shp2 inhibition overcomes rtk-mediated pathway ... · rtk/shp2–mediated feedback activation is...

Cancer Biology and Translational Studies

SHP2 Inhibition Overcomes RTK-MediatedPathway Reactivation in KRAS-Mutant TumorsTreated with MEK InhibitorsHengyu Lu1, Chen Liu1, Roberto Velazquez1, Hongyun Wang1, Lukas Manuel Dunkl2,Malika Kazic-Legueux2, Anne Haberkorn2, Eric Billy2, Eusebio Manchado2,Saskia M. Brachmann2, Susan E. Moody1, Jeffrey A. Engelman1, Peter S. Hammerman1,Giordano Caponigro1, Morvarid Mohseni1, and Huai-Xiang Hao1

Abstract

FGFR1 was recently shown to be activated as part of acompensatory response to prolonged treatment with the MEKinhibitor trametinib in several KRAS-mutant lung and pan-creatic cancer cell lines. We hypothesize that other receptortyrosine kinases (RTK) are also feedback-activated in thiscontext. Herein, we profile a large panel of KRAS-mutantcancer cell lines for the contribution of RTKs to the feedbackactivation of phospho-MEK following MEK inhibition, usingan SHP2 inhibitor (SHP099) that blocks RAS activationmedi-ated by multiple RTKs. We find that RTK-driven feedbackactivation widely exists in KRAS-mutant cancer cells, to a less

extent in those harboring the G13D variant, and involvesseveral RTKs, including EGFR, FGFR, and MET. We furtherdemonstrate that this pathway feedback activation ismediatedthroughmutant KRAS, at least for the G12C, G12D, andG12Vvariants, and wild-type KRAS can also contribute significantlyto the feedback activation. Finally, SHP099 and MEK inhibi-tors exhibit combination benefits inhibiting KRAS-mutantcancer cell proliferation in vitro and in vivo. These findingsprovide a rationale for exploration of combining SHP2 andMAPK pathway inhibitors for treating KRAS-mutant cancers inthe clinic.

IntroductionKRASmutations occur in about 30% of all cancers and account

for approximately one million cancer-related deaths per yearworldwide (1). Direct inhibition of mutant KRAS largely remainsa pharmacologic challenge and inhibiting the downstream mito-gen-activated protein kinase (MAPK) signaling pathway withMEK inhibitors (MEKi) had limited clinical efficacy in KRAS-mutant tumors (2–4). One possible explanation is reactivation oftheMAPK pathway due to the alleviation of the negative feedbackmodulation (5, 6), which is commonly observed in KRAS-mutantcells (7–9). In such a scenario, prevention of pathway reactivationwould maintain pathway suppression thereby improving antitu-mor efficacy. Strategies to block pathway reactivation havefocused on cotargeting other MAPK pathway components suchas RAF and ERK (10, 11), as cotargeting upstream RTKs wasgenerally considered likely to be ineffective based on the dogma

that mutant KRAS is constitutively active and does not requirefurther upstream signaling input (12, 13). However, this dogmawas challenged by the recent development of KRASG12C-specificinhibitors (G12Ci) that bind and stabilize KRASG12C in its gua-nosine diphosphate (GDP)-bound inactive conformation(14–16). These findings revealed previously unappreciated biol-ogy that KRASG12C maintains intrinsic guanosine triphosphatase(GTPase) activity and cycles between the guanosine triphosphate(GTP)-bound conformation and the GDP-bound conformation,a process regulated by RTKs (17). These observations suggest thatKRASG12C may require RTK activity for pathway reactivation.Moreover, FGFR1 was recently found to be activated as a com-pensatory response to prolonged treatment with MEK inhibitortrametinib in KRAS-mutant lung and pancreatic cancer cells, andFGFR1 inhibition in combination with trametinib enhancedtumor growth inhibition (7, 18). However, it remains inconclu-sive whether other KRAS variants (e.g., non-cysteine G12, G13, orQ61 mutations) are similarly susceptible to RTK regulation andwhether other RTKs besides FGFR1 contribute to the MAPKpathway reactivation.

The nonreceptor protein tyrosine phosphatase SHP2, encodedby the PTPN11 gene, is part of the signaling adaptor complex thatmediates RAS activation downstream of RTK as well as signalingdownstream of immune inhibitory coreceptors such as T-cell–programed cell death (PD-1; refs. 19–22). The recently describedallosteric SHP2 inhibitor SHP099 enables a specific way tointerrogate the collective effects of RTKs in RAS-driven process-es (23, 24). Herein, we used SHP099, as well as individual RTKinhibitors, to determine how often, and in what capacity, RTKsmediate pathway reactivation in a large panel (n ¼ 34) of KRAS-mutant cell lines, by measuring the reduction of phospho-MEK

1Novartis Institutes for BioMedical Research, Oncology Disease Area, Cam-bridge, Massachusetts. 2Novartis Institutes for BioMedical Research, OncologyDisease Area, Novartis Pharma AG, Basel, Switzerland.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

H. Lu and C. Liu contributed equally to this article.

Corresponding Author: Huai-Xiang Hao, Novartis Institutes for BioMedicalResearch, 250 Massachusetts Avenue, Cambridge, MA 02139. Phone: 617-871-3723; Fax: 617-871-4213; E-mail: [email protected]

Mol Cancer Ther 2019;18:1323–34

doi: 10.1158/1535-7163.MCT-18-0852

�2019 American Association for Cancer Research.

MolecularCancerTherapeutics

www.aacrjournals.org 1323

on June 28, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst May 8, 2019; DOI: 10.1158/1535-7163.MCT-18-0852

http://crossmark.crossref.org/dialog/?doi=10.1158/1535-7163.MCT-18-0852&domain=pdf&date_stamp=2019-6-27http://mct.aacrjournals.org/

adaptive induction after cotreatment with MEKi as a surrogatereadout for RAS activation. We also found that combining SHP2andMEK inhibitors led to enhanced antiproliferative activity andMAPK pathway suppression in KRAS-mutant cells with RTK/SHP2–mediated feedback activation in vitro and in vivo.

Materials and MethodsCell lines and drugs

Human cancer cell lines originated from theCCLE (25) authen-ticated by single-nucleotide polymorphism analysis and tested forMycoplasma infection using a PCR-based detection technology(https://www.idexxbioanalytics.com/) when CCLE was estab-lished in 2012. All cell lines used were directly thawed from theCCLE collection stock. All cell lines were cultured in RPMIMedium (Thermo Fisher Scientific) except MIA PaCa-2 (DMEM)andLS180/LS 123 (MEMa), supplementedwith10%FBS (VWR).Mouse pancreatic tumor organoid–derived cells from a geneti-cally engineered mouse model (KrasG12D/þ; Trp53�/�; Apc�/�)were obtained from Zhao Chen lab at Novartis and cultured inDMEM medium with 10% FBS. Cell lines were used within 15passages of thawing and continuously cultured for less than 6months.

All small-molecule inhibitors used were synthesized and struc-turally verifiedbyNMRandLC/MS according to cited references atNovartis except LY3009120, which was purchased from SelleckChemicals. The structure of LFW527 was disclosed as example 40in patentWO2010/002655A2 (26).Onartuzumabwas producedin Chinese hamster ovary cells at Novartis in a manner similar tothose in patent US 2011/0262436.

Cell line engineeringKnock-out clone was generated by CRISPR technology.

Sequences encoding guide RNAs targeting NRAS, HRAS, andPTPN11 were cloned into pNGx vector (sgRNA NRAS_1CGCCAATTAACCCTGATTACTGG, sgRNA NRAS_2 TGAATAT-GATCCCACCATAGAGG, sgRNA HRAS_1 ATTCCGT-CATCGCTCCTC, sgRNA HRAS_2 AATACGACCCCACTATAG,sgRNA PTPN11_1 GACCACGGCGTGCCCAGCGA, sgRNAPTPN11_2 TGCGCACTGGTGATGACAAA). Cells were trans-fected with respective sgRNA vectors and treated with mediacontaining 1–2 mg/mL of Puromycin (Thermo Fisher Scientific)24 hours after transfection. NRAS/HRAS double knockout NCI-H358 and MIA PaCa-2 cells were generated sequentially. Indi-vidual clones were generated by plating puromycin-resistant cellsat low density in 10-cm plates. Surviving clones were isolatedusing cloning cylinders (Sigma-Aldrich, #C-1059). Cas9-inducedmutations in NRAS and HRAS were detected by PCR and furtherconfirmed by Sanger sequencing following TOPO TA cloning ofPCR-amplified target regions (Thermo Fisher Scientific,#450641). For PTPN11 knockout, single clones were picked bypaper cloning disks (Scienceware, #F37847-0001) and their SHP2levels were determined by immunoblotting.

RAS-GTP pull-down assay and immunoblottingRAS-GTP pull-down was performed by using the RAS Activa-

tion Assay Kit (Millipore Sigma) following the manufacturer'sinstructions. Immunoblotting was performed as described previ-ously (24). The following antibodies were used: p-MEK (CST#9154), MEK1 (CST #2352), p-ERK (CST #4370), ERK1/2 (CST#4695), p-RSK3 (CST #9348), p-AKT (CST #4060), p-SHP2

(Abcam #ab62322), SHP2 (CST #3397), Tubulin (CST #3873),KRAS (Sigma-Aldrich #WH0003845M1), NRAS (Calbiochem#OP25), HRAS (Novus Biologicals # NB110-57027), and RAS(Millipore #05-516). Band signal intensities were quantified withOdyssey Software (LI-COR). p-MEK levels were normalized totubulin levels. Percentages of p-MEK reduction in combo¼ (Normalized p-MEK levels in selumetinib-treated group– Normalized p-MEK levels in selumetinib and SHP099 combi-nation-treated group)/Normalized p-MEK levels in selumetinib-treated group, expressed as percentage values.

