short tandem target mimic rice lines uncover functions of ......new agronomic targets: mir398...

Short tandem target mimic rice lines uncover functionsof miRNAs in regulating important agronomic traitsHui Zhanga,b,c,1, Jinshan Zhanga,b,d,1, Jun Yana,b,c, Feng Goua,b,d, Yanfei Maoa,b, Guiliang Tange, José Ramón Botellaf,and Jian-Kang Zhua,b,c,2

aShanghai Center for Plant Stress Biology, Chinese Academy of Sciences, Shanghai 201602, People’s Republic of China; bCenter of Excellence in MolecularPlant Sciences, Chinese Academy of Sciences, Shanghai 201602, People’s Republic of China; cDepartment of Horticulture and Landscape Architecture,Purdue University, West Lafayette, IN 47907; dUniversity of Chinese Academy of Sciences, Shanghai 201602, People’s Republic of China; eDepartment ofBiological Sciences, Michigan Technological University, Houghton, MI 49931; and fPlant Genetic Engineering Laboratory, School of Agriculture and FoodSciences, University of Queensland, Brisbane, QLD 4072, Australia

Contributed by Jian-Kang Zhu, March 31, 2017 (sent for review March 6, 2017; reviewed by Shou-Wei Ding and Ramanjulu Sunkar)

Improvements in plant agricultural productivity are urgently neededto reduce the dependency on limited natural resources and produceenough food for a growing world population. Human interventionover thousands of years has improved the yield of important crops;however, it is increasingly difficult to find new targets for geneticimprovement. MicroRNAs (miRNAs) are promising targets for cropimprovement, but their inactivation is technically challenging andhas hampered functional analyses. We have produced a largecollection of transgenic short tandem target mimic (STTM) linessilencing 35 miRNA families in rice as a resource for functionalstudies and crop improvement. Visual assessment of field-grownmiRNA-silenced lines uncovered alterations in many valuable agro-nomic traits, including plant height, tiller number, and grain number,that remained stable for up to five generations. We show thatmanipulation of miR398 can increase panicle length, grain number,and grain size in rice. In addition, we discovered additional agronomicfunctions for several known miRNAs, including miR172 and miR156.Our collection of STTM lines thus represents a valuable resource forfunctional analysis of rice miRNAs, as well as for agronomic improve-ment that can be readily transferred to other important food crops.

small RNA | microRNA | silencing | yield | crop

Population growth worldwide is skyrocketing and expected tocontinue, making food security one of the most important

challenges facing humanity in the 21st century. To meet an in-creasing demand for food, crop production may need to increaseby 100–110% between 2005 and 2050 (1). Unfortunately, thisdemand for increased food production cannot be met by simplyexpanding the area of cultivation because most arable land is al-ready in use (2). Climate change will add an additional level ofuncertainty to agriculture in the future. The need to increase foodproduction necessitates the development of vastly superior cropsthat not only require less water, chemical fertilizers, and pesticidesbut also deliver higher yields. Rice is a staple food for nearly halfof the world’s population and provides almost one-quarter of theglobal per capita dietary energy supply. Many quantitative traitloci (QTLs) and genes have been identified and shown to controlimportant agronomic traits in rice (3, 4); however, our knowledgeof the gene networks controlling such traits is still limited.New strategies are needed to unlock the full potential of the rice

genome. The use of microRNAs (miRNA) as targets for cropimprovement is promising, although it has not yet been thoroughlyexplored (5). Homology-mediated pairing of plant miRNAs, pre-dominantly 21 nt in length, with their mRNA targets triggersmRNA cleavage or translational inhibition and, ultimately, post-transcriptional gene repression (6). The first plant miRNA wasreported in 2002 (7), and there are currently in excess of 7,000confirmed or putative mature miRNAs from 73 plant species(miRBase, version 21; www.mirbase.org/). Some rice miRNAs arethought to be at the center of complex gene regulatory networksthat control crop development and architecture, with specificmiRNAs affecting yield by regulating tiller number, grain size, and

panicle branching (8–13). These miRNAs also regulate responsesto the different stresses encountered by crops in the field, suchas drought, salinity, heat, cold, nutrient, and oxidative stress(reviewed in refs. 14, 15). Given their involvement in the control ofso many valuable agronomic traits, miRNAs are emerging assuitable but underexplored targets for crop improvement. Un-fortunately, their small size and extensive genetic redundancy havehampered approaches for functional analyses. Most of the avail-able data have been generated by miRNA overexpression and thegeneration of miRNA-resistant target genes, rather than by loss offunction. Some of the phenotypes from overexpression studiesmay be a consequence of temporal or spatial misexpression, andthus can be misleading. The target mimicry technologies, such astarget MIMICs (MIMs) (16) and short tandem target MIMICs(STTMs) (17), have provided effective tools to block endogenousmature miRNA activity, making it technically possible to un-dertake large-scale genome-wide studies.Target mimicry technology was based on the discovery of an

endogenous regulatory mechanism used by INDUCED BYPHOSPHATE STARVATION1 (IPS1) to modulate miR399 ac-tivity in Arabidopsis thaliana (16). IPS1 encodes a noncoding

Significance

Plant microRNAs (miRNAs) control intricate gene regulatorynetworks and have been implicated in important develop-mental switches and stress responses. Plant miRNAs have re-cently emerged as promising targets for crop improvementbecause they can control complex agronomic traits; however,functional studies using reverse genetics have been hamperedby practical difficulties. We have silenced 35 miRNA families inrice to generate a resource for discovering new functions ofmiRNAs and targets of agronomic improvements. As a proof ofconcept, we show that manipulation of a promising miRNA,miRNA398, leads to important yield improvements. Our find-ings also reveal important agronomic roles for several miRNAs.

Author contributions: H.Z. and J.-K.Z. designed research; H.Z., J.Z., J.Y., F.G., and Y.M.performed research; H.Z., J.Z., G.T., J.R.B., and J.-K.Z. analyzed data; and H.Z., J.Z., J.R.B.,and J.-K.Z. wrote the paper.

Reviewers: S.-W.D., University of California; and R.S., Oklahoma State University.

The authors declare no conflict of interest.

Data deposition: Sequence data from this article have been deposited in the miRBasedatabase or Rice Genome Annotation Project website (rice.plantbiology.msu.edu/) (Mich-igan State University) under the following accession numbers: miR398a (MI0001051),OsSPL2 (LOC_Os01g69830), OsSPL3 (LOC_Os02g04680), OsSPL4 (LOC_Os02g07780),OsSPL7 (LOC_Os04g46580), OsSPL11 (LOC_Os06g45310), OsSPL12 (LOC_Os06g49010),OsSPL13 (LOC_Os07g32170), OsSPL14 (LOC_Os08g39890), OsSPL16 (LOC_Os08g41940),OsSPL17 (LOC_Os09g31438) , OsSPL18 (LOC_Os09g32944), and OsGAMYB(LOC_Os01g59660).1H.Z. and J.Z. contributed equally to this work.2To whom correspondence should be addressed. Email: [email protected].

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1703752114/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1703752114 PNAS | May 16, 2017 | vol. 114 | no. 20 | 5277–5282

PLANTBIOLO

GY

http://www.mirbase.org/

http://crossmark.crossref.org/dialog/?doi=10.1073/pnas.1703752114&domain=pdf

http://rice.plantbiology.msu.edu/

mailto:[email protected]

http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1703752114/-/DCSupplemental

http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1703752114/-/DCSupplemental

www.pnas.org/cgi/doi/10.1073/pnas.1703752114

RNA that contains a motif complementary to miR399 except fora central stretch of three nucleotides. When miR399 pairs withIPS1, the duplex contains a central bulge that prevents cleavageof IPS1, thereby sequestering miR399 and reducing its bio-availability (16). MIMs have been used to sequester miRNAfamilies in Arabidopsis, although this approach is not equally ef-fective for all targeted miRNAs (18). STTMs were developed asan improvement on target mimicry and contain two imperfectmiRNA target sites with a CTA trinucleotide bulge in the centerlinked by a 31- to 96-nt short spacer (17). STTMs can trigger ef-ficient degradation of the targeted miRNAs in Arabidopsis andmice (17, 19). Here, we report an extensive functional study of ricemiRNAs using STTM technology. Our results revealed importantfunctions of rice miRNAs in the regulation of key agronomic traits.

Results and DiscussionSTTM-Mediated Silencing of miRNA Families in Rice Is Highly Specificand Stable for Multiple Generations. We designed 35 STTM con-structs, containing two noncleavable miRNA-binding sites linkedby a spacer (48–88 nt) (SI Appendix, Table S1), that target either asingle mature miRNA or two different mature miRNAs of thesame family in rice (SI Appendix, Table S2). We generated manyindependent transgenic rice lines (n = 21–46) for each construct inthe japonica variety Nipponbare (SI Appendix, Table S2). Most ofthe targeted miRNA families were chosen due to their potentialroles in plant development/architecture or in response to variousabiotic and biotic stresses (SI Appendix, Dataset S1). Visual in-spection of the transgenic lines (T0–T4) grown in the field in twodifferent locations (Shanghai and Lingshui, China) revealed a widerange of obvious above-ground phenotypic alterations. Impor-tantly, the phenotypes generated by each STTM were consistentand detected in multiple independent transgenic lines (SI Appen-dix, Table S2). We observed strong transgenerational stability ofSTTMs in rice, with phenotypes being stable for up to five gen-erations thus far (SI Appendix, Fig. S1). Our results also showedhigh STTM specificity; for instance, miR156, but not miR160, ex-pression levels were dramatically decreased in the STTM156 lines,and vice versa (discussed below). Rice STTM lines displayed a widerange of phenotypic alterations distinct from those phenotypic al-terations reported in Arabidopsis, suggesting substantial evolu-tionary functional diversifications of miRNA functions betweendicots and monocots.

New Agronomic Targets: miR398 Inhibition Increases Rice Yield. Ourinitial characterization of the STTM transgenic rice lines re-vealed alterations in agronomic traits such as seed size, tillernumber, plant height, and flowering time, emphasizing the im-portance of miRNAs in rice productivity.We further investigated miR398, which has been extensively

studied and is thought to regulate the response to abiotic andbiotic stresses by promoting cleavage of its target genes, Cu/Zn-superoxide dismutases (CSD1 and CSD2) (20–23). Although nodevelopmental or architectural phenotypes have been associatedwith this miRNA in Arabidopsis, we found that silencing ofmiR398 resulted in rice lines (STTM398) that were significantlyshorter than wild-type (WT) plants (62.7 ± 4.1 cm vs. 86.7 ±2.4 cm, respectively) (Fig. 1 A and E). STTM398 also displayedsmaller panicles, containing a reduced number of grains, than WT(77.8 ± 10.1 vs. 96.31 ± 1.3; P < 0.001) (Fig. 1 B, F, and G) andflowered about 2 wk later than WT plants (87.4 ± 1.6 d vs. 71.8 ±1.4 d; P < 0.001) (SI Appendix, Fig. S2). Importantly, STTM398lines showed a significant decrease in grain length (12.9%) andwidth (19.5%) compared with WT, resulting in a 40% decrease in1,000-grain weight (Fig. 1C, D, and H). Northern blot analysisshowed that the expression of miR398 was almost undetectable inthe STTM398 transgenic plants (Fig. 1I), whereas several pre-dicted miR398 target genes showed significantly increased ex-pression levels in the STTM398 transgenic lines relative to WT

(Fig. 1J). Our results show that miR398 plays a significant role inrice growth and seed development, identifying it as a promisingtarget for improvement.To validate our hypothesis, we generated transgenic lines over-

expressing miR398a (OX-miR398a). Analysis of two independentfield-grown T1 transgenic OX-miR398a lines showed an overallincrease in height compared with WT, accompanied by biggerpanicles and an increased number of grains per panicle (Fig. 1K–O).Trade-offs between grain number and size are commonly observed

Fig. 1. miR398 controls rice panicle and seed development and can be ma-nipulated for rice improvement. (A) Gross morphologies of WT (Nipponbare)and STTM398 plants at maturity. (Scale bar, 10 cm.) (B) Panicle morphologies ofWT and STTM398 plants. (Scale bar, 5 cm.) (C) Grain width of WT andSTTM398 plants. (Scale bar, 1 cm.) (D) Grain length of WT and STTM398 plants.(Scale bar, 1 cm.) Plant height (E), main panicle length (F), grain number perpanicle (G), and 1,000-grain weight (H) of WT and STTM398 plants are shown.(I) Expression levels of miR398 inWT and STTM398 plants detected using Northernblotting. U6 was used as a loading control. (J) Expression levels of miR398predicted targets inWT and STTM398 plants determined by qRT-PCR. (K) Grossmorphologies of WT, OX-miR398a, and mOs07g46990 plants at maturity. (Scalebar, 10 cm.) (L) Panicle morphologies of WT, OX-miR398a, and mOs07g46990plants at maturity. (Scale bar, 5 cm.) Plant height (M), main panicle length (N),grain number per panicle (O), and 1,000-grain weight (P) of WT, OX-miR398a,and mOs07g46990 plants are shown. Data are presented as mean ± SD [n =15 replicates in E andM; n = 30 replicates in F,G,N, andO; n = 10 (>120 seeds foreach biological replicate) replicates in H and P; n = 3 in replicates in J]. *P < 0.05,**P < 0.01; two-tailed, two-sample t test. NS, not significant.

