O

M(

JAa

b

a

ARRAA

KHBOM

I

tciawbzpHc1

gotW

1h

Ticks and Tick-borne Diseases 4 (2013) 341– 345

Contents lists available at SciVerse ScienceDirect

Ticks and Tick-borne Diseases

jo ur nal homepage: www.elsev ier .com/ locate / t tbd is

riginal article

olecular detection and identification of hemoparasites in pampas deerOzotoceros bezoarticus Linnaeus, 1758) from the Pantanal Brazil

úlia A.G. Silveiraa, Élida M.L. Rabeloa, Ana C.R. Lacerdab, Paulo A.L. Borgesb, Walfrido M. Tomásb,iesca O. Pellegrinb, Renata G.P. Tomichb, Múcio F.B. Ribeiroa,∗

Departamento de Parasitologia, ICB – UFMG, Minas Gerais, BrazilEMBRAPA-Pantanal (Brazilian Enterprise for Agricultural Research), Mato Grosso do Sul, Brazil

r t i c l e i n f o

rticle history:eceived 31 July 2012eceived in revised form 21 January 2013ccepted 21 January 2013vailable online 6 April 2013

eywords:emoparasites

a b s t r a c t

Hemoparasites were surveyed in 60 free-living pampas deer Ozotoceros bezoarticus from the central areaof the Pantanal, known as Nhecolândia, State of Mato Grosso do Sul, Brazil, through the analysis of nestedPCR assays and nucleotide sequencing. Blood samples were tested for Babesia/Theileria, Anaplasma spp.,and Trypanosoma spp. using nPCR assays and sequencing of the 18S rRNA, msp4, ITS, and cathepsin Lgenes. The identity of each sequence was confirmed by comparison with sequences from GenBank usingBLAST software. Forty-six (77%) pampas deer were positive for at least one hemoparasite, accordingto PCR assays. Co-infection occurred in 13 (22%) animals. Based on the sequencing results, 29 (48%)

razilian deerzotoceros bezoarticusolecular detection

tested positive for A. marginale. Babesia/Theileria were detected in 23 (38%) samples, and according tothe sequencing results 52% (12/23) of the samples were similar to T. cervi, 13% (3/23) were similar toBabesia bovis, and 9% (2/23) were similar to B. bigemina. No samples were amplified with the primers forT. vivax, while 11 (18%) were amplified with the ITS primers for T. evansi. The results showed pampasdeer to be co-infected with several hemoparasites, including species that may cause serious disease incattle. Pampas deer is an endangered species in Brazil, and the consequences of these infections to theirhealth are poorly understood.

ntroduction

Natural habitats of cervids have been significantly transformedhrough intense deforestation driven by the needs of farmers andattle breeders. As a consequence, many cervids have begun liv-ng in proximity to domestic animals and humans. Some diseasesre associated with spill-over from domestic animals to nearbyildlife populations (Daszak et al., 2000). The emergence of tick-

orne diseases is associated with interactions of pathogens in aoonotic relationship with wildlife, domestic animals, and humanopulations (Daszak et al., 2000; Munderloh and Kurtti, 2010).emoparasites are a serious problem in domestic ruminants livinglose to wild animals, particularly deer, in South America (Duarte,997).

The pampas deer, Ozotoceros bezoarticus, is on the list of endan-

ered species in Brazil (IUCN, 2012). It characteristically lives inpen habitats and primarily occupies the central areas of the Pan-anal wetlands where grasslands and open savanna dominate.

ithin this area, Nhecolândia supports the highest population

∗ Corresponding author. Tel.: +55 31 34092842; fax: +55 31 34092970.E-mail address: muciobr@icb.ufmg.br (M.F.B. Ribeiro).

877-959X/$ – see front matter © 2013 Elsevier GmbH. All rights reserved.ttp://dx.doi.org/10.1016/j.ttbdis.2013.01.008

© 2013 Elsevier GmbH. All rights reserved.

density of pampas deer (Tomás, 1995; Merino et al., 1997; Mourãoet al., 2000).

