simultaneously typing nine serotypes of enteroviruses associated

1

Simultaneously typing nine serotypes of enteroviruses 1

associated with hand, foot and mouth disease by a GeXP 2

anaylizer-based multiplex RT-PCR assay 3

4

Xiumei Hu,1, 2† Yong Zhang,1† Xiaomian Zhou,2† Banglao Xu,2 Mengjie Yang,1 5

Miao Wang,1 Chen Zhang,1 Jin Li,1 Ruyin Bai,1 Wenbo Xu,1* and Xuejun Ma1* 6

State Key Laboratory for Genetic Engineering and Molecular Virology, National 7

Institute for Viral Disease Control and Prevention, Chinese Center for Disease 8

Control and Prevention, No.155, Changbai Road, Changping district, Beijing, 102206, 9

People’s Republic of China1; Clinical Laboratory of Guangzhou First Municipal 10

People's Hospital, Affiliated Hospital of Guangzhou Medical College, No. 1, Panfu 11

Road, Yuexiu district, Guangzhou, 510180, People’s Republic of China2 12

13

Running Title: Typing enteroviruses by GeXP anaylizer 14

15

* Corresponding authors. Mailing address for X. Ma: Department of Core Facility, 16

National Institute for Viral Disease Control and Prevention, Chinese Center for 17

Disease Control and Prevention, No. 155, Changbai Road, Changping district, Beijing, 18

102206, People’s Republic of China. Phone: 86-10-58900810. Fax: 86-10-58900810. 19

E-mail to X. Ma: [email protected]; 20

E-mail to W. Xu: [email protected]. 21

† Xiumei Hu, Yong Zhang and Xiaomian Zhou contributed equally to the study 22

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.05828-11 JCM Accepts, published online ahead of print on 23 November 2011

on March 13, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

2

ABSTRACT 23

Hand, foot and mouth disease (HFMD) is a contagious enteroviral disease 24

occurring primarily in young children caused by enterovirus 71 (EV71), 25

coxsackievirus A16 (CVA16) and other serotypes of coxsackievirus and echovirus. In 26

this study, a GeXP analyzer-based multiplex RT-PCR assay (GeXP assay) consisting 27

of chimeric primer-based fluorescently labeled PCR amplification and capillary 28

electrophoresis separation was developed to simultaneously identify nine serotypes of 29

enteroviruses associated with HFMD in China, including EV71, CVA16, CVA4, 5, 9, 30

10, CVB1, 3 and 5. The RNAs extracted from cell cultures of viral isolates and 31

synthetic RNAs via in vitro transcription were used to analyze the specificity and 32

sensitivity of the assay. The GeXP assay detected as few as 0.03 TCID50 of EV71 and 33

CVA16, 10 copies of pan-enterovirus, EV71, CVA16, CVB1, CVB5, and 100 copies 34

of ten (including pan-enterovirus) pre-mixed RNAs templates. A total of 180 stool 35

specimens collected from HFMD patients and suspects were adopted to evaluate the 36

clinical performance. In comparison with the results of conventional methods, the 37

sensitivities of the GeXP assay for detection of pan-enterovirus, EV71 and CVA16 38

were 98.79% (163/165), 91.67% (44/48) and 91.67% (33/36), respectively, and the 39

specificities were 80.00% (12/15), 98.48% (130/132) and 100% (144/144), 40

respectively. The accordance of typing other 7 serotypes of enteroviruses with the 41

results of conventional methods was 92.59% (25/27). In conclusion, the GeXP assay is 42

a rapid, cost-effective and high throughput method for typing nine serotypes of 43

HFMD associated enteroviruses. 44

INTRODUCTION 45

Hand, foot and mouth disease (HFMD) is a common acute enteroviral infectious 46

disease, which usually affects infants and young children below 10 years old, 47


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

3

characterized by a brief febrile illness and vesicular rash and cutaneous vesicles on the 48

hands, feet, mouth and buttocks. Some complications such as myocarditis, aseptic 49

meningitis, encephalitis, pulmonary edema, circulatory disturbance and even death 50

have appeared in minority patients (3, 8, 22). HFMD is caused by enteroviruses, 51

members of the Picornavirus family (single stranded RNA, non-enveloped) and is most 52

commonly associated with coxsackievirus A16 (CVA16) and human enterovirus 71 53

(EV71) (12). Other members including CVA2, CVA4 to CVA6, CVA9, CVA10, 54

CVB1 to CVB3, CVB5 (1, 3, 5-6, 10, 14, 23) and partial echovirus (ECHO) (2, 9, 22, 55

32) have also been associated with outbreaks or sporadic cases of HFMD. 56

The identification and serotyping of enteroviruses have been based on the 57

time-consuming and labor-intensive procedures of viral isolation in cell culture and 58

neutralization with mixed hyperimmune equine serum pools and specific monovalent 59

polyclonal antisera for confirmation (4, 13, 21). Recently, a series of molecular typing 60

methods largely were developed for rapid identification of the enteroviral serotypes, 61

including RT-PCR combined amplicon sequencing (17-18), real-time RT-PCR 62

(26-27), nested and seminested PCR (16), PCR-RFLP for typing of enteroviruses 63

causing aseptic meningitis in Korea (11)，microwell oligonucleotide arrays (24) and 64