Phospho-ERK/total ERK MSD assayTwenty thousand MIA PaCa-2 cells were cultured in 96-well

plates per well overnight and treated with selumetinib alone or incombination with 5 mmol/L SHP099 at 3-fold serial dilutionsfrom 10 mmol/L for 24 hours and 48 hours. Cell were lysed with50 mL complete lysis buffer in the MSD phospho-ERK/total ERKAssay Kit (Meso Scale Discovery #K15107D-1) and processedaccording to the manufacturer's instructions. p-ERK inhibitionwas normalized by the total ERK signal and compared with theDMSO control.

Cell proliferation assay and colony formation assayTwo to three thousand cells were seeded in 96-well plates per

well the night before they were treated with compounds. Cellviability was thenmeasured by the CellTiter-Glo Assay (Promega)according to the supplier's instructions after 72 hours of treat-ment. For colony formation assay, 10,000 cells were seeded in6-well plates per well the night before they were treated withcompounds. Media with compounds were replaced every 7 days.After 10–14 days of culture, cell colonies were stained with crystalviolet.

Tumor xenograft experimentsAll animal studies were performed in accordance with the NIH

Guide for the Care and Use of Laboratory Animals and theNovartis Institutes for Biomedical Research Animal Care and UseCommittee guidelines. Female athymic nude mice (8�12 weeksof age) were inoculated with MIA PaCA-2 and T3M-4 cells(5� 106 cells in 200 mL suspension containing 50%Matrigel (BDBiosciences) in Hank balanced salt solution) or human-derivedcolon tumor xenograft (HCOX) model HCOX1402 (25–50 mgtumor slurry in 200 mL suspension containing 50% Matrigel inPBS) subcutaneously into the right superciliary region. Mice weremonitored twice a week and tumors were measured and calcu-lated by length � width2/2. Once tumors reached roughly250 mm3 for MIA PaCa-2 and 200mm3 for T3M-4 andHCOX1402, mice were randomly assigned to receive either vehi-cle, SHP099 (25 or 50mg/kg every other day for MIA PaCA-2,25mg/kg daily for T3M-4, or 50 mg/kg daily for HCOX1402),trametinib (0.3 mg/kg daily for all three models), or the combi-nation of trametinib and SHP099 by oral gavage. At the end of thestudy, mice were euthanized at 3, 8, and 24 hours following thelast dose. Tumor fragments were collected for immunoblotting.

ResultsRTK/SHP2–mediated feedback activation is frequent inKRAS-mutant cell lines

The MAPK signaling cascade is an important effector pathwayof RTK activation and is tightly regulated at multiple levels. ERK

Lu et al.

Mol Cancer Ther; 18(7) July 2019 Molecular Cancer Therapeutics1324



https://www.idexxbioanalytics.com/http://mct.aacrjournals.org/

activation turns on various negative regulators of the pathway,such as dual-specificity phosphatase (DUSP) and Sprouty (SPRY)family proteins, imposing feedback inhibition at several nodes inthe pathway (6). As illustrated in Supplementary Fig. S1A,inhibiting ERK signaling using MEKi relieves the feedback inhi-bition, which causes pathway reactivation and increased phos-phorylation of MEK at Ser217/221 (p-MEK) despite its catalyticactivity still being inhibited. We took advantage of this quick androbust adaptive induction of p-MEK caused by MEKi and theextent of p-MEK reduction by cotreatment with SHP099 or RTKinhibitor(s) tomeasure the contribution of RTKs and SHP2 to thepathway feedback activation.

As exemplified in Fig. 1A, when CCK-81, an EGFR-dependentand RAS/RAF wild-type (WT) colorectal cancer cell line, wastreated with MEKi selumetinib (27) for 24 hours, a dramaticincrease in RAS-GTP and p-MEK levels was observed, which couldbe diminished or blocked by cotreatment with SHP099 or anEGFR inhibitor, erlotinib, indicating that the feedback activationof MEK was mediated through EGFR and SHP2. Five micromolarSHP099 was chosen based on previous characterization (24).Interestingly, although SHP099 did not completely block RASreactivation, the residual RAS activity was not sufficient to reac-tivate MEK, possibly due to the existence of a threshold of RASactivity for MEK reactivation (Fig. 1A). Phospho-ERK1/2 (p-ERK)and downstream phospho-RSK3 (p-RSK3) were still effectivelyinhibited by selumetinib despite the adaptive p-MEK inductionand the combination of selumetinib with SHP2i or EGFRi furtherinhibited p-ERK andp-RSK3 (Fig. 1A). These data indicate that theSHP2i-sensitive p-MEK–adaptive induction by MEKi can be aconvenient readout of RAS feedback activation, compared withmeasuring RAS-GTP levels, which is often not sensitive or mon-itoring the p-ERK rebound that is often delayed (48 hours�96hours) with varying degrees among cell lines.

We profiled a diverse panel of 34 KRAS-mutant and 5 NRAS-mutant cancer cell lines across different lineages with this p-MEKassay (Supplementary Table S1) and quantified the "% p-MEK ofreduction in combo" as described in Materials and Methods(Supplementary Table S2). As shown in Fig. 1B–F, p-MEK induc-tion after treatment with selumetinib was observed in all cell linesexamined. Cotreatment with 5 mmol/L SHP099 reduced p-MEKinduction in the majority of KRAS-mutant cell lines by varyingdegrees, with only five cell lines (NCI-H2122, NCI-H1792, COR-L23, PSN1, and HCT 116) having less than 10% reduction,suggesting SHP2-mediated feedback activation is frequent inKRAS-mutant cell lines. Moreover, in several cell lines, SHP2 islikely the major contributor to the pathway feedback activation,with more than 50% p-MEK reduction by SHP099 (Fig. 1B–D).

On the basis of structural and biochemical studies (28, 29),KRASG12C has the highest intrinsic GTP hydrolysis activityamong all KRAS mutants, suggesting it may undergo significantnucleotide cycling and depend on RTK/SHP2 for GTP loading.Our profiling indicates there is a wide spectrum of SHP2dependency of feedback activation among KRASG12C cell lines(70%�6%; Fig. 1B). Similar spectrum of SHP2 dependency wasobserved with cell lines harboring KRASG12D and KRASG12V

(Fig. 1C). Unexpectedly, in cell lines harboring KRASQ61L/H,which have the lowest intrinsic GTP hydrolysis activity, weobserved substantial reduction in selumetinib-induced p-MEKby SHP099 (SW948, 74% reduction, KRASQ61L/þ; T3M-4, 43%reduction, KRASQ61H/þ; Fig. 1D). In the two lung cancer celllines with homozygous KRASQ61H mutation, NCI-H460 and

HCC2108, SHP2 activity is associated with 27% and 14% of thefeedback activation, respectively (Fig. 1D). Because we havelimited number of cell lines harboring KRASQ61 mutants, wethen examined five NRASQ61-mutant melanoma cell lines (Sup-plementary Table S1) and found little effect (0%�11%) ofSHP099 on reducing p-MEK feedback activation (Fig. 1E). Sim-ilarly, SHP099 only had modest effect reducing p-MEK–adaptiveinduction in the five cell lines harboring KRASG13D (Fig. 1F).

To understand the maximal contribution of SHP2 to thefeedback activation, we performed the p-MEK assay with up to100 mmol/L SHP099 and generated SHP2 knock-out clones usingthe CRISPR/Cas9 technology in two cell lines with abundantSHP2-dependent feedback activation, MIA PaCa-2 and HUP-T3(Supplementary Fig. S1B). InMIAPaCa-2 cells (KRASG12C/G12C), 5mmol/L SHP099 was sufficient to achieve maximal inhibition onselumetinib-induced p-MEK–adaptive induction, comparablewith the effect of 10 mmol/L ARS853, a KRASG12C inhibitor (14),or SHP2 deletion (Supplementary Fig. S1C). In HUP-T3 cells(KRASG12R/þ), higher SHP099 concentrations further inhibitedthe selumetinib-induced p-MEK and 100 mmol/L SHP099 as wellas SHP2 deletion blockedmost of the p-MEK–adaptive induction(Supplementary Fig. S1C). We then performed the SHP099 dose-dependent p-MEK assay in two cell lines with little or no p-MEKreduction by 5 mmol/L SHP099, NCI-H2122, and PSN1. Similarto HUP-T3 cells, in NCI-H2122 cells (KRASG12C/G12C), higherSHP099 concentrations also further suppressed the p-MEK–adap-tive induction (Supplementary Fig. S1D). Moreover, the effect by100 mmol/L SHP099 exceeded that seen by 10 mmol/L ARS853,suggesting HRAS/NRAS may be involved in the p-MEK–adaptiveinduction. In contrast, in PSN1 cells (KRASG12R/G12R), p-MEKfeedback activation was unaffected by coadministration of 100mmol/L SHP099 but was fully inhibited by 3 mmol/L LY3009120,a pan-RAF inhibitor (Supplementary Fig. S1D; ref. 30), indicatingthat the p-MEK feedback activation in PSN1 cells is indeed SHP2independent. Notably, 24-hour treatment with high SHP099concentrations did not cause obvious cytotoxicity in any cell linetested.

We also performed the p-MEK assay with a mouse cell linederived from pancreatic tumor organoids of a genetically engi-neered mouse model (KrasG12D/þ; Trp53�/�; APC�/�) andSHP099 dramatically reduced adaptive p-MEK induction byselumetinib (Supplementary Fig. S1E). Pan-RAF inhibitorLY3009120 achieved near complete suppression of p-MEK–adaptive induction, suggesting that the residual SHP099-insen-sitive p-MEK–adaptive induction was likely due to feedbackactivation directly on RAF. Taken together, we speculate that thepathway reactivation in KRAS-mutant cell lines may be broadlyand dominantly mediated by SHP2 though they may exhibitdifferential sensitivity to SHP099.