5278 | www.pnas.org/cgi/doi/10.1073/pnas.1703752114 Zhang et al.

http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1703752114/-/DCSupplemental/pnas.1703752114.sapp.pdf




http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1703752114/-/DCSupplemental/pnas.1703752114.sd01.pdf






in both natural (24) and domesticated systems (25); however, OX-miR398a lines displayed increased seed length, seed width, and1,000-grain weight compared withWT (Fig. 1P and SI Appendix, Fig.S3 A and B). To confirm our hypothesis further, we producedtransgenic lines carrying a resistant version of one of themiR398 targets, Os07g46990, that had shown increased levels inSTTM398 lines (Fig. 1J). The modified Os07g46990 gene(mOs07g46990) contained five mismatches in the miR398 targetsite and was expressed in transgenic rice under its native promoter(SI Appendix, Fig. S4). The mOs07g46990 lines showed some of thephenotypes of STTM lines, such as decreased plant height, paniclelength, and grain number per panicle, compared with WT (Fig. 1K–O). However, mOs07g46990 plants showed WT phenotypes forseed length, seed width, and 1,000-grain weight (Fig. 1P and SIAppendix, Fig. S3 C and D), confirming that the phenotypes ob-served in STTM lines result from the compounded effects ofmiR398 on multiple target genes. The strong developmentalphenotypes observed in the STTM and overexpression lines in riceare in clear contrast to the lack of visible phenotypes reported forArabidopsis, which may reflect different experimental approachesor evolutionary differences between monocots and eudicots.

Previously Undiscovered Functions for miR172 in Culm and PanicleDevelopment. miR172 has been the focus of multiple studies us-ing different approaches, such as overexpression, expression ofresistant target genes, or mutations in individual loci encoding themiRNA (26–35). These previous studies suggested that miR172mainly controls flowering time and floral organ identity. For in-stance, loss of function of one locus, miR172a, and overexpressionof miR172 targets resulted in slow vegetative development andlate flowering in Arabidopsis (30), whereas overexpression ofmiR172 caused an early flowering phenotype and defective floralorgan identity (9, 26, 30). Overexpression of miR172 in rice causedloss of spikelet determinacy and multiple abnormalities in floralorgans, including an increased number of bract-like structures andmultiple layers of lemma and palea, ultimately resulting in de-creased fertility or even complete sterility (31, 32).Unexpectedly, we found that STTM172 lines targeting miR172

showed defects mainly in culm (main stem) and panicle devel-opment. STTM172 plants had very short culms compared withWT, resulting in enclosed panicles and dwarf plants (Fig. 2 A, B,D, and F). Whereas WT culms have either four (63.9%) or five(34.7%) elongated internodes at maturity, 75.8% of STTM172culms had only three elongated internodes (Fig. 2 D, E, and J). In

addition, the internodes in STTM172 plants were shorter, espe-cially the top internode (internode I: 7.5 ± 2.4 cm in STTM172 vs.33.7 ± 2.2 cm in WT, n = 25), which also showed a wavy phe-notype (Fig. 2 D, E, and I). Natural variation in miR172 and themiR172 target site in maize and barley have been linked to panicledensity (29, 34). In agreement with this finding, our STTM172lines displayed increased density and shorter panicles comparedwith WT (Fig. 2 C and G). The grain number per panicle wasidentical in WT and STTM172 plants (Fig. 2H), and no abnor-malities were observed in STTM172 flowers (SI Appendix, Fig. S5A and B), in contrast to previous observations that overexpressionof miR172 affected these features (31, 32). STTM172 plantsproduced normal fertile pollen (SI Appendix, Fig. S5 C and D),although the seed setting rate was significantly lower than WT,perhaps due to the enclosed panicle (SI Appendix, Fig. S6). Ex-pression of miR172 was strongly inhibited in STTM172 lines, andexpression of the predicted target gene was consequently in-creased (Fig. 2 K and L). Our results reinforce the limitations ofrelying on overexpression as a tool to perform miRNA functionalstudies. The different phenotypes arising from single-locusknockouts of miR172 in Arabidopsis and maize (29, 30) and thecomplete inhibition of miR172 in rice suggest that this miRNA orspecific miRNA loci might have undergone functional specializa-tion during evolution, perhaps associated with distinct tissue- orcell-specific expression patterns.

New Roles for Old miRNAs: miR156 Controls Root Development at theSeedling Stage. Some agronomically important QTLs have beenlinked to differential regulation of individual genes by specificmiRNAs, but the effects of manipulating the miRNA instead of asingle target gene are still unknown. In rice, regulation ofOsSPL14 by miR156 is associated with “ideal plant architecture,”because increased expression of OsSPL14 reduces the number oftillers, increases grain number per panicle, and promotes a moresturdy stem. These observations suggest that miR156 is a potentialtarget for rice improvement (8, 9). Our results from silencingmiR156 confirmed the published data but also revealed previouslyunknown functions. STTM156 plants have fewer tillers than WT(4.1 ± 1.5 vs. 17.8 ± 4.7) (Fig. 3 A, B, and E) and thicker culms(4.3 ± 0.4 mm vs. 3.2 ± 0.4 mm) (Fig. 3 C and F). STTM156 plantsalso show a slight increase in grain length and 1,000-grain weight(P < 0.001) (Fig. 3 D, G, and H) but show no difference in grainwidth (SI Appendix, Fig. S7 A and B). In addition to the expectedphenotypes, analysis of STTM156 plants revealed a previously

Fig. 2. New roles for miR172 in rice shoot and panicle development. (A) Gross morphologies of WT (Left) and STTM172 (Right) plants at maturity. (Scale bar,10 cm.) (B) Panicle and upper part of stem of WT (Upper) and STTM172 (Lower) plants at maturity. (Scale bar, 10 cm.) (C) Panicle morphologies of WT (Upper)and STTM172 (Lower) plants. (Scale bar, 5 cm.) (D) Elongated internodes of WT (Left) and STTM172 (Right) plants. (Scale bar, 10 cm.) (E) EnlargedSTTM172 internodes from D. (Scale bar, 5 cm.) Plant height (F), panicle length (G), and grain number per panicle (H) of WT and STTM172 plants are shown.(I) Length of top four internodes (I to IV, where I is the uppermost) of WT and STTM172 plants. (J) Percentage of different internode number in WT andSTTM172 plants. (K) Expression levels of miR172 in WT and STTM172 plants detected using Northern blotting. U6 was used as a loading control. (L) Expressionlevels of predicted miR172 target in WT and STTM172 plants determined by qRT-PCR. Data are presented as mean ± SD (n = 15 replicates in F and G, n =25 replicates in H and I, n = 66 replicates in J, n = 3 replicates in L). **P < 0.01; two-tailed, two-sample t test.

Zhang et al. PNAS | May 16, 2017 | vol. 114 | no. 20 | 5279

PLANTBIOLO

GY











unknown role for miR156 in the regulation of shoot and root de-velopment at the seedling stage. Both 7- and 18-d-old STTM156seedlings grown hydroponically or in soil showed a substantial de-crease in root number and an increase in root width compared withWT seedlings (Fig. 3 I, J, and K and SI Appendix, Fig. S8). Shootsfrom the STTM156 seedlings were also shorter than shoots fromWTseedlings (Fig. 3I and SI Appendix, Fig. S8); however, WT andSTTM156 plants showed similar height at maturity (Fig. 3A).Northern blot analysis showed that miR156 was efficiently down-regulated in STTM156 plants (Fig. 3L); however, quantitative RT-PCR (qRT-PCR) revealed that only five of the 11 predicted targetswere up-regulated in the STTM156 plants (Fig. 3M), suggesting thatthe regulatory role of this miRNA is quite complex and goes beyondmere sequence conservation, even within a single protein family.

Identification of Multiple Rice miRNAs with Effects on AgronomicTraits. In addition to the examples discussed above, we observedalterations in important agronomic traits in other STTM lines.miR159 is highly conserved in eudicots and monocots, and regu-lates the expression of a family of GAMYB or GAMYB-like genesat the posttranscriptional level (36, 37). In Arabidopsis, themiR159 gene family has three members: MIR159a, MIR159b, andMIR159c. The Arabidopsis mir159ab double mutant has pleiotropicmorphological defects, including reduced height, curled leaves,shorter siliques, and smaller and irregularly shaped seeds (37). Wefound that rice STTM159 lines exhibited very similar phenotypes tothe Arabidopsis mir159ab double mutant (Fig. 4 A–D). STTM159plants were dwarf (36.0 ± 3.1 cm vs. 86.7 ± 2.4 cm for WT) anddisplayed curled leaves and small, irregularly shaped seeds com-pared with WT (Fig. 4 A–D). Grain length and width in STTM159lines showed a reduction of 21.3% and 9.1%, respectively, com-pared with WT, and 1,000-grain weight was decreased by 47.2% (SIAppendix, Fig. S9 A–C). Northern blot analysis showed thatmiR159 was efficiently silenced in the STTM transgenic lines, andqRT-PCR revealed that the expression of two predicted miR159target genes, OsGAMYB and GAMYB-like gene Os06g40330, wasup-regulated in the STTM159 plants, as expected (Fig. 4 N and R).

