Gene 523 (2013) 76–81

Contents lists available at SciVerse ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Single nucleotide polymorphism in CPT1B and CPT2 genes and itsassociation with blood carnitine levels in acute myocardialinfarction patients

Haseeb Ahmad Khan ⁎, Abdullah Saleh AlhomidaDepartment of Biochemistry, College of Science, King Saud University, Riyadh, Saudi Arabia

Abbreviations: AMI, acute myocardial infarction; BMnary artery disease; CoA, coenzyme A; CPT1B, carnitinecarnitine palmitoyltransferase II; dbSNP, database of sinDNA, deoxyribonucleic acid; dNTP, deoxyribonucleotidmunosorbent assay; LC-MS/MS, liquid chromatographNSTEMI, non-ST-elevated myocardial infarction; PCRSNP, single nucleotide polymorphism; STEMI, ST-elevat⁎ Corresponding author at: Department of Biochemis

King Saud University, P.O. Box 2455, Riyadh 11451, SauE-mail addresses: khan_haseeb@yahoo.com, haseeb@

0378-1119/$ – see front matter © 2013 Elsevier B.V. Alhttp://dx.doi.org/10.1016/j.gene.2013.03.086

a b s t r a c t

a r t i c l e i n f o

Article history:Accepted 16 March 2013Available online 6 April 2013

Keywords:Acute myocardial infarctionCarnitineCarnitine palmitoyltransferaseCPT1BCPT2Single nucleotide polymorphism

Ischemic and reperfusion injuries in acute myocardial infarction (AMI) lead to mitochondrial dysfunction inheart cells. Lipid metabolism takes place in mitochondria where carnitine palmitoyltransferase (CPT) enzymesystem facilitates the transport of long-chain fatty acids into matrix to provide substrates for beta-oxidation.We sequenced the coding regions of CPT1B and CPT2 genes to identify the single nucleotide polymorphism(SNP) in 23 AMI patients and 23 normal subjects. We also determined blood carnitine levels in these samplesto study the impact of these SNPs on carnitine homeostasis. The sequencing of coding regions revealed 4novel variants in CPT1B gene (G320D, S427C, E531K, and A627E) and 2 variants in CPT2 gene (V368I andM647V). There were significant increases in total carnitine (54.18 ± 3.11 versus 21.49 ± 1.03 μmol/l) andfree carnitine (37.78 ± 1.87 versus 10.06 ± 0.80 μmol/l) levels in AMI patients as compared to normal sub-jects. CPT1B heterozygous variants of G320D and S427C among control subjects showed significantly higherlevels of total and free carnitine in the blood. The homozygous genotype (AA) of CPT2 variant V368I had sig-nificantly less blood carnitine in AMI patients. Serum troponin T was significantly less in GG genotype ofCPT1B variant S427C whereas the genotype AA of CPT2 variant V368I showed significantly higher serum tro-ponin T levels. Further studies on large number of patients are necessary to confirm the role of CPT1B andCPT2 polymorphism in AMI.

© 2013 Elsevier B.V. All rights reserved.

1. Introduction

Acutemyocardial infarction (AMI) is a key component of the burdenof cardiovascular disease due to its associated complications and mor-tality (Roger, 2007). AMI is the consequence of the chronic develop-ment of atherosclerosis lesions. Ischemic and reperfusion injuries inAMI lead to mitochondrial dysfunction in heart cells (Misra et al.,2009). Carnitine (3-hydroxy-4-N-trimethylammonium butyrate) is anessential cofactor in fatty acid metabolism. Carnitine transfers and reg-ulates long-chain fatty acid transport across the inner mitochondrialmembrane for beta-oxidation. Carnitine has been shown to protectagainst ischemic insult (Zhang et al., 2012). Studies on the role of carni-tine administration to patients with AMI, angina, and congestive heart

I, body mass index; CAD, coro-palmitoyltransferase IB; CPT2,gle nucleotide polymorphism;es; ELISA, enzyme-linked im-y-tandem mass spectrometry;, polymerase chain reaction;ed myocardial infarction.try, College of Science, Bldg. 5,di Arabia.ksu.edu.sa (H.A. Khan).

l rights reserved.

failure generally have been positive (Davini et al., 1992; Pauly andPepine, 2003; Rizzon et al., 1989). L-carnitine therapy led to a reductionin early mortality without affecting the risk of death and heart failure atsix months in patients with anterior AMI (Tarantini et al., 2006). L-car-nitine adjunct therapy appears to be associated with a reduced levelof cardiac markers in patients with NSTEMI (Xue et al., 2007). L-carni-tine has been found to induce an immediate recovery of myocardialcontractility in experimental animals, affected by very brief and repeat-ed coronary occlusions (Hernandiz Martínez et al., 1997).

