SHORT REPORT Open Access

ldquoColor Timerrdquo mice visualization of neuronaldifferentiation with fluorescent proteinsHiroaki Kanki1 Marilia Kimie Shimabukuro13 Atsushi Miyawaki2 Hideyuki Okano1

Abstract

The molecular mechanisms governing the differentiation of neural stem cells (NSCs) into neuronal progenitor cellsand finally into neurons are gradually being revealed The lack of convenient means for real-time determination ofthe stages of differentiation of individual neural cells however has been hindering progress in elucidating themechanisms In order to be able to easily identify the stages of differentiation of neural cells we have beenattempting to establish a mouse system that would allow progression of neuronal differentiation to be visualizedbased on transitions between fluorescence colors by using a combination of mouse genetics and the ever-expand-ing repertoire of fluorescent proteins In this study we report the initial version of such a mouse system which wecall ldquoColor Timerrdquo We first generated transgenic (Tg nestinKOr Tg) mice in which production of the fluorescentprotein Kusabira-Orange (KOr) is controlled by the gene regulatory elements within the 2nd intronic enhancer ofthe nestin gene which is a good marker for NSCs so that NSCs would emit orange fluorescence upon excitationWe then confirmed by immunohistochemical and immunocytochemical analyses that the KOr fluorescence closelyreflected the presence of the Nestin protein We also confirmed by a neurosphere formation assay that the inten-sity of the KOr fluorescence correlated with ldquostemnessrdquo of the cell and it was possible to readily identify NSCs inthe two neurogenic regions namely the dentate gyrus of the hippocampus and the subventricular zone of the lat-eral ventricle in the brain of adult nestinKOr Tg mice by the orange fluorescence they emitted We then crossednestinKOr mice with doublecortin-enhanced Green Fluorescent Protein Tg mice whose immature neurons emitgreen fluorescence upon excitation and it was possible to visualize the progress of NSC-to-neuron differentiationby the transition between fluorescence colors from orange to green This two-color initial version of the ldquoColorTimerrdquo mouse system will provide a powerful new tool for neurogenesis research

FindingsGeneration of nestinKOr Tg miceIdentification and purification of the Green FluorescentProtein (GFP) and cloning of its gene revolutionized thebiological sciences because labeling specific cell typesprotein tracing and real-time monitoring of geneexpression in living cells among other things becamepossible for the first time [12] A number of otherfluorescent proteins (FPs) that possess distinct charac-teristics have been discovered andor engineered sincethen and the ever-expanding repertoire of FPs has madeit possible to label individual cells with different color offluorescence reporters in the same animal as eg inldquoBrainbowrdquo mice [34]

The long-term goal of our research is to establish amouse system in which it will be possible to visualizeneuronal differentiation from neural stem cells (NSCs)to neuronal progenitor cells (NPCs) and then to neu-rons based on transitions between the colors of thefluorescence To achieve that goal we decided to use acombination of mouse genetics and FPs to regulate theproduction of different color FPs by different gene regu-latory elements (GREs) each of which is specific to adifferent cell type in the mouse brainAs a first step we attempted to establish a two-color

first version of such a mouse system which we calledldquoColor Timerrdquo We began by generating transgenic (Tg)mice whose NSCs upon excitation emit fluorescence ofa color that is readily distinguishable from green whichhas already been used in hundreds of reporter mouselines One of the most-widely-used markers for NSCs isthe ~200-kDa intermediate filament protein Nestin [5]

Correspondence hidokanoscitckeioacjp1Department of Physiology Keio University School of Medicine 35Shinanomachi Shinjuku-ku Tokyo 160-8582 Japan

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

copy 2010 Kanki et al licensee BioMed Central Ltd This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (httpcreativecommonsorglicensesby20) which permits unrestricted use distribution and reproduction inany medium provided the original work is properly cited

Thorough investigation of the regulation of the nestingene has revealed the importance of the second intronicenhancer as the main regulator of the NSC-specificexpression of the gene [6] A number of reporter Tgmouse lines have already been generated with this nestinsecond intronic enhancer proving the usefulness of theelement in driving expression of the gene in NSCs [78]We therefore decided to use it in combination with thenestin promoter as the driver of production of the FPin our Tg mice [9]We selected the fluorescent protein Kusabira-Orange

(KOr) as the reporter because of its spectral separationfrom GFP (Additional file 1) and red fluorescent pro-teins (RFPs) both of which are already being widelyused in fluorescent reporter mice [10] The ldquod4rdquo versionof the PEST sequence was added to the C-terminus ofthe KOr protein for higher temporal resolution to con-struct the nestinKOr transgene with which the trans-genic mice were generated (Figure 1A) and 10 of the 13founders obtained with the transgene construct trans-mitted the transgene to subsequent generationsAll the animal-related procedures employed in thisstudy were conducted according to the institutionalregulationsOrange fluorescence of KOr in embryonic nestinKOr Tgmouse brainsThe 10 founders were crossed with wild-type B6 animalsto obtain F1 progeny and they were examined for theorange fluorescence of KOr KOr fluorescence wasdetected in the brains of embryonic day-145 (E145)embryos of 4 (s 20 48 55 and 70) of the 10 lines (Fig-ure 1B) As can be seen in Figure 1B the KOr signals inthe cerebral cortex of line 55 showed a scattered distri-bution pattern that was totally different from the pat-terns in the other lines Among the other three linesthe intensity of the KOr signals was highest in line 70intermediate in line 48 and lowest in line 20 By 8weeks after birth (P8w) the KOr signal intensity in line48 had become similar to its intensity in line 70whereas the signal intensity in line 20 remained weak(data not shown)Overlap between the orange fluorescence of KOr andNestin protein Immunohistochemical analysis of nestinKOr Tg miceIn order to determine how accurately the KOr fluores-cence reflected expression of the endogenous nestingene and then decide which line to use in subsequentexperiments we next compared the KOr fluorescencesignals and distribution of the Nestin protein by immu-nohistochemical detection with an anti-Nestin antibodyin the cerebral cortices of E145 embryos of the 4 lines(Figure 2) KOr-positive cells exhibited radial glia-likemorphology and were scattered throughout the cerebralcortex of the line 55 embryos and the intensity of the

KOr signals in individual positive cells was highest inthis line Of the other three lines line 70 showed thehighest fidelity of the KOr signals which for the mostpart were consistent with the signals for the immunohis-tochemically-detected Nestin protein Similar resultswere obtained in line 20 and then in 48 As is oftentrue of reporter mice the overlap between the signals ofthe reporter KOr and the corresponding gene was notperfect even in the seemingly-best line 70 Some of thereasons for the differences are (1) positional effects (2)differences between the kinetics of degradation of thereporter KOr protein fused to the PEST sequence andthe Nestin protein and (3) different intracellular distri-butions of the two proteins However we judged theoverlap between the signals in line 70 to be reasonablyhigh and decided to mainly use this line for subsequentanalysesCorrelation between KOr fluorescence intensity and levelsof expression of the nestin gene ImmunocytochemicalanalysisTo investigate the correlation between the intensity ofthe orange fluorescence and the levels of expression ofthe nestin gene in individual KOr-positive cells we per-formed an immunocytochemical analysis of cells pre-pared from the brains of E145 nestinKOr Tg mouseembryos Dissociated cells from line 70 animals wereimmunocytochemically processed with an anti-Nestinantibody which was in turn recognized by an AlexaFluor 488-conjugated secondary Ab The processed cellswere then analyzed for orange and green fluorescencewith a cell sorterAs shown in Figure 3A there was a linear correlation

between the intensity of the KOr fluorescence and thatof the fluorescent dye Alexa Fluor 488 which reflectedthe amount of the Nestin protein in the cellsThese results indicated that the intensity of the KOr

fluorescence closely reflected the levels of expression ofthe endogenous nestin gene in nestinKOr mouse line70Correlation between KOr fluorescence intensity andldquostemnessrdquo Neurosphere formation assayWhen cultured in a suspension containing growth fac-tors such as epidermal growth factor (EGF) and basicfibroblast growth factor (bFGF) NSCs proliferate andform floating masses of cells called ldquoneurospheresrdquo andthe number and size of the neurospheres have beenused as a measure of ldquostemnessrdquo [11] This ldquoneurosphereformation assayrdquo is one of the systems most widely usedto evaluate the stemness of neural cells and we used itto examine the relationship between the orange fluores-cence and stemness of the KOr-positive cells asdescribed in our previous reports [78]Cells were prepared from the brains of E145 line 70

nestinKOr mice and after sorting them into several

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 2 of 9

populations according to the intensity of the KOr fluor-escence we submitted them to a neurosphere formationassay As shown in Figure 3B there was a positive corre-lation between the intensity of the KOr fluorescence andstemness assessed by the frequency of neurosphereformationBased on all of these findings taken together we con-

cluded that NSCs can be prospectively enriched asorange fluorescent cells from nestinKOr Tg mouse line70 whose potency is positively correlated with theintensity of the orange fluorescence they emit

Orange cells in two neurogenic regions of the brains ofadult nestinKOr Tg miceThe concept of ldquoadult neurogenesisrdquo is now well acceptedand it is widely known that new neurons are constantlygenerated in two neurogenic regions in the adult mam-malian brain the dentate gyrus (DG) of the hippocampusand the subventricular zone (SVZ) of the lateral ventricle(LV) Since the orange signals of KOr should be observedin these regions as new neurons are generated fromNSCs we examined the distribution of KOr-positive cellsin these two regions of adult (P8w) mice

Figure 1 Structure of the nestinKOr transgene and KOr fluorescence in the brains of E145 transgenic mice (A) Map of the nestinKOrtransgene used to generate the transgenic mice (B) Bright-field (top panel) and fluorescent (bottom panel) images of the brains of E145nestinKOr mice acquired through a stereoscopic fluorescence microscope (Leica MZ10 F) with AxioVision (Zeiss) software

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 3 of 9

Figure 2 Comparison of KOr fluorescence and Nestin protein distribution in cerebral cortices of E145 nestinKOr mice The genotypesof E145 embryos were determined by direct observation of their heads under the stereoscopic fluorescence microscope described in Figure 1KOr-positive embryos were perfused with 4 paraformaldehyde (PFA) and the brains were removed After additional overnight fixation in 4PFA they were cut into 14-μm sections with a Cryostat (Leica) and then immunohistochemically (IHC) processed with a mouse anti-Nestinprimary antibody (Ab BD Biosciences Rat-401 1100) and FITC-conjugated donkey anti-mouse secondary Ab (Jackson ImmunoResearch 1250)Fluorescent micrography was performed with an ApoTome fluorescence microscope (Zeiss) and the AxioVision software (Zeiss) Scale bar 100μm

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 4 of 9

The orange fluorescence of KOr was easily detected inthe DG of the brains of nestinKOr Tg mice (Figure4A) The same as in the embryonic brains there werefewer KOr-positive cells in line 55 Among the otherthree lines the intensity of the KOr signals was againhighest in line 70In the other neurogenic area the SVZ the KOr fluor-

escence signals were distributed along the wall of theLV (Figure 4B) This pattern closely overlapped the pat-tern of distribution of immunohistochemically-detectedNestin protein especially at the dorsolateral corner (bot-tom panels)Taken together these findings confirmed the useful-

ness of nestinKOr Tg mouse line 70 as an NSCreporternestinKOr - DCX-EGFP double Tg mice the first versionof the ldquoColor Timerrdquo mouseWe then considered which mouse line to use to fluores-cence label neurons With our future plan to separateneurons into immature and mature subpopulations inmind we searched for a good specific marker for imma-ture neuronsAmong the several candidates we considered we

selected Doublecortin (DCX) a ~45-kDa microtubule-associated protein already being widely used as a markerfor immature neurons The usefulness of DCX as a mar-ker of immature neurons has been clearly demonstrated

by the immunohistochemical work of the Aigner labora-tory [12]In addition to several conventional Tg mouse lines a