miR165 and miR166 have almost identical sequence except fora C/U substitution at position 17, and the two miRNAs havefunctional redundancy in Arabidopsis (38). Down-regulation ofboth miRNA families by STTM and MIM in Arabidopsis suggeststhat they function in multiple developmental processes via nega-tive regulation of class III homeodomain-leucine zipper (HD-ZIPIII) transcriptional factors (17, 18, 39). We found that STTM166lines displayed a wide tiller angle (Fig. 4E), which is a key agro-nomic trait for ideal plant architecture (40), and upwardly curledleaves (Fig. 4F), indicating loss of leaf polarity. Expression ofmiR166 was drastically down-regulated in the transgenic lines, andthe expression of two predicted miR166 targets, HD-ZIP IIIfamily genes Os03g43930 and Os12g41860, was up-regulated in theSTTM166 plants (Fig. 4 Q and T), as expected.miR160 is a highly conserved miRNA family that controls root,

embryo, leaf, and floral organ development as well as seed ger-mination in Arabidopsis by negatively regulating auxin responsefactor (ARF) family genes (41–44). Rice STTM160 transgeniclines shared some phenotypic alterations with Arabidopsis, such asreduced plant height (Fig. 4G). Although down-regulation ofmiR160 in Arabidopsis resulted in reduced fertility, it producedcomplete male sterility in rice (Fig. 4H). Other phenotypes ob-served in Arabidopsis, such as serrated leaves and aberrant floralorgans, were not observed in the rice transgenic lines.Overexpression of miR171 results in multiple and, on many

occasions, opposite phenotypes. Barley plants overexpressingmiR171 were dwarf and had a reduced number of tillers comparedwith WT, whereas rice miR171 overexpression lines were tallerand had increased tiller numbers compared with WT (45, 46). InArabidopsis, miR171 targets the scarecrow-like (SCL) transcrip-tion factors and is thought to regulate meristematic cell pro-liferation, polar organization, and chlorophyll synthesis (47, 48).Silencing of miR171 in Arabidopsis using MIM produced roundand pale leaves. In contrast, we found that rice STTM171 plantsshowed semidwarf stature, semienclosed panicles, and droopingflag leaves (Fig. 4 I and J), as well as no obvious changes in leafshape or color, again suggesting a diversification in the function ofmiRNAs between monocots and eudicots.Very little is known about the roles of miR441 and miR1428. In

our study, STTM441 plants were taller than WT (Fig. 4K and SIAppendix, Fig. S10), whereas STTM1428 plants showed abortedpollen at the pollen maturation stage (Fig. 4 L andM). In line withthe phenotypic effects, STTM lines showed almost complete si-lencing of the targeted miRNAs, which was accompanied by de-regulation of the predicted target genes (Fig. 4N–T). Interestingly,many miRNAs with reported phenotypes upon overexpression orpartial suppression, such as miR169, miR393, miR397, andmiR167, did not produce any obvious above-ground phenotypes inour STTM transgenic rice lines.

STTM Is a Powerful Tool for Functional Characterization of miRNAsand Manipulating Agronomic Traits. There are very few functionalstudies available for rice miRNAs, largely due to the technicaldifficulties in down-regulating mature miRNA expression. Here,we used STTM to silence 35 different miRNA families, nine ofwhich produced obvious above-ground phenotypes (SI Appendix,Table S2). Our results have unveiled a number of characteristicsthat make STTM the technique of choice for miRNA functionalstudies compared with other available methods, such as MIM. First,the phenotypes, when available, were observed in multiple in-dependent transgenic lines and were consistent among lines. Sec-ond, the levels of down-regulation achieved by STTM were vastlysuperior to the levels of down-regulation reported using MIM inrice. For example, miR156 levels in transgenic lines carrying MIMconstructs were reduced about twofold compared with WT (49),whereas the expression levels of all of the STTM-targeted miRNAswere reduced by up to 100-fold in transgenic lines compared withWT (Figs. 1I, 2K, 3L, and 4 N–Q and SI Appendix, Fig. S11 A–C).

Fig. 3. miR156 affects rice seedling development and plant architecture.(A) Gross morphologies of WT (Left) and STTM156 (Right) plants at maturity.(Scale bar, 10 cm.) (B) Magnification of A highlighting differences in tillernumbers. (C) Comparison of third internodes between WT (Left) and STTM156(Right) plants. (Scale bar, 5 mm.) (D) Grain length of WT (Left) and STTM156(Right) plants. (Scale bar, 1 cm.) Tiller number per plant (E), third internodediameter (F), grain length (G), and 1,000-grain weight (H) of WT and STTM156plants are shown. (I) Hydroponically grown 7-d-old seedlings of WT (Left) andSTTM156 (Right) plants. (Scale bar, 1 cm.) Transverse sections of 7-d-old rootsof WT (J) and STTM156 (K) plants are shown. (Scale bars, 100 μm.) (L) Ex-pression levels of miR156 and miR160 in WT and STTM156 plants detectedusing Northern blotting. U6 was used as a loading control. (M) Expressionlevels of predicted miR156 targets in WT and STTM156 plants determined byqRT-PCR. Data are presented as mean ± SD [n = 20 replicates in E, n = 43 rep-licates in F, n = 10 (>120 seeds for each biological replicate) replicates inG andH,n = 3 replicates in M]. **P < 0.01; two-tailed, two-sample t test.
















The use of CRISPR-Cas for miRNA studies is hampered by thesmall size of the mature miRNA sequences (∼21 nt); the re-quirement of a protospacer adjacent motif sequence (50); and theexistence of large gene families encoding some miRNAs, such asmiR166 with 14 loci, in rice (51). Most importantly, the observedphenotypes were stable across generations (SI Appendix, Fig. S1).This transgenerational stability is essential if STTM lines are to beused for research purposes or as breeding resources.

ConclusionsSTTM lines are a valuable resource for functional miRNAstudies as well as potential breeding materials for rice improve-ment. We have discovered the strong agronomic potential ofsome miRNAs and revealed previously unknown functions oflong-studied miRNAs. We also provide evidence for evolution-ary divergences in the functions of some miRNAs betweenmonocots and eudicots. Our work suggests that targetingmiRNAs can influence entire gene networks and improve complexagronomic traits. The transgenic lines generated in this study canbe screened for responses to biotic and abiotic stresses, nutrientuse efficiency, and photosynthetic efficiency, for example, toreveal new and exciting targets for agronomic improvement inthe future.

MethodsPlant Materials and Growth Conditions. Rice (Oryza sativa L.) variety Nip-ponbare (ssp. japonica) was used in this study. Most of the WT and trans-genic plants were grown under natural field conditions in the Shanghairegion of China (30°N, 121°E) during the normal rice-growing season frommid-May to mid-October and in Lingshui, China (18°N, 110°E) during thenormal rice-growing season from mid-December to mid-April. SomeSTTM156 plants were also grown in a greenhouse with a 30/24 ± 1 °C day/night temperature, 50–70% relative humidity, and a light/dark period of14 h/10 h. For hydroponic culture experiments, plants were grown in solu-tion as described by Yoshida et al. (52) in a greenhouse.

Trait Measurements. Plant height, tiller number, grain length, grain width,1,000-grainweight, panicle length, grain number per panicle, internode length,and diameter of the third internode were measured at full maturity. Plantheight was measured in the paddy fields. Grain length and width were mea-sured using an SC-A grain analysis system (Wseen Company). The 1,000-grainweightwasweighted using an SC-A grain analysis system after fully filled grainswere dried at 42 °C in an oven for 2 wk.

Phenotyping and Histological Experiments. All of the materials, exceptSTTM156and correspondingWTseedling-stageplants,weregrownundernaturalfield conditions. The plants were moved to pots for photographing to display thedifferences more clearly. Most plant materials were photographed with a NikonD3000 digital camera and an Olympus BX53 microscope. Grain length and widthphotographs were generated using an SC-A grain analysis system.

For the iodine-potassium iodide (I2-KI) staining of pollen grains, the spikeletwas collected near anthesis and fixed in FAA (50% ethanol, 10% formalin, and5% acetic acid) solution. The pollen grains were squeezed out to a microscopeslide, stained with1.0% I2-KI, and photographed using the Olympus BX53microscope.

For root transverse sectionobservations, thematerialswere collectedand fixedovernight at 4 °C in FAA solution and dehydrated in a graded ethanol series. Thesamples were then embedded in Technovit 7100 resin (Hereaus Kulzer), and2-μm sections were made using a Leica RM 2265 programmable rotary micro-tome (Leica Microsystems). After staining with 0.05% Toluidine Blue, transversesections were photographed using an Olympus BX53 microscope.

Vector Construction and Transformation of Rice. STTM vectors were con-structed as described by Tang et al. (19). For the OX-miR398 vector, a PCRfragment amplified from genomic DNA using primers OE-miR398a-F andOX-miR398a-R was cloned into the BamHI/SpeI sites of the binary vectorpTCK303 (53) between the maize Ubi 1 promoter and the Nos terminator. Toconstruct the mOs07g46990 vector, a 4,181-bp genomic fragment, includingthe 1,406-bp promoter and coding sequence for Os07g46990, was amplifiedand cloned into the BamHI/HindIII sites of the binary vector pCAMBIA 1300.To introduce mismatches into Os07g46990, a fragment amplified by PCR usingmOs07g46990-5-F and mOs07g46990-5-R was first cloned into the BamHI/SalIsites of pCAMBIA 1300. A second fragment was then amplified usingmOs07g46990-3-F and mOs07g46990-3-R and cloned into the HindIII/SalI sitesof the vector described above. All constructs were introduced into the

Fig. 4. Examples of developmental alterations observed in STTM159, STTM160, STTM166, STTM171, STTM441, and STTM1428 rice lines. (A) Gross morphologiesof WT and STTM159 plants at maturity. (Scale bar, 10 cm.) (B) Leaf morphologies of WT and STTM159 plants at maturity. (Scale bar, 5 cm.) (C) Grain length of WTand STTM159 plants. (Scale bar, 1 cm.) (D) Grain width of WT and STTM159 plants. (Scale bar, 1 cm.) (E) Gross morphologies of WT and STTM166 plants. (Scale bar,10 cm.) (F) Leaf morphologies of WT and STTM166 plants at maturity. (G) Gross morphologies of WT and STTM160 plants. (Scale bar, 10 cm.) (H) Spikelets of WTand STTM160 after removing the palea and lemma. (Scale bar, 1 mm.) (I) Gross morphologies of WT and STTM171 plants at maturity. (Scale bar, 10 cm.)(J) Comparison of flag leaf angle between WT and STTM171 plants. (K) Gross morphologies of WT and STTM441 plants at maturity. (Scale bar, 10 cm.) I2-KIstaining of pollen grains fromWT (L) and STTM1428 plants (M) is shown. (Scale bars, 100 μm.) (N) Expression levels of miR159 inWT and STTM159 plants detectedusing Northern blotting. U6 was used as a loading control. (O) Expression levels of miR160 and miR156 in WT and STTM160 plants detected using Northernblotting. U6 was used as a loading control. (P) Expression levels of miR171 and miR398 in WT and STTM171 plants detected using Northern blotting. U6 was usedas a loading control. (Q) Expression levels of miR166 in WT and STTM166 plants determined by stem-loop qRT-PCR. U6 was used to normalize samples. (R) Ex-pression levels of predicted miR159 targets in WT and STTM159 plants determined by qRT-PCR. (S) Expression levels of predicted miR160 target in WT andSTTM160 plants determined by qRT-PCR. (T) Expression levels of predicted miR166 targets in WT and STTM166 plants determined by qRT-PCR. Data are presentedas mean ± SD (n = 3 replicates in Q–T). **P < 0.01; two-tailed, two-sample t test.

Zhang et al. PNAS | May 16, 2017 | vol. 114 | no. 20 | 5281

PLANTBIOLO

GY


Agrobacterium tumefaciens strain EHA105 and subsequently transferred intojaponica variety Nipponbare by A. tumefaciens-mediated rice transformationas previously described (54). Sequences of the primers used are listed in SIAppendix, Table S3.

Small RNA Northern Blotting Analysis. Total RNA was isolated from roots,shoots, leaves, and panicles at different stages using a TRIzol Reagent kit(Invitrogen) according to themanufacturer’s protocol. About 40 μg of total RNAwas electrophoresed on a denaturing 19% polyacrylamide gel, transferred toNytran Super Charge Nylon Membranes (Schleicher & Schuell BioScience), andcross-linked using a Stratagene UV Crosslinker. DNA oligonucleotides comple-mentary to the different miRNA sequences were synthesized and labeled with[32P]-γ-ATP (PerkinElmer) using T4 polynucleotide kinase (Takara). The mem-branes were prehybridized with PerfectHyb (Sigma–Aldrich) hybridizing withthe labeled probes. After washing, the membranes were autoradiographedusing film (X-Omat BT Film; Carestream). U6 was used as a loading control. Theprobe sequences are listed in SI Appendix, Table S3.