RT-PCR-based reverse line blot (RLB) hybridization assay (31). These molecular 65

methods could sensitively identify different serotypes of enteroviruses, however, the 66

real-time RT-PCR and nested and seminested PCR were used for detecting only 67

limited serotypes. The PCR-RFLP, microwell oligonucleotide arrays and RLB 68

hybridization assay could simultaneously detect several viral serotypes, however, the 69

costly, time-consuming and labor-intensive hand procedures were needed. Therefore, 70

a rapid, cost-effective and high throughput method for typing the HFMD associated 71

enteroviruses was needed. 72


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

4

The GeXP analyzer is a multiplex gene-expression profiling analysis platform 73

developed by Beckman Coulter Company (USA), which has previously been used in 74

rapidly identifying gene expression prostate cancer biomarker signatures in biological 75

samples, rapid and sensitive detection of 68 unique varicella zoster virus gene 76

transcripts (15), and detection of pandemic influenza A H1N1 virus (19). The 77

principle of GeXP multiplex amplification assay is based on the amplification of two 78

sets of primers: the universal primers and the gene-specific chimeric primers 79

(gene-specific primers linked to the universal primer sequences at the 3’ end). During 80

the first few cycles of PCR, amplification is carried out by chimeric forward and 81

reverse primers. In later stages of PCR, amplification is predominantly carried out by 82

universal forward and reverse primers. All gene targets in the multiplex panel are 83

amplified by universal primers. The forward universal primer is fluorescently 84

dye-labeled enabling subsequent fluorescence detection of amplicons by capillary 85

electrophoresis. 86

In this study, a GeXP analyzer-based multiplex RT-PCR assay (GeXP assay) was 87

developed to simultaneously detect nine common serotypes of enteroviruses 88

associated with HFMD in China, including EV71, CVA16, CVA4, CVA5, CVA9, 89

CVA10, CVB1, CVB3 and CVB5. It is a methodology that can be implemented 90

effectively in routine testing environments by allowing users to process higher 91

numbers of sample in less time than existing assays and platforms. 92

MATERIALS AND METHODS 93

Viral isolates and RNA extraction. Twenty eight serotypes of cell cultured 94


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

5

enterovirus isolates used for evaluating the sensitivity and specificity of the GeXP 95

assay were obtained from National Laboratory for Poliomyelitis, National Institute for 96

Viral Disease Control and Prevention, Chinese Center for Disease Control and 97

Prevention. These isolates were used as control viruses and were identified previously 98

by sequencing or neutralization tests. These control viruses included EV71, CVA16, 99

CV2, CVA4, CVA5, CVA6, CVA9, CVA10, CVA12, CVA14, CVA24v, CVB1 to 100

CVB6, ECHO1 to ECHO 7, ECHO11, ECHO13, ECHO19 and ECHO30. Among 101

them, the EV71 isolate (Strain FY17.08/AN/CHN/2008, GenBank accession no. 102

EU703812) and CVA16 isolate (Strain FY18/AN/CHN/2008, GenBank accession no. 103

EU812514) were used as reference viruses in this study, both reference viruses had an 104

infectivity titer of 106.5 50% tissue culture infective doses (TCID50)/ml on human 105

rhabdomyosarcoma (RD) cells. The Viral RNAs were extracted from 140 μl of cell 106

culture of various reference virus stocks using QIAamp Viral RNA Mini kit 107

(QIAGEN) according to the manual and eluted in 50 μl of nuclease -free water. The 108

eluted RNA was aliquoted and stored at －80°C until needed (7). 109

Primers. The GeXP multiplex assay consisted of 11 pairs of chimeric primers 110

(including one pair of pan-enterovirus primers and ten pairs of human enterovirus 111

serotype-specific primers) and one pair of universal primers (Tag-F/Tag-R) (TABLE 112

1.). Each of these chimeric primers consisted of a gene-specific sequence for each 113

virus fused at the 5’ end to the universal sequence. Both the forward and reverse 114

universal sequences were quasi-T7 sequences and selected by default using the GeXP 115

eXpress Profiler software. Tag-F/Tag-R was the same as the forward or reverse 116


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

6

universal sequence. This strategy was first developed by Beckman Coulter Company 117

(USA) and was reported in our previous study (19). The pan-enterovirus primers 118

(PE-F and PE-R) were designed in highly conserved region of 5’UTR of the 119

enterovirus genomes as Yang, C. F. reported (28). Ten pairs of human enterovirus 120

serotype-specific primers for the nine serotypes of enteroviruses were designed in 121

relatively conserved VP1 regions of each serotype. Serotype-specific primers 122

sequences were evaluated using the NCBI Primer-Blast, Primer Premier 5.0 and Oligo 123

6.0 softwares. Degenerated bases were introduced to cover different strains. The 5’ 124

end of forward universal primer (Tag-F) was labeled with fluorescent dye Cy5 and 125

purified with high pressure liquid chromatography. All chimeric primers and the 126

reverse universal primer (Tag-R) were synthesized and purified by polyacrylamide gel 127

electrophoresis in Invitrogen (Shanghai, China). 128

Evaluation of the specificity of the GeXP assay. Firstly the mono RT-PCR assay 129

was developed individually with extracted RNA from 28 cell cultured serotypes of 130

enterovirus strains to evaluate the specificity of each pair of gene-specific primers 131