RTKs driving feedback activation in KRAS-mutant cell lines arediverse

Next, we used individual RTK inhibitors to demonstrate thatSHP2-dependent pathway reactivation is due to RTK activity andto identifywhich RTKswere responsible in KRAS-mutant cell lines(Fig. 2A). In HUP-T3, the FGFR1/2/3 inhibitor BGJ398 (31, 32)reduced p-MEK induction to a comparable level as SHP099,suggesting that pathway reactivation primarily depends onFGFR1/2/3. In NCI-H358 (KRASG12C/þ), LS 180 (KRASG12D/þ),Panc 03.27 (KRASG12V/þ), and Capan-2 (KRASG12V/þ), EGFR wasthe major feedback-activated RTK because the p-MEK induction

SHP2 and MEK Inhibitors Combination for KRAS-Mutant Cancers

www.aacrjournals.org Mol Cancer Ther; 18(7) July 2019 1325



http://mct.aacrjournals.org/

was decreased by both erlotinib and EGFR/HER2 dual inhibitorlapatinib. In KP-4, the p-MEK induction was reduced by crizoti-nib, a MET and ALK dual inhibitor. The expression of ALK is low,whereas the expression of MET ligand hepatocyte growth factor(HGF) is high in KP4 (Supplementary Table S3) and furtheranalysis using a selective MET inhibitor INC280 (33) indicatedthat MET is the feedback-activated RTK in KP4 (Fig. 2D). Incontrast, no single RTK inhibitor reduced p-MEK induction tothe same extent as SHP099 in MIA PaCa-2 or NCI-H2030,suggesting that more than one RTK could be involved. Indeed,a combinatorial treatment with lapatinib and BGJ398 reducedp-MEK–adaptive induction to a similar level as SHP099 in bothcell lines, suggesting both ERBBs and FGFRs were feedback-

activated (Fig. 2B). LFW527, an IGF-1R inhibitor (34), failed toinhibit p-MEK induction in all cell lines tested. Taken together,these data indicate that RTKs that mediate selumetinib-inducedpathway reactivation inKRAS-mutant cells, at least, includeoneormore RTKs including ERBBs, FGFRs, and MET.

To test whether the RTK feedback activation depends on RTKligands from the serum in media, we performed the p-MEK assayunder serum-free conditions in four cell lines with RTK-drivenfeedback activation (Fig. 2C). Twenty-four hours after serumstarvation, selumetinib treatment still led to robust p-MEK–adap-tive induction, albeit to a smaller magnitude than the conditionwith serum, except in NCI-H2030 cells (Fig. 2C, identical expo-sure from the same immunoblot for each cell line). Moreover, the

A

B

70%

43%

56%

61%

34%

37%

44%

34%

10%

44%

30%

13%

32%

8%

27%

0%

C

11%

31%

21%

6%

17%

D

74%

43%

27%

27%

14%% p-MEK Reduction in combo

KRAS G12C

CCK-81(KRAS WT)

DMSO

DMSO Erlo

tinibSH

P099

Selumetinib

RAS-GTP

p-MEK1/2(S217/221)

Tubulin

Total-RAS

70%

54%

23%

20%

6%

p-ERK1/2(T202/Y204)

42%

p-RSK3(T356/S360)

57%

5%

p-MEK(S217/221)

Tubulin

DMSO

SHP09

9Sel

umetin

ib

Combo

MIA PaCa-2

NCI-H358

NCI-H2030

NCI-H23

SW1463

NCI-H2122

Calu-1

NCI-H1373

HCC-1171

LU65

NCI-H1792

p-MEK(S217/221)

Tubulinp-MEK

(S217/221)Tubulinp-MEK


(S217/221)Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulinp-MEK

(S217/221)Tubulin

p-MEK(S217/221)

Tubulin

Panc 03.27

HUP-T3

LS 180

LS 123

Capan-1

SW1116

AsPC-1

SK-LU-1

A427

PSN1

DAN-G

KP4

KRAS G12D

KRAS G12V

Capan-2

KRAS G12R/S/A

COR-L23

DMSO

SHP09

9Sel

umetin

ib

Combo

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulinp-MEK

(S217/221)Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulinp-MEK

(S217/221)Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulinp-MEK

(S217/221)Tubulin

p-MEK(S217/221)

Tubulin

SW948

KRAS Q61LDM

SOSH

P099

Selum

etinib

Combo

p-MEK(S217/221)

Tubulin

LoVo

NCI-H1944

NCI-H747

HCT 116

NCI-H647

T3M-4

NCI-H460

HCC2108

KRAS G13D

KRAS Q61Hp-MEK


(S217/221)Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulinp-MEK

(S217/221)Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

IPC-298

MM415

11%

11%

NRAS Q61 Melanoma

7%

0%

Hs 944.T

SK-MEL-30

SK-MEL-20%

p-MEK(S217/221)

Tubulinp-MEK

(S217/221)Tubulin

p-MEK(S217/221)

Tubulinp-MEK


(S217/221)Tubulin

% p-MEK Reduction in combo

% p-MEK Reductionin combo

E

F

Figure 1.

RTK/SHP2-mediated feedback activation is frequent in KRAS-mutant cell lines. A, CCK-81 cells were treated with DMSO, selumetinib (0.5 mmol/L), or thecombination of selumetinib with SHP099 (5 mmol/L) or erlotinib (0.5 mmol/L) for 24 hours. The effect on the levels of GTP-bound RAS was determined by a RASactivation assay and immunoblotting with a RAS antibody. The effect on the MAPK signaling was determined by immunoblotting with the indicated antibodies.Immunoblot of phospho-MEK1/2 (Ser217/221) and tubulin in 11 KRASG12C-mutant cell lines (B), 5 KRASG12D, 5 KRASG12V, and 4 KRASG12R/S/A-mutant cell lines (C),1 KRASQ61L and 3 KRASQ61H-mutant cell lines (D), 5 melanoma cell lines with NRASQ61 mutations (E), and 5 KRASG13D-mutant cell lines (F), treated with DMSO,selumetinib (0.5 mmol/L), SHP099 (5 mmol/L), or the combination for 24 hours. Band signal intensities were quantified with Odyssey Software (LI-COR) and thepercentages of reduction of p-MEK after normalization to tubulin expression in the combination groups compared with the selumetinib-treated groups for eachcell line were reported.

Lu et al.





p-MEK feedback activation still largely depended on SHP2 in allfour cell lines. These data demonstrate that the RTK feedbackactivation occurs in the absence of exogenous RTK ligands anddepends on either autocrine RTK ligands or relief of negativeregulators of RTKs such as SPRY proteins in a ligand-independentmanner (6, 35). Next, we utilized KP4 cells with MET-drivenfeedback activation to differentiate these two possibilities. Onar-tuzumab (36), a monovalent mAb that binds to the extracellulardomain ofMET and prevents HGF binding, as well as the selectiveMET inhibitor INC280, but not the selective ALK inhibitor cer-itinib (37), significantly reduced both baseline phospho-MET andthe induced p-MEK by selumetinib treatment (Fig. 2D). Thesedata suggest that the feedback activation of RTK may require RTKligands in certain cell lines such as KP4.

RTKs may also activate the PI3K/AKT pathway (38, 39); wetherefore tested whether MEKi treatment can induce AKT

activation in KRAS-mutant cells with RTK-mediated feedbackactivation. In 6 of 8 cell lines tested, there was no significantincrease of p-AKT levels, suggesting that the RAS/MAPK path-way is often the major effector pathway of feedback-activatedRTKs, at least within the first 24-hour treatment with MEKi(Supplementary Fig. S1F). In MIA PaCa-2 cells where p-AKTwas induced by selumetinib treatment, we examined the effectof SHP2 and KRASG12C inhibitors on the induced p-AKT(Supplementary Fig. S1G). The p-AKT induction was notblocked by SHP2 or KRASG12C inhibitors, suggesting thep-AKT induction is likely a result of RTK feedback activationinstead of a secondary effect of RAS feedback activation andcross-talk with PI3K/AKT signaling (40). Interestingly, theincreased p-AKT levels did not translate to activation of alldownstream effectors such as phosho-S6 (p-S6; Supplemen-tary Fig. S1G).

A C

DMSO

DMSO

SHP09

9 Lapatin

ib

+BGJ39

8

Selumetinib

NCI-H358

Panc 03.27

LS 180

MIA PaCa-2

DMSO

DMSO

SHP09

9Erlo

tinibBG

J398

Selumetinib

Crizotin

ib

LFW527

Lapatin

ib

HUP-T3

EGFR

FGFR

NCI-H2030

RTKs

KP-4 MET

B

DMSO

DMSO

SHP09

9Criz

otinib

INC280

Selumetinib

Onartu

zumab

Ceritini

bKP4

p-MET(Y1234/1235)

Tubulin

p-MEK(S217/221)

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

DMSO

Selum

etinib

MIA PaCa-2

LS 180

Selu.+

SHP09

9

p-MEK(S217/221)

TubulinNCI-H2030

24-Hr serumstarvation

p-MEK(S217/221)

TubulinKP-4

With serum

DMSO

Selum

etinib

Selu.+

SHP09

9

D

MIA PaCa-2

NCI-H2030

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

Capan-2

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulinp-MEK


(S217/221)Tubulin

Figure 2.

