ORIGINAL PAPER

Jacques Daniel

Sir-dependent downregulation of various aging processes

Received: 6 March 2005 / Accepted: 19 July 2005 / Published online: 1 October 2005� Springer-Verlag 2005

Abstract Using a new genetic selection approach in yeasttermed fitness-based interferential genetics (FIG), genesthat are in an antagonistic relationship with the Sircomplexes were selected. Many of the functionally well-defined genes belong to various aging processes occur-ring in this organism. Three genes are somehow involvedin glucose utilization (HXT4,YIL107c, EMI2). Anothergene, CDC25, encodes the main regulator of the cyclicAMP pathway in response to glucose. STM1 has beenimplicated in the control of apoptosis, and indeed, thiswork shows that disruption of this gene results, amongother phenotypes, in resistance to aging. LCB4, encod-ing a sphingoid bases kinase is linked to the cell integritypathway. Two other genes, FHL1 and PEP5, are in-volved in the control of ribosome formation and vacuolebiogenesis, respectively; and five genes, presently havingunknown functions, could be new potentially interestingcandidates for further studies in relation to yeast repli-cative aging. It is proposed that most, if not all, selectedgenes are downregulated by the Sir complexes. Inaddition to changing our view of the mechanisms usedby the Sir complexes for extending life span in yeast,these findings could contribute to a better understandingof the role of the Sir complexes in the higher eukaryotes.

Keywords Longevity Æ Gene silencing Æ Calorierestriction Æ Cyclic AMP Æ STM1 Æ Sphingolipids ÆGene interference

Introduction

Sir2p, a ubiquitous NAD-dependent deacetylase in cellsranging from bacterial to human, has been linked tomany physiological processes such as stress response,development, metabolism, and aging. Mutation andoverexpression studies have shown Sir2p to be anessential component in the protection against aging inyeast, nematode, and fruit fly. In yeast, Sir2p acts as ahistone deacetylase, which regardless of whether it iscomplexed with Sir3/4p, represses regions on the chro-mosomes. In studies on replicative aging in yeast, it hasbeen shown in aging mother cells that the Sir proteincomplexes migrate from their repository sites (mostlytelomeres and the mating-type cassette regions) to newsites such as the ribosomal DNA (rDNA) within thenucleolus. This new location may prevent or retard theadvent of extrachromosal rDNA circle (ERC) accumu-lation in aging mother cells (see Bitterman et al. 2003).One current model gives ERC accumulation a crucialrole in the aging, and ultimately death, of these cells(Sinclair and Guarente 1997). Although the ERC-accu-mulation model of aging in yeast was initially based oncorrelations between these two parameters under severalenvironmental and genetic conditions (Sinclair andGuarente 1997; Bitterman et al. 2003), a few disturbingfacts have surfaced more recently, which appear tocontradict this model (Ashrafi et al. 1999; Heo et al.1999; Kaeberlein et al. 1999; Lin et al. 2000). In partic-ular, a strain harboring a cdc25 mutation—whichmimics calorie restriction (CR), a general conditionknown to extend life span—has a much greater longevitythan the wild type, an effect, which is dependent uponSir2p but is not entirely accounted for by the decrease inERC accumulation (Lin et al. 2000). These findings areparticularly relevant as a Sir2p-mediated CR effect thatwas also recently observed in Drosophila which—like allthe other organisms studied to date—does not accu-mulate any nuclear DNA circles during aging (Roginaand Helfand 2004).

Communicated by C. Hollenberg

J. Daniel (&)Centre de Genetique Moleculaire, Centre National de la RechercheScientifique, rue de la Terrasse, 91198 Gif-sur-Yvette, FranceE-mail: daniel@cgm.cnrs-gif.frTel.: +33-169-823879Fax: +33-169-823877

Mol Gen Genomics (2005) 274: 539–547DOI 10.1007/s00438-005-0040-5

These facts suggest that the Sir complexes may exerttheir protective effect against aging in yeast by silencingregions of the chromosomes other than rDNA. As amatter of fact, using the Ty5 transposon’s ability tomake specific insertions into silent chromatin, Zhu et al.(1999) have shown that the sir4-42 allele, which leads toprolonged life span by permanently redistributing the Sircomplexes to locations other than telomeres and mating-type cassettes (Kennedy et al. 1995, 1997), also consis-tently modifies the locations of Ty5 insertions. Indeed, aninefold increase in the sir4-42 mutant relative to thewild type was found in the number of insertions in therDNA region. Nevertheless, this represented only 26%of the total insertions, leading the authors to proposethat the remaining ones might ‘‘identify other sites atwhich silent chromatin assembles in genetically agedcells.’’

This interesting possibility, which could have im-mense implications for the mechanism of action of theSir complexes in protecting against aging, can be testedby the fitness-based interferential genetics (FIG) ap-proach (Daniel 1993, 1996a, 1996b). FIG makes itpossible to select for genes (or gene products) that arein antagonistic relationships with a given referencegene (or gene product). Indeed, in the first FIGexperiment made with TPK1 as the reference gene(encoding a protein kinase A), a couple of selectedcandidates chosen for further study were found to begenes, SWI4 and MID2, that encode crucial positiveregulators of the cell integrity pathway and the cellcycle Start control (Daniel 1993). These findings, whichare in striking agreement with the known negative ef-fect of protein kinase A in the Start control, werecorroborated by mutational studies showing that thephosphorylation by Tpk1p of a putative site in Swi4p,has a negative impact on its activity in vivo (Daniel1996a). More generally, the FIG approach enables adeeper understanding of in vivo functional interactionsoccurring within the cell’s macromolecular networks(manuscript in preparation; unpublished results withvarious reference genes), and thus was used here in thesearch of genes antagonized (i.e., repressed) by the Sircomplexes.