(including PE-F and PE-R) and ascertain the actual amplicon size of each target 132

region. Both the mono RT-PCR assay and the multiplex RT-PCR were performed 133

with QIAGEN One Step RT-PCR kit in a 25 μl volume, containing 5 μl of 5× 134

QIAGEN One Step RT-PCR Buffer, 1 μl of RT-PCR Enzyme Mix, 1 μl of 135

deoxynucleotide triphosphate (10 mM each) mix, 5 units of RNase inhibitor, and 1μl 136

of extracted viral RNA from each serotype. The mono RT-PCR assay contained 50 137

nM of each pair of gene-specific chimeric primers individually while the GeXP assay 138


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

7

contained 50 nM of 11 pairs of gene-specific chimeric primers and 500 nM of the 139

universal Tag primers as the final concentrations, Nuclease-free water was added to 140

25 μl volume. The RT-PCR was performed under the following conditions: 50°C for 141

30 min (the RT reaction), 95°C for 15 min, followed by three steps of amplification 142

procedures reaction according to the temperature switch PCR (TSP) strategy(25): step 143

1, 10 cycles of 95°C for 30 s, 55°C for30 s, and 72°C for 30 s; step 2, 10 cycles of 144

95°C for 30 s, 65°C for 30 s, and 72°C for 30 s; step 3, 20 cycles of 95°C for 30 s, 145

48°C for 30 s, and 72°C for 30 s. 146

Separation by capillary electrophoresis (CE) and fragment analysis. PCR 147

product separation and detection were performed on a GenomeLabTM GeXP Genetic 148

Analysis System (Beckman Coulter, USA) by capillary electrophoresis, following the 149

protocols described previously (20). After amplified fragments were separated, the 150

peaks were initially analyzed using the Fragment Analysis module of the GeXP 151

system software and matched to the appropriate gene. The peaks height for each gene 152

was reported in the electropherogram, respectively. 153

Evaluation of the sensitivity of the GeXP assay. Sensitivity was tested following 154

the method described previously (16) by using titrated reference viruses (EV71 and 155

CVA16) obtained from infected human RD cells. Serial 10-fold dilutions of the EV71 156

and CVA16 stock were made in Hank’s balanced salt solution, and RNA from 140 μl 157

of each dilution was extracted with the QIAamp Viral RNA mini kit (QIAGEN). The 158

RNAs preparation ranging from 105.5 TCID50 to 10-1.5 TCID50 (0.03 TCID50) per 159

microliter were tested with the GeXP assay. The assay at each template concentration 160


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

8

was repeated three times. 161

Absolute sensitivity was measured by using in vitro transcribed synthetic RNAs 162

derived from ten recombinant plasmids containing the VP1 sequences of the nine 163

serotypes of enteroviruses or the 5’UTR region, respectively. The in vitro synthesized 164

RNA products were purified with RNeasy MinElute Cleanup Kit (QIAGEN) and 165

quantitated by spectrophotometry (NanoDrop ND-1000). The concentration for each 166

serotype was diluted ranging from 105 copies to 1 copy per microliter, and then 167

individually subjected to the GeXP assay, respectively. The concentrations of specific 168

primers were optimized according to the amplification efficiency of the GeXP assay 169

using single template. The sensitivity of the optimized GeXP assay was re-evaluated 170

using ten pre-mixed RNAs templates ranging from 105 copies to 10 copies for each 171

serotype per microliter for three times on three different days. 172

Application to clinical specimens. RNAs were extracted from 180 original clinical 173

stool specimens obtained from HFMD patients and suspects to illustrate the 174

application of the optimized GeXP assay. All the clinical stool specimens were 175

detected in parallel by conventional methods including isolation of the viruses 176

followed by neutralization testing and conventional RT-PCR followed by amplicons 177

sequencing (21, 29-30). 178

RESULTS 179

Evaluation of the specificity of the GeXP assay The RNAs of 28 cell cultured 180

serotypes of enterovirus isolates were individually used as template to evaluate the 181

specificity of each pair of gene-specific primers. In mono-RT-PCR assays, the 182


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

9

pan-enterovirus universal primers could amplify the target genes of all the 28 183

serotypes of enteroviruses, but each pair of serotype-specific primers only generated 184

corresponding VP1 gene of the targeted serotype without cross-amplification. The 185

amplicon size for each serotype was as follows, pan-enterovirus: 150-153 bp, EV71: 186

264-267 bp, CVA16: 246-248 bp, CVA4: 270-272 bp, CVA5: 180-181 bp, CVA9: 187

251-254 bp, CVA10: 274-276 bp, CVB1: 224-225 bp, CVB3: 281-284 bp, CVB5: 188

193-196 bp (electropherograms not shown). The nine serotypes of enteroviruses 189

associated with HFMD were detected via the GeXP assay. Two specific amplification 190

peaks were observed presenting the pan-enterovirus target amplicon and the 191

serotype-specific target amplicon, respectively (FIG. 1.). 192

Evaluation of the sensitivity of the GeXP assay. The sensitivity of the GeXP 193

assay was measured using titrated reference viruses (EV71 and CVA16 stocks) or in 194

vitro transcribed RNAs of 9 serotypes of enteroviruses and pan-enterovirus. The 195