Tg mouse line with a bacterial artificial chromosome(BAC) backbone containing the genomic region aroundthe mouse DCX gene was generated by the GENSATproject whose mission is to construct an array of EGFPreporter mice by using BAC backbones with genesexpressed in the nervous system [13] This DCX-EGFPBAC Tg mouse line was used to confirm that the inten-sity of EGFP which reflects the amount of the DCXprotein within the cell can be used as an indicator ofneuronal maturation which confirmed the usefulness ofthis mouse line as a reporter for neurons [14] By com-bining this mouse line with the nestinKOr Tg that wehad generated we hoped to be able to establish a mousesystem in which the NSC-to-immature neuron differen-tiation could be visualized as a transition from orangeto green fluorescenceDouble Tg mice were obtained by crossing nestinKOr

and DCX-EGFP animals both of which were heterozy-gous according to the Mendelian ratio as expectedVisualization of NSC-to-neuron differentiation by thetransition from orange-to-green fluorescence in thecerebral cortex of double Tg mouse embryosTo determine whether the expected transition fromorange-to-green fluorescence actually occurred during

Figure 3 Correlation between KOr intensity and nestin expression levels or ldquostemnessrdquo (A) Dissociated neural cells were prepared fromthe cerebral cortices of E145 nestinKOr embryos and immunocytochemically labeled for Nestin by using the same anti-Nestin primary Abdescribed in Figure 2 and an Alexa Fluor 488-conjugated goat anti-mouse secondary Ab (Jackson ImmunoResearch 1250) The processed cellswere then analyzed for KOr and Alexa Fluor 488 fluorescence with a cell sorter (MoFlo Beckman Coulter) (B) Dissociated neural cells wereprepared as in (A) and sorted into four populations according to the intensity of the KOr fluorescence About 500 cells of each population wereplated per well at a density of 25 cellμl in a 96-well plate for neurosphere formation assay After 7 days of culture in medium containing EGF(BD Biosciences) and bFGF (Roche) the numbers of spheres in each well were determined

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 5 of 9

the process of NSC-to-neuron differentiation in develop-ing mouse brains we performed time-lapse imaging ofthe embryonic cerebral cortex of double Tg miceAs expected most of the orange cells in the double Tg

animals resided on the apical side of the cortex and thegreen cells were located on the cortical side Additionalfile 2 shows time-lapse images of the cerebral cortex ofa double Tg mouse generated by using nestinKOr line70 Although it is rather difficult to identify individual

orange cells on the apical side of the cortex because ofthe ubiquitous expression of the KOr transgene in theregion an orange-to-green fluorescence transition wasoccasionally observed in individual cells and a typicalexample is indicated by an arrow in Additional file 2The cortex of a double Tg mouse generated by using

nestinKOr line 55 is shown in Additional file 3 Thescattered distribution of KOr-positive cells made identi-fication of yellow cells much easier than in line 70

Figure 4 KOr fluorescence in the two neurogenic regions in the brains of adult nestinKOr mice Animals were genotyped at P2w bypolymerase chain reaction (PCR) with the primer pair ldquohKO-IntFrdquo (TGAAGTACTTCATGGACGGC) and ldquohKO-IntRrdquo (TGAACTGGCACTTGTGGTTG) Theresultant product was ~500 bp (A) Fixed brains of P8w nestinKOr Tg mice were cut into 40-μm sections with a Vibratome (Leica) andfluorescent micrography was performed with an ApoTome fluorescence microscope and the AxioVision software (Zeiss) (B) Comparison of theKOr fluorescence and the distribution of the Nestin protein around the lateral ventricle (LV top panels) and at the dorsolateral corner (DLCbottom panels) The slices were prepared essentially as in (A) and immunohistochemistry was performed as described in Figure 2 Scale bar 200μm (top row) and 100 μm (bottom row)

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 6 of 9

Taken together these results demonstrate that thecolor of the fluorescence that neural cells emit uponexcitation actually does change from orange to greenduring neuronal differentiationTransition from orange-to-green fluorescence inneurospheres derived from cerebral cortices of nestinKOr- DCX-EGFP double Tg embryosAs mentioned above NSCs cultured in suspension inthe presence of growth factors such as EGF and bFGFproliferate and form floating masses of cells called neu-rospheres Since the cells undergo differentiation in par-allel with self-renewal practically all neurospheresconsist of mixtures of different types of neural cellsincluding NSCs neurons and glia To determinewhether it would be possible to visualize the differentia-tion of NSCs into neurons in neurospheres as well wealso performed time-lapse imaging of neurospheres pre-pared from the cerebral cortices of E145 double Tgembryos with line 70 of nestinKOr (Additional file 4)In most of the spheres the majority of the orange sig-

nals were found in the middle with green cells sur-rounding them although the distribution of fluorescentcolors was reversed (green inside and red outside) in

some spheres Yellow cells which are presumably in theNSC-to-neuron transition phase were also observedTransition from orange-to-green fluorescence along therostral migratory stream of adult nestinKOr - DCX-EGFPdouble Tg miceNewborn neurons generated in the SVZ of the adultmouse brain migrate to the olfactory bulb and in theprocess they give rise to a characteristic formation calledthe rostral migratory stream (RMS) along which theyundergo neuronal maturation Since the RMS shouldprovide another suitable system for investigating therelationship between neuronal differentiation and thetransition between fluorescence colors in the double Tgmice we examined the LV of an adult double Tg mousefor fluorescence (Figure 5)KOr fluorescence was most intense along the wall of

the LV and as cells migrated and passed the dorsolat-eral corner the KOr fluorescence gradually diminishedand became diffuseThe green fluorescence of EGFP on the other hand

was relatively weak around the LV but suddenly becameintense as the cells approached the dorsolateral cornerand it remained intense for some distance Strong yellow

Figure 5 Transition from orange to green fluorescence in RMS of adult nestinKOr - DCX-EGFP double Tg Animals were genotyped atP2w by PCR with the KOr-specific primer pair (above) and a GFP-specific primer pair ldquoGFP-IntF3rdquo (GCACGACTTCTTCAAGTCCGCCATGCC) andldquoGFP-IntR3rdquo (GCGGATCTTGAAGTTCACCTTGATGCC) The size of the PCR product for GFP was 265 bp Nestin IHC was performed with the sameprimary Ab as in Figure 2 and an Alexa 350-conjugated anti-mouse secondary Ab (Jackson ImmunoResearch 1250) Scale bar 100 μm

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 7 of 9

signals corresponding to cells in which both KOr andEGFP were present were clustered at the dorsolateralcornerThese observations confirmed the expected orange-to-

green fluorescence transition during neuronal differen-tiation in the adult mouse brainBased on all of these findings taken together we con-

cluded that the transition between fluorescent colorsfrom orange to green reflects NSC-to-neuron differen-tiation in both the embryonic brain and the adult brainthereby demonstrating the usefulness of these animalsas an NSC-to-neuron reporterThe pioneering work by Chalfie and colleagues clearly

showed the great potential of GFP as a reporter for real-time identification of a specific cell type [15] Duringthe 15 years since then thanks to the efforts of severallaboratories the FP repertoire has been expanded to thepoint that it now not only spans the visible spectrumbut also extends beyond it By combining different colorFPs with a number of cell-type-specific gene regulatoryelements that have been identified to date we have beentrying to establish mouse systems in which neural cellscan ldquotell what they arerdquo by the color of the fluorescencethey emitBased on the findings described above we concluded

that this two-color initial version of the ldquoColor Timerrdquomouse system as well as the more-advanced multi-colorversions that we are currently generating will provide apowerful new tool for neurogenesis research

Additional file 1 Spectral characteristics of KOr and EGFP Thenumerical data for the KOr spectra were obtained at httpsruomblcojpproductflproteinkohtmlClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S1PNG ]

Additional file 2 Transition from orange to green fluorescence inthe cerebral cortex of embryonic nestinKOr (line 70) - DCX-EGFPdouble Tg mice Cerebral cortices of E145 double Tg mice with line 70of nestinKOr were isolated manually cut with a knife embedded in acollagen (Nitta Gelatin) matrix and time-lapse imaged with an LSM5PASCAL fluorescence microscope (Zeiss) The 543-nm HeNe laser and488-nm Argon laser were used to excite KOr and EGFP respectively Thecell indicated by the arrow is a representative example of the orange-to-green transitionClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S2MOV ]

Additional file 3 Transition from orange to green fluorescence innestinKOr (line 55) - DCX-EGFP double Tg mice The cerebral cortexof an E145 double Tg mouse embryo with line 55 of nestinKOr wastime-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S3MOV ]

Additional file 4 Transition from orange to green fluorescence inneurospheres derived from cerebral cortex of embryonic nestinKOr(Line 70) - DCX-EGFP double Tg Cerebral cortices of E145 double Tgmouse embryos with line 70 of nestinKOr were isolated dissociated

into individual cells by mechanical pipetting cultured for several days ina medium containing EGF and bFGF and time-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S4MOV ]

AcknowledgementsWe are grateful to Dr Masahiro Yamaguchi (U of Tokyo Japan) for thenestin promoter-enhancer construct to Molecular Biological Laboratories(MBL Nagoya Japan) for the KOr cDNA and the numerical data for the KOrspectra to the GENSAT Project for the DCX-EGFP BAC Tg mice and to theldquoTamago Clubrdquo of the Research Resource Center of RIKEN BSI formicroinjection of the nestinKO transgene DNA fragment We are indebtedto Yoichi ldquoYotanrdquo Imaizumi for his advice in regard to theimmunohistochemical analyses to Sadafumi Suzuki and Dr Yumi Matsuzakifor their help with cell sorting to Chikako Hara for her help with preparingAdditional file 1 and to Satoshi Suyama Franccedilois Renault-Mihara andChikako Hara for their advice in regard to time-lapse imaging We also thankother members of the Okano and Miyawaki laboratories in particular themembers of the Adult Neurogenesis Group (Minashigosrdquo) of the former fordiscussions advice encouragement andor entertainment throughout thisstudy This work has been supported by grants from the Ministry ofEducation Culture Sports Science and Technology (MEXT to HO to HK)and from RIKEN BSI (to AM)

Author details1Department of Physiology Keio University School of Medicine 35Shinanomachi Shinjuku-ku Tokyo 160-8582 Japan 2Laboratory for CellFunction Dynamics Advanced Technology Development Core Brain ScienceInstitute (BSI) Institute of Physical and Chemical Research (RIKEN) 2-1Hirosawa Wako-shi Saitama 351-0198 Japan 3Current addressDepartamento de Histologia e Embriologia Instituto de Ciecircncias BiomeacutedicasUniversidade Federal do Rio de Janeiro (UFRJ) Rio de Janeiro Brazil

Authorsrsquo contributionsHK designed the project performed experiments analyzed data preparedfigures and wrote the manuscript MKS performed experiments analyzeddata and prepared figures AM contributed to the original experimentaldesign to generate the nestinKOr Tg mice and gave various suggestions onfluorescent reporter proteins and their combinatory usages HO providedfinancial supports for the experiments (except for nestinKOr micegeneration) and supervised the project All authors read and approved thefinal manuscript

Competing interestsThe authors declare that they have no competing interests

Received 6 January 2010Accepted 2 February 2010 Published 2 February 2010

References1 Shimomura O Johnson FH Saiga Y Extraction purification and properties

of aequorin a bioluminescent protein from the luminoushydromedusan Aequorea J Cell Comp Physiol 1962 59223-239

2 Prasher DC Eckenrode VK Ward WW Prendergast FG Cormier MJ Primarystructure of the Aequorea victoria green-fluorescent protein Gene 1992111229-233

3 Nowotschin S Eakin GS Hadjantonakis AK Live-imaging fluorescentproteins in mouse embryos multi-dimensional multi-spectralperspectives Trends in Biotechnol 2009 27266-276