Materials and methods

Strains and media

The Saccharomyces cerevisiae strain used was: C90-A-7 (Mat a leu2-3,112 his3D1 trp1 ura3-52 ade2::TRP1).

Media for yeast (YPD rich medium and SD syntheticminimal medium) and concentrations of supplementingauxotrophic requirements were as in Sherman et al.(1987).

Escherichia coli strain used was XL1-Blue (Sambrooket al. 1989; Stratagene).

General DNA manipulations

Transformation of yeast was essentially performed bythe lithium chloride method according to Ito et al.(1983). Transformation of E. coli was done by electro-poration according to protocols from Bio-Rad.

PCR were performed with an Hybaid thermocycler.

FIG selection

Strains harboring the sir4-42 mutation are stress-resis-tant and have a longer life span, the last phenotype beingsemi-dominant. Since the sir4-42 mutation—generatinga stop codon removing 121 residues from the 1358 res-idue Sir4 open reading frame—abolishes silencingactivity at the telomere and the mating-type cassettes, itwas assumed that the carboxyl terminus of Sir4p isresponsible for the normal localization of the Sir com-plexes at these sites (Kennedy et al. 1995). In agreementwith this view, it was found that overexpression of acarboxy-terminal fragment of Sir4p apparently com-petes with the wild-type protein for recruiting to thesesites since it leads to an anti-Sir4 dominant negativeeffect with respect to silencing at the mating-type cas-settes (i.e., dominant negative inhibition of mating). Inaddition, this situation also results in stress-resistanceand extension of life span due to permanent redistribu-tion of the Sir complexes (Kennedy et al. 1995). Thus, asa basis for this FIG selection, we chose to overexpressthe 121 residue C-terminus of Sir4p from the referencemulticopy plasmid.

To construct the Yep21bA- sir4(3¢) plasmid, PCRwas performed with SIR4+ yeast cells using thefollowing primers: GTGAAGATCTACTCTCT-TTCTCAAGACCTGCGTCC and CACTCTGCATG-CGTAATTTTACATATGTAGCCAAAAGCCC. Theobtained 680 bp DNA fragment was digested by BglIIand SphI restriction enzymes and inserted into theBamHI and SphI sites of Yep21bA (Daniel 1993) so asto generate a hybrid protein fragment containing, at itsN-terminal, 40 amino acid residues belonging to the N-terminal of TetR p followed by the 176 amino acid res-idues of the C-terminal of Sir4p. The TETR promoterfound in the Yep21bA vector has been shown to besignificantly expressed in yeast even in the absence oftetracyclin addition to the medium (Daniel 1993,unpublished results). To check that this construct leadsto an overexpressed functional C-terminal Sir4p frag-ment with the expected concomitant loss of mating-typecassette silencing (see above), efficiency of mating wasstudied: haploid cells bearing this plasmid gave about 7times less conjugants than control cells bearing theYep21bA vector. Also, most cells showed a bipolarpattern of budding normally encountered only in thediploid state, which expresses both mating-type pep-tides. Moreover, ‘‘gene toxicity’’ (Daniel 1996b) result-ing from this construct showed a 9% difference relativeto the control vector.

540

The FIG selection made with the Yep21bA- sir4(3¢)and a yeast genomic library was performed in yeast re-cipient strain C90-A-7, basically as in Daniel (1993).Among the approximately 20,000 transformants ob-tained, 13 were found consistently (i.e., also after puri-fication of the genomic library plasmid andretransformation) to tend to retain the Yep21bA- sir4(3¢)plasmid in their cell population relative to all the othertransformants (observed as colonies with less red sec-tors, these red sectors being formed when the Yep21bA-sir4(3¢) reference plasmid containing the ADE2 gene islost in the ade2-disrupted C90-A-7 cells containing theselibrary plasmid). The inserts of these 13 genomic libraryplasmids, all different, were identified on the yeast gen-ome map by sequencing at both ends using two appro-priate primers on the corresponding vector closed to thesite of genomic fragment insertion and using the Blastprogram at the Saccharomyces Genome Database(Stanford University). DNA Strider was used for gen-erating a restriction map of each genomic fragment andgene sequence-guided subcloning was performed forobtaining the gene responsible for the colony phenotype(‘‘white’’ phenotype).

STM1 disruption

For disrupting STM1, the kanamycin-PCR-basedmethod was used (Wach et al. 1994) with the followingprimers: CTTTTAGAGGTGAAGTAGAAATAA-ACCAAGAAAGCATACACCCAGCGACATGGAG-GCCC and CACTGTTATTGGATTCTTTCAGTTG-GAATTATTCATATATAAGGCCATTCACATAGA-TTGACGC. The geneticin resistant clones were testeddirectly by PCR using the following specific primer:GTATACTTGGTTTATTGTGGAG and the anti-kanprimer: CAGCATCCATGTTGGAATT. With thesetwo primers, the stm1 disruptants should display a0.54 kb band in agarose gels.