The feedback-activated RTKs in KRAS-mutant cell lines are diverse. A, Immunoblot of phospho-MEK1/2 in the indicated KRAS-mutant cell lines treated withDMSO, selumetinib (0.5 mmol/L), or selumetinib in combination with SHP099 (5 mmol/L) or the indicated RTK inhibitors (all at 0.5 mmol/L) for 24 hours. B,Immunoblot of phospho-MEK1/2 in MIA PaCa-2 and NCI-H2030 cells treated with DMSO, selumetinib (0.5 mmol/L), or selumetinib in combination with SHP099(5 mmol/L) or with lapatinib plus BGJ398 (0.5 mmol/L each) for 24 hours. C, Immunoblot of phospho-MEK1/2 in the indicated cells that were cultured in completeor serum-free medium and treated with DMSO, selumetinib (0.5 mmol/L), or selumetinib in combination with SHP099 (5 mmol/L) for 24 hours. The samples fromcells cultured with serum and serum starved for 24 hours were analyzed on the same gel and the same exposure were shown. D, Immunoblot of phospho-METand phospho-MEK1/2 in KP4 cells treated with DMSO, selumetinib (0.5 mmol/L), or selumetinib in combination with SHP099 (5 mmol/L) or the indicatedinhibitors (0.5 mmol/L for each except onartuzumab at 1 mmol/L) for 24 hours. Tubulin served as a loading control.






G12C/D/V–mutant KRAS can mediate the RTK/SHP2–dependent feedback activation

RTK-dependent feedback activation of p-MEK in KRAS-mutantcell lines could be mediated through mutant KRAS, WT KRAS (inKRAS heterozygotes), other RAS paralogs (e.g., NRAS andHRAS),or a combination of those possibilities. To determine the contri-bution of mutant KRAS, we knocked out both HRAS and NRASusing CRISPR/Cas9 technology in NCI-H358 (KRASG12C/þ) andMIA PaCa-2 (KRASG12C/G12C) cells, where the feedback activationdepends largely on RTK/SHP2 (Fig. 1B), and validated the loss ofNRAS and HRAS in the double knock-out (DKO) clones byimmunoblots (Supplementary Fig. S2A and S2B). In all DKOclones from both cell lines, the p-MEK-adaptive induction byselumetinib was comparable to that of parental cells (Supple-mentary Fig. S2C and S2D). Moreover, the p-MEK-adaptiveinduction by selumetinib was efficiently reduced by SHP099, intwo selected DKO clones of both cell lines (Supplementary Fig.S2E and Fig. 3A). BecauseMIA PaCa-2 cells harbor a homozygousKRASG12C mutation, these data suggest that KRASG12C can medi-ate RTK-driven p-MEK feedback activation.

To further determine the contribution of mutant KRAS toRTK-driven feedback activation in the presence of HRAS/NRAS,we took advantage of the KRAS G12Ci and examined the RASactivity directly in MIA PaCa-2 cells (Fig. 3B). Selumetinibtreatment resulted in increased RAS-GTP levels, consistent withincreased p-MEK levels and both increases were abolished by10 mmol/L ARS853 and significantly reduced by 10 mmol/LSHP099. In addition, the combination of ARS853 or SHP099with selumetinib further decreased p-ERK and p-RSK3 levelsthan selumetinib alone. Consistent with the SHP099 effect, inthe SHP2 KO clone of MIA PaCa-2 cells, treatment withselumetinib induced only a slight increase of RAS-GTP andp-MEK levels. These data suggest that the feedback activation inMIA PaCa-2 cells is mainly mediated through KRASG12C whichcan be diminished by SHP2 inhibition. In another KRASG12C/G12C cell line NCI-H2122, KRAS-GTP induction by selumetinibwas also blocked by SHP099 or ARS853 but the p-MEK induc-tion was only partially blocked (Fig. 3C), suggesting additionalfeedback activation of the pathway downstream of RAS (e.g.,RAF) may exist in NCI-H2122.

We further explored whether SHP2 inhibition can influencefeedback activation of KRASG12D by measuring RAS-GTP levelsusing a RASG12D-specific antibody in LS 180 cells (KRASG12D/þ;Supplementary Fig. S2F and Fig. 3D). We observed increasedKRASG12D-GTP and p-MEK levels following treatment with selu-metinib, which was effectively reduced by SHP099. The combi-nation of SHP2 and MEK inhibitors also further decreased p-ERKand p-RSK3 levels than selumetinib alone. These data indicatethat KRASG12D can also mediate the RTK/SHP2–driven pathwayfeedback activation.

For other KRAS mutants (G12V, Q61H and G13D), due to thelack of validated mutant-specific RAS antibodies, we performedtheRAS activation assayswithhomozygousmutant lines (Fig. 3E–G) andused aKRAS-specific antibody to investigatewhether thosemutants can be feedback activated through SHP2. As shown withCOR-L23 (KRASG12V/G12V), KRASG12V can also be feedback acti-vated in a SHP2-dependent manner. However, the p-MEK feed-back activation was not blocked by up to 100 mmol/L SHP099while sensitive to the pan-RAF inhibitor LY3009120. Consistentwith the effect on p-MEK feedback activation, the combination ofSHP2 and MEK inhibitors did not further decrease p-ERK or

p-RSK3 levels as the combination of RAF and MEK inhibitorsdid (Fig. 3E).

We also discovered in NCI-H647 (KRASG13D/G13D) andNCI-H460 (KRASQ61H/Q61H) cells, KRASG13D and KRASQ61H werefeedback activated following the treatment with selumetinib butthe activation was not dependent on SHP2 (Fig. 3F and G).Consistently, the p-MEK feedback activation was not impactedby SHP2 inhibition and the combination of selumetinib andSHP099did not further inhibit p-ERKor p-RSK3 in both cell lines.The observation in NCI-H460 cells raised the possibility that theSHP099-sensitive p-MEK induction in SW948 (KRASQ61L/þ) andT3M-4 (KRASQ61H/þ; Fig. 1D) may be due to the effect on the WTKRAS or HRAS or NRAS. Indeed, in T3M-4 the KRAS feedbackactivation was strongly inhibited by SHP099 (Fig. 3G) and wespeculate that WT KRAS dominantly contributed to the feedbackactivation in T3M-4 cells despite the presence of more activeKRASQ61H.

SHP2 inhibition sensitizes KRAS-mutant cells to MEKinhibitors in vitro

The observation that SHP099 blocked the pathway feedbackactivation induced by MEK inhibitors led us to hypothesize thatSHP2 inhibition may enhance the efficacy of MEK inhibitorsagainst KRAS-mutant cells. Therefore, we tested the effects ofSHP099 or SHP2 deletion on the antiproliferative effects ofselumetinib in MIA PaCa-2 and HUP-T3, two cell lines withabundant SHP2-mediated feedback activation. SHP099 at10 mmol/L or SHP2 deletion sensitized MIA PaCa-2 cells toselumetinib, causing a decrease in the IC50 by approximately10-fold (0.13 mmol/L vs. 1.22 mmol/L; Fig. 4A) and 4-fold(0.21 mmol/L vs. 0.87 mmol/L; Fig. 4B), respectively. Similarly,in HUP-T3 cells, SHP2 inhibition or deletion led to a roughly3-fold (0.04 mmol/L vs. 0.14 mmol/L; Fig. 4A) and an average of3-fold (0.02 mmol/L for KO-1 and 0.05 mmol/L for KO-2 vs. 0.11mmol/L; Fig. 4B) decrease in the IC50 of selumetinib, respectively.More striking results were observedwith anotherMEKi trametinibin both cell lines (Supplementary Fig. S3A and S3B). Todeterminewhether the combination benefit of MEK and SHP2 inhibitors isadditive or synergistic, we performed a cell proliferation assayusing an 8 by 8 combination dose matrix of selumetinib andSHP099 inMIAPaCa-2 andHUP-T3 cells and assessed the synergyusing the Loewe Excess method (41). Selumetinib and SHP099showed synergistic effects as determined by a synergy score ofgreater than 2 in both cell lines (Supplementary Fig. S3C). Thegreatest antiproliferative synergy was observed at low concentra-tions of selumetinib (�0.1 mmol/L) and high concentrations ofSHP099 (>3 mmol/L). We also studied the combination synergyin six additional cells lines with both SHP2-dependent andSHP2-independent p-MEK feedback activation (SupplementaryFig. S3C) andobserved a greater synergyof the combination in celllines where the p-MEK induction largely depends on SHP2. Takentogether, we conclude that SHP2 dependency of p-MEK inductioncould, to some extent, predict a synergistic combination benefit ofMEK and SHP2 inhibitors.

To investigate the long-term efficacy of the SHP2i and MEKicombination,weperformed colony formation assays. After 10–14days, 10 mmol/L SHP099 did not have a significant effect onthe growth of KRAS-mutant cells while selumetinib alone(50�300 nmol/L) had a modest antiproliferative effect(Fig. 4C). The combination treatment with selumetinib andSHP099 led to enhanced inhibition of colony formation in all

Lu et al.





cell lines with SHP2-dependent feedback activation but not inPSN1 cells in which the feedback activation was independent ofSHP2 (Fig. 1C; Supplementary Fig. S1D). These data demonstratethat blocking RTK-mediated MAPK pathway reactivation by inhi-biting SHP2 can enhance sensitivity to MEK inhibitors in KRAS-mutant cells in vitro.