4 Livet J Weissman TA Kang H Draft RW Lu J Bennis RA Sanes JRLichtman JW Transgenic strategies for combinatorial expression offluorescent proteins in the nervous system Nature 2007 45056-62

5 Gilyarov AV Nestin in central nervous system cells Neurosci Behav Physiol2008 38165-169

6 Zimmerman L Lendahl U Cunningham M McKay R Parr B Gavin BMann J Vassileva G McMahon A Independent regulatory elements in the

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 8 of 9

populations according to the intensity of the KOr fluor-escence we submitted them to a neurosphere formationassay As shown in Figure 3B there was a positive corre-lation between the intensity of the KOr fluorescence andstemness assessed by the frequency of neurosphereformationBased on all of these findings taken together we con-

cluded that NSCs can be prospectively enriched asorange fluorescent cells from nestinKOr Tg mouse line70 whose potency is positively correlated with theintensity of the orange fluorescence they emit

Orange cells in two neurogenic regions of the brains ofadult nestinKOr Tg miceThe concept of ldquoadult neurogenesisrdquo is now well acceptedand it is widely known that new neurons are constantlygenerated in two neurogenic regions in the adult mam-malian brain the dentate gyrus (DG) of the hippocampusand the subventricular zone (SVZ) of the lateral ventricle(LV) Since the orange signals of KOr should be observedin these regions as new neurons are generated fromNSCs we examined the distribution of KOr-positive cellsin these two regions of adult (P8w) mice

Figure 1 Structure of the nestinKOr transgene and KOr fluorescence in the brains of E145 transgenic mice (A) Map of the nestinKOrtransgene used to generate the transgenic mice (B) Bright-field (top panel) and fluorescent (bottom panel) images of the brains of E145nestinKOr mice acquired through a stereoscopic fluorescence microscope (Leica MZ10 F) with AxioVision (Zeiss) software

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 3 of 9

Figure 2 Comparison of KOr fluorescence and Nestin protein distribution in cerebral cortices of E145 nestinKOr mice The genotypesof E145 embryos were determined by direct observation of their heads under the stereoscopic fluorescence microscope described in Figure 1KOr-positive embryos were perfused with 4 paraformaldehyde (PFA) and the brains were removed After additional overnight fixation in 4PFA they were cut into 14-μm sections with a Cryostat (Leica) and then immunohistochemically (IHC) processed with a mouse anti-Nestinprimary antibody (Ab BD Biosciences Rat-401 1100) and FITC-conjugated donkey anti-mouse secondary Ab (Jackson ImmunoResearch 1250)Fluorescent micrography was performed with an ApoTome fluorescence microscope (Zeiss) and the AxioVision software (Zeiss) Scale bar 100μm

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 4 of 9

The orange fluorescence of KOr was easily detected inthe DG of the brains of nestinKOr Tg mice (Figure4A) The same as in the embryonic brains there werefewer KOr-positive cells in line 55 Among the otherthree lines the intensity of the KOr signals was againhighest in line 70In the other neurogenic area the SVZ the KOr fluor-

escence signals were distributed along the wall of theLV (Figure 4B) This pattern closely overlapped the pat-tern of distribution of immunohistochemically-detectedNestin protein especially at the dorsolateral corner (bot-tom panels)Taken together these findings confirmed the useful-

ness of nestinKOr Tg mouse line 70 as an NSCreporternestinKOr - DCX-EGFP double Tg mice the first versionof the ldquoColor Timerrdquo mouseWe then considered which mouse line to use to fluores-cence label neurons With our future plan to separateneurons into immature and mature subpopulations inmind we searched for a good specific marker for imma-ture neuronsAmong the several candidates we considered we

selected Doublecortin (DCX) a ~45-kDa microtubule-associated protein already being widely used as a markerfor immature neurons The usefulness of DCX as a mar-ker of immature neurons has been clearly demonstrated

by the immunohistochemical work of the Aigner labora-tory [12]In addition to several conventional Tg mouse lines a

Tg mouse line with a bacterial artificial chromosome(BAC) backbone containing the genomic region aroundthe mouse DCX gene was generated by the GENSATproject whose mission is to construct an array of EGFPreporter mice by using BAC backbones with genesexpressed in the nervous system [13] This DCX-EGFPBAC Tg mouse line was used to confirm that the inten-sity of EGFP which reflects the amount of the DCXprotein within the cell can be used as an indicator ofneuronal maturation which confirmed the usefulness ofthis mouse line as a reporter for neurons [14] By com-bining this mouse line with the nestinKOr Tg that wehad generated we hoped to be able to establish a mousesystem in which the NSC-to-immature neuron differen-tiation could be visualized as a transition from orangeto green fluorescenceDouble Tg mice were obtained by crossing nestinKOr

and DCX-EGFP animals both of which were heterozy-gous according to the Mendelian ratio as expectedVisualization of NSC-to-neuron differentiation by thetransition from orange-to-green fluorescence in thecerebral cortex of double Tg mouse embryosTo determine whether the expected transition fromorange-to-green fluorescence actually occurred during

Figure 3 Correlation between KOr intensity and nestin expression levels or ldquostemnessrdquo (A) Dissociated neural cells were prepared fromthe cerebral cortices of E145 nestinKOr embryos and immunocytochemically labeled for Nestin by using the same anti-Nestin primary Abdescribed in Figure 2 and an Alexa Fluor 488-conjugated goat anti-mouse secondary Ab (Jackson ImmunoResearch 1250) The processed cellswere then analyzed for KOr and Alexa Fluor 488 fluorescence with a cell sorter (MoFlo Beckman Coulter) (B) Dissociated neural cells wereprepared as in (A) and sorted into four populations according to the intensity of the KOr fluorescence About 500 cells of each population wereplated per well at a density of 25 cellμl in a 96-well plate for neurosphere formation assay After 7 days of culture in medium containing EGF(BD Biosciences) and bFGF (Roche) the numbers of spheres in each well were determined

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 5 of 9

the process of NSC-to-neuron differentiation in develop-ing mouse brains we performed time-lapse imaging ofthe embryonic cerebral cortex of double Tg miceAs expected most of the orange cells in the double Tg

animals resided on the apical side of the cortex and thegreen cells were located on the cortical side Additionalfile 2 shows time-lapse images of the cerebral cortex ofa double Tg mouse generated by using nestinKOr line70 Although it is rather difficult to identify individual

orange cells on the apical side of the cortex because ofthe ubiquitous expression of the KOr transgene in theregion an orange-to-green fluorescence transition wasoccasionally observed in individual cells and a typicalexample is indicated by an arrow in Additional file 2The cortex of a double Tg mouse generated by using

nestinKOr line 55 is shown in Additional file 3 Thescattered distribution of KOr-positive cells made identi-fication of yellow cells much easier than in line 70

Figure 4 KOr fluorescence in the two neurogenic regions in the brains of adult nestinKOr mice Animals were genotyped at P2w bypolymerase chain reaction (PCR) with the primer pair ldquohKO-IntFrdquo (TGAAGTACTTCATGGACGGC) and ldquohKO-IntRrdquo (TGAACTGGCACTTGTGGTTG) Theresultant product was ~500 bp (A) Fixed brains of P8w nestinKOr Tg mice were cut into 40-μm sections with a Vibratome (Leica) andfluorescent micrography was performed with an ApoTome fluorescence microscope and the AxioVision software (Zeiss) (B) Comparison of theKOr fluorescence and the distribution of the Nestin protein around the lateral ventricle (LV top panels) and at the dorsolateral corner (DLCbottom panels) The slices were prepared essentially as in (A) and immunohistochemistry was performed as described in Figure 2 Scale bar 200μm (top row) and 100 μm (bottom row)

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 6 of 9

Taken together these results demonstrate that thecolor of the fluorescence that neural cells emit uponexcitation actually does change from orange to greenduring neuronal differentiationTransition from orange-to-green fluorescence inneurospheres derived from cerebral cortices of nestinKOr- DCX-EGFP double Tg embryosAs mentioned above NSCs cultured in suspension inthe presence of growth factors such as EGF and bFGFproliferate and form floating masses of cells called neu-rospheres Since the cells undergo differentiation in par-allel with self-renewal practically all neurospheresconsist of mixtures of different types of neural cellsincluding NSCs neurons and glia To determinewhether it would be possible to visualize the differentia-tion of NSCs into neurons in neurospheres as well wealso performed time-lapse imaging of neurospheres pre-pared from the cerebral cortices of E145 double Tgembryos with line 70 of nestinKOr (Additional file 4)In most of the spheres the majority of the orange sig-

nals were found in the middle with green cells sur-rounding them although the distribution of fluorescentcolors was reversed (green inside and red outside) in

some spheres Yellow cells which are presumably in theNSC-to-neuron transition phase were also observedTransition from orange-to-green fluorescence along therostral migratory stream of adult nestinKOr - DCX-EGFPdouble Tg miceNewborn neurons generated in the SVZ of the adultmouse brain migrate to the olfactory bulb and in theprocess they give rise to a characteristic formation calledthe rostral migratory stream (RMS) along which theyundergo neuronal maturation Since the RMS shouldprovide another suitable system for investigating therelationship between neuronal differentiation and thetransition between fluorescence colors in the double Tgmice we examined the LV of an adult double Tg mousefor fluorescence (Figure 5)KOr fluorescence was most intense along the wall of

the LV and as cells migrated and passed the dorsolat-eral corner the KOr fluorescence gradually diminishedand became diffuseThe green fluorescence of EGFP on the other hand

was relatively weak around the LV but suddenly becameintense as the cells approached the dorsolateral cornerand it remained intense for some distance Strong yellow

Figure 5 Transition from orange to green fluorescence in RMS of adult nestinKOr - DCX-EGFP double Tg Animals were genotyped atP2w by PCR with the KOr-specific primer pair (above) and a GFP-specific primer pair ldquoGFP-IntF3rdquo (GCACGACTTCTTCAAGTCCGCCATGCC) andldquoGFP-IntR3rdquo (GCGGATCTTGAAGTTCACCTTGATGCC) The size of the PCR product for GFP was 265 bp Nestin IHC was performed with the sameprimary Ab as in Figure 2 and an Alexa 350-conjugated anti-mouse secondary Ab (Jackson ImmunoResearch 1250) Scale bar 100 μm

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 7 of 9

signals corresponding to cells in which both KOr andEGFP were present were clustered at the dorsolateralcornerThese observations confirmed the expected orange-to-

green fluorescence transition during neuronal differen-tiation in the adult mouse brainBased on all of these findings taken together we con-

cluded that the transition between fluorescent colorsfrom orange to green reflects NSC-to-neuron differen-tiation in both the embryonic brain and the adult brainthereby demonstrating the usefulness of these animalsas an NSC-to-neuron reporterThe pioneering work by Chalfie and colleagues clearly

showed the great potential of GFP as a reporter for real-time identification of a specific cell type [15] Duringthe 15 years since then thanks to the efforts of severallaboratories the FP repertoire has been expanded to thepoint that it now not only spans the visible spectrumbut also extends beyond it By combining different colorFPs with a number of cell-type-specific gene regulatoryelements that have been identified to date we have beentrying to establish mouse systems in which neural cellscan ldquotell what they arerdquo by the color of the fluorescencethey emitBased on the findings described above we concluded

that this two-color initial version of the ldquoColor Timerrdquomouse system as well as the more-advanced multi-colorversions that we are currently generating will provide apowerful new tool for neurogenesis research

Additional file 1 Spectral characteristics of KOr and EGFP Thenumerical data for the KOr spectra were obtained at httpsruomblcojpproductflproteinkohtmlClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S1PNG ]

Additional file 2 Transition from orange to green fluorescence inthe cerebral cortex of embryonic nestinKOr (line 70) - DCX-EGFPdouble Tg mice Cerebral cortices of E145 double Tg mice with line 70of nestinKOr were isolated manually cut with a knife embedded in acollagen (Nitta Gelatin) matrix and time-lapse imaged with an LSM5PASCAL fluorescence microscope (Zeiss) The 543-nm HeNe laser and488-nm Argon laser were used to excite KOr and EGFP respectively Thecell indicated by the arrow is a representative example of the orange-to-green transitionClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S2MOV ]