RNA Extraction and qRT-PCR. Total RNA was isolated from roots, shoots,leaves, and panicles at different stages using the TRIzol Reagent kit accordingto the manufacturer’s protocol. After treatment with RNase-free DNase I(Promega), total RNA (1 μg) was reverse-transcribed using the TransScript IIOne-Step gDNA Removal and cDNA Synthesis SuperMix kits (TransGen Bio-tech). For stem-loop qRT-PCR, SuperScript III Reverse Transcriptase (Invitrogen)was used for reverse transcription. The reverse transcription products wereused as templates for qRT-PCR performed on a CFX96 real-time PCR system(Bio-Rad) using SYBR Premix EX Taq (Takara) according to the manufacturer’sprotocol. ACTIN1 and U6 snRNA were used to normalize samples in normalqRT-PCR and stem-loop qRT-PCR, respectively; relative expression levels weremeasured using the 2−ΔΔCt analysis method. The sequences used in qRT-PCRare listed in SI Appendix, Table S3.

ACKNOWLEDGMENTS. This work was supported by the Chinese Academy ofSciences and by US NIH Grants R01GM070795 and R01GM059138 (to J.-K.Z.).H.Z. acknowledges the support of the International Postdoctoral ExchangeFellowship Program of China under Grant 20140029.

1. Tilman D, Balzer C, Hill J, Befort BL (2011) Global food demand and the sustainableintensification of agriculture. Proc Natl Acad Sci USA 108:20260–20264.

2. Dubois O (2011) The State of the World’s Land and Water Resources for Food andAgriculture: Managing Systems at Risk (Food and Agriculture Organization, Rome).

3. Xing Y, Zhang Q (2010) Genetic and molecular bases of rice yield. Annu Rev Plant Biol61:421–442.

4. Zuo J, Li J (2014) Molecular genetic dissection of quantitative trait loci regulating ricegrain size. Annu Rev Genet 48:99–118.

5. Kamthan A, Chaudhuri A, Kamthan M, Datta A (2015) Small RNAs in plants: Recentdevelopment and application for crop improvement. Front Plant Sci 6:208.

6. Bartel DP (2004) MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell116:281–297.

7. Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP (2002) MicroRNAs inplants. Genes Dev 16:1616–1626.

8. Jiao Y, et al. (2010) Regulation of OsSPL14 by OsmiR156 defines ideal plant archi-tecture in rice. Nat Genet 42:541–544.

9. Miura K, et al. (2010) OsSPL14 promotes panicle branching and higher grain pro-ductivity in rice. Nat Genet 42:545–549.

10. Zhang Y-C, et al. (2013) Overexpression of microRNA OsmiR397 improves rice yield byincreasing grain size and promoting panicle branching. Nat Biotechnol 31:848–852.

11. Gao F, et al. (2015) Blocking miR396 increases rice yield by shaping inflorescence ar-chitecture. Nat Plants 2:15196.

12. Duan P, et al. (2015) Regulation of OsGRF4 by OsmiR396 controls grain size and yieldin rice. Nat Plants 2:15203.

13. Che R, et al. (2015) Control of grain size and rice yield by GL2-mediated brassinos-teroid responses. Nat Plants 2:15195.

14. Zhang B (2015) MicroRNA: A new target for improving plant tolerance to abioticstress. J Exp Bot 66:1749–1761.

15. Khraiwesh B, Zhu J-K, Zhu J (2012) Role of miRNAs and siRNAs in biotic and abioticstress responses of plants. Biochim Biophys Acta 1819:137–148.

16. Franco-Zorrilla JM, et al. (2007) Target mimicry provides a new mechanism for reg-ulation of microRNA activity. Nat Genet 39:1033–1037.

17. Yan J, et al. (2012) Effective small RNA destruction by the expression of a shorttandem target mimic in Arabidopsis. Plant Cell 24:415–427.

18. Todesco M, Rubio-Somoza I, Paz-Ares J, Weigel D (2010) A collection of target mimicsfor comprehensive analysis of microRNA function in Arabidopsis thaliana. PLoS Genet6:e1001031.

19. Tang G, et al. (2012) Construction of short tandem target mimic (STTM) to block thefunctions of plant and animal microRNAs. Methods 58:118–125.

20. Sunkar R, Kapoor A, Zhu J-K (2006) Posttranscriptional induction of two Cu/Zn su-peroxide dismutase genes in Arabidopsis is mediated by downregulation ofmiR398 and important for oxidative stress tolerance. Plant Cell 18:2051–2065.

21. Beauclair L, Yu A, Bouché N (2010) MicroRNA-directed cleavage and translationalrepression of the copper chaperone for superoxide dismutase mRNA in Arabidopsis.Plant J 62:454–462.

22. Zhu C, Ding Y, Liu H (2011) MiR398 and plant stress responses. Physiol Plant 143:1–9.23. Guan Q, Lu X, Zeng H, Zhang Y, Zhu J (2013) Heat stress induction of miR398 triggers

a regulatory loop that is critical for thermotolerance in Arabidopsis. Plant J 74:840–851.

24. Jakobsson A, Eriksson O (2000) A comparative study of seed number, seed size,seedling size and recruitment in grassland plants. Oikos 88:494–502.

25. Yoshida S (1972) Physiological aspects of grain yield. Annu Rev Plant Physiol 23:437–464.

26. Aukerman MJ, Sakai H (2003) Regulation of flowering time and floral organ identityby a MicroRNA and its APETALA2-like target genes. Plant Cell 15:2730–2741.

27. Chen X (2004) A microRNA as a translational repressor of APETALA2 in Arabidopsisflower development. Science 303:2022–2025.

28. Zhao L, Kim Y, Dinh TT, Chen X (2007) miR172 regulates stem cell fate and defines theinner boundary of APETALA3 and PISTILLATA expression domain in Arabidopsis floralmeristems. Plant J 51:840–849.

29. Chuck G, Meeley R, Irish E, Sakai H, Hake S (2007) The maize tasselseed4 microRNAcontrols sex determination and meristem cell fate by targeting Tasselseed6/in-determinate spikelet1. Nat Genet 39:1517–1521.

30. Wu G, et al. (2009) The sequential action of miR156 and miR172 regulates de-velopmental timing in Arabidopsis. Cell 138:750–759.

31. Zhu Q-H, Upadhyaya NM, Gubler F, Helliwell CA (2009) Over-expression ofmiR172 causes loss of spikelet determinacy and floral organ abnormalities in rice(Oryza sativa). BMC Plant Biol 9:149.

32. Lee DY, An G (2012) Two AP2 family genes, supernumerary bract (SNB) and Osinde-terminate spikelet 1 (OsIDS1), synergistically control inflorescence architecture andfloral meristem establishment in rice. Plant J 69:445–461.

33. Varkonyi-Gasic E, Lough RH, Moss SM, Wu R, Hellens RP (2012) Kiwifruit floral geneAPETALA2 is alternatively spliced and accumulates in aberrant indeterminate flowersin the absence of miR172. Plant Mol Biol 78:417–429.

34. Houston K, et al. (2013) Variation in the interaction between alleles ofHvAPETALA2 and microRNA172 determines the density of grains on the barley in-florescence. Proc Natl Acad Sci USA 110:16675–16680.

35. Jung J-H, Lee S, Yun J, Lee M, Park C-M (2014) The miR172 target TOE3 repressesAGAMOUS expression during Arabidopsis floral patterning. Plant Sci 215-216:29–38.

36. Zhang B, Pan X, Cannon CH, Cobb GP, Anderson TA (2006) Conservation and di-vergence of plant microRNA genes. Plant J 46:243–259.

37. Allen RS, et al. (2007) Genetic analysis reveals functional redundancy and the majortarget genes of the Arabidopsis miR159 family. Proc Natl Acad Sci USA 104:16371–16376.

38. Sakaguchi J, Watanabe Y (2012) miR165∕166 and the development of land plants. DevGrowth Differ 54:93–99.

39. Jia X, et al. (2015) Functional plasticity of miR165/166 in plant development revealedby small tandem target mimic. Plant Sci 233:11–21.

40. Wang Y, Li J (2008) Rice, rising. Nat Genet 40:1273–1275.41. Wang J-W, et al. (2005) Control of root cap formation by microRNA-targeted auxin

response factors in Arabidopsis. Plant Cell 17:2204–2216.42. Mallory AC, Bartel DP, Bartel B (2005) MicroRNA-directed regulation of Arabidopsis

AUXIN RESPONSE FACTOR17 is essential for proper development and modulatesexpression of early auxin response genes. Plant Cell 17:1360–1375.

43. Liu X, et al. (2010) The role of floral organs in carpels, an Arabidopsis loss-of-functionmutation in MicroRNA160a, in organogenesis and the mechanism regulating its ex-pression. Plant J 62:416–428.

44. Shi Z-H, et al. (2015) Overexpression of AtTTP affects ARF17 expression and leads tomale sterility in Arabidopsis. PLoS One 10:e0117317.

45. Fan T, et al. (2015) Rice osa-miR171c mediates phase change from vegetative to re-productive development and shoot apical meristem maintenance by repressing fourOsHAM transcription factors. PLoS One 10:e0125833.

46. Curaba J, Talbot M, Li Z, Helliwell C (2013) Over-expression of microRNA171 affectsphase transitions and floral meristem determinancy in barley. BMC Plant Biol 13:6.

47. Ma Z, et al. (2014) Arabidopsis miR171-targeted scarecrow-like proteins bind to GT cis-elements and mediate gibberellin-regulated chlorophyll biosynthesis under lightconditions. PLoS Genet 10:e1004519.

48. Wang L, Mai Y-X, Zhang Y-C, Luo Q, Yang H-Q (2010) MicroRNA171c-targeted SCL6-II,SCL6-III, and SCL6-IV genes regulate shoot branching in Arabidopsis. Mol Plant3:794–806.

49. Wang L, et al. (2015) Coordinated regulation of vegetative and reproductivebranching in rice. Proc Natl Acad Sci USA 112:15504–15509.

50. Deveau H, et al. (2008) Phage response to CRISPR-encoded resistance in Streptococcusthermophilus. J Bacteriol 190:1390–1400.

51. Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu J-K (2008) Identification of novel andcandidate miRNAs in rice by high throughput sequencing. BMC Plant Biol 8:25.

52. Yoshida S, Forno D, Cock J, Gomez K (1976) Routine procedure for growing rice plantsin culture solution. Laboratory Manual for Physiological Studies of Rice, eds YoshidaS; International Rice Research Institute (International Rice Research Institute, LosBaños, Philippines), pp 61–66.

53. Wang Z, et al. (2004) A practical vector for efficient knockdown of gene expression inrice (Oryza sativa L.). Plant Mol Biol Report 22:409–417.

54. Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryzasativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of theT-DNA. Plant J 6:271–282.







!

Supplemental*Information*Appendix*

Supplemental*Tables*

Table*S1.*List*of*different*spacer*sequences*used*in*the*STTM*constructs.*48bp*spacer*sequences*GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT!72bp*spacer*sequences*GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAAT!77bp*spacer*sequences*GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTAAAATATGGTCTAAAGAAGAAGGATATGGTCTAAAGAAGAAGAAT!88bp*spacer*sequences*GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAAT!!* *

Table*S2.*Summary*of*constructed*rice*STTMBmiRNAs*and*their*corresponding*T0*plants.*

!STTM*

targeted*miRNAs*

Sequences*of*STTM*target*miRNAs*(5'B3')*

Length*of*spacer*between*the*two*STTM*submodules*(nt)*

#*of*all*T0* *plants*

#*of*T0*plants*showing*visible*

phenotypes*

miR156*� *

TGACAGAAGAGAGTGAGCAC!88! 36! 16!