Carnitine acyltransferase I (synonym; carnitine palmitoyltransferaseI, CPT1) in the outer surface of innermitochondrial membrane transfersacyl group from acyl CoA to carnitine forming acylcarnitine. There are 3isoforms of CPT1 including liver isoform (CPT1A), muscle isoform(CPT1B) and brain isoform (CPT1C). CPT1B is highly expressed inheart and skeletal muscle cells. Another enzyme, CPT2, located in theinner surface of the inner mitochondrial membrane, removes the acylgroup from acylcarnitine and transfers it to CoA to form acyl CoA inthe mitochondrial matrix. Administration of L-carnitine in rats signifi-cantly increases the activities of cardiac CPT1 and CPT2by approximate-ly 50% above those of the control animals (Yoon et al., 2003). Recently,an association has been reported between CPT1B coding polymor-phisms and metabolic syndrome, with a deleterious effect of theCPT1B I66V and a protective impact of the CPT1B K531E SNP, though

77H.A. Khan, A.S. Alhomida / Gene 523 (2013) 76–81

haplotype analysis indicates a relevance of the E531K polymorphismonly (Auinger et al., 2012). In the present investigation, we sequencedthe coding regions of CPT1B and CPT2 genes to identify single nucleo-tide polymorphism (SNP) in AMI patients and normal subjects. Wealso determined blood carnitine levels in these samples to study the im-pact of these SNPs on carnitine homeostasis.

2. Materials and methods

2.1. Patients and controls

This studywas conductedon23AMIpatients (18males and5 females,aged 61.34 ± 13.69 y) admitted to King Khalid University Hospital andPrince Sultan Cardiac Center, Riyadh, Saudi Arabia. We also included 23age-matched normal subjects (19 males and 4 females) to serve as con-trol group. All the subjects used in this study were Saudis. The AMI pa-tients were classified as STEMI (N = 12) or NSTEMI (N = 11). Thediagnosis of MI required the presence at least two of the followingcriteria: (i) history of characteristic prolonged (≥30 min) pain or discom-fort, (ii) abnormal troponin T levels, and (iii) presence of newQwaves ornew abnormal ST–T features. Patients with STEMI were classified on thebasis of (i) continuous chest painuponpresentation, refractory to nitrates,and lasting≥30 min, (ii) presence of ST-segment elevationof≥0.2 mV in≥2 contiguous precordial leads, or≥0.1 mV in≥2 contiguous limb leads,or new left bundle branch block on admission electrocardiogram, and (iii)abnormal troponin-T levels. Patients with NSTEMI were classified on thebasis of (i) angina-like chest pain at rest during the last 24 h lasting≥5 min, (ii) absence of ST-segment elevation, and (iii) abnormaltroponin-T levels. The exclusion criteria included recent surgery, active in-fection, chronic inflammatory diseases, significant hepatic or renal dys-function and malignancy. The patients' characteristics are summarizedin Table 1. Most of the patients were non-smokers; only 3 patients weresmoker and ex-smokers. The protocol of this study was approved byour Institution Ethics Review Board for human studies and the patientssigned an informed consent.

2.2. Gene sequencing for SNP analysis

DNA was extracted from the blood samples using DNeasy Bloodand Tissue Kit (Qiagen GmbH, Germany) according to manufacturer'sinstructions. The isolated DNA was dissolved in 200 μl of elution buff-er and stored at −20 °C.

Table 1Patient's characteristics.