Additional file 3 Transition from orange to green fluorescence innestinKOr (line 55) - DCX-EGFP double Tg mice The cerebral cortexof an E145 double Tg mouse embryo with line 55 of nestinKOr wastime-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S3MOV ]

Additional file 4 Transition from orange to green fluorescence inneurospheres derived from cerebral cortex of embryonic nestinKOr(Line 70) - DCX-EGFP double Tg Cerebral cortices of E145 double Tgmouse embryos with line 70 of nestinKOr were isolated dissociated

into individual cells by mechanical pipetting cultured for several days ina medium containing EGF and bFGF and time-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S4MOV ]

AcknowledgementsWe are grateful to Dr Masahiro Yamaguchi (U of Tokyo Japan) for thenestin promoter-enhancer construct to Molecular Biological Laboratories(MBL Nagoya Japan) for the KOr cDNA and the numerical data for the KOrspectra to the GENSAT Project for the DCX-EGFP BAC Tg mice and to theldquoTamago Clubrdquo of the Research Resource Center of RIKEN BSI formicroinjection of the nestinKO transgene DNA fragment We are indebtedto Yoichi ldquoYotanrdquo Imaizumi for his advice in regard to theimmunohistochemical analyses to Sadafumi Suzuki and Dr Yumi Matsuzakifor their help with cell sorting to Chikako Hara for her help with preparingAdditional file 1 and to Satoshi Suyama Franccedilois Renault-Mihara andChikako Hara for their advice in regard to time-lapse imaging We also thankother members of the Okano and Miyawaki laboratories in particular themembers of the Adult Neurogenesis Group (Minashigosrdquo) of the former fordiscussions advice encouragement andor entertainment throughout thisstudy This work has been supported by grants from the Ministry ofEducation Culture Sports Science and Technology (MEXT to HO to HK)and from RIKEN BSI (to AM)

Author details1Department of Physiology Keio University School of Medicine 35Shinanomachi Shinjuku-ku Tokyo 160-8582 Japan 2Laboratory for CellFunction Dynamics Advanced Technology Development Core Brain ScienceInstitute (BSI) Institute of Physical and Chemical Research (RIKEN) 2-1Hirosawa Wako-shi Saitama 351-0198 Japan 3Current addressDepartamento de Histologia e Embriologia Instituto de Ciecircncias BiomeacutedicasUniversidade Federal do Rio de Janeiro (UFRJ) Rio de Janeiro Brazil

Authorsrsquo contributionsHK designed the project performed experiments analyzed data preparedfigures and wrote the manuscript MKS performed experiments analyzeddata and prepared figures AM contributed to the original experimentaldesign to generate the nestinKOr Tg mice and gave various suggestions onfluorescent reporter proteins and their combinatory usages HO providedfinancial supports for the experiments (except for nestinKOr micegeneration) and supervised the project All authors read and approved thefinal manuscript

Competing interestsThe authors declare that they have no competing interests

Received 6 January 2010Accepted 2 February 2010 Published 2 February 2010

References1 Shimomura O Johnson FH Saiga Y Extraction purification and properties

of aequorin a bioluminescent protein from the luminoushydromedusan Aequorea J Cell Comp Physiol 1962 59223-239

2 Prasher DC Eckenrode VK Ward WW Prendergast FG Cormier MJ Primarystructure of the Aequorea victoria green-fluorescent protein Gene 1992111229-233

3 Nowotschin S Eakin GS Hadjantonakis AK Live-imaging fluorescentproteins in mouse embryos multi-dimensional multi-spectralperspectives Trends in Biotechnol 2009 27266-276

4 Livet J Weissman TA Kang H Draft RW Lu J Bennis RA Sanes JRLichtman JW Transgenic strategies for combinatorial expression offluorescent proteins in the nervous system Nature 2007 45056-62

5 Gilyarov AV Nestin in central nervous system cells Neurosci Behav Physiol2008 38165-169

6 Zimmerman L Lendahl U Cunningham M McKay R Parr B Gavin BMann J Vassileva G McMahon A Independent regulatory elements in the

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 8 of 9

Figure 2 Comparison of KOr fluorescence and Nestin protein distribution in cerebral cortices of E145 nestinKOr mice The genotypesof E145 embryos were determined by direct observation of their heads under the stereoscopic fluorescence microscope described in Figure 1KOr-positive embryos were perfused with 4 paraformaldehyde (PFA) and the brains were removed After additional overnight fixation in 4PFA they were cut into 14-μm sections with a Cryostat (Leica) and then immunohistochemically (IHC) processed with a mouse anti-Nestinprimary antibody (Ab BD Biosciences Rat-401 1100) and FITC-conjugated donkey anti-mouse secondary Ab (Jackson ImmunoResearch 1250)Fluorescent micrography was performed with an ApoTome fluorescence microscope (Zeiss) and the AxioVision software (Zeiss) Scale bar 100μm

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 4 of 9

The orange fluorescence of KOr was easily detected inthe DG of the brains of nestinKOr Tg mice (Figure4A) The same as in the embryonic brains there werefewer KOr-positive cells in line 55 Among the otherthree lines the intensity of the KOr signals was againhighest in line 70In the other neurogenic area the SVZ the KOr fluor-

escence signals were distributed along the wall of theLV (Figure 4B) This pattern closely overlapped the pat-tern of distribution of immunohistochemically-detectedNestin protein especially at the dorsolateral corner (bot-tom panels)Taken together these findings confirmed the useful-

ness of nestinKOr Tg mouse line 70 as an NSCreporternestinKOr - DCX-EGFP double Tg mice the first versionof the ldquoColor Timerrdquo mouseWe then considered which mouse line to use to fluores-cence label neurons With our future plan to separateneurons into immature and mature subpopulations inmind we searched for a good specific marker for imma-ture neuronsAmong the several candidates we considered we

selected Doublecortin (DCX) a ~45-kDa microtubule-associated protein already being widely used as a markerfor immature neurons The usefulness of DCX as a mar-ker of immature neurons has been clearly demonstrated

by the immunohistochemical work of the Aigner labora-tory [12]In addition to several conventional Tg mouse lines a

Tg mouse line with a bacterial artificial chromosome(BAC) backbone containing the genomic region aroundthe mouse DCX gene was generated by the GENSATproject whose mission is to construct an array of EGFPreporter mice by using BAC backbones with genesexpressed in the nervous system [13] This DCX-EGFPBAC Tg mouse line was used to confirm that the inten-sity of EGFP which reflects the amount of the DCXprotein within the cell can be used as an indicator ofneuronal maturation which confirmed the usefulness ofthis mouse line as a reporter for neurons [14] By com-bining this mouse line with the nestinKOr Tg that wehad generated we hoped to be able to establish a mousesystem in which the NSC-to-immature neuron differen-tiation could be visualized as a transition from orangeto green fluorescenceDouble Tg mice were obtained by crossing nestinKOr

and DCX-EGFP animals both of which were heterozy-gous according to the Mendelian ratio as expectedVisualization of NSC-to-neuron differentiation by thetransition from orange-to-green fluorescence in thecerebral cortex of double Tg mouse embryosTo determine whether the expected transition fromorange-to-green fluorescence actually occurred during

Figure 3 Correlation between KOr intensity and nestin expression levels or ldquostemnessrdquo (A) Dissociated neural cells were prepared fromthe cerebral cortices of E145 nestinKOr embryos and immunocytochemically labeled for Nestin by using the same anti-Nestin primary Abdescribed in Figure 2 and an Alexa Fluor 488-conjugated goat anti-mouse secondary Ab (Jackson ImmunoResearch 1250) The processed cellswere then analyzed for KOr and Alexa Fluor 488 fluorescence with a cell sorter (MoFlo Beckman Coulter) (B) Dissociated neural cells wereprepared as in (A) and sorted into four populations according to the intensity of the KOr fluorescence About 500 cells of each population wereplated per well at a density of 25 cellμl in a 96-well plate for neurosphere formation assay After 7 days of culture in medium containing EGF(BD Biosciences) and bFGF (Roche) the numbers of spheres in each well were determined

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 5 of 9

the process of NSC-to-neuron differentiation in develop-ing mouse brains we performed time-lapse imaging ofthe embryonic cerebral cortex of double Tg miceAs expected most of the orange cells in the double Tg

animals resided on the apical side of the cortex and thegreen cells were located on the cortical side Additionalfile 2 shows time-lapse images of the cerebral cortex ofa double Tg mouse generated by using nestinKOr line70 Although it is rather difficult to identify individual

orange cells on the apical side of the cortex because ofthe ubiquitous expression of the KOr transgene in theregion an orange-to-green fluorescence transition wasoccasionally observed in individual cells and a typicalexample is indicated by an arrow in Additional file 2The cortex of a double Tg mouse generated by using

nestinKOr line 55 is shown in Additional file 3 Thescattered distribution of KOr-positive cells made identi-fication of yellow cells much easier than in line 70

Figure 4 KOr fluorescence in the two neurogenic regions in the brains of adult nestinKOr mice Animals were genotyped at P2w bypolymerase chain reaction (PCR) with the primer pair ldquohKO-IntFrdquo (TGAAGTACTTCATGGACGGC) and ldquohKO-IntRrdquo (TGAACTGGCACTTGTGGTTG) Theresultant product was ~500 bp (A) Fixed brains of P8w nestinKOr Tg mice were cut into 40-μm sections with a Vibratome (Leica) andfluorescent micrography was performed with an ApoTome fluorescence microscope and the AxioVision software (Zeiss) (B) Comparison of theKOr fluorescence and the distribution of the Nestin protein around the lateral ventricle (LV top panels) and at the dorsolateral corner (DLCbottom panels) The slices were prepared essentially as in (A) and immunohistochemistry was performed as described in Figure 2 Scale bar 200μm (top row) and 100 μm (bottom row)

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 6 of 9

Taken together these results demonstrate that thecolor of the fluorescence that neural cells emit uponexcitation actually does change from orange to greenduring neuronal differentiationTransition from orange-to-green fluorescence inneurospheres derived from cerebral cortices of nestinKOr- DCX-EGFP double Tg embryosAs mentioned above NSCs cultured in suspension inthe presence of growth factors such as EGF and bFGFproliferate and form floating masses of cells called neu-rospheres Since the cells undergo differentiation in par-allel with self-renewal practically all neurospheresconsist of mixtures of different types of neural cellsincluding NSCs neurons and glia To determinewhether it would be possible to visualize the differentia-tion of NSCs into neurons in neurospheres as well wealso performed time-lapse imaging of neurospheres pre-pared from the cerebral cortices of E145 double Tgembryos with line 70 of nestinKOr (Additional file 4)In most of the spheres the majority of the orange sig-

nals were found in the middle with green cells sur-rounding them although the distribution of fluorescentcolors was reversed (green inside and red outside) in

some spheres Yellow cells which are presumably in theNSC-to-neuron transition phase were also observedTransition from orange-to-green fluorescence along therostral migratory stream of adult nestinKOr - DCX-EGFPdouble Tg miceNewborn neurons generated in the SVZ of the adultmouse brain migrate to the olfactory bulb and in theprocess they give rise to a characteristic formation calledthe rostral migratory stream (RMS) along which theyundergo neuronal maturation Since the RMS shouldprovide another suitable system for investigating therelationship between neuronal differentiation and thetransition between fluorescence colors in the double Tgmice we examined the LV of an adult double Tg mousefor fluorescence (Figure 5)KOr fluorescence was most intense along the wall of

the LV and as cells migrated and passed the dorsolat-eral corner the KOr fluorescence gradually diminishedand became diffuseThe green fluorescence of EGFP on the other hand

was relatively weak around the LV but suddenly becameintense as the cells approached the dorsolateral cornerand it remained intense for some distance Strong yellow