We next examined whether the combination benefit of MEKiand SHP2i was due to sustained inhibition of theMAPK pathway.p-ERK and total ERK levels inMIA PaCa-2 cells at 24 hours and 48hours posttreatment with various doses of selumetinib in thepresence or absence of 5 mmol/L SHP099 were measured usingMeso Scale Discovery (MSD) MULTI-SPOT assays. As expected,

A

DMSO

SHP09

9Sel

umetin

ib

ComboMIA PaCa-2

B

p-MEK(S217/221)

Tubulin

p-MEK(S217/221)

Tubulin

RAS-GTP

Total-RAS

MIA PaCa-2C

DMSO

SHP09

9Sel

umetin

ib

Combo

DMSO

SHP09

9Sel

umetin

ib

Combo

NRAS/HRAS DKO SC6-39WT NRAS/HRAS DKO SC6-6

SHP2 KO WT

p-ERK(T202/Y204)

p-RSK3(T356/S360)

p-MEK(S217/221)

Tubulin

RASG12D-GTP

Total-RASG12D

RAS-GTP

Total-RAS

LS 180DM

SODM

SOSH

P099

Selumetinib

p-ERK(T202/Y204)

p-RSK3(T356/S360)

D

NCI-H2122

COR-L23

NCI-H460 T3M-4NCI-H647

Tubulin

KRAS-GTP

Total KRAS

MEK1

+−−

+ + +− 10 100 ARS853

+−−

+ + +− 10 100 RAFi

+−−

+ +− 10 100

+−−

+ + +− 10 30 100

+−−

+ +− 10 100

KRAS-GTPTotal KRAS

Selumetinib

E

F G

p-MEK(S217/221)

p-ERK(T202/Y204)

p-RSK3(T356/S360)

Tubulin

MEK1

p-MEK(S217/221)

p-ERK(T202/Y204)

p-RSK3(T356/S360)

Selumetinib

SHP099 (μmol/L)

SHP099 (μmol/L)

+−−

++− 10ARS853

+−− −

Selumetinib

SHP099 (μmol/L)

KRAS-GTPTotal KRAS

Selumetinib

SHP099 (μmol/L)

Tubulin

MEK1

p-MEK(S217/221)

p-ERK(T202/Y204)

p-RSK3(T356/S360)

Figure 3.

G12C/D/V–mutant KRAS canmediate the p-MEK feedbackactivation from RTK/SHP2. A,Immunoblot of phospho-MEK1/2 inHRAS/NRAS double knockout(DKO) clones of MIA PaCa-2(KRASG12C/G12C) cells treated withDMSO, selumetinib (0.5 mmol/L),SHP099 (5 mmol/L), or thecombination for 24 hours. B,MIAPaCa-2 cells were treated withDMSO, selumetinib (0.5 mmol/L), orthe combination of selumetinibwith ARS853 (10 mmol/L) orSHP099 (10 mmol/L) for 24 hours,and a SHP2 knockout clone of MIAPaCa-2 was treated with DMSO orselumetinib (0.5 mmol/L) for 24hours. RAS-GTP levels weredetermined by a RAS activationassay and immunoblotting with apan-RAS antibody. C,NCI-H2122cells were treated with DMSO,selumetinib (0.5 mmol/L), or thecombination of selumetinib withSHP099 (10 mmol/L or 100 mmol/L)or ARS853 (10 mmol/L) for 24hours. The effect on the levels ofGTP-bound KRAS was determinedby a RAS activation assay andimmunoblotting with a KRAS-specific antibody. D, LS 180 cellswere treated with DMSO,selumetinib (0.5 mmol/L), SHP099(5 mmol/L), or the combination for24 hours. KRASG12D-GTP and RAS-GTP levels were determined by aRAS activation assay andimmunoblotting with RASG12D-specific or pan-RAS antibodies,respectively. COR-L23 (E), NCI-H647 (F), NCI-H460, and T3M-4(G) cells were treated with DMSO,selumetinib (0.5 mmol/L), or thecombination of selumetinib withSHP099 (10 mmol/L, 30 mmol/L forT3M-4 only, or 100 mmol/L), orRAFi (LY3009120, 3 mmol/L) forCOR-L23 only for 24 hours. Theeffect on the levels of GTP-boundKRAS was determined by a RASactivation assay andimmunoblotting with a KRAS-specific antibody. Phospho-MEK1/2, phospho-ERK1/2, and phospho-RSK3 levels were determined byimmunoblotting. Tubulin served asa loading control.






while p-ERK was effectively inhibited by selumetinib at 24 hoursposttreatment (94% inhibition at 0.37 mmol/L), a significantrebound was observed at 48 hours (76% inhibition at0.37 mmol/L), which could not be inhibited by higher concentra-tions of selumetinib (Fig. 4D). Cotreatment with SHP099 signif-icantly suppressed the p-ERK rebound at 48 hours (P ¼0.0185, Fig. 4D). We also confirmed the enhanced inhibition ofp-ERK and p-RSK3 by the combination of MEK and SHP2 inhi-bitors in both MIA PaCa-2 and HUP-T3 cells using immunoblotassays (Supplementary Fig. S3D).

Because we observed p-AKT feedback activation inMIA PaCa-2and HUP-T3 cells, which was not blocked by SHP2 inhibition inMIA PaCa-2 cells (Supplementary Fig. S1G), we assessed thecombination effect of trametinib and BYL719, a potent andselective PI3Ka inhibitor (42). Addition of 1 mmol/L BYL719hadno effect on trametinib efficacy in bothMIAPaCa-2 andHUP-T3 cells (Supplementary Fig. S3E), consistentwith the observationthat downstream p-S6 was not feedback-activated in MIA PaCa-2cells (Supplementary Fig. S1G). We next compared the MEKinhibitor combination effects of SHP099 with those of RTKinhibitors, which may block additional RTK effector pathwaysbeyond the RAS/MAPK pathway such as PI3K/AKT and JAK/STATpathways (38, 39, 43). In HUP-T3 cells, in which FGFRs mediate

the feedback activation (Fig. 2A) and p-ATK was feedback-acti-vated (Supplementary Fig. S1F), SHP099 at 10 mmol/L led to asimilar magnitude of sensitization to trametinib compared with1 mmol/L BGJ398 (IC50 of trametinib, DMSO ¼ 20.64 nmol/L;with 10mmol/L SHP099¼ 3.37 nmol/L; with 1 mmol/L BGJ398¼6.46 nmol/L; Supplementary Fig. S3F). Similar results wereobserved with erlotinib and SHP099 in LS 180 cells, in whichEGFR mediates the feedback activation (Fig. 2A; SupplementaryFig. S3F). These data suggest that similar in vitro combinationbenefit withMEK inhibitors can be achievedwith SHP2 inhibitorsin place of RTK inhibitors.

Combination efficacy of trametinib and SHP099 in vivoTo evaluate the in vivo efficacy of the combination of MEKi and

SHP2i, we treated nudemice bearingMIA PaCa-2 xenografts withSHP099, trametinib, or the combination (Fig. 5A). Trametinibalone at a clinically relevant dose (0.3mpk, daily) only resulted inmoderate tumor growth inhibition. SHP099 alone at 50 mpkevery other day dosing (reduced from the MTD at 100 mpk dailyfor tolerability reasons in combination with trametinib) also hadsignificant antitumor efficacy, similar to 0.3 mpk trametinib,which coincides with inhibition of MAPK to some degree(Fig. 5B). This was not unexpected with recent studies showing

D

CDMSO SHP099Selumetinib Combo

0

50

100

Selumetinib (μmol/L)0.04 0.12 0.37 1.11 3.330 10

0

50

100

MIA PaCa-2 24 hrs

Selumetinib (μmol/L)

Rel

ativ

e p-

ER

K le

vels

(%)

Rel

ativ

e p-

ER

K le

vels

(%)

0.04 0.12 0.37 1.11 3.330 10

MIA PaCa-2 48 hrs

* P = 0.0185

MIA PaCa-2(KRASG12C)

NCI-H358(KRASG12C)

DAN-G(KRASG12V)

HUP-T3(KRASG12R)

T3M-4(KRASQ61H)

PSN1(KRASG12R)

DMSOSHP099

DMSOSHP099

B

A

10-3 10-2 10-1 100 1010

50

100

HUP-T3 72 hrs


Parental

SHP2 KO-1SHP2 KO-2

10-3 10-2 10-1 100 1010

50

100

MIA PaCa-2 72 hrs


Parental

SHP2 KO

Rel

ativ

e vi

abilit

y (%

)

Rel

ativ

e vi

abilit

y (%

)


Rel

ativ

e vi

abili

ty (%

)

10-3 10-2 10-1 100 1010

50

100

MIA PaCa-2 72 hrsDMSO

SHP099

10-3 10-2 10-1 100 1010

50

100

HUP-T3 72 hrs


DMSO

SHP099

Rel

ativ

e vi

abili

ty (%

)

Figure 4.

SHP2 inhibition sensitizes KRAS-mutant cells to MEK inhibitors in vitro. A, Cell viability of MIA PaCa-2 cells and HUP-T3 cells treated with selumetinib in theabsence or presence of 10 mmol/L SHP099 for 72 hours (mean percentage of cell viability, error bars, SD, n¼ 3). B, Cell viability of SHP2 knockout (SHP2 KO)clones and parental MIA PaCa-2 and HUP-T3 cells treated with selumetinib for 72 hours (mean percentage of cell viability, error bars, SD, n¼ 3). C, Colonyformation assay of indicated cell lines treated with DMSO, selumetinib (300 nmol/L except for HUP-T3 at 50 nmol/L), SHP099 (10 mmol/L), and the combinationfor approximately 10 to 14 days. Cells were stained by crystal violet at the end of the assay for imaging. PSN1 cells with SHP2-independent feedback activationwere included as a negative control. D,Mean phospho-ERK levels measured by Meso Scale Discovery (MSD) assays of MIA PaCa-2 cells treated with selumetinibalone or in combination with 5 mmol/L SHP099 for 24 hours or 48 hours. Error bars, SD, n¼ 3. P values were calculated by paired t test.

Lu et al.