CGACAGAAGAGAATGAGCATA!

miR159* * ATTGGATTGAAGGGAGCTCCA! 88! 30! 17!

miR160*� *

TGCCTGGCTCCCTGTATGCCG!88! 32! 12!

TGCCTGGCTCCCTGAATGCCA!

miR162*TCGATAAACCTCTGCATCCAG!

88! 34!*TCGATAAGCCTCTGCATCCAG!

miR166* *� *

TCGGACCAGGCTTCATTCCCC!48! 34! 12!

TCGGACCAGGCTTCATTCCCT!

miR167* * *� *

TGAAGCTGCCAGCATGATCTA!88! 27! *TGAAGCTGCCAGCATGATCTG!

miR169*� *

TAGCCAAGGATGAATTGCCGG!88! 21!

*TAGCCAAGGACAAACTTGCCGG!

miR171* *TGATTGAGCCGCGCCAATATC!

77! 30! 11!TGATTGAGCCGCGCCATTATC!

miR172* *� *

AGATCTTGATGATGCTGCAT!88! 23! 10!

TGAATCTTGATGATGCTGCAC!

miR393* * * TCCAAAGGGATCGCATTGATC! 88! 32!

� * TCAGTGCAATCCCTTTGGAAT!

*miR397* *� *

TCATTGAGTGCAGCGTTGATG!88! 26! *TTATTGAGTGCAGCGTTGATG!

miR398*� *

TGTGTTCTCAGGTCACCCCTT!72! 46! 22!

TGTGTTCTCAGGTCGCCCCTG!

miR399* TGCCAAAGGAGAATTGCCCTG! 88! 38!

*miR413* CTAGTTTCACTTGTTCTGCAC! 88! 23!

*miR414* TCATCCTCATCATCATCGTCC! 88! 29!

*miR415* AACAGAACAGAAGCAGAGCAG! 88! 31!

*miR419* * TGATGAATGCTGACGATGTTG! 88! 36!

*miR435* TTATCCGGTATTGGAGTTGA! 88! 35!

*miR437* AAAGTTAGAGAAGTTTGACTT! 88! 35!

*miR441* * TACCATCAATATAAATGTGGGAAA! 88! 26! 14!

miR528* TGGAAGGGGCATGCAGAGGAG! 88! 24!

!miR808* ATGAATGTGGGAAATGTAAGAA! 88! 44!

*miR809* TGAATGTGAGAAATGTTAGAAT! 88! 29!

*miR827*� *

TAAGATGACCATCAGCGAAAA!88! 43! *TTAGATGACCATCAGCAAACA!

miR1425* TAGGATTCAATCCTTGCTGCT! 88! 25!

*miR1428*� *

TAAGATAAAGCCGTGAATTTG!88! 29! 8!

CGTTTTGCAAATTCGCAGGCC!

miR1436* ACATTATGGGACGGAGGGAGT! 88! 27!

*miR1440* TGCTCAAATACCACTCTCCT! 88! 23!

*miR1442* ATTCATAGTACTAGATGTGT! 88! 23!

ATTCATAGTACTAGATGTAT!

*miR1850*� *

TGGAAAGTTGGGAGATTGGGG!88! 31! *CTGTTTAGTTCACATCAATCTT!

miR1861*� *

TGATCTTGAGGCAGAAACTGAG!88! 24! *CGGTCTTGTGGCAAGAACTGAG!

miR1884* *� *

TGTGACGCCGTTGACTTTTCAT!71! 23!

*AATGTATGACGCTGTTGACTTTTA!

miR2101*� *

ATTTAACTCAAGTGAGCATTGT!88! 37! *ACATGTTTACAAGTTAAAATGT!

miR2118*� *

TTCTCGATGCCTCCCATTCCTA!88! 45! *TTCCCGATGCCTCCCATTCCTA!

miR2275*TTTGGTTTCCTCCAATATCTCA!

88! 33! *TTGGGTTTCCTATCCAATCTCA!

!

! !

Table*S3.*List*of*primers*and*their*applications.*!Primer*name* Primer*sequence*(5’B3’)* * Experiment*

OX2miR398a2F! CGGGATCCCAAGGGTTGGCAAGATGTCA! Vector!construction!

OX2miR398a2R! GGACTAGTGGGTCACCGAAATCCCGAAA! Vector!construction!

mOs07g46990252F! CGCGGATCCTGACTTCAGCAAGTTTGG! Vector!construction!

mOs07g46990252R! GGGTCGACGCCTGCGGCGCGAGCGCGACGAG! Vector!construction!

mOs07g46990232F! CCGTCGACACACGTATGCAGCTTCACCTCCCCCAAC! Vector!construction!

mOs07g46990232R! CCAAGCTTCATAGCCCGTCATGTGCTTATC! Vector!construction!

miR1562probe! GTGCTCACTCTCTTCTGTCA! Northern!blotting!

miR1592probe! TGGAGCTCCCTTCAATCCAAT! Northern!blotting!

miR1602probe! TGGCATACAGGGAGCCAGGCA! Northern!blotting!

miR1712probe! GATATTGGCGCGGCTCAATCA! Northern!blotting!

miR1722probe! ATGCAGCATCATCAAGATTCT! Northern!blotting!

miR3982probe! AAGGGGTGACCTGAGAACACA! Northern!blotting!

U62probe! TGTATCGTTCCAATTTTATCGGATGT! Northern!blotting!

Os07g469902RT2F! TCCATCATTGGCCGAGCTGTTG! qRT2PCR!

Os07g469902RT2R! TAACCCTGGAGTCCGATGATTCCG! qRT2PCR!

Os03g228102RT2F! AAGGCTGTTGTTGTGCTTGG! qRT2PCR!

Os03g228102RT2R! TCCGGCAGGATTGTAGTGTG! qRT2PCR!

Os04g484102RT2F! TTGGTGTTGTTCGTCTGGCT! qRT2PCR!

Os04g484102RT2R! GTTCCCAGGTCACCAAGAGG! qRT2PCR!

Os07g131702RT2F! ATGGAAGGGAAGCTGTTACT! qRT2PCR!

Os07g131702RT2R! TCAGGCGGTCGGGGGGAAGTAGAA! qRT2PCR!

OsSPL22RT2F! AATCACCACGGAGCGGCAAGATTC! qRT2PCR!

OsSPL22RT2R! TGGTAGTACGGCTCTTGGAACACG! qRT2PCR!

OsSPL32RT2F! AGCCACAACCAGAAGCAATTTCC! qRT2PCR!

OsSPL32RT2R! CTTGCCTGTTGCCTTGCATCAC! qRT2PCR!

OsSPL42RT2F! ATCTGAAGTTGGGACAACTGATGG! qRT2PCR!

OsSPL42RT2R! TGGCTGCAGAGAAGTCTTTCATTG! qRT2PCR!

OsSPL72RT2F! TGCTCTCTCTCTTCTGTCATCGG! qRT2PCR!

OsSPL72RT2R! GTCGGAGAAGAATTGCCACGAG! qRT2PCR!

OsSPL112RT2F! CACTACCGCGATCACTGTTTGATG! qRT2PCR!

OsSPL112RT2R! TGTCCATCACTTGGGAGAGCTG! qRT2PCR!

OsSPL122RT2F! CACGAAGAAGGAAACCGCAACAAG! qRT2PCR!

OsSPL122RT2R! ATCTGTCTGCTGCCTTGCATCG! qRT2PCR!

OsSPL132RT2F! TGCTCCCTCTCTTCTGTCATGC! qRT2PCR!

OsSPL132RT2R! AGTAGTGGCACGAACACACACAC! qRT2PCR!

OsSPL142RT2F! CAAGGGTTCCAAGCAGCGTAA! qRT2PCR!

OsSPL142RT2R! TGCACCTCATCAAGTGAGAC! qRT2PCR!

OsSPL172RT2F! GCTCTGTCCACATGGTTAGGTTCC! qRT2PCR!

OsSPL172RT2R! AGCGAGAAGAAAGAGGTCCAGGTG! qRT2PCR!

OsSPL182RT2F! GAAGCCACAGGCAGATAGCATGAG! qRT2PCR!

OsSPL182RT2R! ACGCGAACCTTGTCCCTTGTTG! qRT2PCR!

GAMYB2RT2F! GCCCACAAGTGGTCCTTTGA! qRT2PCR!

GAMYB2RT2R! GACGCGCACTCTGATTTCAC! qRT2PCR!

Os06g403302RT2F! AGTGCCATTGCCACACAAGA! qRT2PCR!

Os06g403302RT2R! AGGATGTCCTAAGGGGTCGT! qRT2PCR!

Os10g339402RT2F! ATCCGGGTGAGGTACCATTCAGTG! qRT2PCR!

Os10g339402RT2R! GGTCTCTCAATTCTCTCCCTGTCG! qRT2PCR!

Os03g439302RT2F! TACCACTGGATGGCAAGACGGATG! qRT2PCR!

Os03g439302RT2R! TGGTCAGGACCGATCTTGTGTTG! qRT2PCR!

Os12g418602RT2F! GCTGGATTGGTAGGAGCTATAGGG! qRT2PCR!

Os12g418602RT2R! CGGCATCTTCGGTATCAGACCAAC! qRT2PCR!

ACTIN12F! GAGATCACTGCCTTGGCTCC! qRT2PCR!

ACTIN12R! CGATAACAGCTCCTCTTGGC! qRT2PCR!

stem2loop2miR159! GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCA

GAGCCAACTGGAGC!

stem2loop!qRT2PCR!

Forward2miR159! GCGGCGGATTGGATTGAAGGGA! stem2loop!qRT2PCR!


GAGCCAACTTCCCC!

stem2loop!qRT2PCR!

Forward2miR166! GCGGCGGTCGGACCAGGCTTCA! stem2loop!qRT2PCR!


GAGCCAACCTGCAT!

stem2loop!qRT2PCR!

Forward2miR172! GCGGCGGAGAATCTTGATGATG! stem2loop!qRT2PCR!


GAGCCAACAAGGGG!

stem2loop!qRT2PCR!

Forward2miR398! GCGGCGGTGTGTTCTCAGGTCA! stem2loop!qRT2PCR!

universal!primer! GTGCAGGGTCCGAGGT! stem2loop!qRT2PCR!

U6!RT2Primer2F! CGATAAAATTGGAACGATACAGA! stem2loop!qRT2PCR!

U6!RT2Primer2R! ATTTGGACCATTTCTCGATTTGT! stem2loop!qRT2PCR!

!! !

Supplemental*Figures*

!

Figure*S1.*Transgenerational*stability*of*STTMBmiRNAs.*

The!phenotypes!of!STTM156,!STTM159!and!STTM172!plants!are!stable!in!five!generations.!

Scale!bars,!10!cm.!

!

*

Figure*S2.*STTM398*shows*delayed*heading*time.*

Gross!morphologies!of!WT!and!STTM398!plants!at!WT!heading!stage.!Scale!bar,!10!cm.!

! !

!

!

Figure*S3.*Comparison*of*grain*width*(A*and*C)*and*grain*length*(B*and*D)*of*WT,*

OXBmiR398a*and*mOs07g46990.plants.*

Scale!bars,!1!cm.!

!

! !

!

Figure*S4.*Sequence*of*miR398*resistant*version*mOs07g46990.*

The!asterisks!and!red!letters!indicate!the!mutations!introduced!into!the!miR398!target!site!in!

the!Os07g46990)gene.!

! !

!

Figure*S5.*Phenotypes*of*flower*organ*and*I2BKI*stained*pollen*grains*of*WT*and*

STTM172.!

(A)!Spikelet.!Scale!bar,!2!mm.!(B)!Spikelet!after!removing!the!palea!and!the!lemma.!Scale!bar,!

2!mm.!(C*and*D)!I22KI!stained!pollen!grains!of!WT!and!STTM172.!Scale!bars,!100µm.!