Figure 5 Transition from orange to green fluorescence in RMS of adult nestinKOr - DCX-EGFP double Tg Animals were genotyped atP2w by PCR with the KOr-specific primer pair (above) and a GFP-specific primer pair ldquoGFP-IntF3rdquo (GCACGACTTCTTCAAGTCCGCCATGCC) andldquoGFP-IntR3rdquo (GCGGATCTTGAAGTTCACCTTGATGCC) The size of the PCR product for GFP was 265 bp Nestin IHC was performed with the sameprimary Ab as in Figure 2 and an Alexa 350-conjugated anti-mouse secondary Ab (Jackson ImmunoResearch 1250) Scale bar 100 μm

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 7 of 9

signals corresponding to cells in which both KOr andEGFP were present were clustered at the dorsolateralcornerThese observations confirmed the expected orange-to-

green fluorescence transition during neuronal differen-tiation in the adult mouse brainBased on all of these findings taken together we con-

cluded that the transition between fluorescent colorsfrom orange to green reflects NSC-to-neuron differen-tiation in both the embryonic brain and the adult brainthereby demonstrating the usefulness of these animalsas an NSC-to-neuron reporterThe pioneering work by Chalfie and colleagues clearly

showed the great potential of GFP as a reporter for real-time identification of a specific cell type [15] Duringthe 15 years since then thanks to the efforts of severallaboratories the FP repertoire has been expanded to thepoint that it now not only spans the visible spectrumbut also extends beyond it By combining different colorFPs with a number of cell-type-specific gene regulatoryelements that have been identified to date we have beentrying to establish mouse systems in which neural cellscan ldquotell what they arerdquo by the color of the fluorescencethey emitBased on the findings described above we concluded

that this two-color initial version of the ldquoColor Timerrdquomouse system as well as the more-advanced multi-colorversions that we are currently generating will provide apowerful new tool for neurogenesis research

Additional file 1 Spectral characteristics of KOr and EGFP Thenumerical data for the KOr spectra were obtained at httpsruomblcojpproductflproteinkohtmlClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S1PNG ]

Additional file 2 Transition from orange to green fluorescence inthe cerebral cortex of embryonic nestinKOr (line 70) - DCX-EGFPdouble Tg mice Cerebral cortices of E145 double Tg mice with line 70of nestinKOr were isolated manually cut with a knife embedded in acollagen (Nitta Gelatin) matrix and time-lapse imaged with an LSM5PASCAL fluorescence microscope (Zeiss) The 543-nm HeNe laser and488-nm Argon laser were used to excite KOr and EGFP respectively Thecell indicated by the arrow is a representative example of the orange-to-green transitionClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S2MOV ]

Additional file 3 Transition from orange to green fluorescence innestinKOr (line 55) - DCX-EGFP double Tg mice The cerebral cortexof an E145 double Tg mouse embryo with line 55 of nestinKOr wastime-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S3MOV ]

Additional file 4 Transition from orange to green fluorescence inneurospheres derived from cerebral cortex of embryonic nestinKOr(Line 70) - DCX-EGFP double Tg Cerebral cortices of E145 double Tgmouse embryos with line 70 of nestinKOr were isolated dissociated

into individual cells by mechanical pipetting cultured for several days ina medium containing EGF and bFGF and time-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S4MOV ]

AcknowledgementsWe are grateful to Dr Masahiro Yamaguchi (U of Tokyo Japan) for thenestin promoter-enhancer construct to Molecular Biological Laboratories(MBL Nagoya Japan) for the KOr cDNA and the numerical data for the KOrspectra to the GENSAT Project for the DCX-EGFP BAC Tg mice and to theldquoTamago Clubrdquo of the Research Resource Center of RIKEN BSI formicroinjection of the nestinKO transgene DNA fragment We are indebtedto Yoichi ldquoYotanrdquo Imaizumi for his advice in regard to theimmunohistochemical analyses to Sadafumi Suzuki and Dr Yumi Matsuzakifor their help with cell sorting to Chikako Hara for her help with preparingAdditional file 1 and to Satoshi Suyama Franccedilois Renault-Mihara andChikako Hara for their advice in regard to time-lapse imaging We also thankother members of the Okano and Miyawaki laboratories in particular themembers of the Adult Neurogenesis Group (Minashigosrdquo) of the former fordiscussions advice encouragement andor entertainment throughout thisstudy This work has been supported by grants from the Ministry ofEducation Culture Sports Science and Technology (MEXT to HO to HK)and from RIKEN BSI (to AM)

Author details1Department of Physiology Keio University School of Medicine 35Shinanomachi Shinjuku-ku Tokyo 160-8582 Japan 2Laboratory for CellFunction Dynamics Advanced Technology Development Core Brain ScienceInstitute (BSI) Institute of Physical and Chemical Research (RIKEN) 2-1Hirosawa Wako-shi Saitama 351-0198 Japan 3Current addressDepartamento de Histologia e Embriologia Instituto de Ciecircncias BiomeacutedicasUniversidade Federal do Rio de Janeiro (UFRJ) Rio de Janeiro Brazil

Authorsrsquo contributionsHK designed the project performed experiments analyzed data preparedfigures and wrote the manuscript MKS performed experiments analyzeddata and prepared figures AM contributed to the original experimentaldesign to generate the nestinKOr Tg mice and gave various suggestions onfluorescent reporter proteins and their combinatory usages HO providedfinancial supports for the experiments (except for nestinKOr micegeneration) and supervised the project All authors read and approved thefinal manuscript

Competing interestsThe authors declare that they have no competing interests

Received 6 January 2010Accepted 2 February 2010 Published 2 February 2010

References1 Shimomura O Johnson FH Saiga Y Extraction purification and properties

of aequorin a bioluminescent protein from the luminoushydromedusan Aequorea J Cell Comp Physiol 1962 59223-239

2 Prasher DC Eckenrode VK Ward WW Prendergast FG Cormier MJ Primarystructure of the Aequorea victoria green-fluorescent protein Gene 1992111229-233

3 Nowotschin S Eakin GS Hadjantonakis AK Live-imaging fluorescentproteins in mouse embryos multi-dimensional multi-spectralperspectives Trends in Biotechnol 2009 27266-276

4 Livet J Weissman TA Kang H Draft RW Lu J Bennis RA Sanes JRLichtman JW Transgenic strategies for combinatorial expression offluorescent proteins in the nervous system Nature 2007 45056-62

5 Gilyarov AV Nestin in central nervous system cells Neurosci Behav Physiol2008 38165-169

6 Zimmerman L Lendahl U Cunningham M McKay R Parr B Gavin BMann J Vassileva G McMahon A Independent regulatory elements in the

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 8 of 9

The orange fluorescence of KOr was easily detected inthe DG of the brains of nestinKOr Tg mice (Figure4A) The same as in the embryonic brains there werefewer KOr-positive cells in line 55 Among the otherthree lines the intensity of the KOr signals was againhighest in line 70In the other neurogenic area the SVZ the KOr fluor-

escence signals were distributed along the wall of theLV (Figure 4B) This pattern closely overlapped the pat-tern of distribution of immunohistochemically-detectedNestin protein especially at the dorsolateral corner (bot-tom panels)Taken together these findings confirmed the useful-

ness of nestinKOr Tg mouse line 70 as an NSCreporternestinKOr - DCX-EGFP double Tg mice the first versionof the ldquoColor Timerrdquo mouseWe then considered which mouse line to use to fluores-cence label neurons With our future plan to separateneurons into immature and mature subpopulations inmind we searched for a good specific marker for imma-ture neuronsAmong the several candidates we considered we

selected Doublecortin (DCX) a ~45-kDa microtubule-associated protein already being widely used as a markerfor immature neurons The usefulness of DCX as a mar-ker of immature neurons has been clearly demonstrated

by the immunohistochemical work of the Aigner labora-tory [12]In addition to several conventional Tg mouse lines a

Tg mouse line with a bacterial artificial chromosome(BAC) backbone containing the genomic region aroundthe mouse DCX gene was generated by the GENSATproject whose mission is to construct an array of EGFPreporter mice by using BAC backbones with genesexpressed in the nervous system [13] This DCX-EGFPBAC Tg mouse line was used to confirm that the inten-sity of EGFP which reflects the amount of the DCXprotein within the cell can be used as an indicator ofneuronal maturation which confirmed the usefulness ofthis mouse line as a reporter for neurons [14] By com-bining this mouse line with the nestinKOr Tg that wehad generated we hoped to be able to establish a mousesystem in which the NSC-to-immature neuron differen-tiation could be visualized as a transition from orangeto green fluorescenceDouble Tg mice were obtained by crossing nestinKOr

and DCX-EGFP animals both of which were heterozy-gous according to the Mendelian ratio as expectedVisualization of NSC-to-neuron differentiation by thetransition from orange-to-green fluorescence in thecerebral cortex of double Tg mouse embryosTo determine whether the expected transition fromorange-to-green fluorescence actually occurred during

Figure 3 Correlation between KOr intensity and nestin expression levels or ldquostemnessrdquo (A) Dissociated neural cells were prepared fromthe cerebral cortices of E145 nestinKOr embryos and immunocytochemically labeled for Nestin by using the same anti-Nestin primary Abdescribed in Figure 2 and an Alexa Fluor 488-conjugated goat anti-mouse secondary Ab (Jackson ImmunoResearch 1250) The processed cellswere then analyzed for KOr and Alexa Fluor 488 fluorescence with a cell sorter (MoFlo Beckman Coulter) (B) Dissociated neural cells wereprepared as in (A) and sorted into four populations according to the intensity of the KOr fluorescence About 500 cells of each population wereplated per well at a density of 25 cellμl in a 96-well plate for neurosphere formation assay After 7 days of culture in medium containing EGF(BD Biosciences) and bFGF (Roche) the numbers of spheres in each well were determined

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 5 of 9

the process of NSC-to-neuron differentiation in develop-ing mouse brains we performed time-lapse imaging ofthe embryonic cerebral cortex of double Tg miceAs expected most of the orange cells in the double Tg

animals resided on the apical side of the cortex and thegreen cells were located on the cortical side Additionalfile 2 shows time-lapse images of the cerebral cortex ofa double Tg mouse generated by using nestinKOr line70 Although it is rather difficult to identify individual

orange cells on the apical side of the cortex because ofthe ubiquitous expression of the KOr transgene in theregion an orange-to-green fluorescence transition wasoccasionally observed in individual cells and a typicalexample is indicated by an arrow in Additional file 2The cortex of a double Tg mouse generated by using

nestinKOr line 55 is shown in Additional file 3 Thescattered distribution of KOr-positive cells made identi-fication of yellow cells much easier than in line 70

Figure 4 KOr fluorescence in the two neurogenic regions in the brains of adult nestinKOr mice Animals were genotyped at P2w bypolymerase chain reaction (PCR) with the primer pair ldquohKO-IntFrdquo (TGAAGTACTTCATGGACGGC) and ldquohKO-IntRrdquo (TGAACTGGCACTTGTGGTTG) Theresultant product was ~500 bp (A) Fixed brains of P8w nestinKOr Tg mice were cut into 40-μm sections with a Vibratome (Leica) andfluorescent micrography was performed with an ApoTome fluorescence microscope and the AxioVision software (Zeiss) (B) Comparison of theKOr fluorescence and the distribution of the Nestin protein around the lateral ventricle (LV top panels) and at the dorsolateral corner (DLCbottom panels) The slices were prepared essentially as in (A) and immunohistochemistry was performed as described in Figure 2 Scale bar 200μm (top row) and 100 μm (bottom row)