Patient no. Gender Age (y) BMI (kg/m2) D

1 Female 40 35.09 N2 Male 58 24.71 S3 Female 65 36.32 S4 Male 60 30.44 N5 Male 66 26.10 S6 Male 79 39.00 S7 Female 51 30.62 S8 Male 52 30.96 S9 Male 72 28.36 N10 Female 83 31.64 N11 Male 55 40.07 N12 Male 63 27.57 N13 Male 58 22.49 S14 Male 85 21.27 N15 Male 35 26.59 S16 Male 56 27.20 N17 Male 72 21.91 N18 Female 86 21.36 S19 Male 67 25.89 N20 Male 52 28.02 S21 Male 48 23.87 S22 Male 60 22.49 S23 Male 48 35.64 N

We obtained the sequences of Homo sapiens CPT1B (accession,NG_012643) and CPT2 (accession, NG_008035) genes from theGenBank and primers were designed for the coding regions of thesegenes using Primer Primier version 5.0 software. Targeted regions ofboth the genes were amplified using specific primers (Table 2).

The total PCR reaction volume (30 μl) contained 10× rTaq buffer(3 μl), dNTP (2 μl), each primer (1 μl), rTaq (0.2 μl), DNA (2 μl) anddouble distilled water (20.8 μl). The conditions of PCR amplificationwere as follows: denaturation of DNA at 95 °C for 5 min followedby 30 cycles of 30 s at 95 °C, 30 s at 55 °C, and 50 s at 72 °C. At theend of PCR, a final extension step for 5 min at 72 °C followed bymaintaining the temperature at 4 °C was used. Before sequencing,all the PCR products were subjected to purification using PCR CleanupFilter Plates (Millipore). We used a BigDye Terminator Cycle Sequenc-ing Kit (Applied Biosystems, USA) for sequencing of PCR products ona 3130XL genetic analyzer (Applied Biosystems).

2.3. Biochemical analysis

Serum troponin-T was analyzed using a commercially availablesandwich ELISA kit (Roche Diagnostics, Germany). For carnitine anal-ysis, a single drop of venous blood sample was placed on filter papercards (No. 903; Schleicher and Schuell, Dassel, Germany), dried over-night at room temperature and then stored in brown color paper en-velopes. The levels of total and free carnitine in blood spots weredetermined using a NeoBase non-derivatized MS/MS kit (PerkinElmer, USA). The internal standards of carnitine were reconstitutedwith 1 ml of NeoBase extraction solution followed by their dilutionto 1:110 to get the daily working solution of internal standards.Punch outs (3.2 mm diameter, equivalent to 3.1 μl of blood) of con-trol and patient samples were individually placed in assigned wellsof a clear microplate and 100 μl of working solution of internal stan-dard were added to each well. The plate was sealed with an adhesivecover to minimize evaporation and then shaken (750 rpm) at 45 °Cfor 45 min. The cover was removed and the aliquots (75 μl) of wellcontents were transferred to a V-bottomed microplate beforeinjecting to API 3200 LC-MS/MS (Applied Biosystems, USA).

2.4. Statistics

Statistical comparisons were performed using Fisher Exact Test forSNP data and Student's t-test for biochemical data. Pearson test was

iagnosis Associated disease(s) Family history

STEMI Diabetes, hypertension HypertensionTEMI Diabetes, hypertension –

TEMI Diabetes, Hypertension, dyslipidemia –

STEMI Diabetes, dyslipidemia –

TEMI Diabetes, hypertension –

TEMI Hypertension –

TEMI Diabetes, hypertension, dyslipidemia –

TEMI Diabetes, hypertension, dyslipidemia –

STEMI Diabetes, hypertension –

STEMI Diabetes, hypertension –

STEMI Diabetes, hypertension –

STEMI Diabetes, hypertension –

TEMI Diabetes, hypertension –

STEMI Diabetes, hypertension –

TEMI Dyslipidemia HypertensionSTEMI Diabetes, hypertension Diabetes, CADSTEMI Diabetes, hypertension –

TEMI Diabetes, hypertension –

STEMI Diabetes, hypertension, dyslipidemia –

TEMI Diabetes, hypertension, dyslipidemia –

TEMI Hypertension, dyslipidemia –

TEMI Diabetes, hypertension Diabetes, CADSTEMI Hypertension Diabetes, CAD

Table 2PCR amplification primers for the coding regions of CPT1B and CTP2 genes.