! !

!Figure*S6.*Seed*setting*rate*of*WT*and*STTM172.*

Data!are!presented!as!means!±!s.d.!n!=!15.!**P!<!0.01,!two2tailed,!two2sample!t!test.!

! !

!

Figure*S7.*Grain*width*of*WT*and*STTM156*plants.!

(A)!Grain!width!of!WT!and!STTM156.!Scale!bar,!1!cm.!

(B)!Statistics!data!of!grain!width!of!WT!and!STTM156.!Data!are!presented!as!means!±!s.d.!

n=10!(>120!seeds!for!each!biological!replicate).!NS,!not!significant.!

! !

!

Figure*S8.*Seedling*and*root*phenotypes*of*WT*and*STTM156*plants.* *

182days!seedling!grown!in!soil!at!greenhouse.!Scale!bar,!5!cm.!

! !

!

Figure*S9.*Statistical*data*for*grain*length*(A),*grain*width*(B)*and*1,000*grains*

weight*(C)*of*WT*and*STTM159.*

Data!are!presented!as!means!±!s.d.!n!=!10!(>120!seeds!for!each!biological!replicate)!in!A2C.!

**P!<!0.01,!two2tailed,!two2sample!t!test.!

! !

!

!Figure*S10.*Statistical*data*for*plant*height*of*WT*and*STTM441.*

Data!are!presented!as!means!±!s.d.!n!=!15.!**P!<!0.01,!two2tailed,!two2sample!t!test.!

! !

!!

!Figure*S11.*Quantification*of*miR159*(A),*miR172*(B)*and*miR398*(C)*expression*in*

wideBtype*and*STTM*plants*by*stemBloop*qRT–PCR.* *

U6!snRNA!was!used!to!normalize!samples.!ND,!not!detected.!

!

Dataset S1. Putative functions and predicted gene targets of miRNAs. #, we provide published functions for miRNAs in rice or monocot plants; for some miRNAs with diverse

putative functions, we only list the main functions and references. ＆, prediction of putative miRNA

targets was performed using the psRNATarget online server (http://plantgrn.noble.org/psRNATarget/)

with relatively strict rules including a maximum target accessibility-allowed maximum energy to unpair

the target site (UPE), of 25 and a maximum expectation value of 3; we also list some miRNA targets not

predicted by psRNATarget but confirmed in the published literature. *, for miRNAs having in excess of

30 predicted targets and we list the top 30 targets.

Targeted miRNAs

Putative functions and references#

Predicted targets＆

Annotation of targets

miR156 Regulation of plant

architecture (1-3).

Os01g69830 OsSPL2 - SBP-box gene family member,

expressed


expressed


expressed


expressed


expressed


expressed


expressed


expressed


expressed


expressed


expressed


development (4, 5).

Os01g59660 GAMYB-MYB family transcription factor,

putative, expressed

Os06g40330 MYB family transcription factor, putative,

expressed

Os01g12700 MYB family transcription factor, putative


expressed


expressed

Os09g36650 expressed protein


Os06g35910 FYVE zinc finger domain containing

protein, expressed

Os04g44354 UDP-glucoronosyl and UDP-glucosyl

transferase domain containing protein,

d Os11g02550 expressed protein

Os03g57190 TCP family transcription factor, putative,

expressed

Os07g05720 TCP family transcription factor, putative,

expressed

miR160 Regulation of leaf

and flower

development (5-9).

Os10g33940 auxin response factor 18, putative,

expressed

Os04g43910 auxin response factor, putative, expressed

Os04g59430 auxin response factor, putative, expressed


Os02g44760 hypothetical protein

Os09g25200 protein binding protein, putative,

expressed

Os02g37790 retrotransposon protein, putative,

unclassified, expressed





Os07g29360 tetratricopeptide repeat domain containing

protein, expressed

miR162 Regulate miRNA

biogenesis (10);

Response to abiotic

stress (11, 12).

Os03g02970 Dicer, putative, expressed

Os03g15230 DUF292 domain containing protein,

expressed



Os03g01090 peptidyl-prolyl cis-trans isomerase,

cyclophilin type, putative, expressed



Os03g57100 endoplasmic reticulum-Golgi intermediate

compartment protein 3, putative, expressed

Os03g56370 methyltransferase, putative, expressed


Os05g50380 glucose-1-phosphate adenylyltransferase

large subunit, chloroplast precursor,

i d mi166 Regulation of shoot

apical meristem and

Os12g41860 START domain containing protein,

expressed

lateral organ

formation (13-15).


expressed


expressed


expressed









Os08g34740 SGT1 protein, putative, expressed

miR167 Regulation of root

formation and flower

development (5, 16).

Os07g29820 NBS-LRR disease resistance protein,

putative, expressed

Os01g63290 transporter, major facilitator family,

putative, expressed


Os09g37890 serine/threonine-protein kinase receptor

precursor, putative, expressed

Os06g03830 retinol dehydrogenase, putative, expressed

Os07g49320 HEAT repeat family protein, putative,

expressed



Os04g18010 cleavage and polyadenylation specificity

factor subunit 1, putative, expressed

miR169 Response to different

abiotic stresses and

regulation of plant

development (5, 17-

20).

Os07g41720 nuclear transcription factor Y subunit,

putative, expressed


putative, expressed


putative, expressed


putative, expressed


putative, expressed


putative, expressed


Os05g37150 syntaxin 6, N-terminal domain containing

protein, expressed

Os04g52550 PAZ domain-containing protein, putative,

expressed

Os04g34330 serine/threonine-protein kinase receptor


Os08g33550 transposon protein, putative, Mutator sub-

class, expressed


Os07g28560 retrotransposon protein, putative, Ty3-

gypsy subclass, expressed


development and

response to different

Os02g44360 scarecrow transcription factor family

protein, putative, expressed

abiotic stresses (5,

21, 22).

Os06g01620 scarecrow, putative, expressed

Os02g19990 reticulon domain containing protein,

putative, expressed

miR172 Regulation of

flowering time, floral

organ identity and

plant architecture (3,

23-26).

Os07g13170 AP2 domain containing protein, expressed



Os08g39630 helix-loop-helix DNA-binding domain

containing protein, expressed

Os08g26870 wound responsive protein, putative,

expressed

Os11g23110 retrotransposon, putative, centromere-

specific, expressed


specific, expressed


specific, expressed


Os01g67970 ZOS1-20 - C2H2 zinc finger protein,

expressed

Os05g26926 chaperone protein dnaJ, putative,

expressed

Os05g26902 chaperone protein dnaJ, putative,

expressed

Os03g57070 amine oxidase-related, putative, expressed


Os05g47970 microtubule associated protein, putative,

expressed

Os11g07870 DEAD/DEAH box helicase domain


miR393 Response to stresses

and regulation of

various

developmental

processes via the

auxin pathway (20,

27-30).

Os05g05800 OsFBL21 - F-box domain and LRR




Os05g41010 oxidoreductase, putative, expressed

Os03g52320 GRF-interacting factor 1, putative,

expressed



Os02g06260 phytosulfokine receptor precursor,

putative, expressed


Os08g09860 hydroxyacid oxidase 1, putative, expressed

Os08g03440 actin, putative, expressed

miR397 Regulation of rice

yield (30).

Os01g62490 laccase precursor protein, putative,

expressed


expressed


expressed

Os11g48060 laccase-22 precursor, putative, expressed


expressed


expressed

Os01g63180 laccase-6 precursor, putative, expressed


expressed


expressed


expressed


expressed



Os09g27950 galactosyltransferase, putative, expressed


protein, expressed

Os10g03850 OsFBX352 - F-box domain containing

protein, expressed


protein, expressed

Os07g31310 PPR repeat domain containing protein,

putative, expressed

Os02g01710 peptidase family C78 domain containing

protein, expressed



Os08g35210 ferric reductase, putative, expressed


miR398 Regulation of copper

homeostasis and

response to biotic

and abiotic stresses

(31-35).

Os07g46990 copper/zinc superoxide dismutase,

putative, expressed


putative, expressed

Os04g48410 copper chaperone for superoxide

dismutase, putative, expressed

Os01g68770 selenium-binding protein, putative,

expressed



miR399 Response to

phosphate and other

multiple nutrient

starvation responses;

Regulation of

phosphate

homeostasis (3, 36,

37).

Os05g48390 ubiquitin conjugating enzyme protein,

putative, expressed

Os05g45350 dnaJ domain containing protein, expressed


Os06g19470 WW domain containing protein, expressed

miR413 Unknown. Os08g17400 WRKY89, expressed


Os08g13570 exo70 exocyst complex subunit family


Os12g21930 PPR repeat containing protein, expressed


Os12g44210 ATPase, AAA family domain containing

protein, expressed

miR414*

Response to salinity

stress (38).





Os06g33520 DEAD/DEAH box helicase, putative,

expressed

Os09g38400 prostatic spermine-binding protein










Os12g01290 ulp1 protease family protein, putative,

expressed

Os01g16670 BSD domain-containing protein, putative,

expressed












Os08g43480 zinc finger, C3HC4 type family protein,

expressed




Os03g04920 multidrug resistance-associated protein,

putative, expressed

Os08g19890 ZOS8-03 - C2H2 zinc finger protein,

expressed




Os09g06560 WD domain, G-beta repeat domain




Os07g22450 NAC domain containing protein, putative,

expressed






protein, expressed

mi415 Response to fungal

elicitors (39).

Os12g42280 9-cis-epoxycarotenoid dioxygenase 1,

chloroplast precursor, putative, expressed

Os05g02520 cupin domain containing protein,

expressed

Os02g18320 BRASSINOSTEROID INSENSITIVE 1-

associated receptor kinase 1 precursor,

i d Os03g02514 hydrolase, alpha/beta fold family protein,

putative, expressed

Os03g17920 RNA pseudouridine synthase, putative,

expressed


Os06g02000 adenylate kinase, putative, expressed

Os03g61990 glycine-rich RNA-binding protein 7,

putative, expressed

Os02g26810 cytochrome P450, putative, expressed


Os04g38630 helicase conserved C-terminal domain


Os02g01560 40S ribosomal protein S4, putative,

expressed

Os02g56540 kinesin motor domain containing protein,

putative, expressed

Os01g72490 LRP1, putative, expressed



Os10g35690 ribosomal protein S18 containing protein,

expressed

Os12g40890 OsIAA30 - Auxin-responsive Aux/IAA

gene family member, expressed



Os12g40560 KH domain containing protein, putative,

expressed

Os05g37330 60S acidic ribosomal protein, putative,

expressed

miR419 Response to salinity

stress and nitrogen

starvation (40, 41).

Os07g31540 ubiquitin family protein, putative,

expressed

Os06g35870 lectin protein kinase family protein,

putative, expressed


Os08g20000 NB-ARC domain containing protein,

expressed

Os02g32200 thioesterase family protein, putative,

expressed

Os01g44970 polygalacturonase, putative, expressed

Os01g45060 polygalacturonase, putative, expressed


Os01g03060 splicing factor, putative, expressed

miR435 Response to the blast

fungus

Magnaportheoryzae

infection (42).

Os07g41730 OsPOP16 - Putative Prolyl Oligopeptidase

homologue, expressed

Os01g36790 TKL_IRAK_DUF26-lf - DUF26 kinases

have homology to DUF26 containing loci,

expressed

Os07g41320 COBRA-like protein precursor, putative,

expressed



miR437 Response to

phosphorus

deficiency (43).

