke, and J. Stock. 1991. Predicting coiled coils fromprotein sequences. Science 252:1162–1164.

56. Maddox, A. S., L. Lewellyn, A. Desai, and K. Oegema. 2007. Anillin and theseptins promote asymmetric ingression of the cytokinetic furrow. Dev. Cell12:827–835.

57. Mans, B. J., V. Anantharaman, L. Aravind, and E. V. Koonin. 2004. Com-parative genomics, evolution and origins of the nuclear envelope and nuclearpore complex. Cell Cycle 3:1612–1637.

58. Mijaljica, D., M. Prescott, and R. J. Devenish. 2007. Different fates ofmitochondria: alternative ways for degradation? Autophagy 3:4–9.

59. Momany, M., J. Zhao, R. Lindsey, and P. J. Westfall. 2001. Characterizationof the Aspergillus nidulans septin (asp) gene family. Genetics 157:969–977.

60. Munafo, D. B., and M. I. Colombo. 2001. A novel assay to study autophagy:regulation of autophagosome vacuole size by amino acid deprivation. J. CellSci. 114:3619–3629.

61. Nelsen, E. M., J. Frankel, and E. Martel. 1981. Development of the ciliatureof Tetrahymena thermophila. I. Temporal coordination with oral develop-ment. Dev. Biol. 88:27–38.

62. Numata, O. 1996. Multifunctional proteins in Tetrahymena: 14-nm filamentprotein/citrate synthase and translation elongation factor-1 alpha. Int. Rev.Cytol. 164:1–35.

63. Orrenius, S., B. Zhivotovsky, and P. Nicotera. 2003. Regulation of cell death:the calcium-apoptosis link. Nat. Rev. Mol. Cell Biol. 4:552–565.

64. Pan, F., R. L. Malmberg, and M. Momany. 2008. Analysis of septins acrosskingdoms reveals orthology and new motifs. BMC Evol. Biol. 7:103.

65. Pendergrass, W., N. Wolf, and M. Poot. 2004. Efficacy of MitoTracker greenand CMXrosamine to measure changes in mitochondrial membrane poten-tials in living cells and tissues. Cytometry 61:162–169.

66. Perasso, R., and J. Beisson. 1978. Temporal pattern of mitochondrial mul-tiplication during the cell cycle in Paramecium. Biol. Cell 32:275–290.

67. Rao, R. V., K. Niazi, P. Mollahan, X. Mao, D. Crippen, K. S. Poksay, S.Chen, and D. E. Bredesen. 2006. Coupling endoplasmic reticulum stress tothe cell-death program: a novel HSP90-independent role for the small chap-erone protein p23. Cell Death Differ. 13:415–425.

68. Shang, Y., X. Song, J. Bowen, R. Corstanje, Y. Gao, J. Gaertig, and M. A.Gorovsky. 2002. A robust inducible-repressible promoter greatly facilitatesgene knockouts, conditional expression, and overexpression of homologousand heterologous genes in Tetrahymena thermophila. Proc. Nat. Acad. Sci.USA 99:3734–3739.

69. Sharma, N., J. Bryant, D. Wloga, R. Donaldson, R. C. Davis, M. Jerka-Dziadosz, and J. Gaertig. 2007. Katanin regulates dynamics of microtubulesand biogenesis of motile cilia. J. Cell Biol. 178:1065–1079.

70. Sirajuddin, M., M. Farkasovsky, F. Hauer, D. Kuhlmann, I. G. Macara, M.Weyand, H. Stark, and A. Wittinghofer. 2007. Structural insight into filamentformation by mammalian septins. Nature 449:311–315.

71. Spiliotis, E. T., S. J. Hunt, Q. Hu, M. Kinoshita, and W. J. Nelson. 2008.Epithelial polarity requires septin coupling of vesicle transport to polyglu-tamylated microtubules. J. Cell Biol. 180:295–303.