Anaplasma, Babesia, and Trypanosoma are the major hemopar-asites reported in domestic ruminants in Brazil (Madruga, 2004;Barros et al., 2005). Hard ticks are vectors of anaplasmosis andbabesiosis, and hematophagus Diptera are vectors of trypanoso-miasis and anaplasmosis (Gardiner, 1989; Cohn, 2003; Madruga,2004; Barros et al., 2005).

Cervids can be infected with these hemoparasites, suggestingan interchange of pathogens between wild and domestic animals(Duarte, 2007). Although the impact of such parasites on wildcervids is not known, clinical manifestations have been reportedin a single immunosuppressed individual (Perry et al., 1985).

Investigations of the infection of cervids with hemoparasitesin Brazil are scarce. Anaplasmataceae agents have been detectedin wild ruminants (Machado et al., 2006; Picoloto et al., 2010;Sacchi et al., 2012; Silveira et al., 2012). Machado and Müller (1996)reported the prevalence of B. bovis and B. bigemina in pampas deer

from the State of Goiás, and a high prevalence of Theileria spp. wasdetected in Minas Gerais (Silveira et al., 2011). Herrera et al. (2010)recorded T. evansi in pampas deer on the Pantanal.

The aim of the present study was to survey hemoparasites infree-living pampas deer from Nhecolândia in the Pantanal, State

342 J.A.G. Silveira et al. / Ticks and Tick-borne Diseases 4 (2013) 341– 345

ons (t

on

M

mur0

P

f5owp(awr

Fig. 1. Map showing the location of the study area in Brazilian Pantanal subregi

f Mato Grosso do Sul, Brazil, through nested PCR assays anducleotide sequencing.

aterials and methods

The research was approved by the Ethical Committee on Ani-al Experimentation (CETEA/UFMG, Belo Horizonte, MG, Brazil)

nder protocol no. 142/08, and by the Brazilian Institute for Envi-onment and Natural Renewable Resources (IBAMA, 032/2005,214.0022008/05-00).

ampas deer samples

Sixty pampas deer were captured in a livestock farmrom Nhecolândia a Brazilian Pantanal sub region (18◦59′115′′S6◦37′63′′N), in 2006 where the main economic activity is basedn extensive breeding on natural pastures (Fig. 1). The animalsere restrained by anesthetic dart (Distinject, model 35 or blow-

ipe, Zootech). Chemical anesthesia with tiletamine/zolazepam1.0 mg/kg), xylazine (0.1 mg/kg), and atropine (0.01 mg/kg) wasdministered to animals, and intravenous injection of yohimbineas used to reverse anesthesia. Data regarding age and sex were

ecorded during clinical examination.

he dot in the region 6 corresponds to the area from where deer were captured).

Blood-sampling

Samples of blood collected by puncture of the jugular vein weretransferred immediately to vials without anticoagulant. After cen-trifugation, aliquots of erythrocyte layers were frozen and storedfor subsequent DNA extraction.

DNA extraction and PCR amplification

DNA was extracted from 300 �l of erythrocyte layers using aWizard Genomic DNA Purification Kit (Promega, Madison, WI, USA)following the manufacturer’s instructions for isolation of genomicDNA from whole blood. Prior to DNA extraction, samples were incu-bated with 15 �l of 5% saponin at 37 ◦C for 10 min and washed 6times with 900 �l cell lysis solution.

The PCR was performed in 2 stages by nested PCR. An aliquotof the first amplified PCR product was used for a second PCR witha second set of primers. These were chosen to amplify the targetsequence of the first PCR, thereby increasing sensitivity.

Sets of primers were used to detect hemoparasite species(Table 1). Twice-distilled water was used as the negative control(no DNA). For the positive control, DNA was extracted from 300 �lof whole blood of host species of each target parasite. A calf exper-imentally infected with A. marginale and another experimentally

J.A.G. Silveira et al. / Ticks and Tick-borne Diseases 4 (2013) 341– 345 343

Table 1Specific primers used for the detection of hemoparasites.