Os02g42350 nitrilase, putative, expressed

Os06g46670 glutamate receptor, putative, expressed

Os04g33880 HVA22, putative, expressed

Os01g38190 plant protein of unknown function domain


Os01g65150 proton-dependent oligopeptide transport,

putative, expressed

Os09g31514 dihydroflavonol-4-reductase, putative,

expressed


expressed

Os01g61430 HIT zinc finger domain containing protein,

expressed


Os02g27310 TKL_IRAK_DUF26-lc - DUF26 kinases


d Os11g42220 laccase precursor protein, putative,

expressed


Os07g35290 TKL_IRAK_DUF26-lc0 - DUF26 kinases


d Os02g48900 aspartic proteinase nepenthesin-1


Os12g07110 acyl-CoA synthetase protein, putative,

expressed

Os01g72370 helix-loop-helix DNA-binding domain



Os02g36140 terpene synthase, putative, expressed




miR441 Regulation of ABA

signaling and

response to abiotic

stress (44).



putative, expressed


Os12g37480 invertase/pectin methylesterase inhibitor

family protein, putative, expressed

Os04g52020 PHD-finger domain containing protein,

putative, expressed

Os05g42350 ferredoxin--nitrite reductase, putative,

expressed

Os07g47284 DNA polymerase zeta catalytic subunit,

putative, expressed


unclassified



Os02g29980 X8 domain containing protein, expressed



Os04g52500 lecithine cholesterol acyltransferase,

putative, expressed


unclassified

Os02g48620 tetratricopeptide repeat, putative,

expressed

miR528 Response to different

abiotic stresses (20,

45-47).

Os08g04310 plastocyanin-like domain containing




Os01g40150 eukaryotic translation initiation factor 5B,

putative, expressed

Os06g37150 L-ascorbate oxidase precursor, putative,

expressed




expressed

Os09g33800 arabinogalactan protein, putative,

expressed


putative, expressed


Os01g03620 multicopper oxidase domain containing

protein, expressed

Os01g03640 multicopper oxidase domain containing

protein, expressed


Os02g52910 zinc finger protein, putative, expressed


Os01g70020 DEK C terminal domain containing

protein, expressed



Os08g27460 transposon protein, putative, CACTA,

En/Spm sub-class, expressed


miR808 Response to rice

ragged stunt virus

(48).




putative, expressed

Os09g34250 UDP-glucoronosyl and UDP-glucosyl


d Os04g20400 cytokinin-O-glucosyltransferase 1,

putative, expressed

Os10g04580 ras-related protein, putative, expressed

Os06g23274 zinc finger, C3HC4 type, domain


Os03g09880 AIR12, putative, expressed


Os09g35690 zinc RING finger protein, putative,

expressed





Os01g19529 pentatricopeptide, putative, expressed

Os03g62070 hydrolase, putative, expressed


protein, expressed

Os02g51130 glycosyl transferase 8 domain containing




copia subclass, expressed





Os01g13150 metallo-beta-lactamase family protein,

putative, expressed

Os10g11750 LTPL89 - Protease inhibitor/seed

storage/LTP family protein precursor,

d Os01g16330 OsRhmbd2 - Putative Rhomboid



Os10g37520 major facilitator superfamily domain-

containing protein 5, putative, expressed

Os03g02380 major facilitator superfamily domain-

containing protein 5, putative, expressed

miR809 Unknown. Os09g34250 UDP-glucoronosyl and UDP-glucosyl


d Os03g09880 AIR12, putative, expressed





putative, expressed


Os04g20400 cytokinin-O-glucosyltransferase 1,

putative, expressed

Os10g04580 ras-related protein, putative, expressed

Os06g23274 zinc finger, C3HC4 type, domain



protein, expressed

Os02g51130 glycosyl transferase 8 domain containing






Os03g39610 chlorophyll A-B binding protein, putative,

expressed

Os02g55480 zinc finger, C3HC4 type domain


Os09g35690 zinc RING finger protein, putative,

expressed




Os03g62070 hydrolase, putative, expressed

Os05g34260 transposon protein, putative, Ac/Ds sub-

class, expressed


Os12g37480 invertase/pectin methylesterase inhibitor





miR827 Response to

phosphate starvation

and regulation of

phosphate

homeostasis (49-51).

Os02g16110 xa1, putative, expressed

Os02g45520 uncharacterized membrane protein,

putative, expressed

Os04g48390 uncharacterized membrane protein,

putative, expressed

Os02g56370 OsWAK20 - OsWAK receptor-like protein

kinase, expressed

miR1425 Response to ABA

and H2O2 (52, 53);

Regulation of rice

grain filling (54).

Os10g35640 Rf1, mitochondrial precursor, putative,

expressed



expressed


expressed


expressed

Os01g61190 exo70 exocyst complex subunit, putative,

expressed


expressed


expressed


expressed


expressed

Os05g40700 transmembrane protein 56, putative,

expressed

Os10g08580 FAD binding domain of DNA photolyase

domain containing protein, expressed


Os06g32944 transposon protein, putative, Pong sub-

class, expressed


class, expressed


class, expressed


grain filling (54).

Os07g10256 mitosis protein dim1, putative, expressed

Os01g55880 hemimethylated DNA binding domain


Os08g07540 hemimethylated DNA binding domain


Os01g06520 verticillium wilt disease resistance protein,

putative, expressed


expressed




Os12g06340 BEL1-like homeodomain transcription

factor, putative, expressed



miR1436*

Regulation of rice

grain filling (54);

Response to abiotic

stress (55).




Os03g63370 CRAL/TRIO domain containing protein,

expressed

Os02g14290 scramblase, putative, expressed



Os01g52864 transmembrane protein, putative,

expressed

Os09g36320 tyrosine protein kinase domain containing


Os08g36840 glycoprotein 3-alpha-L-fucosyltransferase

A, putative, expressed

Os03g15350 Sel1 repeat domain containing protein,

putative, expressed



Os05g43570 AGC_AGC_other_NDRh_TRCd - ACG

kinases include homologs to PKA, PKG

d PKC d Os12g16350 enoyl-CoA hydratase/isomerase family


Os06g11500 MCM9 - Putative minichromosome

maintenance MCM family subunit 9,

d Os11g13390 expressed protein





Os06g35590 reticuline oxidase-like protein precursor,

putative, expressed

Os03g08530 aminotransferase, classes I and II, domain



Os09g21210 beta-glucan-binding protein 4, putative,

expressed

Os03g48010 exostosin, putative, expressed


Os09g37710 NIN, putative, expressed

Os01g18120 cinnamoyl CoA reductase, putative,

expressed



miR1440 Unknown. Os07g27450 expressed protein











expressed

Os01g64810 zinc finger DHHC domain-containing


miR1442 Unknown. Os09g12860 expressed protein

Os02g24940 conserved hypothetical protein



Os02g28720 spotted leaf 11, putative, expressed


Os06g39520 myristoyl-acyl carrier protein thioesterase,




protein, expressed


grain filling (56);

Response to

dehydration stress

(57).

Os10g36650 actin, putative, expressed

Os03g46440 BTBA4 - Bric-a-Brac,Tramtrack, Broad

Complex BTB domain with Ankyrin repeat

i d Os09g24820 ZF-HD protein dimerisation region



Os04g47410 DHHC zinc finger domain containing

protein, expressed

Os03g01216 phosphatidylserine decarboxylase,

putative, expressed



Os02g48140 hsp20/alpha crystallin family protein,

putative, expressed

Os08g04650 pectinesterase inhibitor domain containing

protein, expressed



Os06g49250 peptide transporter PTR2, putative,

expressed

Os10g35810 thylakoid lumenal protein, putative,

expressed

Os12g06610 nucleolar complex protein 2, putative,

expressed


Os08g43580 acyl carrier protein, putative, expressed

miR1861 Response to arsenate

and arsenite stress

(57);

Regulation of rice

grain filling (54, 58).

Os06g33570 cyclic nucleotide-gated ion channel 1,

putative, expressed



Os11g08950 protein kinase family protein, putative,

expressed

Os05g51790 RecF/RecN/SMC N terminal domain




Os03g21980 tRNA pseudouridine synthase family


Os02g53680 RPA1A - Putative single-stranded DNA

binding complex subunit 1, expressed

Os08g09250 glyoxalase family protein, putative,

expressed

Os08g09250 glyoxalase family protein, putative,

expressed

Os01g63810 starch binding domain containing protein,

putative, expressed

Os06g44970 auxin efflux carrier component, putative,

expressed


miR1884* Response to drought

and heat stress (20,

59).

Os06g48240 AAA ATPase, putative, expressed

Os09g33710 Os9bglu33 - beta-glucosidase homologue,

similar to G. max hydroxyisourate

h d l d Os03g19380 calvin cycle protein CP12, putative,

expressed


Os01g70190 exostosin family domain containing

protein, expressed

Os01g64520 uricase, putative, expressed



Os04g09900 ent-kaurene synthase, chloroplast



Os11g34460 OsFBO10 - F-box and other domain



kinase, expressed

Os07g35870 basic helix-loop-helix DND-binding

domain containing protein, expressed


Os08g04920 OsDegp11 - Putative Deg protease



Os01g73250 abscisic stress-ripening, putative,

expressed


Os12g163503 enoyl-CoA hydratase/isomerase family


Os03g29540 ATP-dependent protease, putative,

expressed

Os04g58730 AT hook motif domain containing protein,

expressed

Os02g43370 transposon protein, putative, unclassified,

expressed

Os07g28570 leucine rich repeat protein, putative,

expressed


Os03g60890 calmodulin binding protein, putative,

expressed

Os02g34950 ATP binding protein, putative, expressed



Os01g72120 glutathione S-transferase, putative,

expressed



miR2101 Regulation of grain

filling (60).

Os03g25620 LTV1, putative, expressed

Os07g49240 MRH1, putative, expressed

Os04g42090 CPuORF7 - conserved peptide uORF-

containing transcript, expressed


kinase, expressed






Os01g06290 splicing factor, arginine/serine-rich,

putative, expressed






copia subclass, expressed

Os10g24900 OsFBK22 - F-box domain and kelch repeat


Os11g41150 nitrilase-associated protein, putative,

expressed

Os02g42880 remorin C-terminal domain containing




Os01g04650 PB1 domain containing protein, expressed

Os03g51440 LRR receptor-like protein kinase, putative,

expressed

Os04g42420 nodulin, putative, expressed

Os11g19460 haloacid dehalogenase-like hydrolase


miR2118 Response to drought

stress (61-63).

Os08g42700 resistance protein, putative, expressed


putative, expressed


putative, expressed

Os01g20720 CC-NBS-LRR, putative, expressed

Os12g37290 resistance protein T10rga2-1A, putative,

expressed

Os04g30690 NBS type disease resistance protein,

putative, expressed

Os04g30610 disease resistance protein RGA2, putative,

expressed

Os05g34220 vrga1, putative, expressed


putative, expressed


putative, expressed


specific, expressed






putative, expressed

Os03g15910 membrane protein, putative, expressed

Os08g43700 OsSAUR36 - Auxin-responsive SAUR

gene family member, expressed


Os09g14010 disease resistance protein RPS2, putative,

expressed

Os09g14060 disease resistance protein RPS2, putative,

expressed

Os10g07400 disease resistance RPP13-like protein 1,

putative, expressed

Os03g15250 lectin-like receptor kinase, putative,

expressed


putative, expressed

Os11g45780 RGH2B, putative, expressed



expressed

Os06g13720 dehydrogenase E1 component domain


Os02g43470 glutamate dehydrogenase protein, putative,

expressed

miR2275* Response to cold and

drought stress (20,

64).







Os04g58504 choline transporter-related, putative,

expressed

Os04g58470 choline transporter-related, putative,

expressed






gypsy subclass







Os01g55590 AMP-binding enzyme, putative, expressed

Os06g44230 DNA-directed RNA polymerase 3A,


1. Jiao Y, et al. (2010) Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nature genetics 42(6):541-544.

2. Miura K, et al. (2010) OsSPL14 promotes panicle branching and higher grain productivity in rice. Nature genetics 42(6):545-549.