Replicative aging

Replicative aging was studied by starting from isolatedsmall buds from exponential cultures and using themicromanipulation procedure described by Kennedyet al. (1994) for counting the number of buds producedby each of these mother cells before she dies. Survivalcurves (Fig. 2) were transformed into Gompertz age-specific mortality curves (Fig. 3) for reasons given in thetext.

Results and discussion

For the convenience in the presently described FIGselection and to obtain permanent redistribution of theSir complexes, overexpression of a gene encoding a C-terminal fragment of Sir4p was used on the referencegene product’s multicopy plasmid since this overex-pression completely mimicks the effect of the sir4-42allele (Kennedy et al. 1995, see ‘‘Materials and meth-ods’’). A yeast genomic library made on the secondmulticopy plasmid was utilized to search for genes thatwould tend to retain the multicopy plasmid containingthe reference gene (the latter multicopy plasmid notbeing selected for its specific marker and thus, able todrift), an indication of an antagonistic relationshipexisting between the Sir complexes and those particulargenes (see Daniel 1993, see ‘‘Materials and methods’’).

This specific FIG selection gave 13 genes, all fullydefined, in antagonistic relationship with the Sir com-plexes. Table 1 clusters these genes into various physi-ological domains: glucose utilization (two genes,possibly three), cAMP signal-transduction pathway(one), sphingolipid metabolism (one), DNA mainte-nance (one), rRNA processing control (one), vacuolebiogenesis (one), and no known functions (five). Fig-ure 1 shows the striking relationship of the functionallydefined genes with specific regulatory systems, or genes,known to be essential in the control of yeast longevity(boxes in Fig. 1).

Among the three genes potentially involved in glu-cose utilization, YIL107c encodes phosphofructokinase2, which might constitute a crucial switch for controllingglycolysis vs gluconeogenesis: its product, diphospho-fructose 2-6, inhibits diphosphofructose 1-6 phospha-tase, allowing the inhibition of gluconeogenesis and thedegradation of glucose (Boles et al. 1996). Another gene,HXT4, encodes a moderately low-affinity glucosetransporter (Reifenberger et al. 1997), and thus is di-rectly linked to the first step in glucose utilization. Thethird gene, EMI2, has an intriguing function: originallyisolated as an inducer of early meiosis, it is completelyrepressed by high concentrations of glucose (Lutfiyyaet al. 1998); a finding consistent with the observationthat meiosis is repressed in the presence of glucose. Yet,Emi2p is highly homologous to the glucokinase Glk1pand is expressed in the presence of moderate concen-

Table 1 Genes obtained by FIG selection and physiological do-mains concerned

Gene Physiological domain

YIL107c Glucose utilizationHXT4 Glucose utilizationEMI2 Glucose utilization?CDC25 cAMP transduction pathwayLCB4 Sphingolipid metabolismSTM1 DNA maintenanceFHL1 rRNA processing controlPEP5 Vacuole biogenesisTOS8 UnknownYDR527w UnknownYKL121w UnknownYBR157c UnknownYOL087c Unknown

541

trations of glucose (Lutfiyya et al. 1998). One possibilityis that Emi2p may represent a positive regulator in thephosphorylation of available glucose. In particular, itmay be part of the so-far elusive glucose phosphoryla-tion-dependent system required for glucose-inducedRas2p-GTP loading: this system participates in theglucose activation of cAMP synthesis and its effect ismediated by Cdc25p (Colombo et al. 2004), encoded byanother gene found here to be in an antagonistic rela-tionship with the Sir complexes.

Indeed, cdc25p is a crucial positive regulator ofcAMP synthesis in response to glucose availability(Mintzer and Field 1999).The Cdc25/Ras/Pka pathwaycontrols a wide variety of cellular properties related tocell growth and proliferation. In particular, the cAMP-dependent cascade was found to activate phosphofruc-tokinase 2 (Francois et al. 1984), another already men-tioned activity obtained in the present selection.

Another selected gene, STM1, encodes a guaninequadruplex (G4) and purine-motif triplex nucleic-acid-

Fig. 2 Replicative-aging survivalcurve for the stm1 disruptant.Parental strain C90-A(triangles) and stm1 disruptant(squares). The sample sizes forthe strains in this experimentwere: stm1 disruptant, 43 cells;parental, 34 cells

Fig. 1 The various yeast agingprocesses likely downregulatedby the Sir complexes as revealedby FIG. Each aging process isshown in box. Genes obtainedby FIG (see Table 1 and text)are highlighted andunderscored. Within someboxes, italicized genes orsystems are likely to beantagonistic to genes selectedby FIG. Empty boxes representpossible unknown agingprocesses downregulated by theSir complexes. See text

542

binding protein (Frantz and Gilbert 1995; Nelson et al.2000). Stm1p interacts with Cdc13p, which binds the G-rich single strand on yeast telomeres and serves as aregulator of telomere replication. Overexpression ofSTM1 suppresses the growth–temperature sensitivity ofa Cdc13p-defective strain. However, overexpressing theSGS1 gene along with STM1 prevents this suppression(Hayashi and Murakami 2002). This indicates anantagonistic relationship between Sgs1p and Stm1p.SGS1 codes for a DNA helicase of the RecQ family,which unwinds G4 DNA (Sun et al. 1999). A Sgs1-deficient mutation results in defective chromosome seg-regation, increased mitotic and illegitimate recombina-tion (Gangloff et al. 2000), and accelerated aging(Sinclair et al. 1997). Yeast SGS1 is the homologue ofthe Werner’s helicase gene whose mutation is responsiblefor Werner’s syndrome characterized by many symp-toms of premature aging, as well as susceptibility tocancer (Sinclair et al. 1997).