Primername

Bases sequence(5′ to 3′)

Basenumbers

Region Tm

CPT1B-2F TCAGGAGAGAAAGCCTTCCA 20 6205–6811 55CPT1B-2R CTGAGACCCTCAGAGCCATC 20CPT1B-3F CTGGTGTGTGGTTTGTCCTG 20 7031–7633 55CPT1B-3R CCTCAGGCCTCACTCCATAA 20CPT1B-4F CTGGAGCAGAGGGTTACTGC 20 9068–9333 55CPT1B-4R CCAGCATCATGCCTGTAAAC 20CPT1B-5F ATTGTTGGTGTTGCGTGAGA 20 9953–10793 55CPT1B-5R GCACCCAGCTCATAACCCTA 20CPT1B-7F CCAGAGTCCTGCTTGGAGAG 20 12129–12777 55CPT1B-7R CTCAGTCCCAGGACCACAG 19CPT1B-8F GGCAGCTCACACAAGCCTTA 20 13262–14092 55CPT1B-8R CTGTTCCCACAAGCAAGGAT 20CPT1B-9F ATCCTTGCTTGTGGGAACAG 20 14247–14807 60CPT1B-9R TCCATGCTGACAAGAAGCTG 20CPT2-2F TTGGCATTAGTAAACCCATTGA 22 Exon 2: 9291 ...

937155

CPT2-2R CCTGTTGAGCCTGTTTAGAGGA 22CPT2-3F TTGATTCCTGTTCTGGTTAGAGG 23 Exon 3: 10895 ...

1100155

CPT2-3R GGAAGGGAGGATGAGACGTT 20CPT2-4F CTCTGGAGGTTGATGCCATT 20 Exon 4: 18587 ...

1989155

CPT2-4R GGAGTTGGCGATGGATTAAA 20CPT2-5F AGCTTGAGCTGCTCTGAAGG 20 Exon 5: 21836 ...

2276955

CPT2-5R CCATCACTCAATGAGCCAGA 20

Table 3Blood carnitine levels in CPT1B and CPT2 genetic variants among controls and AMIpatients.

SNP (dbSNPaccession)

Group Genotype (N) Blood carnitine (μmol/l)

Total Free

CPT1B: G320D(ss715578389)

Control GG (21) 20.66 ± 0.87 15.43 ± 0.66AG (2) 30.21 ± 5.29⁎⁎ 22.73 ± 4.48⁎⁎

AMI GG (22) 53.81 ± 3.23 37.44 ± 1.93AG (1) 62.38 45.38

CPT1B: S427C(ss715578390)

Control CC (20) 20.58 ± 0.91 15.38 ± 0.68CG (2) 28.90 ± 6.60⁎ 22.39 ± 5.17⁎

GG (1) 24.91 17.88AMI CC (17) 56.37 ± 3.77 38.76 ± 2.21

CG (4) 43.84 ± 6.43 32.27 ± 5.01GG (2) 56.28 ± 3.08 40.55 ± 1.65

CPT1B: E531K(ss715578392)

Control GG (22) 21.36 ± 1.07 16.02 ± 0.84AG (1) 24.39 17.00

AMI GG (21) 54.61 ± 3.40 37.81 ± 2.04AG (1) 47.51 34.17AA (1) 51.89 40.91

CPT1B: A627E(ss715578393)

Control CC (22) 21.45 ± 1.08 16.01 ± 0.84AC (1) 22.29 17.22

AMI CC (21) 54.42 ± 3.33 37.74 ± 2.00AC (2) 51.65 ± 10.7 38.24 ± 7.13

CPT2: V368I(ss715578396)

Control GG (10) 20.04 ± 1.43 14.95 ± 0.96AG (10) 23.45 ± 1.83 17.54 ± 1.48AA (3) 19.83 ± 1.16 14.84 ± 0.94

AMI GG (10) 57.75 ± 2.93 40.58 ± 1.57AG (10) 53.58 ± 6.24 37.35 ± 3.61AA (3) 44.24 ± 5.84 29.92 ± 4.48⁎

CPT2: M647V(ss715578398)

Control AA (15) 21.43 ± 1.40 16.02 ± 1.11AG (7) 22.19 ± 1.59 16.58 ± 1.14GG (1) 17.49 12.99

AMI AA (14) 57.99 ± 4.40 39.66 ± 2.56AG (8) 48.53 ± 3.91 34.99 ± 2.85GG (1) 46.00 33.83

⁎ P b 0.05.⁎⁎ P b 0.01 versus the base genotype (t-test).

Fig. 1. Blood carnitine levels in control and AMI patients. *P b 0.001 versus controlgroup (t-test).