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 6 of 9

Taken together these results demonstrate that thecolor of the fluorescence that neural cells emit uponexcitation actually does change from orange to greenduring neuronal differentiationTransition from orange-to-green fluorescence inneurospheres derived from cerebral cortices of nestinKOr- DCX-EGFP double Tg embryosAs mentioned above NSCs cultured in suspension inthe presence of growth factors such as EGF and bFGFproliferate and form floating masses of cells called neu-rospheres Since the cells undergo differentiation in par-allel with self-renewal practically all neurospheresconsist of mixtures of different types of neural cellsincluding NSCs neurons and glia To determinewhether it would be possible to visualize the differentia-tion of NSCs into neurons in neurospheres as well wealso performed time-lapse imaging of neurospheres pre-pared from the cerebral cortices of E145 double Tgembryos with line 70 of nestinKOr (Additional file 4)In most of the spheres the majority of the orange sig-

nals were found in the middle with green cells sur-rounding them although the distribution of fluorescentcolors was reversed (green inside and red outside) in

some spheres Yellow cells which are presumably in theNSC-to-neuron transition phase were also observedTransition from orange-to-green fluorescence along therostral migratory stream of adult nestinKOr - DCX-EGFPdouble Tg miceNewborn neurons generated in the SVZ of the adultmouse brain migrate to the olfactory bulb and in theprocess they give rise to a characteristic formation calledthe rostral migratory stream (RMS) along which theyundergo neuronal maturation Since the RMS shouldprovide another suitable system for investigating therelationship between neuronal differentiation and thetransition between fluorescence colors in the double Tgmice we examined the LV of an adult double Tg mousefor fluorescence (Figure 5)KOr fluorescence was most intense along the wall of

the LV and as cells migrated and passed the dorsolat-eral corner the KOr fluorescence gradually diminishedand became diffuseThe green fluorescence of EGFP on the other hand

was relatively weak around the LV but suddenly becameintense as the cells approached the dorsolateral cornerand it remained intense for some distance Strong yellow

Figure 5 Transition from orange to green fluorescence in RMS of adult nestinKOr - DCX-EGFP double Tg Animals were genotyped atP2w by PCR with the KOr-specific primer pair (above) and a GFP-specific primer pair ldquoGFP-IntF3rdquo (GCACGACTTCTTCAAGTCCGCCATGCC) andldquoGFP-IntR3rdquo (GCGGATCTTGAAGTTCACCTTGATGCC) The size of the PCR product for GFP was 265 bp Nestin IHC was performed with the sameprimary Ab as in Figure 2 and an Alexa 350-conjugated anti-mouse secondary Ab (Jackson ImmunoResearch 1250) Scale bar 100 μm

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 7 of 9

signals corresponding to cells in which both KOr andEGFP were present were clustered at the dorsolateralcornerThese observations confirmed the expected orange-to-

green fluorescence transition during neuronal differen-tiation in the adult mouse brainBased on all of these findings taken together we con-

cluded that the transition between fluorescent colorsfrom orange to green reflects NSC-to-neuron differen-tiation in both the embryonic brain and the adult brainthereby demonstrating the usefulness of these animalsas an NSC-to-neuron reporterThe pioneering work by Chalfie and colleagues clearly

showed the great potential of GFP as a reporter for real-time identification of a specific cell type [15] Duringthe 15 years since then thanks to the efforts of severallaboratories the FP repertoire has been expanded to thepoint that it now not only spans the visible spectrumbut also extends beyond it By combining different colorFPs with a number of cell-type-specific gene regulatoryelements that have been identified to date we have beentrying to establish mouse systems in which neural cellscan ldquotell what they arerdquo by the color of the fluorescencethey emitBased on the findings described above we concluded

that this two-color initial version of the ldquoColor Timerrdquomouse system as well as the more-advanced multi-colorversions that we are currently generating will provide apowerful new tool for neurogenesis research

Additional file 1 Spectral characteristics of KOr and EGFP Thenumerical data for the KOr spectra were obtained at httpsruomblcojpproductflproteinkohtmlClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S1PNG ]

Additional file 2 Transition from orange to green fluorescence inthe cerebral cortex of embryonic nestinKOr (line 70) - DCX-EGFPdouble Tg mice Cerebral cortices of E145 double Tg mice with line 70of nestinKOr were isolated manually cut with a knife embedded in acollagen (Nitta Gelatin) matrix and time-lapse imaged with an LSM5PASCAL fluorescence microscope (Zeiss) The 543-nm HeNe laser and488-nm Argon laser were used to excite KOr and EGFP respectively Thecell indicated by the arrow is a representative example of the orange-to-green transitionClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S2MOV ]

Additional file 3 Transition from orange to green fluorescence innestinKOr (line 55) - DCX-EGFP double Tg mice The cerebral cortexof an E145 double Tg mouse embryo with line 55 of nestinKOr wastime-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S3MOV ]

Additional file 4 Transition from orange to green fluorescence inneurospheres derived from cerebral cortex of embryonic nestinKOr(Line 70) - DCX-EGFP double Tg Cerebral cortices of E145 double Tgmouse embryos with line 70 of nestinKOr were isolated dissociated

into individual cells by mechanical pipetting cultured for several days ina medium containing EGF and bFGF and time-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S4MOV ]

AcknowledgementsWe are grateful to Dr Masahiro Yamaguchi (U of Tokyo Japan) for thenestin promoter-enhancer construct to Molecular Biological Laboratories(MBL Nagoya Japan) for the KOr cDNA and the numerical data for the KOrspectra to the GENSAT Project for the DCX-EGFP BAC Tg mice and to theldquoTamago Clubrdquo of the Research Resource Center of RIKEN BSI formicroinjection of the nestinKO transgene DNA fragment We are indebtedto Yoichi ldquoYotanrdquo Imaizumi for his advice in regard to theimmunohistochemical analyses to Sadafumi Suzuki and Dr Yumi Matsuzakifor their help with cell sorting to Chikako Hara for her help with preparingAdditional file 1 and to Satoshi Suyama Franccedilois Renault-Mihara andChikako Hara for their advice in regard to time-lapse imaging We also thankother members of the Okano and Miyawaki laboratories in particular themembers of the Adult Neurogenesis Group (Minashigosrdquo) of the former fordiscussions advice encouragement andor entertainment throughout thisstudy This work has been supported by grants from the Ministry ofEducation Culture Sports Science and Technology (MEXT to HO to HK)and from RIKEN BSI (to AM)

Author details1Department of Physiology Keio University School of Medicine 35Shinanomachi Shinjuku-ku Tokyo 160-8582 Japan 2Laboratory for CellFunction Dynamics Advanced Technology Development Core Brain ScienceInstitute (BSI) Institute of Physical and Chemical Research (RIKEN) 2-1Hirosawa Wako-shi Saitama 351-0198 Japan 3Current addressDepartamento de Histologia e Embriologia Instituto de Ciecircncias BiomeacutedicasUniversidade Federal do Rio de Janeiro (UFRJ) Rio de Janeiro Brazil

Authorsrsquo contributionsHK designed the project performed experiments analyzed data preparedfigures and wrote the manuscript MKS performed experiments analyzeddata and prepared figures AM contributed to the original experimentaldesign to generate the nestinKOr Tg mice and gave various suggestions onfluorescent reporter proteins and their combinatory usages HO providedfinancial supports for the experiments (except for nestinKOr micegeneration) and supervised the project All authors read and approved thefinal manuscript

Competing interestsThe authors declare that they have no competing interests

Received 6 January 2010Accepted 2 February 2010 Published 2 February 2010

References1 Shimomura O Johnson FH Saiga Y Extraction purification and properties

of aequorin a bioluminescent protein from the luminoushydromedusan Aequorea J Cell Comp Physiol 1962 59223-239

2 Prasher DC Eckenrode VK Ward WW Prendergast FG Cormier MJ Primarystructure of the Aequorea victoria green-fluorescent protein Gene 1992111229-233

3 Nowotschin S Eakin GS Hadjantonakis AK Live-imaging fluorescentproteins in mouse embryos multi-dimensional multi-spectralperspectives Trends in Biotechnol 2009 27266-276

4 Livet J Weissman TA Kang H Draft RW Lu J Bennis RA Sanes JRLichtman JW Transgenic strategies for combinatorial expression offluorescent proteins in the nervous system Nature 2007 45056-62

5 Gilyarov AV Nestin in central nervous system cells Neurosci Behav Physiol2008 38165-169

6 Zimmerman L Lendahl U Cunningham M McKay R Parr B Gavin BMann J Vassileva G McMahon A Independent regulatory elements in the

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 8 of 9

the process of NSC-to-neuron differentiation in develop-ing mouse brains we performed time-lapse imaging ofthe embryonic cerebral cortex of double Tg miceAs expected most of the orange cells in the double Tg

animals resided on the apical side of the cortex and thegreen cells were located on the cortical side Additionalfile 2 shows time-lapse images of the cerebral cortex ofa double Tg mouse generated by using nestinKOr line70 Although it is rather difficult to identify individual

orange cells on the apical side of the cortex because ofthe ubiquitous expression of the KOr transgene in theregion an orange-to-green fluorescence transition wasoccasionally observed in individual cells and a typicalexample is indicated by an arrow in Additional file 2The cortex of a double Tg mouse generated by using

nestinKOr line 55 is shown in Additional file 3 Thescattered distribution of KOr-positive cells made identi-fication of yellow cells much easier than in line 70

Figure 4 KOr fluorescence in the two neurogenic regions in the brains of adult nestinKOr mice Animals were genotyped at P2w bypolymerase chain reaction (PCR) with the primer pair ldquohKO-IntFrdquo (TGAAGTACTTCATGGACGGC) and ldquohKO-IntRrdquo (TGAACTGGCACTTGTGGTTG) Theresultant product was ~500 bp (A) Fixed brains of P8w nestinKOr Tg mice were cut into 40-μm sections with a Vibratome (Leica) andfluorescent micrography was performed with an ApoTome fluorescence microscope and the AxioVision software (Zeiss) (B) Comparison of theKOr fluorescence and the distribution of the Nestin protein around the lateral ventricle (LV top panels) and at the dorsolateral corner (DLCbottom panels) The slices were prepared essentially as in (A) and immunohistochemistry was performed as described in Figure 2 Scale bar 200μm (top row) and 100 μm (bottom row)

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 6 of 9

Taken together these results demonstrate that thecolor of the fluorescence that neural cells emit uponexcitation actually does change from orange to greenduring neuronal differentiationTransition from orange-to-green fluorescence inneurospheres derived from cerebral cortices of nestinKOr- DCX-EGFP double Tg embryosAs mentioned above NSCs cultured in suspension inthe presence of growth factors such as EGF and bFGFproliferate and form floating masses of cells called neu-rospheres Since the cells undergo differentiation in par-allel with self-renewal practically all neurospheresconsist of mixtures of different types of neural cellsincluding NSCs neurons and glia To determinewhether it would be possible to visualize the differentia-tion of NSCs into neurons in neurospheres as well wealso performed time-lapse imaging of neurospheres pre-pared from the cerebral cortices of E145 double Tgembryos with line 70 of nestinKOr (Additional file 4)In most of the spheres the majority of the orange sig-

nals were found in the middle with green cells sur-rounding them although the distribution of fluorescentcolors was reversed (green inside and red outside) in

some spheres Yellow cells which are presumably in theNSC-to-neuron transition phase were also observedTransition from orange-to-green fluorescence along therostral migratory stream of adult nestinKOr - DCX-EGFPdouble Tg miceNewborn neurons generated in the SVZ of the adultmouse brain migrate to the olfactory bulb and in theprocess they give rise to a characteristic formation calledthe rostral migratory stream (RMS) along which theyundergo neuronal maturation Since the RMS shouldprovide another suitable system for investigating therelationship between neuronal differentiation and thetransition between fluorescence colors in the double Tgmice we examined the LV of an adult double Tg mousefor fluorescence (Figure 5)KOr fluorescence was most intense along the wall of

the LV and as cells migrated and passed the dorsolat-eral corner the KOr fluorescence gradually diminishedand became diffuseThe green fluorescence of EGFP on the other hand

was relatively weak around the LV but suddenly becameintense as the cells approached the dorsolateral cornerand it remained intense for some distance Strong yellow