GeXP assay detected as few as 0.03 TCID50 of EV71 and CVA16, 10 copies of 196

pan-enterovirus, EV71, CVA16, CVB1, CVB5, more than 100 copies of CVA4, CVA5, 197

CVA9, CVA10 and CVB3 with single RNA template. 198

Based on all the sensitivity results of GeXP assay with single RNA template, the 199

concentration of each chimeric primer in the new GeXP assay was adjusted as the 200

following: PE (F/R) 20 nM, EV71 (F/R) 50 nM, CVA16 (F/R) 40 nM, CVA4 (F2, 201

F3/R2) 80 nM, CVA5 (F4/R4) 50 nM, CVA9 (F2/R2) 70 nM, CVA10 (F2/R2, R3) 202

100 nM, CVB1 (F1/R1, F2/R2) 30 nM, CVB3 (F2/R2) 100 nM, CVB5 (F1/R1) 40 203

nM. The optimized GeXP assay achieved a sensitivity of 100 copies with ten 204


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

10

pre-mixed RNAs templates in three independent experiments on three different days 205

(FIG. 2.), and the CV was less than 10.15% (not shown). 206

Application to clinical specimens. A total of 180 specimens collected from HFMD 207

patients and suspects were detected simultaneously by both the GeXP assay and the 208

conventional methods including viral isolation in cell culture, neutralization and 209

conventional RT-PCR followed by amplicons sequencing (21, 29-30). In comparison 210

with the results of conventional methods, the sensitivities of the GeXP assay for 211

detection of pan-enterovirus, EV71 and CVA16 were 98.79% (163/165), 91.67% 212

(44/48) and 91.67% (33/36), respectively, and the specificities were 80.00% (12/15), 213

98.48% (130/132) and 100% (144/144), respectively, as showed in TABLE 2. The 214

accordance between the detection results of GeXP assay and the results of 215

conventional methods for typing other 7 serotypes of enteroviruses was 92.59% 216

(25/27) as shown in TABLE 3. 217

DISCUSSION 218

In our study, ten pairs of serotype-specific primers and one pair of pan-enterovirus 219

universal primers were designed to develop a GeXP assay for simultaneous 220

identification of nine serotypes of enteroviruses including EV71, CVA16, CVA4, 221

CVA5, CVA9, CVA10, CVB1, CVB3 and CVB5. The selection of enterovirus 222

associated with HFMD was based on the research data from the National Notifiable 223

Disease Reporting System (NNDRSe) in China and the previous study (10, 23). The 224

serotype-specific primers were designed to target relatively conserved VP1 regions of 225

each enterovirus serotype and the pan-enterovirus universal primers were designed 226


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

11

from 5’UTR (28). Due to the high degree diversities of VP1 sequences, some 227

degenerated bases were introduced and more than two primers for some enterovirus 228

serotypes were designed to cover the majority of the viral sequences, such as the 229

primers for CVA4, CVA10 and CVB1. 230

The original standard workflow of GeXP was performed in two separated tubes 231

with a RT reaction and a subsequent PCR amplification as the previous reports (15, 232

19-20), which was a costly, time-consuming, tedious-process and apt to bring carry 233

over. In order to obviate these troubles, a One Step RT-PCR Kit (QIAGEN) was 234

adopted and replaced the GeXP start kit (Beckman Coulter Company). The 235

amplification procedure of the GeXP assay was improved via temperature switch 236

PCR (TSP) strategy (25) including three steps with different annealing temperatures 237

(FIG. 3.): the step 1 was carried out by gene specific sequences of chimeric forward 238

and reverse primers, step 2 was mainly carried out by chimeric forward and reverse 239

primers and step 3 predominantly by universal forward and reverse Tag primers. The 240

chimeric primers and fluorescent dye labeled universal Tag primers-based GeXP 241

assay using the TSP strategy offered high sensitive and specific amplifications of 242

different genes in one multiplex RT-PCR assay, avoided preferred and inferior 243

amplification and minimized non-specific reactions. The resolution of GeXP 244

analyzer-based capillary electrophoresis is superior to that of conventional capillary 245

electrophoresis. The forward universal primer was fluorescently labeled in the GeXP 246

assay. The resulting dye-labeled PCR products were separated and detected via the 247