3. Hu B, et al. (2015) MicroRNA399 is involved in multiple nutrient starvation responses in rice. Frontiers in plant science 6.

4. Allen RS, et al. (2007) Genetic analysis reveals functional redundancy and the major target genes of the Arabidopsis miR159 family. Proceedings of the National Academy of Sciences 104(41):16371-16376.

5. Todesco M, Rubio-Somoza I, Paz-Ares J, & Weigel D (2010) A collection of target mimics for comprehensive analysis of microRNA function in Arabidopsis thaliana. PLoS Genet 6(7):e1001031.

6. Liu X, et al. (2010) The role of floral organs in carpels, an Arabidopsis loss‐of‐function mutation in MicroRNA160a, in organogenesis and the mechanism regulating its expression. The Plant Journal 62(3):416-428.

7. Mallory AC, Bartel DP, & Bartel B (2005) MicroRNA-directed regulation of Arabidopsis AUXIN RESPONSE FACTOR17 is essential for proper development and modulates expression of early auxin response genes. The Plant Cell 17(5):1360-1375.

8. Shi Z-H, et al. (2015) Overexpression of AtTTP affects ARF17 expression and leads to male sterility in Arabidopsis. PloS one 10(3):e0117317.

9. Liu PP, et al. (2007) Repression of AUXIN RESPONSE FACTOR10 by microRNA160 is critical for seed germination and post‐germination stages. The Plant Journal 52(1):133-146.

10. Xie Z, Kasschau KD, & Carrington JC (2003) Negative feedback regulation of Dicer-Like1 in Arabidopsis by microRNA-guided mRNA degradation. Current Biology 13(9):784-789.

11. Barciszewska-Pacak M, et al. (2015) Arabidopsis microRNA expression regulation in a wide range of abiotic stress responses. Frontiers in plant science 6.

12. Sun G, Stewart Jr CN, Xiao P, & Zhang B (2012) MicroRNA expression analysis in the cellulosic biofuel crop switchgrass (Panicum virgatum) under abiotic stress. PLoS One 7(3):e32017.

13. Byrne ME (2006) Shoot meristem function and leaf polarity: the role of class III HD–ZIP genes. PLoS Genet 2(6):e89.

14. Jia X, et al. (2015) Functional plasticity of miR165/166 in plant development revealed by small tandem target mimic. Plant Science 233:11-21.

15. Yan J, et al. (2012) Effective small RNA destruction by the expression of a

short tandem target mimic in Arabidopsis. The Plant Cell 24(2):415-427. 16. Gutierrez L, et al. (2009) Phenotypic plasticity of adventitious rooting in

Arabidopsis is controlled by complex regulation of AUXIN RESPONSE FACTOR transcripts and microRNA abundance. The Plant Cell 21(10):3119-3132.

17. Zhang X, et al. (2011) Over-expression of microRNA169 confers enhanced drought tolerance to tomato. Biotechnology letters 33(2):403-409.

18. Zhao M, Ding H, Zhu JK, Zhang F, & Li WX (2011) Involvement of miR169 in the nitrogen‐starvation responses in Arabidopsis. New Phytologist 190(4):906-915.

19. Li W-X, et al. (2008) The Arabidopsis NFYA5 transcription factor is regulated transcriptionally and posttranscriptionally to promote drought resistance. The Plant Cell 20(8):2238-2251.

20. Barrera-Figueroa BE, et al. (2012) High throughput sequencing reveals novel and abiotic stress-regulated microRNAs in the inflorescences of rice. BMC plant biology 12(1):1.

21. Zhou L, et al. (2010) Genome-wide identification and analysis of drought-responsive microRNAs in Oryza sativa. Journal of experimental botany 61(15):4157-4168.

22. Zhao M, et al. (2012) Cloning and characterization of maize miRNAs involved in responses to nitrogen deficiency. PloS one 7(1):e29669.

23. Chuck G, Meeley R, Irish E, Sakai H, & Hake S (2007) The maize tasselseed4 microRNA controls sex determination and meristem cell fate by targeting Tasselseed6/indeterminate spikelet1. Nature genetics 39(12):1517-1521.

24. Chen X (2004) A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 303(5666):2022-2025.

25. Lee DY & An G (2012) Two AP2 family genes, supernumerary bract (SNB) and Osindeterminate spikelet 1 (OsIDS1), synergistically control inflorescence architecture and floral meristem establishment in rice. The Plant Journal 69(3):445-461.

26. Zhu Q-H, Upadhyaya NM, Gubler F, & Helliwell CA (2009) Over-expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa). BMC Plant Biology 9(1):1.

27. Iglesias MJ, et al. (2014) MiR393 regulation of auxin signaling and redox-related components during acclimation to salinity in Arabidopsis. PloS one 9(9):e107678.

28. Xia K, et al. (2012) OsTIR1 and OsAFB2 downregulation via OsmiR393 overexpression leads to more tillers, early flowering and less tolerance to salt and drought in rice. PLoS One 7(1):e30039.

29. Bian H, et al. (2012) Distinctive expression patterns and roles of the miRNA393/TIR1 homolog module in regulating flag leaf inclination and primary and crown root growth in rice (Oryza sativa). New Phytologist 196(1):149-161.

30. Gao P, et al. (2011) osa-MIR393: a salinity-and alkaline stress-related microRNA gene. Molecular biology reports 38(1):237-242.

31. Guan Q, Lu X, Zeng H, Zhang Y, & Zhu J (2013) Heat stress induction of miR398 triggers a regulatory loop that is critical for thermotolerance in Arabidopsis. The Plant Journal 74(5):840-851.

32. Yamasaki H, Hayashi M, Fukazawa M, Kobayashi Y, & Shikanai T (2009) SQUAMOSA promoter binding protein–like7 is a central regulator for copper homeostasis in Arabidopsis. The Plant Cell 21(1):347-361.

33. Jagadeeswaran G, Saini A, & Sunkar R (2009) Biotic and abiotic stress down-regulate miR398 expression in Arabidopsis. Planta 229(4):1009-1014.

34. Sunkar R, Kapoor A, & Zhu J-K (2006) Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance. The Plant Cell 18(8):2051-2065.

35. Yamasaki H, et al. (2007) Regulation of copper homeostasis by micro-RNA in Arabidopsis. Journal of Biological Chemistry 282(22):16369-16378.

36. Fujii H, Chiou T-J, Lin S-I, Aung K, & Zhu J-K (2005) A miRNA involved in phosphate-starvation response in Arabidopsis. Current Biology 15(22):2038-2043.

37. Pant BD, Buhtz A, Kehr J, & Scheible WR (2008) MicroRNA399 is a long‐distance signal for the regulation of plant phosphate homeostasis. The Plant Journal 53(5):731-738.

38. Macovei A & Tuteja N (2012) microRNAs targeting DEAD-box helicases are involved in salinity stress response in rice (Oryza sativa L.). BMC plant biology 12(1):1.

39. Baldrich P, et al. (2014) Small RNA profiling reveals regulation of Arabidopsis miR168 and heterochromatic siRNA415 in response to fungal elicitors. BMC genomics 15(1):1.

40. Deng P, et al. (2015) Global Identification of MicroRNAs and Their Targets in Barley under Salinity Stress. PloS one 10(9):e0137990.

41. Krapp A, et al. (2011) Arabidopsis roots and shoots show distinct temporal adaptation patterns toward nitrogen starvation. Plant Physiology 157(3):1255-1282.

42. Li Y, et al. (2014) Multiple rice microRNAs are involved in immunity against

the blast fungus Magnaporthe oryzae. Plant physiology 164(2):1077-1092. 43. Zhu YY, et al. (2010) microRNA expression profiles associated with

phosphorus deficiency in white lupin (Lupinus albus L.). Plant Science 178(1):23-29.

44. Yan Y, et al. (2011) Small RNAs from MITE‐derived stem‐loop precursors regulate abscisic acid signaling and abiotic stress responses in rice. The Plant Journal 65(5):820-828.

45. Nischal L, et al. (2012) Identification and comparative analysis of microRNAs associated with low-N tolerance in rice genotypes. PLoS One 7(12):e50261.

46. Liu Q, et al. (2015) Involvement of miR528 in the Regulation of Arsenite Tolerance in Rice (Oryza sativa L.). Journal of Agricultural and Food Chemistry 63(40):8849-8861.

47. Yuan S, et al. (2015) Constitutive Expression of Rice MicroRNA528 Alters Plant Development and Enhances Tolerance to Salinity Stress and Nitrogen Starvation in Creeping Bentgrass. Plant physiology 169(1):576-593.

48. Zhang Y, Chen X, Yang F, Zhang L, & Liu W (2016) miRNA: A Novel Link Between Rice Ragged Stunt Virus and Oryza sativa. Indian Journal of Microbiology 56(2):219-224.

49. Lin S-I, et al. (2010) Complex regulation of two target genes encoding SPX-MFS proteins by rice miR827 in response to phosphate starvation. Plant and Cell Physiology 51(12):2119-2131.

50. Hackenberg M, Shi B-J, Gustafson P, & Langridge P (2013) Characterization of phosphorus-regulated miR399 and miR827 and their isomirs in barley under phosphorus-sufficient and phosphorus-deficient conditions. BMC plant biology 13(1):214.

51. Lin W-Y, Huang T-K, & Chiou T-J (2013) NITROGEN LIMITATION ADAPTATION, a target of microRNA827, mediates degradation of plasma membrane–localized phosphate transporters to maintain phosphate homeostasis in Arabidopsis. The Plant Cell 25(10):4061-4074.

52. Tian C, Zuo Z, & Qiu J-L (2015) Identification and Characterization of ABA-Responsive MicroRNAs in Rice. Journal of Genetics and Genomics 42(7):393-402.

53. Li T, Li H, Zhang Y-X, & Liu J-Y (2010) Identification and analysis of seven H2O2-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica). Nucleic Acids Research:gkq1047.

54. Peng T, et al. (2013) Characterization and expression patterns of microRNAs involved in rice grain filling. PloS one 8(1):e54148.

55. Unver T, Bakar M, Shearman RC, & Budak H (2010) Genome-wide profiling

and analysis of Festuca arundinacea miRNAs and transcriptomes in response to foliar glyphosate application. Molecular Genetics and Genomics 283(4):397-413.

56. Lan Y, et al. (2012) Identification of novel MiRNAs and MiRNA expression profiling during grain development in indica rice. BMC genomics 13(1):264.

57. Budak H & Akpinar A (2011) Dehydration stress-responsive miRNA in Brachypodium distachyon: evident by genome-wide screening of microRNAs expression. Omics: a journal of integrative biology 15(11):791-799.

58. Zhu Q-H, et al. (2008) A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains. Genome research 18(9):1456-1465.

59. Sailaja B, et al. (2014) Prediction and expression analysis of miRNAs associated with heat stress in Oryza sativa. Rice Science 21(1):3-12.

60. Peng T, et al. (2014) Differentially expressed microRNA cohorts in seed development may contribute to poor grain filling of inferior spikelets in rice. BMC plant biology 14(1):1.

61. Wu B-f, Li W-f, Xu H-y, Qi L-w, & Han S-y (2015) Role of cin-miR2118 in drought stress responses in Caragana intermedia and Tobacco. Gene 574(1):34-40.

62. Arenas-Huertero C, et al. (2009) Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress. Plant molecular biology 70(4):385-401.

63. Wang T, Chen L, Zhao M, Tian Q, & Zhang W-H (2011) Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing. BMC genomics 12(1):367.

64. Lunardon A, Forestan C, Farinati S, Axtell M, & Varotto S (2016) Genome-wide characterization of maize small RNA loci and their regulation in the required to maintain repression6-1 (rmr6-1) mutant and long-term abiotic stresses. Plant physiology:pp. 01205.02015.

short tandem target mimic rice lines uncover functions of ......new agronomic targets: mir398...

Documents