Figure 5 Transition from orange to green fluorescence in RMS of adult nestinKOr - DCX-EGFP double Tg Animals were genotyped atP2w by PCR with the KOr-specific primer pair (above) and a GFP-specific primer pair ldquoGFP-IntF3rdquo (GCACGACTTCTTCAAGTCCGCCATGCC) andldquoGFP-IntR3rdquo (GCGGATCTTGAAGTTCACCTTGATGCC) The size of the PCR product for GFP was 265 bp Nestin IHC was performed with the sameprimary Ab as in Figure 2 and an Alexa 350-conjugated anti-mouse secondary Ab (Jackson ImmunoResearch 1250) Scale bar 100 μm

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 7 of 9

signals corresponding to cells in which both KOr andEGFP were present were clustered at the dorsolateralcornerThese observations confirmed the expected orange-to-

green fluorescence transition during neuronal differen-tiation in the adult mouse brainBased on all of these findings taken together we con-

cluded that the transition between fluorescent colorsfrom orange to green reflects NSC-to-neuron differen-tiation in both the embryonic brain and the adult brainthereby demonstrating the usefulness of these animalsas an NSC-to-neuron reporterThe pioneering work by Chalfie and colleagues clearly

showed the great potential of GFP as a reporter for real-time identification of a specific cell type [15] Duringthe 15 years since then thanks to the efforts of severallaboratories the FP repertoire has been expanded to thepoint that it now not only spans the visible spectrumbut also extends beyond it By combining different colorFPs with a number of cell-type-specific gene regulatoryelements that have been identified to date we have beentrying to establish mouse systems in which neural cellscan ldquotell what they arerdquo by the color of the fluorescencethey emitBased on the findings described above we concluded

that this two-color initial version of the ldquoColor Timerrdquomouse system as well as the more-advanced multi-colorversions that we are currently generating will provide apowerful new tool for neurogenesis research

Additional file 1 Spectral characteristics of KOr and EGFP Thenumerical data for the KOr spectra were obtained at httpsruomblcojpproductflproteinkohtmlClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S1PNG ]

Additional file 2 Transition from orange to green fluorescence inthe cerebral cortex of embryonic nestinKOr (line 70) - DCX-EGFPdouble Tg mice Cerebral cortices of E145 double Tg mice with line 70of nestinKOr were isolated manually cut with a knife embedded in acollagen (Nitta Gelatin) matrix and time-lapse imaged with an LSM5PASCAL fluorescence microscope (Zeiss) The 543-nm HeNe laser and488-nm Argon laser were used to excite KOr and EGFP respectively Thecell indicated by the arrow is a representative example of the orange-to-green transitionClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S2MOV ]

Additional file 3 Transition from orange to green fluorescence innestinKOr (line 55) - DCX-EGFP double Tg mice The cerebral cortexof an E145 double Tg mouse embryo with line 55 of nestinKOr wastime-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S3MOV ]

Additional file 4 Transition from orange to green fluorescence inneurospheres derived from cerebral cortex of embryonic nestinKOr(Line 70) - DCX-EGFP double Tg Cerebral cortices of E145 double Tgmouse embryos with line 70 of nestinKOr were isolated dissociated

into individual cells by mechanical pipetting cultured for several days ina medium containing EGF and bFGF and time-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S4MOV ]

AcknowledgementsWe are grateful to Dr Masahiro Yamaguchi (U of Tokyo Japan) for thenestin promoter-enhancer construct to Molecular Biological Laboratories(MBL Nagoya Japan) for the KOr cDNA and the numerical data for the KOrspectra to the GENSAT Project for the DCX-EGFP BAC Tg mice and to theldquoTamago Clubrdquo of the Research Resource Center of RIKEN BSI formicroinjection of the nestinKO transgene DNA fragment We are indebtedto Yoichi ldquoYotanrdquo Imaizumi for his advice in regard to theimmunohistochemical analyses to Sadafumi Suzuki and Dr Yumi Matsuzakifor their help with cell sorting to Chikako Hara for her help with preparingAdditional file 1 and to Satoshi Suyama Franccedilois Renault-Mihara andChikako Hara for their advice in regard to time-lapse imaging We also thankother members of the Okano and Miyawaki laboratories in particular themembers of the Adult Neurogenesis Group (Minashigosrdquo) of the former fordiscussions advice encouragement andor entertainment throughout thisstudy This work has been supported by grants from the Ministry ofEducation Culture Sports Science and Technology (MEXT to HO to HK)and from RIKEN BSI (to AM)

Author details1Department of Physiology Keio University School of Medicine 35Shinanomachi Shinjuku-ku Tokyo 160-8582 Japan 2Laboratory for CellFunction Dynamics Advanced Technology Development Core Brain ScienceInstitute (BSI) Institute of Physical and Chemical Research (RIKEN) 2-1Hirosawa Wako-shi Saitama 351-0198 Japan 3Current addressDepartamento de Histologia e Embriologia Instituto de Ciecircncias BiomeacutedicasUniversidade Federal do Rio de Janeiro (UFRJ) Rio de Janeiro Brazil

Authorsrsquo contributionsHK designed the project performed experiments analyzed data preparedfigures and wrote the manuscript MKS performed experiments analyzeddata and prepared figures AM contributed to the original experimentaldesign to generate the nestinKOr Tg mice and gave various suggestions onfluorescent reporter proteins and their combinatory usages HO providedfinancial supports for the experiments (except for nestinKOr micegeneration) and supervised the project All authors read and approved thefinal manuscript

Competing interestsThe authors declare that they have no competing interests

Received 6 January 2010Accepted 2 February 2010 Published 2 February 2010

References1 Shimomura O Johnson FH Saiga Y Extraction purification and properties

of aequorin a bioluminescent protein from the luminoushydromedusan Aequorea J Cell Comp Physiol 1962 59223-239

2 Prasher DC Eckenrode VK Ward WW Prendergast FG Cormier MJ Primarystructure of the Aequorea victoria green-fluorescent protein Gene 1992111229-233

3 Nowotschin S Eakin GS Hadjantonakis AK Live-imaging fluorescentproteins in mouse embryos multi-dimensional multi-spectralperspectives Trends in Biotechnol 2009 27266-276

4 Livet J Weissman TA Kang H Draft RW Lu J Bennis RA Sanes JRLichtman JW Transgenic strategies for combinatorial expression offluorescent proteins in the nervous system Nature 2007 45056-62

5 Gilyarov AV Nestin in central nervous system cells Neurosci Behav Physiol2008 38165-169

6 Zimmerman L Lendahl U Cunningham M McKay R Parr B Gavin BMann J Vassileva G McMahon A Independent regulatory elements in the

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 8 of 9

Taken together these results demonstrate that thecolor of the fluorescence that neural cells emit uponexcitation actually does change from orange to greenduring neuronal differentiationTransition from orange-to-green fluorescence inneurospheres derived from cerebral cortices of nestinKOr- DCX-EGFP double Tg embryosAs mentioned above NSCs cultured in suspension inthe presence of growth factors such as EGF and bFGFproliferate and form floating masses of cells called neu-rospheres Since the cells undergo differentiation in par-allel with self-renewal practically all neurospheresconsist of mixtures of different types of neural cellsincluding NSCs neurons and glia To determinewhether it would be possible to visualize the differentia-tion of NSCs into neurons in neurospheres as well wealso performed time-lapse imaging of neurospheres pre-pared from the cerebral cortices of E145 double Tgembryos with line 70 of nestinKOr (Additional file 4)In most of the spheres the majority of the orange sig-

nals were found in the middle with green cells sur-rounding them although the distribution of fluorescentcolors was reversed (green inside and red outside) in

some spheres Yellow cells which are presumably in theNSC-to-neuron transition phase were also observedTransition from orange-to-green fluorescence along therostral migratory stream of adult nestinKOr - DCX-EGFPdouble Tg miceNewborn neurons generated in the SVZ of the adultmouse brain migrate to the olfactory bulb and in theprocess they give rise to a characteristic formation calledthe rostral migratory stream (RMS) along which theyundergo neuronal maturation Since the RMS shouldprovide another suitable system for investigating therelationship between neuronal differentiation and thetransition between fluorescence colors in the double Tgmice we examined the LV of an adult double Tg mousefor fluorescence (Figure 5)KOr fluorescence was most intense along the wall of

the LV and as cells migrated and passed the dorsolat-eral corner the KOr fluorescence gradually diminishedand became diffuseThe green fluorescence of EGFP on the other hand

was relatively weak around the LV but suddenly becameintense as the cells approached the dorsolateral cornerand it remained intense for some distance Strong yellow

Figure 5 Transition from orange to green fluorescence in RMS of adult nestinKOr - DCX-EGFP double Tg Animals were genotyped atP2w by PCR with the KOr-specific primer pair (above) and a GFP-specific primer pair ldquoGFP-IntF3rdquo (GCACGACTTCTTCAAGTCCGCCATGCC) andldquoGFP-IntR3rdquo (GCGGATCTTGAAGTTCACCTTGATGCC) The size of the PCR product for GFP was 265 bp Nestin IHC was performed with the sameprimary Ab as in Figure 2 and an Alexa 350-conjugated anti-mouse secondary Ab (Jackson ImmunoResearch 1250) Scale bar 100 μm

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 7 of 9

signals corresponding to cells in which both KOr andEGFP were present were clustered at the dorsolateralcornerThese observations confirmed the expected orange-to-

green fluorescence transition during neuronal differen-tiation in the adult mouse brainBased on all of these findings taken together we con-

cluded that the transition between fluorescent colorsfrom orange to green reflects NSC-to-neuron differen-tiation in both the embryonic brain and the adult brainthereby demonstrating the usefulness of these animalsas an NSC-to-neuron reporterThe pioneering work by Chalfie and colleagues clearly

showed the great potential of GFP as a reporter for real-time identification of a specific cell type [15] Duringthe 15 years since then thanks to the efforts of severallaboratories the FP repertoire has been expanded to thepoint that it now not only spans the visible spectrumbut also extends beyond it By combining different colorFPs with a number of cell-type-specific gene regulatoryelements that have been identified to date we have beentrying to establish mouse systems in which neural cellscan ldquotell what they arerdquo by the color of the fluorescencethey emitBased on the findings described above we concluded

that this two-color initial version of the ldquoColor Timerrdquomouse system as well as the more-advanced multi-colorversions that we are currently generating will provide apowerful new tool for neurogenesis research

Additional file 1 Spectral characteristics of KOr and EGFP Thenumerical data for the KOr spectra were obtained at httpsruomblcojpproductflproteinkohtmlClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S1PNG ]

Additional file 2 Transition from orange to green fluorescence inthe cerebral cortex of embryonic nestinKOr (line 70) - DCX-EGFPdouble Tg mice Cerebral cortices of E145 double Tg mice with line 70of nestinKOr were isolated manually cut with a knife embedded in acollagen (Nitta Gelatin) matrix and time-lapse imaged with an LSM5PASCAL fluorescence microscope (Zeiss) The 543-nm HeNe laser and488-nm Argon laser were used to excite KOr and EGFP respectively Thecell indicated by the arrow is a representative example of the orange-to-green transitionClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S2MOV ]

Additional file 3 Transition from orange to green fluorescence innestinKOr (line 55) - DCX-EGFP double Tg mice The cerebral cortexof an E145 double Tg mouse embryo with line 55 of nestinKOr wastime-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S3MOV ]

Additional file 4 Transition from orange to green fluorescence inneurospheres derived from cerebral cortex of embryonic nestinKOr(Line 70) - DCX-EGFP double Tg Cerebral cortices of E145 double Tgmouse embryos with line 70 of nestinKOr were isolated dissociated

into individual cells by mechanical pipetting cultured for several days ina medium containing EGF and bFGF and time-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S4MOV ]