Specificity Primer sequence (5′–3′) Target Name Product size (pb) Reference

A. marginale/A. ovis GGGAGCTCCTATGAATTACAGAGAATTGTTTAC msp4 MSP45 872 de la Fuente et al., 20081st reaction CCGGATCCTTAGCTGAACAGGAATCTTGC MSP432nd reaction CGCCAGCAAACTTTTCCAAA msp4 AnapF 294 Silveira et al., 2011

ATATGGGGACACAGGCAAAT AnapR

Babesia/Theileria CGGGATCCAACCTGGTTGATCCTGC 18S RIB-19 1700 Zahler et al., 20001st reaction CCGAATTCCTTGTTACGACTTCTC rRNA RIB-20

ACCTCACCAGGTCCAGACAG 18S rRNA BAB-rumF 430 Silveira et al., 20112nd reaction GTACAAAGGGCAGGGACGTA BAB-rumR

T. evansi GCACAGTATGCAACCAAAAA ITS Te1F 280 a

1st reaction GTGGTCAACAGGGAGAAAAT Te1R2nd reaction CATGTATGTGTTTCTATATG ITS Te2F 219 a

CatheL

i avai

icoiasfi

0(cua1

011og

tf3mvfirssl

QPi1uausf

N

bJ

T. vivax GCCATCGCCAAGTACCTCGCGA

TTAGAATTCCCAGGAGTTCTTGATGATCCAGTA

a Trypanosoma evansi ITS fragment identified by aligning sequences from T. evans

nfected with B. bovis and B. bigemina were used for the amplifi-ation of the msp4 gene of A. marginale and the 18S rRNA regionf Babesia and Theileria species, respectively. Mice experimentallynfected with T. evansi were used for amplification of the ITS region,nd a cow naturally infected with T. vivax, diagnosed by bloodmear, nPCR, and nucleotide sequencing was used for the ampli-cation of the catalytic domain of cathepsin L of T. vivax.

The first reaction mixture comprised 1.2 �l dNTPs (2.5 mM),.15 �l Taq polymerase (Phoneutria, Belo Horizonte, MG, Brazil)0.05 U), 1.5 �l reaction buffer IB (1×), 0.6 �l of a solutionontaining the mixed primers (10 mM), and 10.05 �l sterileltra-pure water. A 1.5 �l aliquot of the DNA template wasdded to the reaction mixture to give a final volume of5 �l.

The second reaction mixture comprised 2.0 �l dNTPs (2.5 mM),.25 �l Taq polymerase (0.05 U), 2.5 �l reaction buffer IB (1×), and.0 �l of a solution containing the mixed primers (10 mM) and6.75 �l sterile ultra-pure water. An aliquot (2.5 �l) of ampliconbtained in the first reaction was added to the reaction mixture toive a final volume of 25 �l.

Amplification was performed using an Eppendorf Mastercyclerhermocycler (Eppendorf, São Paulo, SP, Brazil). The program usedor amplification was 94 ◦C for 5 min (initial denaturation step),0 cycles of 92 ◦C for 1 min (denaturation), 54 ◦C (to amplify A.arginale/A. ovis and Babesia/Theileria) and 56 ◦C (to amplify T.

ivax and T. evansi) for 1 min (annealing), 72 ◦C for 2 min, and anal extension step at 72 ◦C for 8 min. Following amplification,eaction mixtures were maintained at 12 ◦C. PCR amplicons wereeparated by electrophoresis on 1% agarose gel (40 min, 100 V),tained with GelRedTM (Biotium) and visualized under ultravioletight.

The positive PCR products were subsequently purified withIAquick PCR Purification Kit (Qiagen Biotecnologia Brasil, Sãoaulo, Brasil) following the manufacturer’s instructions. Sequenc-ng of the purified amplicons was performed on a MegaBACE000 DNA Analysis System (GE Healthcare, Waukesha, WI, USA)sing second reaction primers. Sequences were aligned, edited, andnalyzed at URL http://asparagin.cenargen.embrapa.br/phph/ andsing MEGA 5.0 software (Tamura et al., 2011). The identity of eachequence was confirmed by comparison with sequences availablerom GenBank using BLAST software.

ucleotide sequence accession numbers

The msp4, 18S rRNA, and ITS gene sequences haveeen deposited in GenBank under accession numbersX274262–JX274294.

psin Tvi2 177 Bezerra et al., 2008DTO156

lable at GenBank (http://www.ncbi.nlm.nih.gov).