Given the published antagonism between STM1 andSGS1, the STM1 gene was disrupted. A replicative agingstudy was undertaken on the stm1 disruptant using theprocedure described by Guarente’s group (Kennedyet al. 1994, see ‘‘Materials and methods’’). The survivalcurves for the stm1 disruptant and the parental strainsare shown in Fig. 2 and their Gompertz transformation(that is, mortality at each age in semi-logarithmiccoordinates; Gompertz 1825; Arking 1998) in Fig. 3. Itshould be noted that the potential effect of STM1 dis-ruption on aging could not be assessed by simply look-ing at the mean or maximum longevity of mother cellbecause disruption of STM1 leads to some cell mortalityby interfering with the cell cycle (unpublished). In fact,this cell mortality effect could clearly be observed at thestarting end of the exponential curve of aging (Fig. 2).However, later on, when the exponentially growingprobability of dying by aging takes a very rapid pace, thesole effect of aging could practically be captured by theage-specific mortality curve (i.e., Gompertz transfor-mation). This transformation for either the stm1 dis-ruptant or the parental strain surprisingly gave atriphasic curve that can be described as two straight lineswith identical slopes interrupted by an in-between periodof relative—though unstable—aging resistance (Fig. 3a).Although it seems that this pattern has never beenmentionned in previous studies on replicative aging inyeast, a Gompertz transformation was made on themortality curves of two parental, and two mutant (sgs1and sir 4-42), strains extracted from the works of Gua-rente’s laboratory (Kennedy et al. 1995; Sinclair et al.1997) (Fig. 3b–d) and results were found to be basicallysimilar to ours findings. (Noticeably, yeast cultures un-der non-dividing conditions were also found to display avery similar pattern of rise–fall–rise in their mortalityrate (Vaupel et al. 1998) Although this does not seem tobe a general phenomenon for other organisms, it hasalready been observed by another group working inDrosophila (Stearns et al. 2000). The molecular basis ofthese temporary anti-aging effects is not known). Fur-

thermore, the slope of the straight lines relative to thecontrol does predict the effect of both mutations onaging as found by the authors using only the mean andmaximum cell life span values: for the sgs1 mutant therelative slope is around 2 whereas for sir4-42 it is around0.58, showing that sgs1 mutant increases, and sir4-42decreases, mortality rate. In the case of the stm1 dis-ruptant, the relative slope was found to be 0.67, stronglysuggesting that disrupting the STM1 gene results in ananti-aging effect. This result fully agrees with the sug-gestion that the SGS1/STM1 couple might play a deci-sive role in replicative aging.

Recent studies have shown an apoptotic cell deathprogram in unicellular eukaryotes and, in particular, oldyeast cells have been found to produce oxygen radicalsand die with morphological alterations typical ofapoptosis (Laun et al. 2001). Stm1p, an unstable proteinin cells, is a proteasome substrate. Its overexpression incells with impaired proteasomal degradation leads to celldeath with the cytological markers of apoptosis. Con-versely, disruption of STM1 leads to a deficiency in theapoptosis-like cell death process induced by low con-centrations of H2O2. It has thus been proposed thatStm1p plays an important role in the control of apop-tosis-like cell death in yeast (Ligr et al. 2001). This effectcould complement the suggested antagonistic effect withSgs1p.

Another gene selected in the present work, LCB4,encodes the yeast’s main sphingoid base kinase activity(Nagiec et al. 1998). In higher eukaryotes, sphingolipidsare essential structural and signaling molecules involvedin many cellular events, including cell growth, senes-cence, maturation, and cell death. As shown in Fig. 1,Lcb4p is at a diverging path with Lag1p (and Lac1p),which catalyzes the C26-CoA-dependent ceramide syn-thesis (Guillas et al. 2001). LAG1 gene (longevityassurance gene) was isolated by Jazwinski’s group be-cause they observed that it is expressed predominantly inyounger cells, whereas most yeast genes do not displayalterations in transcript levels as a function of replicativeage (D’mello et al. 1994). Recently, the status of theLag1p effect on longevity was assigned by the samegroup: they observed that overexpression of LAG1 re-sults in a bimodal effect, with a moderate overexpression(no more than 10–15 times) conferring an increasedlongevity, and higher overexpression shortening the lifespan (Jiang et al. 2004). The enhancement of longevityinduced by moderate overexpression of LAG1 may berelated to its accelerative effect on the transport of gly-cosylphosphatidylinositol (GPI)-anchored proteins tothe Golgi as a result of its function in ceramide synthesis(Guillas et al. 2001). Moreover, its effect may be morecomplex, since sphingoid bases, the substrates of Lag1pfor ceramide synthesis, have been shown to accumulatein the heat-induced transient cell-cycle arrest mediatedthrough Cln3p (Jenkins and Hannun 2001). However,the accumulation of phosphorylated sphingoid bases byoverexpression of LCB4 in the absence of normalphosphorylated sphingoid bases degradation enzymes,