Beckman Coulter GenomeLabTM GeXP Genetic Analysis System using capillary 248


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

12

electrophoresis. After amplified fragments were separated, the data was initially 249

analyzed using the Fragment Analysis module of the GeXP system software. Then 250

each amplified fragments would be present as a sole peak with accurate size on the 251

electropherogram. One can clearly differentiate two peaks between 3 or more 252

nucleotides difference in a practical way. The minimal nucleotides difference among 253

the PCR products in this study is 3bp as shown in TABLE 1. and FIG. 2. (for CVA4 254

and CVA10). 255

The improved GeXP assay was further optimized by adjusting the concentration of 256

each chimeric primer in the reaction based on individual sensitivity result of GeXP 257

assay with single RNA template to overcome the potential interference due to the 258

preferred amplification in mixed infections. In this study, the relative and absolute 259

sensitivity were analyzed to evaluate the detection limit of the GeXP assay. The 260

optimal GeXP assay detected as few as 0.03 TCID50 of EV71 and EVA16, which is 261

comparable to the detection sensitivity of the real-time RT-PCR assay published 262

recently (26), and slightly less sensitive than seminested RT-PCR (16). The absolute 263

sensitivity of the optimal GeXP assay was 100 copies for simultaneously detecting ten 264

target genes without cross or non-specific amplification. In the clinical performance 265

of 180 samples, the sensitivities of the GeXP assay for detection of pan-enterovirus, 266

EV71 and CVA16 were 98.79% (163/165), 91.67% (44/48) and 91.67% (33/36), 267

respectively, and the specificities were 80.00% (12/15), 98.48% (130/132) and 100% 268

(144/144), respectively, compared with conventional methods, revealing high 269

sensitivity and specificity in detection of pan-enterovirus, EV71 and CVA16. Twelve 270


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

13

negative specimens were detected by both the GeXP assay and the conventional 271

methods. Two specimens that were negative by the GeXP assay were enterovirus 272

positive by the conventional methods. The false negatives of GeXP assay might due 273

to the RNA degradation or occurrence of PCR inhibition with the samples. Three 274

specimens that were negative by the conventional methods were enterovirus positive 275

by the GeXP assay, which were confirmed later by independent RT-PCR and 276

sequencing to be true positives. Because of the limited positive samples for other 7 277

serotypes of enteroviruses (CVA4, CVA5, CVA9, CVA10, CVB1, CVB3 and CVB5), 278

the validation of GeXP assay with a larger number of clinical samples for these 279

viruses is necessary. 280

One distinct advantage of the GeXP assay is the time-saving and cost-effectiveness. 281

The cost of GeXP assay for simultaneous detection of 9 serotypes of enteroviruses is 282

approximately $8 per test, versus $8 per test for each virus using a commercial 283

real-time RT-PCR kit. The whole reaction was completed in one tube in a one-step 284

multiplex RT-PCR within 2.5 hours, followed by capillary electrophoresis separation. 285

In addition, two 96-well plates can be placed in parallel in a GeXP machine at the 286

same time to further increase the throughput of the samples. 287

CONCLUSION 288

This study has demonstrated that the GeXP assay is a rapid, cost-effective and high 289

throughput method with high sensitivity and specificity for typing most of HFMD 290

associated enteroviruses, which might be generalized to department of Viral Disease 291

Control and Prevention for molecular epidemiologic survey of enteroviruses. 292


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

14

CONFLICT OF INTERESTS 293

A Chinese patent (application number: 201110089404.9) has been filed for the 294

combination of all the listed primers specific to 10 HFMD associated enteroviruses 295

and experimental parameters. The authors Xuejun Ma and Wenbo Xu are inventors on 296

the patent application. The technology is available for research-only purposes. 297