SHP2may be required for KRAS-mutant tumor growth in vivo (44,45). The combination of trametinib and SHP099 led to signifi-cantly improved efficacy comparedwith either of the single agents(Fig. 5A; P ¼ 0.0064 compared with trametinib alone andP ¼ 0.0036 compared with SHP099 alone) and achieved tumorstasis. As expected, the combination also more effectivelydecreased p-ERK and p-RSK3 levels compared with either of thesingle agents at both 3 hours and 8 hours after the last dose(Fig. 5B). To further address the tolerability concerns of thecombination in the clinic, we also tested a reduced dose ofSHP099 at 25 mpk every other day and the combinationremained effective in terms of both efficacy (Supplementary Fig.S4A) and p-ERK/p-RSK3 inhibition (Supplementary Fig. S4B).

We also examined the combination efficacy in a KRASQ61H

tumor model, T3M-4, in which we observed selumetinib and

SHP099 combination benefit in vitro (Fig. 4C).The combinationresulted in tumor stasis and enhanced inhibition of p-ERK andp-RSK3 while neither of the single agents effectively inhibited thetumor growth (Fig. 5CandD). A trendof combinationbenefitwasalso observed in a KRASG12V colon cancer patient-derived xeno-graft HCOX1402 (Supplementary Fig. S4C), which coincidedwith decreased p-ERK and p-RSK3 levels (SupplementaryFig. S4D).

DiscussionWe utilized an assay of adaptive induction of p-MEK following

MEKi treatment as a convenient and robust readout of pathwayreactivation and a SHP2 inhibitor that blocks RAS activationdownstream of multiple RTKs to determine the contribution of

A

B

00

300

600

900

1,200

1,500

1184Days post first dose

Tum

or v

olum

e (m

m3 )

**

Vehicle

Trametinib0.3 mpk QDSHP09925 mpk QDTrametinib+SHP099

T3M-4

Vehicle Trametinib SHP099 25 mpk Trametinib + SHP099

p-ERK1/2(T202/Y204)

p-RSK3(T356/S360)

Tubulin

p-MEK1/2(S217/S221)

T3M-4Xenograft

3 Hrs post dose

C

D

0 5 10 15 20 25

300

450

600

750

900

Tum

or v

olum

e (m

m3 )

Days post first dose

**

VehicleTrametinib0.3 mpk QD

SHP09950 mpk Q2DTrametinib+SHP099

MIA PaCa-2

Vehicle TrametinibTrametinib+SHP099

p-ERK1/2(T202/Y204)

p-RSK3(T356/S360)

Tubulin

p-MEK1/2(S217/S221)

3 Hrs post dose

MIA PaCa-2Xenograft

Vehicle TrametinibTrametinib+SHP099

8 Hrs post dose

SHP09950 mpk

SHP09950 mpk

Figure 5.

MEKi and SHP2i have combination benefit in vivo.A,Mean tumor volumes of MIA PaCa-2 subcutaneous xenografts in nude mice following treatment with vehicle,trametinib (0.3 mg/kg body weight, daily), SHP099 (50mg/kg body weight, every other day), or a combination of both drugs. Error bars, SEM. n¼ 9mice pergroup. B, Immunoblot of p-MEK1/2, p-ERK1/2, and p-RSK3 from tumor tissues collected at 3 hours or 8 hours after last dose frommice treated as described in A.C,Mean tumor volumes of T3M-4 subcutaneous xenografts in nude mice following treatment with vehicle, trametinib (0.3 mg/kg body weight, daily), SHP099(25 mg/kg body weight, daily), or a combination of both drugs. Error bars, SEM. n¼ 6mice per group.D, Immunoblot of p-MEK1/2, p-ERK1/2, and p-RSK3 fromtumor tissues collected at 3 hours after last dose frommice treated as described in C. Tubulin served as a loading control. �� , P < 0.01 by paired t test.






RTK/SHP2 to the pathway feedback activation in KRAS-mutantcells. We observed a broad spectrum of dependency of feedbackactivation on RTK/SHP2. In some cell lines such as MIA PaCa-2and HUP-T3, RTK/SHP2 is the major contributor to the pathwayfeedback activation (Fig. 1B andC; Supplementary Fig. S1C)whilein other cell lines such as PSN1, the feedback activation occursdownstream of SHP2 (Supplementary Fig. S1D). This can bepotentially explained bymany reported MAPK pathway feedbackinhibition mechanisms such as direct phosphorylation and inac-tivation of RAF1 (46, 47) or SOS1 (48–50) by ERK activation. Forthe remaining KRAS-mutant cell lines tested here, based on ourfurther studies (Fig. 3C–G), the feedback activation likely occursat both upstream proteins such as RTK/SHP2 and downstreamproteins such as RAF/MEK. This is consistent with the notion thatthe MAPK pathway is tightly controlled through feedback regu-lation at multiple nodes (6).

We also specifically demonstrated that endogenous KRASG12C,KRASG12D, and KRASG12V can be feedback-activated by RTKs in aSHP2-dependent manner while the endogenous KRASG13D andKRASQ61H are feedback-activated in a SHP2-independentmanner(Fig. 3B–G). This observation is consistent with the findings thatKRASG12C and KRASG12D retain higher levels of intrinsic GTPhydrolysis activity compared with other KRAS variants and there-foremay bemore dependent on RTK/SHP2 for GTP-loading (28).The mechanism of SHP2-mediated feedback activation ofKRASG12V with very low intrinsic GTP hydrolysis activity asKRASG13D and KRASQ61H in biochemical assays is yet to bedetermined but consistent with the emerging data that otherKRAS G12 variants are dependent on RTK (44, 45). The SHP2-independent mechanism of GTP loading to KRASG13D andKRASQ61H also remains to be elucidated.

We have also observed a few examples of disconnectionsbetween the feedback activation of p-MEK and mutant KRAS. InNCI-H2122 (KRASG12C/G12C) and COR-L23 (KRASG12V/G12V), thereduction in p-MEK feedback activation by SHP2 inhibition is lessthan the reduction in mutant KRAS feedback activation (Fig. 3Cand E). This disconnect is likely due to feedback activation ofp-MEK downstream of RAS such as RAF, which can occur eitherconcurrently with feedback activation of mutant KRAS or adap-tively when the feedback activation of RAS is blocked by inhibi-tion of RAS or SHP2. In this case, the p-MEK assay may under-estimate the suppression of RAS activity by SHP2 inhibitors. As animperfect surrogate assay for RAS feedback activation, our p-MEKassay coupled with SHP2 inhibition, correctly revealed that manycell lines bearing KRASG12C/D/V mutations, as well as other KRASG12 variants, often have a large amount of feedback activationfrom upstream of RAS. In addition, our p-MEK assay identified afew heterozygous KRAS-mutant cell lines where WT KRAScontributed substantially to pathway feedback activation(T3M-4Q61H/þ; Fig. 3G). This novel finding provides a rationaleto cotarget feedback activation for various emerging therapeuticsselectively targeting the mutant KRAS such as G12Ci. Overall, thep-MEK feedback activation assay may better reflect the generalpathway reactivation than the RAS activation assay.

Interestingly, the RTK/SHP2–mediated feedback activationseems to be less common in NRASQ61 melanoma cell lines(Fig. 1E), which could be related to the low expression of RTKsin melanoma. This observation led us to hypothesize that theexpression levels of SHP2, RTKs, and their ligandsmay potentiallydetermine whether RTK/SHP2 is the major contributor to thepathway reactivation. However, no significant differences were

found between the expression levels of those genes in cell linesthat rely more on SHP2 for feedback activation and those that areless dependent (Supplementary Table S3). Phospho-FRS2 wasproposed as a biomarker for FGFR1 feedback activation in KRAS-mutant lung and pancreatic cancer cells (18). Similar to FRS2,SHP2 can be phosphorylated upon RTK activation, which facil-itates SHP2 activation (51, 52). It was also reported that phospho-SHP2 at Y542 (p-SHP2) may serve as a biomarker for RTK-drivenacquired resistance to vemurafenib inmelanoma (53). Therefore,we examined p-SHP2 changes during feedback activation. Indeed,in 3 of 4 cell lines with RTK/SHP2–driven feedback activation,selumetinib strongly increased p-SHP2 (Supplementary Fig. S5).In contrast, none of the three cell lines in which the feedbackactivationwas less dependent on SHP2 exhibited p-SHP2 increasefollowing treatment with selumetinib. These findings suggest thatp-SHP2 induction following MEKi treatment may serve as apredictive biomarker of RTK/SHP2–mediated feedback activationto inform combination strategies with SHP2 inhibitors.

In KRAS-mutant cell lines in which feedback activation ismainly driven by RTK/SHP2, we observed both improved efficacyand enhanced pathway suppression by combinedMEK and SHP2inhibition in vitro and in vivo. However, the tolerability of thiscombination could be a concern. Indeed, severe body weightloss was observed in mice treated with SHP099 at its MTD (100mpk/day) in combination with trametinib. Therefore, SHP099was administered at a reduced dose (50 mpk or 25 mpk, everyother day) when combined with trametinib (0.3 mpk/day) toimprove the combination tolerability. Encouragingly, combina-tion benefit was still achieved with the tolerated dosing regimensand intermittent dosing could also be explored in preclinicalmodels and eventually clinical studies.

Notably, trametinib treatment caused adaptive p-MEK induc-tion in vivo in all three xenograft models studied, consistent withthe observation in vitro. However, the p-MEK reduction by cotreat-ment with SHP099 was not as dramatic as observed in vitro(Fig. 5B and D; Supplementary Fig. S4B). This disconnect maybe due to the difference between plasma drug concentrationfluctuations and the fixed drug concentration in media. Or thep-MEK–adaptive induction may not accurately reflect RAS acti-vation in vivo due to additional feedback activation mechanismsafter prolonged treatment. Nonetheless, the SHP099 and trame-tinib combination achieved further MAPK pathway inhibitionin vivo than either inhibitor alone, which translated into enhancedantitumor efficacy in KRAS-mutant tumors. In addition, signifi-cant antitumor activity with single-agent SHP099 was observedin vivo in all three xenograftmodels studied, which coincidedwithdecreased p-ERK levels to various degrees (Fig. 5B and D; Sup-plementary Fig. S4B). This is in contrast to the lack of SHP2iefficacy in KRAS-mutant cell lines in vitro (Fig. 4C) as previouslyreported (24). Thismay be possibly explainedby ourfindings thatsome KRAS variants such as G12C/D/V can still be regulated byRTK/SHP2. This observation is consistent with recent reports thatSHP2 is required for KRAS-mutant tumor growth in vivo and SHP2inhibition may reduce the baseline GTP loading of severalKRASG12 variants (44, 45).