Results

Forty-six (77%) pampas deer were positive for hemoparasitesaccording to PCR assays. Based on the sequencing results of themsp4 gene fragment, 29 (48%) of the deer tested were positive forA. marginale. These comprised 31% adult males, 31% adult females,14% young males, 17% young females, and 7% with no identification.

BLAST analysis of the amplicon sequences showed high identity(95–100%) with A. marginale strains deposited in GenBank and 100%identity with Brazilian cervid strains (JN022574.1, JN022572.1,JN022571.1, JN022570.1, JN022564.1, JN022563.1, JN022560.1,JN022557.1, JN022556.1).

Babesia and Theileria were detected in 23 (38%) of the deer, but6 samples were not sequenced successfully. BLAST analysis of theamplicon sequences showed identity with samples deposited inGenBank, with 12 of the 23 (52%) samples showing 90–100% simi-larity to T. cervi (accession number gbHQ184412.1) and 3 samples100% identical to the MGI12 sample (accession number HM466922)from Brazilian Mazama gouazoubira; 3 samples (13%) with B. bovis(87–100% identity to samples from white-tailed deer Odocoileusvirginianus isolates HQ264127.1 and GU938850.1); and 2 samples(9%) with B. bigemina (99–100% maximum identity with bovine B.bigemina isolates EF458206.1 and EF458205.1).

Deer positive for T. cervi comprised 6 (50%) adult males, 2 (17%)adult females, 2 (17%) young females, one (8%) young male, andone (8%) not identified. One adult female, one adult male, and oneyoung male were positive for B. bovis. Finally, one adult male andone adult female were positive for B. bigemina.

No amplification was obtained with the primers specific forT. vivax. Eleven animals (18%), had the ITS region amplified forT. evansi, although only 2 samples were successfully sequenced(87 and 94% identity with accession numbers HQ593643.1 andAY912276.1). Of the 11 positive animals, 3 were adult males (27%), 3were adult females (27%), 2 were young males (18%), 2 were youngfemales (18%), and one was not identified (9%).

Pampas deer were co-infected with combinations of 2pathogens: A. marginale/T. cervi, A. marginale/T. evansi, T. evansi/T.cervi, T. evansi/B. bovis, and T. evansi/B. bigemina. Co-infectionoccurred in 13 (22%) deer, 9 of which were adult (54%) and 4 imma-ture animals (31%) (Table 2).

Discussion

The identification of infectious agents in wild deer is not onlycrucial for species protection, but also for providing valuable infor-mation regarding the epidemiological links to disease. The resultsof this study and other studies of the same research group showed

344 J.A.G. Silveira et al. / Ticks and Tick-bo

Table 2Pampas deer co-infected with hemoparasites according to pathogen, sex, and age.

Co-infection Total (n = 60) Female Male

Adult Young Adult Young

A. marginale/T. cervi 7% (4) 2% (1) 2% (1) 3% (2) 0A. marginale/T. evansi 7% (4) 0 3% (2) 3% (2) 0

3SGpd

tlrd

ltFatdttl

amudMdb

w(dtob

m(psftusp(

iil

C

f

T. evansi/T. cervi 2% (1) 2% (1) 0 0 0T. evansi/B. bovis 5% (3) 2% (1) 0 2% (1) 2% (1)T. evansi/B. bigemina 2% (1) 2% (1) 0 0 0

species of Brazilian deer (O. bezoarticus from Mato Grosso doul state, M. gouazoubira, and Blastocerus dichotomus from Minaserais state) co-infected with several hemoparasites, includinghylogenetically related species and those infective to humans andomestic animals (Silveira et al., 2011, 2012).

Prevalence of A. marginale infection reported here was higherhan described by Picoloto et al. (2010) (16.3%) from other popu-ations of pampas deer in the Pantanal, but is lower than valueseported for other cervids such as brown brocket deer and marsheer from Minas Gerais (78.6%) (Silveira et al., 2012).

The msp4 gene and protein sequences have been used for phy-ogenetic studies on members of the Anaplasmataceae and forhe genetic characterization of Anaplasma spp. (reviewed by de lauente et al., 2005). The nucleotide sequences of the msp4 geneligned on the MEGA 5.0 (Tamura et al., 2011) were identicalo sequences obtained for A. marginale in M. gouazoubira and B.ichotomus from Minas Gerais (Silveira et al., 2012). This reinforceshe value of the msp4 gene in studies of geographic distribution ofhis pathogen, without apparent changes related to host origin (dea Fuente et al., 2001).