ACKNOWLEDGMENTS 298

This work was supported by the China Mega-Project for Infectious Disease 299

(2009ZX10004-101, 202, 2008ZX10004-002, 001, 004). 300

301

REFERENCES 302

1. Abubakar, S., H. Y. Chee, N. Shafee, K. B. Chua, and S. K. Lam. 1999. 303

Molecular detection of enteroviruses from an outbreak of hand, foot and 304

mouth disease in Malaysia in 1997. Scand J Infect Dis 31:331-335. 305

2. Apisarnthanarak, A., R. Kitphati, Y. Pongsuwann, R. Tacharoenmueng, 306

and L. M. Mundy. 2005. Echovirus type 11: outbreak of 307

hand-foot-and-mouth disease in a Thai hospital nursery. Clin Infect Dis 308

41:1361-1362. 309

3. Barriere, H., M. Berger, and S. Billaudel. 1976. Hand, foot and mouth 310

disease. Sem Hop 52:2215-2220. 311

4. Bell, E. J., R. A. McCartney, D. Basquill, and A. K. Chaudhuri. 1986. 312

Mu-antibody capture ELISA for the rapid diagnosis of enterovirus infections 313

in patients with aseptic meningitis. J Med Virol 19:213-217. 314


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

15

5. Blomqvist, S., P. Klemola, S. Kaijalainen, A. Paananen, M. L. Simonen, T. 315

Vuorinen, and M. Roivainen. Co-circulation of coxsackieviruses A6 and A10 316

in hand, foot and mouth disease outbreak in Finland. J Clin Virol 48:49-54. 317

6. Chen, S. P., Y. C. Huang, W. C. Li, C. H. Chiu, C. G. Huang, K. C. Tsao, 318

and T. Y. Lin. 2010. Comparison of clinical features between coxsackievirus 319

A2 and enterovirus 71 during the enterovirus outbreak in Taiwan, 2008: a 320

children's hospital experience. J Microbiol Immunol Infect 43:99-104. 321

7. Chen, T. C., G. W. Chen, C. A. Hsiung, J. Y. Yang, S. R. Shih, Y. K. Lai, 322

and J. L. Juang. 2006. Combining multiplex reverse transcription-PCR and a 323

diagnostic microarray to detect and differentiate enterovirus 71 and 324

coxsackievirus A16. J Clin Microbiol 44:2212-2219. 325

8. Frydenberg, A., and M. Starr. 2003. Hand, foot and mouth disease. Aust 326

Fam Physician 32:594-595. 327

9. Han, J. F., R. Y. Cao, T. Jiang, M. Yu, W. Liu, X. Tian, E. D. Qin, W. C. 328

Cao, and C. F. Qin. Echovirus 30 in EV71-associated hand, foot and mouth 329

disease outbreak, Guangxi, China. J Clin Virol 50:348-349. 330

10. Hu, Y. F., F. Yang, J. Du, J. Dong, T. Zhang, Z. Q. Wu, Y. Xue, and Q. Jin. 331

2011. Complete genome analysis of coxsackievirus A2, A4, A5, and A10 332

strains isolated from hand, foot, and mouth disease patients in China revealing 333

frequent recombination of human enterovirus A. J Clin Microbiol 334

49:2426-2434. 335

11. Lee, Y. S., K. S. Kim, Y. S. Chung, D. S. Cheon, S. K. Jung, K. S. Park, B. 336


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

16

K. Na, Y. M. Jee, D. S. Kim, J. D. Yoon, C. Y. Song, and K. H. Lee. 2002. 337

PCR-RFLP based molecular typing of enteroviruses isolated from patients 338

with aseptic meningitis in Korea. Arch Virol 147:1711-1720. 339

12. Li, L., Y. He, H. Yang, J. Zhu, X. Xu, J. Dong, Y. Zhu, and Q. Jin. 2005. 340

Genetic characteristics of human enterovirus 71 and coxsackievirus A16 341

circulating from 1999 to 2004 in Shenzhen, People's Republic of China. J Clin 342

Microbiol 43:3835-3839. 343

13. Lin, T. L., Y. S. Li, C. W. Huang, C. C. Hsu, H. S. Wu, T. C. Tseng, and C. 344

F. Yang. 2008. Rapid and highly sensitive coxsackievirus a indirect 345

immunofluorescence assay typing kit for enterovirus serotyping. J Clin 346

Microbiol 46:785-788. 347

14. Lindenbaum, J. E., P. C. Van Dyck, and R. G. Allen. 1975. Hand, foot and 348

mouth disease associated with coxsackievirus group B. Scand J Infect Dis 349

7:161-163. 350

15. Nagel, M. A., D. Gilden, T. Shade, B. Gao, and R. J. Cohrs. 2009. Rapid 351

and sensitive detection of 68 unique varicella zoster virus gene transcripts in 352

five multiplex reverse transcription-polymerase chain reactions. J Virol 353

Methods 157:62-68. 354

16. Nix, W. A., M. S. Oberste, and M. A. Pallansch. 2006. Sensitive, seminested 355

PCR amplification of VP1 sequences for direct identification of all enterovirus 356