The two recent studies (44, 45) also reported similar combi-nation benefits of SHP2i and MEKi and observed better p-ERKinhibition in both KRAS-mutant and amplified models (54).Fedele and colleagues (55) also reported the combinationbenefitsof SHP2 and MEK inhibition in KRAS-mutant cancer models aswell as KRAS WT breast and ovarian cancer models but on the

Lu et al.





basis of time-dependent transcriptional upregulation of RTK andRTK ligand gene expression. Our findings are generally in agree-ment with those reports and provide a distinct rationale for theSHP2iþMEKi combination: a quick and robust (within 24 hours)feedback activation of RTK versus transcriptional upregulation ofRTK and its ligands or single-agent activity of SHP2i in KRAS-mutant models in vivo. In addition, we specifically demonstratedthat endogenous KRASG12C/D/V can be regulated by SHP2 usingmutant-specific inhibitors and antibodies (Fig. 3B–E). Our studyand the three other reports collectively demonstrated that com-bining SHP2 inhibitors with MEK inhibitors may achieve bettersuppression of mutant KRAS signaling by not only augmentingthe upfront inhibition of the MAPK pathway but also preventingadaptive resistance to MEKi due to feedback activation of RTK aswell as transcriptional upregulation of RTK and its ligands. Withthe progress of clinical development of SHP2 inhibitors such asTNO155 (ClinicalTrials.gov NCT03114319), the tolerability andeffectiveness of various SHP2i and MEKi combination regimensfor KRAS-mutant cancers can be further explored in clinicalstudies.

Disclosure of Potential Conflicts of InterestE. Manchado has ownership interest (including stocks and patents) in

Novartis. S.M. Brachmann has ownership interest (including stocks andpatents) in Novartis. S.E. Moody has ownership interest (including stocks andpatents) in Novartis. J.A. Engelman is global head, oncology, at NovartisInstitute for Biomedical Research and has ownership interest (including stocksand patents) in Novartis. No potential conflicts of interest were disclosed by theother authors.

Authors' ContributionsConception and design: H. Lu, R. Velazquez, S.M. Brachmann, J.A. Engelman,G. Caponigro, H.-X. HaoDevelopment of methodology: H. Lu, C. Liu, H. Wang, L.M. Dunkl, M. Kazic-Legueux, A. Haberkorn, S.M. Brachmann, H.-X. HaoAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.):H. Lu, C. Liu, R. Velazquez, E. Manchado, M.MohseniAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): H. Lu, C. Liu, R. Velazquez, S.M. Brachmann,M. Mohseni, H.-X. HaoWriting, review, and/or revision of themanuscript:H. Lu, C. Liu, R. Velazquez,M. Kazic-Legueux, E. Manchado, S.E. Moody, P.S. Hammerman, G. Caponigro,M. Mohseni, H.-X. HaoAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): E. BillyStudy supervision: S.M. Brachmann, J.A. Engelman, P.S. Hammerman,G. Caponigro, M. Mohseni, H.-X. Hao

AcknowledgmentsWe thank Lisa Quinn and William Tschantz at Novartis for producing

onartuzumab used in this study. We also thank the following Novartis collea-gues, Yingnan Chen, Bryan Egge, Erick Morris, Tina Yuan, Mariela Jaskelioff,Matthew LaMarche,Michael Acker, Serena Silver, ZhaoChen, andDarrin Stuart,for their technical advice, discussion of data interpretation, suggestions ofexperiment design, and comments on the manuscript. This study was fundedby Novartis Institutes for BioMedical Research.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received August 1, 2018; revised December 8, 2018; accepted May 3, 2019;published first May 8, 2019.

References1. SimanshuDK, Nissley DV,McCormick F. RAS proteins and their regulators

in human disease. Cell 2017;170:17–33.2. Blumenschein GR Jr, Smit EF, Planchard D, Kim DW, Cadranel J, De Pas T,

et al. A randomized phase II study of theMEK1/MEK2 inhibitor trametinib(GSK1120212) compared with docetaxel in KRAS-mutant advanced non-small-cell lung cancer (NSCLC)dagger. Ann Oncol 2015;26:894–901.

3. Janne PA, van denHeuvel MM, Barlesi F, CoboM,Mazieres J, Crino L, et al.Selumetinib plus docetaxel compared with docetaxel alone and progres-sion-free survival in patients with KRAS-mutant advanced non-small celllung cancer: the SELECT-1 randomized clinical trial. JAMA 2017;317:1844–53.

4. Baines AT, Xu D, Der CJ. Inhibition of Ras for cancer treatment: the searchcontinues. Future Med Chem 2011;3:1787–808.

5. Hennig A, Markwart R, Wolff K, Schubert K, Cui Y, Prior IA, et al. Feedbackactivation of neurofibromin terminates growth factor-induced Ras activa-tion. Cell Commun Signal 2016;14:5.

6. Lake D, Correa SA, Muller J. Negative feedback regulation of the ERK1/2MAPK pathway. Cell Mol Life Sci 2016;73:4397–413.

7. Kitai H, EbiH, Tomida S, Floros KV, Kotani H, Adachi Y, et al. Epithelial-to-mesenchymal transition defines feedback activation of receptor tyrosinekinase signaling induced by MEK inhibition in KRAS-mutant lung cancer.Cancer Discov 2016;6:754–69.

8. Lito P, Saborowski A, Yue J, SolomonM, Joseph E,Gadal S, et al.Disruptionof CRAF-mediated MEK activation is required for effective MEK inhibitionin KRAS mutant tumors. Cancer Cell 2014;25:697–710.

9. Pratilas CA, Solit DB. Targeting the mitogen-activated protein kinasepathway: physiological feedback and drug response. Clin Cancer Res2010;16:3329–34.

10. Merchant M, Moffat J, Schaefer G, Chan J, Wang X, Orr C, et al. CombinedMEK and ERK inhibition overcomes therapy-mediated pathway reactiva-tion in RAS mutant tumors. PLoS One 2017;12:e0185862.

11. Shao W, Mishina YM, Feng Y, Caponigro G, Cooke VG, Rivera S, et al.Antitumor properties of RAF709, a highly selective and potent inhibitor of

RAF kinase dimers, in tumors driven by mutant RAS or BRAF. Cancer Res2018;78:1537–48.

12. Scheffzek K, AhmadianMR, KabschW,Wiesmuller L, Lautwein A, SchmitzF, et al. TheRas-RasGAP complex: structural basis forGTPase activation andits loss in oncogenic Ras mutants. Science 1997;277:333–8.

13. Bernards A, Settleman J. GAP control: regulating the regulators of smallGTPases. Trends Cell Biol 2004;14:377–85.

14. PatricelliMP, JanesMR, Li LS,HansenR, Peters U, Kessler LV, et al. Selectiveinhibition of oncogenic KRAS output with small molecules targeting theinactive state. Cancer Discov 2016;6:316–29.

15. Lito P, Solomon M, Li LS, Hansen R, Rosen N. Allele-specific inhibitorsinactivate mutant KRAS G12C by a trapping mechanism. Science 2016;351:604–8.

16. Janes MR, Zhang J, Li LS, Hansen R, Peters U, Guo X, et al. Targeting KRASmutant cancers with a covalent G12C-specific inhibitor. Cell 2018;172:578–89.

17. Hennig A, Markwart R, Esparza-Franco MA, Ladds G, Rubio I. Rasactivation revisited: role of GEF and GAP systems. Biol Chem 2015;396:831–48.

18. Manchado E, Weissmueller S, Morris JP 4th, Chen CC, Wullenkord R,Lujambio A, et al. A combinatorial strategy for treating KRAS-mutantlung cancer. Nature 2016;534:647–51.

19. Neel BG, GuH, Pao L. The 'Shp'ing news: SH2 domain-containing tyrosinephosphatases in cell signaling. Trends Biochem Sci 2003;28:284–93.

20. Matozaki T, Murata Y, Saito Y, Okazawa H, Ohnishi H. Protein tyrosinephosphatase SHP-2: a proto-oncogene product that promotes Ras activa-tion. Cancer Sci 2009;100:1786–93.

21. Grossmann KS, Rosario M, Birchmeier C, Birchmeier W. The tyrosinephosphatase Shp2 in development and cancer. Adv Cancer Res 2010;106:53–89.

22. Hui E, Cheung J, Zhu J, Su X, Taylor MJ, Wallweber HA, et al. T cellcostimulatory receptor CD28 is a primary target for PD-1-mediated inhi-bition. Science 2017;355:1428–33.






23. Garcia Fortanet J, Chen CH, Chen YN, Chen Z, Deng Z, Firestone B, et al.Allosteric inhibition of SHP2: identification of a potent, selective, andorally efficacious phosphatase inhibitor. J Med Chem 2016;59:7773–82.

24. Chen YN, LaMarche MJ, Chan HM, Fekkes P, Garcia-Fortanet J, Acker MG,et al. Allosteric inhibition of SHP2 phosphatase inhibits cancers driven byreceptor tyrosine kinases. Nature 2016;535:148–52.