78 H.A. Khan, A.S. Alhomida / Gene 523 (2013) 76–81

used for correlation studies. P values b0.05 were considered as statis-tically significant.

3. Results

There was a high prevalence of diabetes (82.6%) in AMI patients(Table 1). Eighteen of 23 AMI patients had both diabetes and hyper-tension; 5 of these patients also had dyslipidemia (Table 1). Two ofthe patients had a family history of hypertension while 3 patientshad a family history of diabetes and coronary artery disease (CAD)(Table 1). The body mass index (BMI, average ± SD) of male and fe-male patients were 27.92 ± 5.53 kg/m2 and 31.01 ± 5.88 kg/m2,respectively.

The sequencing of coding regions revealed 4 novel variants (mis-sense mutations) in CPT1B gene (G320D, S427C, E531K, and A627E)and 2 variants (missense) in CPT2 gene (V368I and M647V). Howev-er, there was no significant difference in the frequency of these vari-ants between AMI patients and controls (Table 3). All these SNPs havebeen submitted to the SNP database (dbSNP) and the submitter SNP(ss) accession numbers are given in Table 3.

There were significant increases in total carnitine (54.18 ± 3.11versus 21.49 ± 1.03 μmol/l) and free carnitine (37.78 ± 1.87 versus10.06 ± 0.80 μmol/l) levels in AMI patients as compared to normalsubjects (Fig. 1). CPT1B heterozygous variants of G320D and S427Camong control subjects showed significantly higher levels of totaland free carnitine in the blood (Table 3). The homozygous genotype(AA) of CPT2 variant V368I had significantly less blood carnitine inAMI patients (Table 3).

The levels of serum troponin-T in STEMI and NSTEMI patients were1.42 ± 0.63 ng/ml and 0.96 ± 0.44 ng/ml, respectively; all the controlshad troponin-T levels below 0.01 ng/ml. There were significant inversecorrelations between troponin T and total carnitine (R = −0.499, P =0.015) and free carnitine (R = −0.564, P = 0.005) (Fig. 2).

The trends of serum troponin T in different genotypes of CPT1B andCTP2 variants are shown in Fig. 3. Serum troponin T was significantlyless inGGgenotype of CPT1B variant S427C. The genotypeAAof CPT2var-iant V368I showed significantly higher serum troponin T levels (Fig. 3).

4. Discussion

We have identified four novel variants (G320D, S427C, E531K, andA627E) in CPT1B gene that may have some implication in lipid

metabolism and carnitine homeostasis. Bennett et al. (2004) havereported four novel mutations in five patients from four familieswith severe CPT1 enzyme deficiency and symptoms of hypoketotichypoglycemia; three of these are missense mutations (G465W,R316G, and F343V) and the fourth a nonsense mutation (R160X).We observed two variants (V368I and M647V) of CPT2 gene. These

R =-0.499

P = 0.015

R= -0.564

P = 0.005

Fig. 2. Correlation between serum troponin T and total carnitine (left panel) and free carnitine (right panel) levels in blood of AMI patients.

79H.A. Khan, A.S. Alhomida / Gene 523 (2013) 76–81

common polymorphisms of CPT2, V3681 and M647V, have beenreported to be strikingly overrepresented in the myopathic patients;they may significantly influence the manifestation of clinical diseaseand could therefore potentially be considered as susceptibilityvariants (Olpin et al., 2003). Vladutiu et al. (2000) have presentedbiochemical and molecular evidence for vertical transmission of avariable myopathy caused by heterozygosity for a single mutation,R503C, in the CPT2 gene. Deschauer et al. (2003) have revealed thecommon S113L mutation on one allele while a novel mutation atthe splice donor junction in intron 3 on the other allele (resulting inskipping of exon 3) in a 25-year-old patient with biochemicalevidence of CPT2 deficiency and suffered from attacks of myalgiaand muscle weakness in early adult life. Taggart et al. (1999) haveproposed that heterozygosity for certain CPT2 mutations, S113Land R503C is sufficient to render individuals at risk of clinicalsymptoms.