Babesia and Theileria were detected in 38% of the pampas deer, smaller proportion than was detected in brown brocket deer andarsh deer from Minas Gerais (71.4%) (Silveira et al., 2011). Molec-

lar and serological tests in pampas deer from the same regionemonstrated a high prevalence of Babesia sp. (Villas-Boas, 2007).achado and Müller (1996) found 8.3% and 29.7% of the pampas

eer from Parque Nacional das Emas, Goiás, Brazil, positive for B.ovis and B. bigemina, respectively.

B. bovis samples in the present study showed close similarityith B. bovis-like infections from white-tailed deer in south Texas

USA) (Ramos et al., 2010) which, according to the authors, probablyo not infect bovines, because bovine babesiosis is not common inhe region. This is important, since wild ruminants are a reservoirf several infectious agents that, despite being closely related toovine parasites, do not infect cattle.

Trypanosomiasis is common on the Pantanal, because the cli-atic conditions are favorable for the development of the vectors

Herrera et al., 2004, 2005). Thus, more animals positive to Try-anosoma spp. were expected than were observed in the presenttudy. Herrera et al. (2010) found 68.9% of pampas deer sampledrom the same region to be positive for T. evansi and 21.6% posi-ive to T. vivax. This difference may be related to the methodologysed. In this study, we used erythrocytes, and most Trypanosomapecimens may have been removed along with the buffy coat andlasma, decreasing the number of trypanosomes in the samplesWoo, 1970).

Co-infection of 2 pathogens was detected in 22% of animals. Co-nfection was most common in older animals (69%) that had beenn long-term contact with the vectors and could remain carriers, ateast for Babesia and Theileria.

onclusion

The consequences of co-infection with several hemoparasitesor deer health are poorly understood, although when stressed, the

rne Diseases 4 (2013) 341– 345

deer may become immunosuppressed, favoring the emergence ofclinical signs of infection. Some of these pathogens can seriouslyaffect cattle, and when cattle and pampas deer live in close prox-imity, as in Pantanal, the risk of cross contamination is greatlyincreased with consequences for animal husbandry and free-livingdeer.

Acknowledgments

The authors are grateful to CAPES (Coordenac ão deAperfeic oamento de Pessoal de Nível Superior), to IBAMA (InstitutoBrasileiro do Meio Ambiente e dos Recursos Naturais Renováveis),and to EMBRAPA-Pantanal (Brazilian Enterprise for AgriculturalResearch). We thank Lucidus Consultancy for improving theEnglish, and for all contributions that allowed us to execute thepresent study.

References

Barros, S.L., Madruga, C.R., Araújo, F.R., Menk, C.F., de Almeida, M.A., Melo, E.P.,Kessler, R.H., 2005. Serological survey of Babesia bovis, Babesia bigemina, andAnaplasma marginale antibodies in cattle from the semi-arid region of the stateof Bahia, Brazil, by enzyme-linked immunosorbent assays. Mem. Inst. OswaldoCruz 100, 613–617.

Bezerra, F.S.B., Garcia, H.A., Alves, H.M., Oliveira, I.R.S., Silva, A.E., Teixeira,M.M.G., Batista, J.S., 2008. Trypanosoma vivax nos tecidos testicular e epi-didimário de ovinos experimentalmente infectados. Pesq. Vet. Bras. 28,575–582.

Cohn, L.A., 2003. Ehrlichiosis and related infections. Vet. Clin. Small Anim. Pract. 33,863–884.