543

Fig. 3 Age-specific mortality. a Extracted from Fig. 2: stm1disruptant (diamonds) and parental strain C90-A (squares). bExtracted from Kennedy et al. (1995) (in Fig. 4a); sir4-42 mutant

(squares) and parental strain (diamonds). c, d Extracted fromSinclair et al. (1997); sgs1 mutant (d) and parental strain (c). Seetext and ‘‘Materials and methods’’

544

leads to cell growth inhibition (Kim et al. 2000) anddeath (Zhang et al. 2001). Thus, although these resultssuggest the existence of an antagonistic interplay be-tween Lcb4p and Lag1p, a conclusion as to the precisemechanisms that modulates the life span in relation tothe sphingolipids awaits further investigation.

FHL1, also obtained in the selection, encodes a fork-head protein that plays a key role in controling therRNA-processing genes (Hermann-Le Denmat et al.1994). Complex genetic results were consistent with amodel in which Fhl1p is converted from a transcriptionrepressor to an activator upon binding to another pro-tein, Ifh1p (Cherel and Thuriaux 1995). Remarkably,overexpression of FHL1 appeared to induce a highincidence of aging and dying cells in culture (not shown).This is likely accounted for by an imbalance betweenFhl1p and Ifh1p, leading to the repression of rRNA-processing genes. Potentially relevant to the observationof an antagonistic relationship between the Sir com-plexes and Fhl1p is the finding that aging is accompa-nied by a general decrease in ribosome efficiency (Ratan1991).

Finally, the last selected gene with known functionwas PEP5, which codes for a vacuolar peripheralmembrane protein required for vacuole biogenesis.Obviously, this is consistent with a role for PEP5 duringnormal aging since this process involves a pronouncedenlargement of the cell vacuole.

The main conclusion of the present work is that thereexists an antagonistic relationship between various yeastaging-related genes and the Sir complexes, as revealed byFIG. The observed antagonism likely results from theredistribution of the Sir complexes to chromosomal sitesother than rDNA, and the consequent downregulationof the selected genes directly by those Sir complexes.This notion is supported by the following consider-ations. It is unlikely that the FIG selection could havebeen based on, and have detected, only broad and gen-eral antagonism at the cellular level occurring betweenthe Sir-complex subsystem and several aging-relatedsubsystems. In point of fact, FIG appears much moreefficient at detecting direct functional effects betweenmacromolecules than indirect ones (Daniel 1993a).Moreover, FIG is based on the general observation thatgene overexpression affects cell fitness negatively,though the extent of this effect varies from one gene tothe next. As cell fitness is linked only to proliferationrate (Daniel 1993, 1996a, 1996b), genes affecting agingshould not differ from any other genes in this respect.Indeed, overexpression of the Sir4p C-terminal fragmentused for this selection results in a (moderate) ‘‘toxic ef-fect’’ on cell fitness (see ‘‘Materials and methods’’), al-though it has a very significant effect on extending thelife span. Thus, general antagonism of subsystems inrelation to cell life span could not constitute the basisupon which the gene selection was made. Finally, asalready mentioned, there exist many potential sites thatcan be silenced by the Sir complexes and, consequently,should be readily detectable by the FIG procedure.

The unsuspected functional linkage found here be-tween the Sir complexes and yeast aging processes mayhave several gratifying consequences. First, it mightreconcile yeast with itself. Indeed, glucose utilizationconstitutes an essential aspect of aging since its inversesituation, CR has been the the only stringent and man-ifest means, from yeast to mammals, of extending lifespan to date. The likely downregulation of several keyactivities/regulators in glucose utilization by the Sircomplexes, as found here, gives one molecular explana-tion for the known Sir-dependent participation in theCR phenomenon (Lin et al. 2000). Moreover, as CR isalso mediated by the glucose-sensing Ras/cAMP/Pkapathway, the recognition of a crucial positive regulatorof the cAMP pathway (i.e., Cdc25p) likely beingdownregulated by the Sir complexes provides anotherkey to the link between Sir-independent (Kaeberleinet al. 2004) and Sir-dependent CR. Thus, by these twomechanisms, one can at least understand how Sir-dependent CR relates to Sir-independent CR. Further-more, the FIG results indicate that in yeast, the variousaging processes are integrated under the Sir banner.