serotypes from original clinical specimens. J Clin Microbiol 44:2698-2704. 357

17. Oberste, M. S., K. Maher, D. R. Kilpatrick, and M. A. Pallansch. 1999. 358


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

17

Molecular evolution of the human enteroviruses: correlation of serotype with 359

VP1 sequence and application to picornavirus classification. J Virol 360

73:1941-1948. 361

18. Oberste, M. S., W. A. Nix, K. Maher, and M. A. Pallansch. 2003. Improved 362

molecular identification of enteroviruses by RT-PCR and amplicon sequencing. 363

J Clin Virol 26:375-377. 364

19. Qin, M., D. Y. Wang, F. Huang, K. Nie, M. Qu, M. Wang, Y. L. Shu, and X. 365

J. Ma. 2009. Detection of pandemic influenza A H1N1 virus by multiplex 366

reverse transcription-PCR with a GeXP analyzer. J Virol Methods 367

168:255-258. 368

20. Rai, A. J., R. M. Kamath, W. Gerald, and M. Fleisher. 2009. Analytical 369

validation of the GeXP analyzer and design of a workflow for 370

cancer-biomarker discovery using multiplexed gene-expression profiling. Anal 371

Bioanal Chem 393:1505-1511. 372

21. Rigonan, A. S., L. Mann, and T. Chonmaitree. 1998. Use of monoclonal 373

antibodies to identify serotypes of enterovirus isolates. J Clin Microbiol 374

36:1877-1881. 375

22. Russo, D. H., A. Luchs, B. C. Machado, C. Carmona Rde, and C. 376

Timenetsky Mdo. 2006. Echovirus 4 associated to hand, foot and mouth 377

disease. Rev Inst Med Trop Sao Paulo 48:197-199. 378

23. Shi, H. J., J. S. Liu, L. C. Wang, X. M. Zhang, L. D. Liu, Y. Liao, R. X. Na, 379

and Q. H. Li. 2010. Biological characters of a coxsackievirus B3 variant 380


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

18

strain isolated from a hand-foot-mouth disease patient with severe clinical 381

symptoms. Zhonghua Yi Xue Za Zhi 90:1141-1144. 382

24. Susi, P., L. Hattara, M. Waris, T. Luoma-Aho, H. Siitari, T. Hyypia, and P. 383

Saviranta. 2009. Typing of enteroviruses by use of microwell oligonucleotide 384

arrays. J Clin Microbiol 47:1863-1870. 385

25. Tabone, T., D. E. Mather, and M. J. Hayden. 2009. Temperature switch 386

PCR (TSP): Robust assay design for reliable amplification and genotyping of 387

SNPs. BMC Genomics 10:580. 388

26. Xiao, X. L., Y. Q. He, Y. G. Yu, H. Yang, G. Chen, H. F. Li, J. W. Zhang, D. 389

M. Liu, X. F. Li, X. Q. Yang, and H. Wu. 2009. Simultaneous detection of 390

human enterovirus 71 and coxsackievirus A16 in clinical specimens by 391

multiplex real-time PCR with an internal amplification control. Arch Virol 392

154:121-125. 393

27. Xiao, X. L., H. Wu, Y. J. Li, H. F. Li, Y. Q. He, G. Chen, J. W. Zhang, H. 394

Yang, X. F. Li, X. Q. Yang, and Y. G. Yu. 2009. Simultaneous detection of 395

enterovirus 70 and coxsackievirus A24 variant by multiplex real-time RT-PCR 396

using an internal control. J Virol Methods 159:23-28. 397

28. Yang, C. F., L. De, S. J. Yang, J. Ruiz Gomez, J. R. Cruz, B. P. Holloway, 398

M. A. Pallansch, and O. M. Kew. 1992. Genotype-specific in vitro 399

amplification of sequences of the wild type 3 polioviruses from Mexico and 400

Guatemala. Virus Res 24:277-296. 401

29. Zhang, Y., X. J. Tan, H. Y. Wang, D. M. Yan, S. L. Zhu, D. Y. Wang, F. Ji, 402


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

19

X. J. Wang, Y. J. Gao, L. Chen, H. Q. An, D. X. Li, S. W. Wang, A. Q. Xu, 403

Z. J. Wang, and W. B. Xu. 2009. An outbreak of hand, foot, and mouth 404

disease associated with subgenotype C4 of human enterovirus 71 in Shandong, 405

China. J Clin Virol 44:262-267. 406

30. Zhang, Y., D. Wang, D. Yan, S. Zhu, J. Liu, H. Wang, S. Zhao, D. Yu, L. 407

Nan, J. An, L. Chen, H. An, A. Xu, and W. Xu. Molecular evidence of 408

persistent epidemic and evolution of subgenotype B1 coxsackievirus 409

A16-associated hand, foot, and mouth disease in China. J Clin Microbiol 410

48:619-622. 411

31. Zhou, F., F. Kong, K. McPhie, M. Ratnamohan, L. Donovan, F. Zeng, G. L. 412

Gilbert, and D. E. Dwyer. 2009. Identification of 20 common human 413

enterovirus serotypes by use of a reverse transcription-PCR-based reverse line 414

blot hybridization assay. J Clin Microbiol 47:2737-2743. 415

32. Zhu, Z., W. B. Xu, A. Q. Xu, H. Y. Wang, Y. Zhang, L. Z. Song, H. L. Yang, 416

Y. Li, and F. Ji. 2007. Molecular epidemiological analysis of echovirus 19 417

isolated from an outbreak associated with hand, foot, and mouth disease 418

(HFMD) in Shandong Province of China. Biomed Environ Sci 20:321-328. 419

420

421

422


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

20

423

FIG. 1. The specificity results of multiplex RT-PCR assay. Cy5-labled PCR 424

products were separated via GeXP capillary electrophoresis and detected by 425

fluorescence spectrophotometry given as dye signal in arbitrary unites on the Y-axis, 426

each peak was identified by comparing expected to actual PCR product size on the 427

X-axis. Figure A~I showed amplified results of EV71, CVA16, CVA4, CVA5, CVA9, 428

CVA10, CVB1, CVB3 and CVB5, respectively, using enterovirus RNAs extracted 429

from various cell cultured strains. Nuclease-free water was used as negative control 430

(J). 431

432

433

434

FIG. 2. The sensitivity analysis of GeXP detection of 10 pre-mixed RNA templates 435

with multiplex primers. All 10 target genes could be detected at 103 copies/μL (A) and 436