Daszak, P., Cunningham, A.A., Hyatt, A.D., 2000. Emerging infectious diseases ofwildlife-threats to biodiversity and human health. Sci. Compass 287, 443–449,Available: www.sciencemag.org

de la Fuente, J., Van Den Bussche, R.A., Kocan, K.M., 2001. Molecular phylogenyand biogeography of North American isolates of Anaplasma marginale (Rickettsi-aceae:Ehrlichieae). Vet. Parasitol. 97, 65–76.

de la Fuente, J., Lew, A., Lutz, H., Meli, M.L., Hofmann-Lehmann, R., Shkap, V., Molad,T., Mangold, A.J., Almazan, C., Naranjo, V., Gortazar, C., Torina, A., Caracappa, S.,Garcıa-Perez, A.L., Barral, M., Oporto, B., Ceci, L., Carelli, G., Blouin, E.F., Kocan,K.M., 2005. Genetic diversity of Anaplasma species major surface proteins andimplications for anaplasmosis serodiagnosis and vaccine development. Anim.Health Res. Rev. 6, 75–89.

de la Fuente, J., Ruiz-Fons, F., Naranjo, V., Torina, A., Rodríguez, O., Gortázar, C., 2008.Evidence of Anaplasma infections in European roe deer (Capreolus capreolus)from southern Spain. Res. Vet. Sci. 84, 382–386.

Duarte, J.M.B. (Ed.), 1997. Biologia e conservac ão de cervídeos Sul-americanos: Blas-tocerus, Ozotocerus e Mazama. FUNEP, Jaboticabal, p. 238.

Duarte, J.M.B., 2007. Aftosa and other diseases in wildlife. In: One WorldOne Health: Healthy Ecosystems, Livestocks and Human Livelihoods:An innovative Public-private Partnership, Oral presentation. Available at:http://www.oneworldonehealthorg/oct2007/presentations/duarte.html

Gardiner, P.R., 1989. Recent studies of the biology of Trypanosoma vivax. Adv. Para-sitol. 28, 229–313.

Herrera, H.M., Dávila, A.M.R., Norek, A., Abreu, U.G.P., Souza, S.S., D’andrea, O.S.,Jansen, A.M., 2004. Enzootiology of Trypanosoma evansi in Pantanal. Brazil. Vet.Parasitol. 125, 263–275.

Herrera, H.M., Norek, A., Freitas, T.P.T., Rademaker, V., Fernandes, O., Jansen, A.M.,2005. Domestic and wild mammals infection by Trypanosoma evansi in a pristinearea of the Brazilian Pantanal region. Parasitol. Res. 96, 121–126.

Herrera, H.M., Dávila, A.M.R., Souza, S.S., Parreira, D.R., Abreu, U.G.P., Borges,P.A.L., Lacerda, A.C.R., Zucco, C.A., Tomás, W.M., Mourão, G.M., 2010. Infecc ãopor Trypanosoma evansi e Trypanosoma vivax em veado-campeiro (Ozotozerosbezoarticus, Cervidae, Perisodactyla) no pantanal da Nhecolândia, Mato Grossodo Sul, Brasil , Anais: XVI Congresso Brasileiro de Parasitologia Veterinária,Campo Grande, Mato Grosso do Sul, Brasil.

IUCN-Red List of Threatened Species (Accessed: 28.01.12). Available:www.iucnredlist.org

Machado, R.Z., Müller, E., 1996. Frequencia de anticorpos contra Babesia em Veado-campeiro (Ozotocerus bezoarticus) no Pantanal e no Parque das Emas. In: Duarte,J.M.B. (Ed.), Relatorio Final de Pesquisas do Projeto Veado-campeiro (Ozotocerusbezoarticus). FNMA, Brasilia, pp. 124–132 (cited by: Duarte, J.M.B., 2006. Artio-dactyla – Cervidae (Veado – catingueiro, Veado-campeiro, Cervo - do - pantanal).In: Cubas, Z.S. (Ed.), Tratado de animais selvagens - Medicina Veterinária, São

Paulo, Roca, pp. 641–664.

Machado, R.Z., Duarte, J.M.B., Dagnone, A.S., Szabó, M.P.J., 2006. Detection of Ehrlichiachaffeensis in Brazilian marsh deer (Blastocerus dichotomus). Vet. Parasitol. 139,262–266.