In addition, the present findings might reconcile themodel yeast system with the more complex eukaryotes asfar as possible mechanisms involved in aging are con-cerned. Indeed, the yeast-specific accumulation of ERCdoes not appear to be a bona fide cause of aging, thoughit may aggravate the aging process by depleting proteinssuch as those of the Sir complexes (which seem to be intight supply; Kaeberlein et al. 1999) or Sgs1p (as anexample of a protein antagonistic to another proteinthat is potentially downregulated by the Sir complexes).For both yeast and higher eukaryotes, more likelymodels of aging could be adopted, one possibility beingthe free-radical-induced apoptosis model. As a matter offact, primary human cells in culture have been shown toundergo oxidative stress and apoptosis when enteringsenescence (Unterluggauer et al. 2003). Similarly, it hasbeen reported in yeast that aged mother cells (in theabsence of any external stress) contain reactive oxygenspecies (ROS) that are localized in the mitochondria,and display phenotypic markers of oxidative stress andapoptosis (Laun et al. 2001). Remarkably, at least threeof the four aging processes described here to be down-regulated by the Sir complexes, can potentially lead toapoptosis in yeast. Indeed, in the absence of additionalnutrients to support growth, glucose induces deathwithin a few hours, characterized by the rapid produc-tion of ROS, RNA and DNA degradation, membranedamage, nuclear fragmentation, and cell shrinkage(Granot et al. 2003). This sugar-induced cell death—-which requires sugar phosphorylation (Granot and Dai1997)—is initiated by ROS since it can be prevented bythe addition of ascorbic acid (Granot et al. 2003).Moreover, under normal growth conditions, glucose isknown to activate the Ras/cAMP/Pka cascade via twomechanisms, at least one requiring the Cdc25p activitythat was found here to be downregulated by the Sircomplexes. The cAMP-dependent protein kinase A

545

inhibits both the general stress response, mediated byMsn2/4p, and the specific stress responses mediated bySkn7p and Yap1p, and thus, would likely tend to favormolecular damage by ROS produced as normal by-products of cellular metabolism. As for Stm1p, resultsfrom Ligr et al. (2001) have suggested that this protein isinvolved in the control of apoptosis-like cell death. Thefourth aging system, involving sphingolipids, has onlybeen linked to apoptosis in higher eukaryotes. Never-theless, it has been suggested that in yeast, LCB4 mayhave unimportant role in the protection against heatstress (Obeid et al. 2002). It would be interesting to findout whether death that occurs via the elevation ofendogenous phosphorylated sphingoid bases as a resultof LCB4 overexpression displays all the phenotypiccharacteristics of apoptosis (Laun et al. 2001).

Although this study has exclusively involved replica-tive aging, it is interesting to note that for chronological(post-mitotic) aging in yeast, a causal relationship be-tween apoptosis and free radical-induced aging has beendemonstrated by Herker et al. (2004).

It was recently observed that a proteasome-relatedkey player in yeast apoptosis is the deubiquinating en-zyme Ubp10p. Disruption of UBP10 leads to generationof oxidative stress, which is suppressed by disruption ofSIR4 (Bettiga et al. 2004; Orlandi et al. 2004). Indeed,since sir4D strains have been previously found to bestress-tolerant, these results suggest a transcriptional-dependent induction of apoptosis. However, it is notclear how this transcriptional mechanism might relate tothe SIR-dependent anti-aging phenomenon since sir4Dstrains do not display extension of life span (Kennedyet al. 1995).

Modifying our view of how the Sir complexes mayprotect yeast against aging might provide us with betterinsight into the role and mechanisms of action of thissystem in yeast. Indeed, with replicative aging, yeastmother cells accumulate oxidatively damaged proteinswhich are not normally inherited by daughter cellsduring cytokinesis. Disrupting SIR2 has two conse-quences: (1) the amount of damage increases and (2) theasymmetric inheritance during cytokinesis disappears(Aguilaniu et al. 2003) (the increase in carbonylatedproteins has been found to be approximately 1.9- or 3.8-fold, depending on whether only mother cells or mothercells plus daughter cells are considered, see Fig. 3 inAguilaniu et al. 2003). Thus, Sir2p appears to contributeto free-radical defense. Moreover, since the actin skele-ton has been observed to be required for proper segre-gation of oxidized proteins (Aguilaniu et al. 2003), thefinding here that there exists antagonism between the Sircomplexes and LCB4 may provide a possible explana-tion for the normal Sir2-dependent asymmetric inheri-tance of oxidatively damaged proteins. Indeed, it hasbeen shown that sphingoid bases are required for theorganization of the actin cytoskeleton and the internal-ization step of endocytosis, apparently by directly acti-vating the Pkh1/2p kinases with the resulting

phosphorylation of their substrates, Pkc1p and Ypk1/2pkinases (Friant et al. 2001).

Five genes from this FIG selection have no knownfunctions. Since no gene was obtained twice in this un-ique selection, which gave 13 hits—thus suggesting thatthis particular screen was neither exhaustive nor satu-rated—it is likely that genes other than those presentedin Table 1 are downregulated by the Sir complexes. Byunderstanding the functions of these five ‘‘orphan’’genes, as well as pushing the FIG selection further, onemay be able to get a broader view of various activitiesand mechanisms used by this model eukaryote to controlaging and longevity, thus leading to a more globalunderstanding that may have some relevance to highereukaryotes. This seems to be an achievable goal, since,as also found with other types of FIG selection (Daniel1993; manuscript in preparation; unpublished results),the consistency of the results from the selection pre-sented here provides a strong indication that the FIGapproach could become a powerful tool for decipheringthe functional relationships existing in vivo betweenintracellular macromolecules.

Acknowledgements This work was supported by the Centre Na-tional de la Recherche Scientifique (France). I thank L. Belcourand A. Sainsard for their kind hospitality.