We did not find any statistical difference in the frequencies of vari-ous genotypes of the variants of CPT1B and CPT2 genes, between AMIpatients and controls (Table 3). This could be due to the smaller numberof samples available for this study. However, some of the genotypes ofCPT1B and CTP2 genes showed significant alterations in blood carnitinelevels indicating the possible association between genetic polymor-phism of these genes and carnitine homeostasis. Heterozygous presen-tation (mutation in one allele) of SNPs G320D and S427C of CPT1B genecaused significant increase in total and free carnitine levels in the bloodof control subjects (Table 3). This may be attributed to reduced synthe-sis of CPT1B in subjectswith onedefective allele resulting in elevation ofblood carnitine levels due to limited conversion of carnitine toacylcarnitines. CPT1deficiency is known to cause elevation in blood car-nitine levels (Longo et al., 2006). However, CPT2 variants, V368I andM647V, did not show any significant difference in blood carnitine levelsamong control individual with different genotypes (Table 3). Joshi et al.(2012) have reported two symptomatic patients with CPT2 deficiencyhaving heterozygous S113L mutation indicating that despite the auto-somal recessive mode of CPT2 deficiency disorder, the heterozygotesmight also have typical attacks of myalgia, pareses or rhabdomyolysis(Joshi et al., 2012). Deschauer et al. (2005) have suggested that analysisof not only the common S113L mutation but also the P50H andQ413fs-F448L mutations should be tested as the phenotype of muscleCPT2 deficiency might be influenced by these underlying mutation,and patients with a truncatingmutation on one allele might be affectedmore severely. Fanin et al. (2012) have confirmed the existence ofsymptomatic heterozygous patients by identifying three genotypes(homozygous R631C, homozygous S113L, and heterozygous nullmutations) associated with a relatively severe condition. It has beenspeculated that additional enzyme defects, such as myoadenylate de-aminase deficiency, might be the cause of heterozygous patients

becoming symptomatic (Olpin et al., 2003). Another possible explana-tion of symptomatic heterozygous patients is suggested by the influ-ence of intragenic polymorphisms (Vladutiu et al., 2000).

We observed a significant increase in blood carnitine levels in AMIpatients as compared to normal subjects (Fig. 1). There was a signifi-cant inverse correlation between serum troponin T and blood carni-tine levels (Fig. 2). This could be related to variation in release ofthese markers from the damaged tissue, differences in their half-life,and the mode of their renal clearance. Serum troponin T was also af-fected by the genotypic variations in CPT1B and CTP2 genes (Fig. 3).Rizzon et al. (1989) have found significant increase in free carnitinein the sera of AMI patients as compared to healthy controlssuggesting that ischemia associated with AMI induces a loss of freecarnitine from myocardium. Other investigators have also reportedelevated plasma free carnitine concentration in patients with conges-tive heart failure and some kinds of cardiomyopathies (Regitz et al.,1990; Tripp and Shug, 1984). On the other hand, myocardial and sys-temic deficiencies of carnitine have been implicated in the malfunc-tion of heart (Ino et al., 1988; Paulson et al., 1984; Regitz et al.,1990; Whitmer, 1987). Fatty acid oxidation is the major energy pro-viding pathway of the myocardium and its inhibition has beenshown to impair myocardial function (Bressler et al., 1989). Physio-logically, carnitine is synthesized in liver and accumulated in themyocytes to concentration 20–50 folds greater than the plasma levels(Siliprandi et al., 1987). A specific carnitine carrier together with rel-ative impermeability of the myocyte membrane for carnitine main-tains high myocardial carnitine levels. Any defect in this carriersystem or ischemia-induced membrane damage may lead to the leak-age of carnitine from the myocyte to blood stream. Bartels et al.(1994) have shown that during each single attack of angina there isa release of carnitine from the heart into the coronary sinus. The myo-cardium is unable to synthesize carnitine so it has to extract this com-pound directly from the blood (Sartorelli et al., 1982) via high affinitycarnitine receptors on heart cells (Bohmer et al., 1977). However, im-paired carnitine uptake in CAD patients does not allow balancing ofthe loss of carnitine during acute ischemia (Bieber, 1988). The dra-matic increase of free carnitine in blood, as observed in our study,may also be related to its increased synthesis in liver and/or excessiverelease from skeletal muscle due to stress (Rizzon et al., 1989). Otherpossible causes of elevation of blood carnitine levels, such as impairedrenal function, are ruled out in our patients (based on renal functionbiochemistry, data not shown).