72. Susin, S. A., H. K. Lorenzo, N. Zamzami, I. Marzo, B. E. Snow, G. M.Brothers, J. Mangion, E. Jacotot, P. Costantini, M. Loeffler, N. Larochette,D. R. Goodlett, R. Aebersold, D. P. Siderovski, J. M. Penninger, and G.Kroemer. 1999. Molecular characterization of mitochondrial apoptosis-in-ducing factor. Nature 397:441–446.

73. Tada, T., A. Simonetta, M. Batterton, M. Kinoshita, D. Edbauer, and M.Sheng. 2007. Role of septin cytoskeleton in spine morphogenesis and den-drite development in neurons. Curr. Biol. 17:1752–1758.

74. Takahashi, S., R. Inatome, H. Yamamura, and S. Yanagi. 2003. Isolation andexpression of a novel mitochondrial septin that interacts with CRMP/CRAMin the developing neurones. Genes Cells 8:81–93.

75. Takizawa, P. A., J. L. DeRisi, J. E. Wilhelm, and R. D. Vale. 2000. Plasmamembrane compartmentalization in yeast by messenger RNA transport anda septin diffusion barrier. Science 290:341–344.

76. Tartar, V. 1961. The biology of Stentor. Pergamon Press, Oxford, UnitedKingdom.

77. van Gurp, M., N. Festjens, G. van Loo, X. Saelens, and P. Vandenabeele.2003. Mitochondrial intermembrane proteins in cell death. Biochem. Bio-phys. Res. Commun. 304:487–497.

78. Versele, M., and J. Thorner. 2005. Some assembly required: yeast septinsprovide the instruction manual. Trends Cell Biol. 15:414–424.

79. Vidugiriene, J., D. K. Sharma, T. K. Smith, N. A. Baumann, and A. K.Menon. 1999. Segregation of glycosylphosphatidylinositol biosynthetic reac-tions in a subcompartment of the endoplasmic reticulum. J. Biol. Chem.274:15203–15212.

80. Wang, K. K. 2000. Calpain and caspase: can you tell the difference? TrendsNeurosci. 23:20–26.

81. Weirich, C. H., J. P. Erzberger, and Y. Barral. 2008. The septin family ofGTPases: architecture and dynamics. Nat. Rev. Mol. Cell Biol. 9:478–488.

82. White, C., C. Li, J. Yang, N. B. Petrenko, M. Madesh, C. B. Thompson, andJ. K. Foskett. 2005. The endoplasmic reticulum gateway to apoptosis byBcl-X (L) modulation of the InsP3R. Nat. Cell Biol. 7:1021–1028.

83. Włoga, D., A. Camba, K. Rogowski, G. Manning, M. Jerka-Dziadosz, and J.Gaertig. 2006. Members of the NIMA-related kinase family promote disas-sembly of cilia by multiple mechanisms. Mol. Biol. Cell 17:2799–2810.

84. Włoga, D., K. Rogowski, N. Sharma, J. Van Dijk, C. Janke, B. Edde, M.-H.Bre, N. Levilliers, V. Redeker, J. Duan, M. A. Gorovsky, M. Jerka-Dziadosz,and J. Gaertig. 2008. Glutamylation on �-tubulin is not essential but affectsthe assembly and functions of a subset of microtubules in Tetrahymenathermophila. Eukaryot. Cell 7:1362–1372.

85. Xie, Z., and D. J. Klionsky. 2007. Autophagosome formation: core machin-ery and adaptations. Nat. Cell Biol. 9:1102–1109.

86. Xue, J., C. W. Tsang, W. P. Gai, C. S. Malladi, W. S. Trimble, J. A. Rostas,and P. J. Robinson. 2004. Septin 3 (G-septin) is a developmentally regulatedphosphoprotein enriched in presynaptic nerve terminals. J. Neurochem. 91:579–590.



.org/D

ownloaded from

http://ec.asm.org/

septins stabilize mitochondria in tetrahymena thermophila · proteins (51). septins were discovered...

Documents