References

Aguilaniu H, Gustafsson L, Rigoulet M, Nystrom T (2003)Asymmetric inheritance of oxidatively damaged proteins duringcytokinesis. Science 299:1751–1753

Arking R (1998) Biology of aging: observation and principles. Si-nauer Associates, Sunderland, MA

Ashrafi K, Sinclair D, Gordon JI, Guarente L (1999) Passagethrough stationary phase advances replicative aging in Sac-charomyces cerevisiae. Proc Natl Acad Sci USA 96:9100–9105

Bettiga M, Calzari L, Orlandi I, Alberghina L, Vai M (2004)Involvement of the yeast metacaspase Yca1 in ubp10D -pro-grammed cell death. FEMS Yeast Res 5:141–147

Bitterman KJ, Medvedik O, Sinclair DA (2003) Longevity regu-lation in Saccharomyces cerevisiae: linking metabolism, genomestability, and heterochromatin. Microbiol Mol Biol Rev67:376–399

Boles E, Gohlmann HW, Zimmermann FK (1996) Cloning of asecond encoding 5-phosphofructo-2-kinase in yeast, and char-acterization of mutants strains without fructose-2,6-biphos-phate. Mol Microbiol 20:65–76

Cherel I, Thuriaux P (1995) The IFH1 gene product interacts with afork head protein in Saccharomyces cerevisiae. Yeast 11:261–270

Colombo S, Ronchetti D, Thevelein JM, Winderickx J, MarteganiE (2004) Activation state of the Ras2 protein and glucose-in-duced signaling in Saccharomyces cerevisiae. J Biol Chem279:46715–46722

Daniel J (1993) Potentially rapid walking in cellular regulatorynetworks using the gene–gene interference method in yeast. MolGen Genet 240:245–257

Daniel J (1996a) Detection of antagonistic cellular regulatoryfunctions by the gene–gene interference method in yeast. CurrGenet 29:114–121

Daniel J (1996b) Measuring the toxic effects of high gene dosage onyeast cells. Mol Gen Genet 253:393–396

546

D’mello NP et al (1994) Cloning and characterization of LAG1, alongevity-assurance gene in yeast. J Biol Chem 269(22):15451–15459

Francois J, Van Schaftingen E, Hers HG (1984) The mechanism bywhich glucose increases fructose 2,6-bisphosphate concentra-tion in Saccharomyces cerevisiae. A cyclic-AMP-dependentactivation of phosphofructokinase 2. Eur J Biochem145(1):187–193

Frantz JD, Gilbert W (1995) A yeast gene product, G4p2, with aspecific affinity for quadruplex nucleic acids. J Biol Chem270(16):9413–9429

Friant S, Lombardi R, Schmelzle T, Hall MN, Riezman H (2001)Sphingoid base signaling via Pkh kinases is required for endo-cytosis in yeast. EMBO J 20(23):6783–6792

Gangloff S, Soustelle C, Fabre F (2000) Homologous recombina-tion is responsible for cell death in the absence of the Sgs1 andSrs2 helicases. Nat Genet 25:192–194

Gompertz B (1825) On the nature of the function expressive of thelaw of human mortality and a new mode of determining thevalue of life contingencies. Philos Trans R Soc Lond 115:513–585

Granot D, Dai N (1997) Sugar induced cell death in yeast isdependent on the rate of phosphorylation as determined byArabidopsis thaliana hexokinase. Cell Death Differ 4(7):555–559

Granot D, Levine A, Dor-Hefetz E (2003) Sugar-induced apoptosisin yeast cells. FEMS Yeast Res 4:7–13

Guillas I et al (2001) C26-CoA-dependent ceramide synthesis ofSaccharomyces cerevisiae is operated by Lag1p and Lac1p.EMBO J 20(11):2655–2665

Hayashi N, Murakami S (2002) STM1, a gene which encodes aguanine quadruplex binding protein, interacts with CDC13 inSaccharomyces cerevisiae. Mol Genet Genomics 267:806–813

Heo SJ et al (1999) Bloom’s syndrome gene suppresses prematureageing caused by Sgs1 deficiency in yeast. Genes Cells 4:619–625

Herker E et al (2004) Chronological aging leads to apoptosis inyeast. J Cell Biol 164(4):501–507

Hermann-Le Denmat S, Werner M, Sentenac A, Thuriaux P (1994)Suppression of yeast RNA polymerase III mutations by FHL1,a gene coding for a fork head protein involved in rRNA pro-cessing. Mol Cell Biol 14(5):2905–2913

Ito H, Fufuda Y, Murata K, Kumura A (1983) Transformation ofintact yeast cells treated with alkali cations. J Bacteriol 153:163–168

Jenkins GM, Hannun YA (2001) Role for de novo sphingoid basebiosynthesis in the heat-induced transient cell cycle arrest ofSaccharomyces cerevisiae. J Biol Chem 276(11):8574–8581

Jiang JC, Kirchman PA, Allen M, Jazwinski SM (2004) Suppressoranalysis points to the subtle role of the LAG1 ceramide synthasegene in determining yeast longevity. Exp Gerontol 39(7):999–1009