In conclusion, we reported 4 novel variants in CPT1B gene(G320D, S427C, E531K, and A627E) and 2 variants in CPT2 gene(V368I and M647V) however there was no significant difference inthe frequency of these variants between AMI patients and controls,possible due to the small sample size of this study. Blood carnitine

Fig. 3. Serum troponin T levels in different genotypes of CPT1B and CPT2 variants among AMI patients. *P b 0.05 versus base genotype (t-test).

80 H.A. Khan, A.S. Alhomida / Gene 523 (2013) 76–81

levels were significantly higher in AMI patients as compared to con-trols while some variants of CPT1B and CTP2 genes showed alteredcarnitine levels. Genotypic variation also affected serum troponin Tlevels in AMI patients. We also reported new primers for amplifica-tion and sequencing of coding regions of CPT1B and CPT2 genes.Further studies on large number of patients are necessary to confirmthe role of CPT1B and CPT2 polymorphism in AMI.

Conflict of Interest

The authors report no conflict of interest.

Acknowledgments

This study was supported by National Plan for Science and Technol-ogy (NPST) Program by King Saud University project number08-BIO571-02. We thank Dr. Samia Sobki and Dr. Halima Al Madanifor their help in biochemical analysis and Dr. Syed Shahid Habib andDr. Abdulrahman Al Moughairi for clinical observations. We are thank-ful to BGI Sequencing Ltd, Beijing, China for their cooperation in genesequencing. The technical assistances of Adnan Ali Khan for data man-agement, and nursing staff of Prince Sultan Cardiac Center, Riyadh forsample collection and patient care are gratefully acknowledged.

81H.A. Khan, A.S. Alhomida / Gene 523 (2013) 76–81

References

Auinger, A., et al., 2012. A common haplotype of carnitine palmitoyltransferase 1b is as-sociated with the metabolic syndrome. Br. J. Nutr. 1–6.

Bartels, G.L., Remme, W.J., Pillay, M., Schönfeld, D.H., Kruijssen, D.A., 1994. Effects of L-propionylcarnitine on ischemia-induced myocardial dysfunction in men with angi-na pectoris. Am. J. Cardiol. 74, 125–130.

Bennett, M.J., Boriack, R.L., Narayan, S., Rutledge, S.L., Raff, M.L., 2004. Novel mutationsin CPT 1A define molecular heterogeneity of hepatic carnitine palmitoyltransferaseI deficiency. Mol. Genet. Metab. 82, 59–63.

Bieber, L.L., 1988. Carnitine. Annu. Rev. Biochem. 57, 261–283.Bohmer, T., Eiklid, K., Jonsen, J., 1977. Carnitine uptake into human heart cells in culture.

Biochim. Biophys. Acta 465, 627–633.Bressler, R., Gay, R., Copeland, J.G., Bahl, J.J., Bedotto, J., Goldman, S., 1989. Chronic inhibition

of fatty acid oxidation: new model of diastolic dysfunction. Life Sci. 44, 1897–1906.Davini, P., Bigalli, A., Lamanna, F., Boem, A., 1992. Controlled study on L-carnitine ther-

apeutic efficacy in post-infarction. Drugs Exp. Clin. Res. 18, 355–365.Deschauer, M., et al., 2003. A splice junction mutation in muscle carnitine

palmitoyltransferase II deficiency. Mol. Genet. Metab. 79, 124–128.Deschauer, M., Wieser, T., Zierz, S., 2005. Muscle carnitine palmitoyltransferase II deficiency:

clinical and molecular genetic features and diagnostic aspects. Arch. Neurol. 62, 37–41.Fanin, M., et al., 2012. Allelic and phenotypic heterogeneity in 49 Italian patients with

the muscle form of CPT-II deficiency. Clin. Genet. 82, 232–239.Hernandiz Martínez, A., et al., 1997. Effects of L-carnitine on the regional function of the

stunned myocardium caused by ischemia of short duration. Rev. Esp. Cardiol. 50,650–657.

Ino, T., Sherwood, W.G., Benson, L.N., Wilson, G.J., Freedom, R.M., Rowe, R.D., 1988. Car-diac manifestations in disorders of fat and carnitine metabolism in infancy. J. Am.Coll. Cardiol. 11, 1301–1308.