AcknowledgementsWe are grateful to Dr Masahiro Yamaguchi (U of Tokyo Japan) for thenestin promoter-enhancer construct to Molecular Biological Laboratories(MBL Nagoya Japan) for the KOr cDNA and the numerical data for the KOrspectra to the GENSAT Project for the DCX-EGFP BAC Tg mice and to theldquoTamago Clubrdquo of the Research Resource Center of RIKEN BSI formicroinjection of the nestinKO transgene DNA fragment We are indebtedto Yoichi ldquoYotanrdquo Imaizumi for his advice in regard to theimmunohistochemical analyses to Sadafumi Suzuki and Dr Yumi Matsuzakifor their help with cell sorting to Chikako Hara for her help with preparingAdditional file 1 and to Satoshi Suyama Franccedilois Renault-Mihara andChikako Hara for their advice in regard to time-lapse imaging We also thankother members of the Okano and Miyawaki laboratories in particular themembers of the Adult Neurogenesis Group (Minashigosrdquo) of the former fordiscussions advice encouragement andor entertainment throughout thisstudy This work has been supported by grants from the Ministry ofEducation Culture Sports Science and Technology (MEXT to HO to HK)and from RIKEN BSI (to AM)

Author details1Department of Physiology Keio University School of Medicine 35Shinanomachi Shinjuku-ku Tokyo 160-8582 Japan 2Laboratory for CellFunction Dynamics Advanced Technology Development Core Brain ScienceInstitute (BSI) Institute of Physical and Chemical Research (RIKEN) 2-1Hirosawa Wako-shi Saitama 351-0198 Japan 3Current addressDepartamento de Histologia e Embriologia Instituto de Ciecircncias BiomeacutedicasUniversidade Federal do Rio de Janeiro (UFRJ) Rio de Janeiro Brazil

Authorsrsquo contributionsHK designed the project performed experiments analyzed data preparedfigures and wrote the manuscript MKS performed experiments analyzeddata and prepared figures AM contributed to the original experimentaldesign to generate the nestinKOr Tg mice and gave various suggestions onfluorescent reporter proteins and their combinatory usages HO providedfinancial supports for the experiments (except for nestinKOr micegeneration) and supervised the project All authors read and approved thefinal manuscript

Competing interestsThe authors declare that they have no competing interests

Received 6 January 2010Accepted 2 February 2010 Published 2 February 2010

References1 Shimomura O Johnson FH Saiga Y Extraction purification and properties

of aequorin a bioluminescent protein from the luminoushydromedusan Aequorea J Cell Comp Physiol 1962 59223-239

2 Prasher DC Eckenrode VK Ward WW Prendergast FG Cormier MJ Primarystructure of the Aequorea victoria green-fluorescent protein Gene 1992111229-233

3 Nowotschin S Eakin GS Hadjantonakis AK Live-imaging fluorescentproteins in mouse embryos multi-dimensional multi-spectralperspectives Trends in Biotechnol 2009 27266-276

4 Livet J Weissman TA Kang H Draft RW Lu J Bennis RA Sanes JRLichtman JW Transgenic strategies for combinatorial expression offluorescent proteins in the nervous system Nature 2007 45056-62

5 Gilyarov AV Nestin in central nervous system cells Neurosci Behav Physiol2008 38165-169

6 Zimmerman L Lendahl U Cunningham M McKay R Parr B Gavin BMann J Vassileva G McMahon A Independent regulatory elements in the

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 8 of 9

signals corresponding to cells in which both KOr andEGFP were present were clustered at the dorsolateralcornerThese observations confirmed the expected orange-to-

green fluorescence transition during neuronal differen-tiation in the adult mouse brainBased on all of these findings taken together we con-

cluded that the transition between fluorescent colorsfrom orange to green reflects NSC-to-neuron differen-tiation in both the embryonic brain and the adult brainthereby demonstrating the usefulness of these animalsas an NSC-to-neuron reporterThe pioneering work by Chalfie and colleagues clearly

showed the great potential of GFP as a reporter for real-time identification of a specific cell type [15] Duringthe 15 years since then thanks to the efforts of severallaboratories the FP repertoire has been expanded to thepoint that it now not only spans the visible spectrumbut also extends beyond it By combining different colorFPs with a number of cell-type-specific gene regulatoryelements that have been identified to date we have beentrying to establish mouse systems in which neural cellscan ldquotell what they arerdquo by the color of the fluorescencethey emitBased on the findings described above we concluded

that this two-color initial version of the ldquoColor Timerrdquomouse system as well as the more-advanced multi-colorversions that we are currently generating will provide apowerful new tool for neurogenesis research

Additional file 1 Spectral characteristics of KOr and EGFP Thenumerical data for the KOr spectra were obtained at httpsruomblcojpproductflproteinkohtmlClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S1PNG ]

Additional file 2 Transition from orange to green fluorescence inthe cerebral cortex of embryonic nestinKOr (line 70) - DCX-EGFPdouble Tg mice Cerebral cortices of E145 double Tg mice with line 70of nestinKOr were isolated manually cut with a knife embedded in acollagen (Nitta Gelatin) matrix and time-lapse imaged with an LSM5PASCAL fluorescence microscope (Zeiss) The 543-nm HeNe laser and488-nm Argon laser were used to excite KOr and EGFP respectively Thecell indicated by the arrow is a representative example of the orange-to-green transitionClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S2MOV ]

Additional file 3 Transition from orange to green fluorescence innestinKOr (line 55) - DCX-EGFP double Tg mice The cerebral cortexof an E145 double Tg mouse embryo with line 55 of nestinKOr wastime-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S3MOV ]

Additional file 4 Transition from orange to green fluorescence inneurospheres derived from cerebral cortex of embryonic nestinKOr(Line 70) - DCX-EGFP double Tg Cerebral cortices of E145 double Tgmouse embryos with line 70 of nestinKOr were isolated dissociated

into individual cells by mechanical pipetting cultured for several days ina medium containing EGF and bFGF and time-lapse imagedClick here for file[ httpwwwbiomedcentralcomcontentsupplementary1756-6606-3-5-S4MOV ]

AcknowledgementsWe are grateful to Dr Masahiro Yamaguchi (U of Tokyo Japan) for thenestin promoter-enhancer construct to Molecular Biological Laboratories(MBL Nagoya Japan) for the KOr cDNA and the numerical data for the KOrspectra to the GENSAT Project for the DCX-EGFP BAC Tg mice and to theldquoTamago Clubrdquo of the Research Resource Center of RIKEN BSI formicroinjection of the nestinKO transgene DNA fragment We are indebtedto Yoichi ldquoYotanrdquo Imaizumi for his advice in regard to theimmunohistochemical analyses to Sadafumi Suzuki and Dr Yumi Matsuzakifor their help with cell sorting to Chikako Hara for her help with preparingAdditional file 1 and to Satoshi Suyama Franccedilois Renault-Mihara andChikako Hara for their advice in regard to time-lapse imaging We also thankother members of the Okano and Miyawaki laboratories in particular themembers of the Adult Neurogenesis Group (Minashigosrdquo) of the former fordiscussions advice encouragement andor entertainment throughout thisstudy This work has been supported by grants from the Ministry ofEducation Culture Sports Science and Technology (MEXT to HO to HK)and from RIKEN BSI (to AM)

Author details1Department of Physiology Keio University School of Medicine 35Shinanomachi Shinjuku-ku Tokyo 160-8582 Japan 2Laboratory for CellFunction Dynamics Advanced Technology Development Core Brain ScienceInstitute (BSI) Institute of Physical and Chemical Research (RIKEN) 2-1Hirosawa Wako-shi Saitama 351-0198 Japan 3Current addressDepartamento de Histologia e Embriologia Instituto de Ciecircncias BiomeacutedicasUniversidade Federal do Rio de Janeiro (UFRJ) Rio de Janeiro Brazil

Authorsrsquo contributionsHK designed the project performed experiments analyzed data preparedfigures and wrote the manuscript MKS performed experiments analyzeddata and prepared figures AM contributed to the original experimentaldesign to generate the nestinKOr Tg mice and gave various suggestions onfluorescent reporter proteins and their combinatory usages HO providedfinancial supports for the experiments (except for nestinKOr micegeneration) and supervised the project All authors read and approved thefinal manuscript

Competing interestsThe authors declare that they have no competing interests

Received 6 January 2010Accepted 2 February 2010 Published 2 February 2010

References1 Shimomura O Johnson FH Saiga Y Extraction purification and properties

of aequorin a bioluminescent protein from the luminoushydromedusan Aequorea J Cell Comp Physiol 1962 59223-239

2 Prasher DC Eckenrode VK Ward WW Prendergast FG Cormier MJ Primarystructure of the Aequorea victoria green-fluorescent protein Gene 1992111229-233

3 Nowotschin S Eakin GS Hadjantonakis AK Live-imaging fluorescentproteins in mouse embryos multi-dimensional multi-spectralperspectives Trends in Biotechnol 2009 27266-276

4 Livet J Weissman TA Kang H Draft RW Lu J Bennis RA Sanes JRLichtman JW Transgenic strategies for combinatorial expression offluorescent proteins in the nervous system Nature 2007 45056-62

5 Gilyarov AV Nestin in central nervous system cells Neurosci Behav Physiol2008 38165-169

6 Zimmerman L Lendahl U Cunningham M McKay R Parr B Gavin BMann J Vassileva G McMahon A Independent regulatory elements in the

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 8 of 9

nestin gene direct transgene expression to neural stem cells or muscleprecursors Neuron 1994 1211-24

7 Kawaguchi A Miyata T Sawamoto K Takashita N Murayama AAkamatsu W Ogawa M Okabe M Tano Y Goldman SA Okano H Nestin-EGFP transgenic mice visualization of the self-renewal and multipotencyof CNS stem cells Mol Cell Neurosci 2001 17259-273

8 Sunabori T Tokunaga A Nagai T Sawamoto K Okabe M Miyawaki AMatsuzaki Y Miyata T Okano H Cell-cycle-specific nestin expressioncoordinates with morphological changes in embryonic cortical neuralprogenitors J Cell Sci 2008 1211204-1212

9 Yamaguchi M Saito H Suzuki M Mori K Visualization of neurogenesis inthe central nervous system using nestin promoter-GFP transgenic miceNeuroReport 2000 111991-1996

10 Karasawa S Araki T Nagai T Mizuno H Miyawaki A Cyan-emitting andorange-emitting fluorescent proteins as a donoracceptor pair forfluorescence resonance energy transfer Biochem J 2004 381307-312

11 Reynolds BA Weiss S Clonal and population analyses demonstrate thatan EGF-responsive mammalian embryonic CNS precursor is a stem cellDev Biol 1996 1751-13

12 Couillard-Despres S Winner B Schaubeck S Aigner R Vroemen MWeidner N Boddahn U Winkler J Kuhn H-G Aigner L Doublecortinexpression levels in adult brain reflect neurogenesis Eur J Neurosci 2005211-14

13 The GENSAT project httpwwwncbinlmnihgovprojectsgensat14 Walker TL Yasuda T Adams DJ Bartlett PF The doublecortin-expressing

population in the developing and adult brain contains multipotentialprecursors in addition to neuronal-lineage cells J Neurosci 2007273734-3742

15 Chalfie M Tu Y Euskirchen G Ward WW Prasher DC Green fluorescentprotein as a marker for gene expression Science 1994 263802-805

doi1011861756-6606-3-5Cite this article as Kanki et al ldquoColor Timerrdquo mice visualization ofneuronal differentiation with fluorescent proteins Molecular Brain 201035

Submit your next manuscript to BioMed Centraland take full advantage of

bull Convenient online submission

bull Thorough peer review

bull No space constraints or color figure charges

bull Immediate publication on acceptance

bull Inclusion in PubMed CAS Scopus and Google Scholar

bull Research which is freely available for redistribution

Submit your manuscript at wwwbiomedcentralcomsubmit

Kanki et al Molecular Brain 2010 35httpwwwmolecularbraincomcontent315

Page 9 of 9