Madruga, C., 2004. Diagnóstico e epidemiologia do Trypanosoma (Duttonella) vivaxno Brasil. Rev. Bras. Parasitol. Vet. 13, 46–47.

ick-bo

M

M

M

P

P

R

S

J.A.G. Silveira et al. / Ticks and T

erino, M.L., Gonzales, S., Leeuwenberg, F., Rodrigues, F.H.G., Pinder, L., Tomas,W.M., 1997. Veado-campeiro (Ozotocerus bezoarticus). In: Duarte, J.M.B. (Ed.),Biologia e conservac ão de cervídeos Sul-americanos: Blastocerus, Ozotocerus eMazama. FUNEP, Jaboticabal, pp. 42–58.

ourão, G., Coutinho, M., Mauro, R., Campos, Z., Tomas, W., Magnusson, W., 2000.Aerial surveys of caiman, marsh-deer and pampa-deer in the Pantanal Wetlandof Brazil. Biol. Conserv. 92, 175–183.

underloh, U.G., Kurtti, T.J., 2010. Emerging and re-emerging tick-borne dis-eases: new challenges at the interface of human and animal health. (Accessed:08.11.12). Available at: http://www.iom.edu

erry, B.D., Nichols, D.K., Cullom, E.S., 1985. Babesia odocoilei (Emmerson and Wright,1970), in white-tailed deer, Odocoileus virginianus in Virginia. J. Wildl. Dis. 21,149–152.

icoloto, G., Ferreira de Lima, R., Olegário, L.A.O., Carvalho, C.M.E., Lacerda, A.C.R.,Tomás, W.M., Borges, P.A.L., Pellegrin, A.O., Madruga, C.R., 2010. Real-time poly-merase chain reaction to diagnose Anaplasma marginale in cattle and deer(Ozotoceros bezoarticus leucogaster) of the Brazilian Pantanal. Rev. Bras. Parasitol.Vet. 19, 186–188.

amos, C.M., Cooper, S.M., Holman, P.J., 2010. Molecular and serologic evidence forBabesia bovis-like parasites in white-tailed deer (Odocoileus virginianus) in southTexas. Vet. Parasitol. 172, 214–220.

acchi, A.B.V., Duarte, J.M.B., André, M.R., Machado, R.Z., 2012. Prevalence and molec-ular characterization of Anaplasmataceae agents in free-ranging Brazilian marshdeer (Blastocerus dichotomus). Comp. Immunol. Microb. 35, 325–334.

rne Diseases 4 (2013) 341– 345 345

Silveira, J.A.G., Rabelo, E.M.L., Ribeiro, M.F.B., 2011. Detection of Theileria and Babesiain brown brocket deer (Mazama gouazoubira) and marsh deer (Blastocerusdichotomus) in the State of Minas Gerais. Brazil. Vet. Parasitol. 177, 61–66.

Silveira, J.A.G., Rabelo, E.M.L., Ribeiro, M.F.B., 2012. Molecular detection of tick-borne pathogens of the family Anaplasmataceae in Brazilian brown brocket deer(Mazama gouazoubira, Fischer, 1814) and marsh deer (Blastocerus dichotomus,Illiger, 1815). Transbound Emerg. Dis. 59, 353–360.

Tomás, W.M., 1995. Seasonality of the antler cycle of Pampa deer (Ozotocerosbezoarticus leucogaster) from the Pantanal wetland, Brazil. Stud. Neotrop. FaunaEnviron. 30, 221–227.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:molecular evolutionary genetics analysis using maximum likelihood, evolution-ary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739.

Villas-Boas, J.C., 2007. Survey of Babesia bovis and B. bigemina in Ozotoceros bezoar-ticus leucogaster deer in the Pantanal wetland, Nhecolandia, Brazil. In: BabesiaWorld Summit 2, Palermo, Lombardo Editore, p. 109, Cited by: Canc ado, P.H.D.,Zucco, C.A., Piranda, E.M., Faccini, J.L.H., Mourao, G.M., 2009. Rhipicephalus(Boophilus) microplus (Acari: Ixodidae) as a parasite of pampas deer (Ozotoceros

bezoarticus) and cattle in Brazil’s Central Pantanal. Rev. Bras. Parasitol. Vet. 18,42–46.

Woo, P.T.K., 1970. The haematocrit centrifuge technique for the diagnosis of Africantrypanosomosis. Acta Trop. 27, 384–386.

Zahler, M., Rinder, H., Schein, E., Gothe, R., 2000. Detection of a new pathogenicBabesia microti-like species in dogs. Vet. Parasitol. 89, 241–248.