Joshi, P.R., Deschauer, M., Zierz, S., 2012. Clinically symptomatic heterozygous carnitinepalmitoyltransferase II (CPT II) deficiency. Wien. Klin. Wochenschr. 124, 851–854.

Longo, N., Amat di San Filippo, C., Pasquali, M., 2006. Disorders of carnitine transport andthe carnitine cycle. Am. J. Med. Genet. C: Semin. Med. Genet. 142C, 77–85.

Misra, M.K., Sarwat, M., Bhakuni, P., Tuteja, R., Tuteja, N., 2009. Oxidative stress and is-chemic myocardial syndromes. Med. Sci. Monit. 15, RA209–RA219.

Olpin, S.E., et al., 2003. Mutation and biochemical analysis in carnitine palmitoyltransferasetype II (CPT II) deficiency. J. Inherit. Metab. Dis. 26, 543–557.

Paulson, D.J., Schmidt, M.J., Traxler, J.S., Ramacci, M.T., Shug, A.L., 1984. Improvement ofmyocardial function in diabetic rats after treatment with L-carnitine. Metabolism33, 358–363.

Pauly, D.F., Pepine, C.J., 2003. The role of carnitine in myocardial dysfunction. Am. J.Kidney Dis. 41, S35–S43.

Regitz, V.R., Shug, A.L., Fleck, E., 1990. Defective myocardial carnitine metabolism incongestive heart failure secondary to dilated cardiomyopathy and coronary, hyper-tensive, and valvular diseases. Am. J. Cardiol. 65, 755–760.

Rizzon, P., et al., 1989. High doses of L-carnitine in acute myocardial infarction: meta-bolic and antiarrhythmic effects. Eur. Heart J. 10, 502–508.

Roger, V.L., 2007. Epidemiology of myocardial infarction. Med. Clin. N. Am. 91, 537–552.Sartorelli, L., Ciman,M., Rizzoli, V., Siliprandi, N., 1982. On the transport mechanisms of car-

nitine and its derivative in rat heart slices. Ital. J. Biochem. 31, 261–268.Siliprandi, N., Di Lisa, F., Pivetta, A., Miotto, G., Siliprandi, D., 1987. Transport and func-

tion of L-carnitine and L-propionylcarnitine: relevance to some cardiomyopathiesand cardiac ischemia. Z. Kardiol. 76, 34–40.

Taggart, R.T., Smail, D., Apolito, C., Vladutiu, G.D., 1999. Novel mutations associatedwith carnitine palmitoyltransferase II deficiency. Hum. Mutat. 13, 210–220.

Tarantini, G., Scrutinio, D., Bruzzi, P., Boni, L., Rizzon, P., Iliceto, S., 2006. Metabolictreatment with L-carnitine in acute anterior ST segment elevation myocardial in-farction. A randomized controlled trial. Cardiology 106, 215–223.

Tripp, M.E., Shug, A.L., 1984. Plasma carnitine concentrations in cardiomyopathy pa-tients. Biochem. Med. 32, 199–206.

Vladutiu, G.D., Bennett, M.J., Smail, D., Wong, L.J., Taggart, R.T., Lindsley, H.B., 2000. Avariable myopathy associated with heterozygosity for the R503C mutation in thecarnitine palmitoyltransferase II gene. Mol. Genet. Metab. 70, 134–141.

Whitmer, J.T., 1987. L-carnitine treatment improves cardiac performance and restoreshigh-energy phosphate pools in cardiomyopathic Syrian hamster. Circ. Res. 61,396–408.

Xue, Y.Z., Wang, L.X., Liu, H.Z., Qi, X.W., Wang, X.H., Ren, H.Z., 2007. L-carnitine as an ad-junct therapy to percutaneous coronary intervention for non-ST elevation myocar-dial infarction. Cardiovasc. Drugs Ther. 21, 445–448.

Yoon, H.R., Hong, Y.M., Boriack, R.L., Bennett, M.J., 2003. Effect of L-carnitine supple-mentation on cardiac carnitine palmitoyltransferase activities and plasma carni-tine concentrations in adriamycin-treated rats. Pediatr. Res. 53, 788–792.

Zhang, R., et al., 2012. Neuroprotective effects of pre-treatmentwith L-carnitine and acetyl-L-carnitine on ischemic injury in vivo and in vitro. Int. J. Mol. Sci. 13, 2078–2090.