102 copies/μL levels (B), only CVA16 and CVA9 could be detected at 10 copies/μL 437

levels (C), Nuclease-free water was used as negative control (D). 438

439

440

441

FIG. 3. The workflow of GeXP amplification using Temperature Switch PCR 442

strategy 443

444

445

446


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

TABLE 1. Oligonucleotide primers for the GeXP assay 1

primer name sequence(5'->3')a GenBank

accession no. position size

PE-F AGGTGACACTATAGAATATCCGGCCCCTGAATGCGGCTAATCC

FJ713137.1

450-474

151 bp PE-R GTACGACTCACTATAGGGAACACGGACACCCAAAGTAGTCGGTCC 563-538

EV71-F AGGTGACACTATAGAATAGCAGCCCAAAAGAACTTCAC

FJ713137.1

2368-2387

263 bp EV71-R GTACGACTCACTATAGGGAATTTCAGCAGCTTGGAGTGC 2594-2575

CVA16-F AGGTGACACTATAGAATAATTGGTGCTCCCACTACAGC

GQ279371.1

2519-2539

245 bp CVA16-R GTACGACTCACTATAGGGATCAGTGTTGGCAGCTGTAGG 2349-2330

CVA4-F2 AGGTGACACTATAGAATACCTAARCCTGATGCYCGAGA

EU908135.1

1-20

271 bp

CVA4-F3 AGGTGACACTATAGAATACCTAAGCCTGATGCCCGAGA 1-20

CVA4-R2 GTACGACTCACTATAGGGACAACTCTAGCTGRGAATGTYCCT 210-233

CVA5-F4 AGGTGACACTATAGAATAATGAGCCCAGCYAGYACYTA

AY421763.1

3013-3032

181 bp CVA5-R4 GTACGACTCACTATAGGGAGATACHCCTGASACCATGCG 3036-3157

CVA9-F2 AGGTGACACTATAGAATATTTGATCAGAAGGGCTCATACGGGT

GQ294574.1

604-628

251 bp CVA9-R2 GTACGACTCACTATAGGGATCTGTGATGGGTGTTGGTGTAAA 796-818

CVA10-F2 AGGTGACACTATAGAATACGBTGTGTGGTTAAYAGRAATGG GU947783.1 198-221 274 bp


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

1

a The degenerate sites in each primer are represebped by characters in boldface type, degenerate primer abbreviations are as follows: M=A/C, 2

R=A/G, W=A/T, S=G/C, Y=C/T, K=G/T, V=A/G/C, H=A/C/T, D=A/G/T, B=G/C/T. 3

Universal Tag sequences are underlined. 4

5

CVA10-R2 GTACGACTCACTATAGGGAGCCTCTCCATTYTTAGTCGTTGT 412-434

CVA10-R3 GTACGACTCACTATAGGGAGCTTCYCCAYCTTCAGTHGTTGT 412-434

CVB1-F1 AGGTGACACTATAGAATAGAAAATTTCCTGTGCCGGT

GU949568.1

193-221

223 bp CVB1-R1 GTACGACTCACTATAGGGAGGGTTGTTGTGCACTCGTTA 359-378

CVB1-F2 AGGTGACACTATAGAATAGAGAATTTCCTGTGCCGGTC

AY373099.1

83-102

223 bp CVB1-R2 GTACGACTCACTATAGGGATAGGTTGTTGGGCGCTTGTTA 249-269

CVB3-F2 AGGTGACACTATAGAATAATGTCCATACCTTTCCTGAGTATTGG

GQ141875.1

2985-3010

282 bp CVB3-R2 GTACGACTCACTATAGGGATTTGCCTTCTCATACTGGCA 3210-3229

CVB5-F1 AGGTGACACTATAGAATAGCTCACGCATCAAATCATGT

GQ246507.1

414-433

193 bp CVB5-R1 GTACGACTCACTATAGGGAGCATTGCCTATGCTGATGAA 550-569 Cy5-labeled Tag-F AGGTGACACTATAGAATA

Tag -R GTACGACTCACTATAGGGA


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

TABLE 2. Comparison of GeXP assay and the conventional methods for detecting 1

pan-enterovirus, EV71 and CVA16 2

3

a All of 180 stool specimens were identified previously by cell culture and classical 4

PCR followed by sequencing. Neutralization test was performed for those positive 5

samples for EV71 (n=48) and CVA16 (n=36). 6

b Twelve negative specimens were detected by both the GeXP assay and the 7

conventional methods. Two specimens that were negative by the GeXP assay were 8

enterovirus positive by the conventional methods. The false negatives of GeXP assay 9

might due to the RNA degradation or occurrence of PCR inhibition with the samples. 10

Three specimens that were negative by the conventional methods were enterovirus 11

positive by the GeXP assay, which were confirmed later by independent RT-PCR and 12

sequencing to be true positives. 13

c Measure of Agreement: Kappa for pan-enterovirus (P=0.000), EV71 (P=0.000) and 14

CVA16 (P=0.000) were 0.813, 0.914 and 0.946, respectively (using SPSS13.0) 15

16

Results of the GeXP assay

Results of the conventional

methods Total

（＋）（－）

（＋）

pan-enterovirus 163 3 166

EV71 44 2 46

CVA16 33 0 33

（－）


EV71 4 130 134

CVA16 3 144 147

Total


EV71 48 132 180

CVA16 36 144 180


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

TABLE 3. Comparison of the GeXP assay and the conventional methods for detecting 1

other 7 serotypes of enteroviruses 2

3

Serotype Results of the GeXP assay Results of the conventional methods

CVA4 7 7

CVA5 3 3

CVA9 2 3

CVA10 3 3

CVB1 2 2

CVB3 4 4

CVB5 4 5


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

simultaneously typing nine serotypes of enteroviruses associated

Documents