25. Barretina J, Caponigro G, Stransky N, Venkatesan K, Margolin AA, Kim S,et al. The Cancer Cell Line Encyclopedia enables predictive modelling ofanticancer drug sensitivity. Nature 2012;483:603–7.

26. Marsilje III TH, Lu W, Chen B, He X, Lee CC-H, Jiang S, et al. Novartis AG,assignee. Pyrimidine derivatives as kinase inhibitors patent WO 2010/002655A2. 2010 Jan 7.

27. Yeh TC, Marsh V, Bernat BA, Ballard J, Colwell H, Evans RJ, et al. Biologicalcharacterization of ARRY-142886 (AZD6244), a potent, highly selectivemitogen-activated protein kinase kinase 1/2 inhibitor. Clin Cancer Res2007;13:1576–83.

28. Hunter JC,Manandhar A, CarrascoMA, Gurbani D, Gondi S,Westover KD.Biochemical and structural analysis of common cancer-associated KRASmutations. Mol Cancer Res 2015;13:1325–35.

29. Smith MJ, Neel BG, Ikura M. NMR-based functional profilingof RASopathies and oncogenic RAS mutations. Proc Natl Acad SciU S A 2013;110:4574–9.

30. Henry JR, Kaufman MD, Peng SB, Ahn YM, Caldwell TM, Vogeti L, et al.Discovery of 1-(3,3-dimethylbutyl)-3-(2-fluoro-4-methyl-5-(7-methyl-2-(methylamino)pyrido[2,3- d]pyrimidin-6-yl)phenyl)urea (LY3009120)as a pan-RAF inhibitor with minimal paradoxical activation andactivity against BRAF or RAS mutant tumor cells. J Med Chem 2015;58:4165–79.

31. Guagnano V, Furet P, Spanka C, Bordas V, Le Douget M, Stamm C, et al.Discovery of 3-(2,6-dichloro-3,5-dimethoxy-phenyl)-1-{6-[4-(4-ethyl-piperazin-1-yl)-phenylamin o]-pyrimidin-4-yl}-1-methyl-urea (NVP-BGJ398), a potent and selective inhibitor of the fibroblast growth factorreceptor family of receptor tyrosine kinase. JMedChem2011;54:7066–83.

32. Guagnano V, Kauffmann A, Wohrle S, StammC, Ito M, Barys L, et al. FGFRgenetic alterations predict for sensitivity to NVP-BGJ398, a selective pan-FGFR inhibitor. Cancer Discov 2012;2:1118–33.

33. Baltschukat S, Engstler BS, Huang A, Hao HX, Tam A, Wang HQ, et al.Capmatinib (INC280) is active against models of non-small cell lungcancer and other cancer types with definedmechanisms of MET activation.Clin Cancer Res 2019;25:3164–75.

34. Gao H, Korn JM, Ferretti S, Monahan JE, Wang Y, Singh M, et al. High-throughput screening using patient-derived tumor xenografts to predictclinical trial drug response. Nat Med 2015;21:1318–25.

35. Mason JM, Morrison DJ, Basson MA, Licht JD. Sprouty proteins: multifac-eted negative-feedback regulators of receptor tyrosine kinase signaling.Trends Cell Biol 2006;16:45–54.

36. Merchant M, Ma X, Maun HR, Zheng Z, Peng J, Romero M, et al. Mono-valent antibody design and mechanism of action of onartuzumab, a METantagonist with anti-tumor activity as a therapeutic agent. Proc Natl AcadSci U S A 2013;110:E2987–96.

37. Dardaei L, Wang HQ, Singh M, Fordjour P, Shaw KX, Yoda S, et al. SHP2inhibition restores sensitivity in ALK-rearrangednon-small-cell lung cancerresistant to ALK inhibitors. Nat Med 2018;24:512–7.

38. Freudlsperger C, Burnett JR, Friedman JA, Kannabiran VR, Chen Z,VanWaes C. EGFR-PI3K-AKT-mTOR signaling in head and neck squamous

cell carcinomas: attractive targets for molecular-oriented therapy.Expert Opin Ther Targets 2011;15:63–74.

39. Dey JH, Bianchi F, Voshol J, Bonenfant D, Oakeley EJ, Hynes NE. Targetingfibroblast growth factor receptors blocks PI3K/AKT signaling, inducesapoptosis, and impairs mammary tumor outgrowth and metastasis.Cancer Res 2010;70:4151–62.

40. Mendoza MC, Er EE, Blenis J. The Ras-ERK and PI3K-mTOR pathways:cross-talk and compensation. Trends Biochem Sci 2011;36:320–8.

41. Lehar J, Zimmermann GR, Krueger AS, Molnar RA, Ledell JT, Heilbut AM,et al. Chemical combination effects predict connectivity in biologicalsystems. Mol Syst Biol 2007;3:80.

42. Furet P, Guagnano V, Fairhurst RA, Imbach-Weese P, Bruce I, Knapp M,et al. Discovery of NVP-BYL719 a potent and selective phosphatidylino-sitol-3 kinase alpha inhibitor selected for clinical evaluation. Bioorg MedChem Lett 2013;23:3741–8.

43. Song L, Turkson J, Karras JG, Jove R, Haura EB. Activation of Stat3 byreceptor tyrosine kinases and cytokines regulates survival in human non-small cell carcinoma cells. Oncogene 2003;22:4150–65.

44. Ruess DA, Heynen GJ, Ciecielski KJ, Ai J, Berninger A, Kabacaoglu D, et al.Mutant KRAS-driven cancers depend on PTPN11/SHP2 phosphatase.Nat Med 2018;24:954–60.

45. Mainardi S, Mulero-Sanchez A, Prahallad A, Germano G, Bosma A, Krim-penfort P, et al. SHP2 is required for growthofKRAS-mutant non-small-celllung cancer in vivo. Nat Med 2018;24:961–7.

46. Ueki K,Matsuda S, Tobe K, Gotoh Y, TamemotoH, YachiM, et al. Feedbackregulation of mitogen-activated protein kinase kinase kinase activity ofc-Raf-1 by insulin and phorbol ester stimulation. J Biol Chem 1994;269:15756–61.

47. Dougherty MK, Muller J, Ritt DA, Zhou M, Zhou XZ, Copeland TD, et al.Regulation of Raf-1 by direct feedback phosphorylation.Mol Cell 2005;17:215–24.

48. Langlois WJ, Sasaoka T, Saltiel AR, Olefsky JM. Negative feedbackregulation and desensitization of insulin- and epidermal growthfactor-stimulated p21ras activation. J Biol Chem 1995;270:25320–3.

49. Corbalan-Garcia S, Yang SS, Degenhardt KR, Bar-Sagi D. Identificationof the mitogen-activated protein kinase phosphorylation sites onhuman Sos1 that regulate interaction with Grb2. Mol Cell Biol 1996;16:5674–82.

50. Porfiri E, McCormick F.Regulation of epidermal growth factor receptorsignaling by phosphorylation of the ras exchange factor hSOS1. J BiolChem 1996;271:5871–7.

51. Lu W, Gong D, Bar-Sagi D, Cole PA. Site-specific incorporation of aphosphotyrosine mimetic reveals a role for tyrosine phosphorylation ofSHP-2 in cell signaling. Mol Cell 2001;8:759–69.

52. Araki T, NawaH, Neel BG. Tyrosyl phosphorylation of Shp2 is required fornormal ERK activation in response to some, but not all, growth factors.J Biol Chem 2003;278:41677–84.

53. Prahallad A, Heynen GJ, Germano G, Willems SM, Evers B, Vecchione L,et al. PTPN11 is a central node in intrinsic and acquired resistance totargeted cancer drugs. Cell Rep 2015;12:1978–85.

54. Wong GS, Zhou J, Liu JB, Wu Z, Xu X, Li T, et al. Targeting wild-type KRAS-amplified gastroesophageal cancer through combined MEK and SHP2inhibition. Nat Med 2018;24:968–77.

55. Fedele C, Ran H, Diskin B, Wei W, Jen J, Geer MJ, et al. SHP2 inhibitionprevents adaptive resistance to MEK inhibitors in multiple cancer models.Cancer Discov 2018;8:1237–49.


Lu et al.




2019;18:1323-1334. Published OnlineFirst May 8, 2019.Mol Cancer Ther Hengyu Lu, Chen Liu, Roberto Velazquez, et al. KRAS-Mutant Tumors Treated with MEK InhibitorsSHP2 Inhibition Overcomes RTK-Mediated Pathway Reactivation in

Updated version

10.1158/1535-7163.MCT-18-0852doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2019/05/08/1535-7163.MCT-18-0852.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/18/7/1323.full#ref-list-1

This article cites 54 articles, 21 of which you can access for free at:

Citing articles

http://mct.aacrjournals.org/content/18/7/1323.full#related-urls

This article has been cited by 7 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/18/7/1323To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-18-0852http://mct.aacrjournals.org/content/suppl/2019/05/08/1535-7163.MCT-18-0852.DC1http://mct.aacrjournals.org/content/18/7/1323.full#ref-list-1http://mct.aacrjournals.org/content/18/7/1323.full#related-urlshttp://mct.aacrjournals.org/cgi/alertsmailto:[email protected]://mct.aacrjournals.org/content/18/7/1323http://mct.aacrjournals.org/

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages false /GrayImageMinResolution 200 /GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages false /MonoImageMinResolution 600 /MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 900 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/CreateJDFFile false /Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles false /MarksOffset 18 /MarksWeight 0.250000 /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA /PageMarksFile /RomanDefault /PreserveEditing true /UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling /LeaveUntagged /UseDocumentBleed false >> > ]>> setdistillerparams> setpagedevice

shp2 inhibition overcomes rtk-mediated pathway ... · rtk/shp2–mediated feedback activation is...

Documents