Kaeberlein M, McVey M, Guarente L (1999) The SIR2/3/4 com-plex and SIR2 alone promote longevity in Saccharomyces ce-revisiae by two different mechanisms. Genes Dev 13:2570–2580

Kaeberlein M, Kirkland KT, Fields S, Kennedy BK (2004) Sir2-independent life span extension by calorie restriction in yeast.PLOS Biol 2(9) (online e296)

Kennedy BK et al (1997) Redistribution of silencing proteins fromtelomeres to the nucleus is associated with extension of life spanin S. cerevisiae. Cell 89:381–391

Kennedy BK, Austriaco NR, Guarente L (1994) Daughter cells ofS. cerevisiae from old mothers display a reduced life-span. J CellBiol 127:1985–1993

Kennedy BK, Austriaco NR, Zhang J, Guarente L (1995) Muta-tion in the silencing gene SIR4 can delay aging in S. cerevisiae.Cell 80:485–496

Kim S, Fyrst H, Saba J (2000) Accumulation of phosphorylatedsphingoid long chain bases results in cell growth inhibition inSaccharomyces cerevisiae. Genetics 156:1519–1529

Laun P et al (2001) Aged mother cells of Saccharomyces cerevisiaeshow markers of oxidative stress and apoptosis. Mol Microbiol39(5):1166–1173

Ligr M et al (2001) The proteasomal substrate Stm1 participates inapoptosis-like cell death in yeast. Mol Biol Cell 12:2422–2432

Lin SJ, Defossez P-A, Guarente L (2000) Requirement of NADand SIR2 for life-span extension by calorie restriction in Sac-charomyces cerevisiae. Science 289:2126–2128

Lutfiyya LL et al (1998) Characterization of three related glucoserepressors and genes they regulate in Saccharomyces cerevisiae.Genetics 150:1377–1391

Mintzer KA, Field J (1999) The SH3 domain of the S. cerevisiaeCdc25p binds adenylyl cyclase and facilitates Ras regulation ofcAMP signalling. Cell Signal 11(2):127–135

Nagiec MM, Skrzypek M, Nagiec E, Lester RL, Dickson RC(1998) The LCB4 (YOR171c) and LCB5 (YLR260w) genes ofSaccharomyces encode sphingoid long chain base kinases. J BiolChem 273:19437–19442

Nelson LD, Musso M, Van Dyke MW (2000) The yeast STM1gene encodes a purine motif triple helical DNA-binding protein.J Biol Chem 275:5573–5581

Obeid LM, Okamoto Y, Mao C (2002) Yeast sphingolipids:metabolism and biology. Biochim Biophys Acta 1585:163–171

Orlandi I, Bettiga M, Alberghina L, Vai M (2004) Transcriptionalprofiling of ubp10 null mutant reveals altered subtelomeric geneexpression and insurgence of oxidative stress response. J BiolChem 279(8):6414–6425

Rattan SI (1991) Protein synthesis and the components of proteinsynthetic machinery during cellular aging. Mutat Res 256(2–6):115–125

Reifenberger E, Boles E, Ciriacy M (1997) Kinetic characterizationof individual hexose transporters of Saccharomyces cerevisiaeand their relation to the triggering mechanisms of glucoserepression. Eur J Biochem 245(2):324–333

Rogina B, Helfand SL (2004) Sir2 mediates longevity in the flythrough a pathway related to calorie restriction. Proc NatlAcad Sci USA 101:15998–16003

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: alaboratory manual, 2nd edn. Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, NY

Sherman F, Fink G, Hicks J (1987) Methods in yeast genetics:laboratory course manual. Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, NY

Sinclair DA, Guarente L (1997) Extrachromosomal rDNA cir-cles—a cause of aging in yeast. Cell 91:1033–1042

Sinclair DA, Mills K, Guarente L (1997) Accelerated aging andnucleolar fragmentation in yeast sgs1 mutants. Science277:1313–1316

Stearns SC, Ackermann M, Doebeli M, Kaiser M (2000) Experi-mental evolution of aging, growth, and reproduction in fruitflies. Proc Natl Acad Sci USA 97:3309–3313

Sun H, Bennett RJ, Maizels N (1999) The Saccharomyces cerevisiaeSgs1 helicase efficiently unwinds G–G paired DNAs. NucleicAcids Res 27:1978–1984

Unterluggauer H, Hampel B, Zwerschke W, Jansen-Dure P (2003)Senescence-associated cell death of human endothelial cells: therole of oxidative stress. Exp Gerontol 38(10):1149–1160

Vaupel JW et al (1998) Biodemographic trajectories of longevity.Science 280:855–860

Wach A, Brachat A, Pohlmann R, Philippen P (1994) New heter-ologous modules for classical or PCR-based gene disruptions inS. cerevisiae. Yeast 10:1793–1808

Zhang X, Skrzypek MS, Lester RL, Dickson RC (2001) Elevationof endogenous sphingolipid long-chain base phosphates killsSaccharomyces cerevisiae cells. Curr Genet 40:221–233

Zhu Y, Zou S, Wright DA, Voytas DF (1999) Tagging chromatinwith retrotransposons: target specificity of the SaccharomycesTy5 retrotransposon changes with the chromosomal localiza-tion of Sir3p and Sir4p. Genes Dev 13:2738–2749

547