skewer run2 sw041 1-trimir2.fastq fastqc report · 2015. 5. 21. · filename...

11

FastQC Report Wed 20 May 2015 skewer_run2_SW041_1-trimmed-pair2.fastq Summary Basic Statistics Per base sequence quality Per tile sequence quality Per sequence quality scores Per base sequence content Per sequence GC content Per base N content Sequence Length Distribution Sequence Duplication Levels Overrepresented sequences Adapter Content Kmer Content Basic Statistics Measure Value Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 1311142 Sequences flagged as poor quality 0 Sequence length 28-76 %GC 43 Per base sequence quality

Upload: others

Post on 01-Mar-2021

1 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

TRANSCRIPT

Page 1: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

FastQC Report Wed 20 May 2015skewer_run2_SW041_1-trimmed-pair2.fastq

Summary

Basic Statistics

Per base sequence quality

Per tile sequence quality

Per sequence quality scores

Per base sequence content

Per sequence GC content

Per base N content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences

Adapter Content

Kmer Content

Basic StatisticsMeasure Value

Filename skewer_run2_SW041_1-trimmed-pair2.fastq

File type Conventional base calls

Encoding Sanger / Illumina 1.9

Total Sequences 1311142

Sequences flagged as poor quality 0

Sequence length 28-76

%GC 43

Per base sequence quality

Page 2: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

Per tile sequence quality

Page 3: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

Per sequence quality scores

Page 4: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

Per base sequence content

Page 5: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

Per sequence GC content

Page 6: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

Per base N content

Page 7: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

Sequence Length Distribution

Page 8: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

Sequence Duplication Levels

Page 9: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

Overrepresented sequences

Sequence Count PercentagePossible

Source

CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC 2245 0.17122477961959878 No Hit

GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGG 1929 0.1471236525105595 No Hit

Adapter Content

Page 10: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

Kmer Content

Page 11: skewer run2 SW041 1-trimir2.fastq FastQC Report · 2015. 5. 21. · Filename skewer_run2_SW041_1-trimmed-pair2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9

Sequence Count PValue Obs/Exp Max Max Obs/Exp Position

GGGATAA 7310 0.0 22.797293 1

CCCTATG 705 0.0 22.203465 7

TCCCTAG 1970 0.0 20.998077 10

CCCTGTT 6345 0.0 20.9222 2

AGGGATA 4700 0.0 20.661074 1

ATCCCTA 6230 0.0 20.623749 9

ACCCTGT 6480 0.0 20.49651 1

ATAACAG 8245 0.0 20.354658 4

CCTGTTA 6390 0.0 20.333885 3

GGATAAC 8355 0.0 19.936012 2

TCCCTAT 1960 0.0 19.48694 6

GATAACA 8650 0.0 19.292309 3

AGGGTAA 8680 0.0 19.098875 9

TCCCTAA 1970 0.0 19.08916 10

CAGGGTA 8730 0.0 19.05472 8

CTGTTAT 6810 0.0 19.034563 4

CCTATGC 470 0.0 18.663042 8

ACAGGGT 9060 0.0 18.34874 7

AACAGGG 9340 0.0 17.966265 6

GGTAATT 2480 0.0 17.943556 11

Produced by FastQC (version 0.11.3)

José A. Blakeley Software Architect Database Systems ... Languages with Language Integrated Query Parallel DBMS cluster External Files HDF5, FASTQ DBMS Data Type New Index BLOB TVFs

CLC Assembly Cell - QIAGEN Bioinformaticsresources.qiagenbioinformatics.com/manuals/clcassemblycell/current/... · clc_to_fasta Converts fastq, sff, csfasta and genbank format files

File Types in Bioinformatics - GitHub Pages · File Types in Bioinformatics 151116 ... FASTA – reference sequences FASTQ – reads in raw form SAM – aligned reads BAM – compressed

MuG - FASTQ Pipelines Documentation

SOFTWARE Open Access MAPI: a software framework … · SOAP[5]toWSusingREST[6]principles)anddatafor-mats (for example FASTA [7], GenBank [8] and FASTQ [9]). ... ReadSeq [11] to automatically

RNA-seq data analysis Project QI LIU. From reads to differential expression Raw Sequence Data FASTQ Files Unspliced Mapping BWA, Bowtie Mapped Reads SAM/BAM

RNA$seq(dataanalysis(tutorial(...QC(and(pre$processing(• Firststep(in(QC:((– Look(atquality(scores(to(see(if(sequencing(was(successful(• Sequence(datausually(stored(in(FASTQ(format:

Basic bioinformatics - from fastq to variants · Sanger vs Next-generation sequencing Sanger sequencing - One region in one patient - Robust - Manual analysis possible NGS - Multiplexing

Supplementary Material for · 2 HiSeq 4000 instrument. FASTQ files can be obtained from the European Genome-phenome Archive (accession number EGAS00001002764). The template-specific

Kineton and District Local History Group · 2012. 9. 1. · sw041 Wooden enclosure S E 274 SE273 SE235 SE234 SE233 I SE232 ISE231 ISE230 SE229 SE228 SE227 SE226 ISE225 SE224 SE196

Galaxy environment Dr. Orr Shomroni Analysis of RNA ... · Per-base quality information (Phred score 33) RNA-seq workflow II – FASTQ processing Steps towards identifying differential

NAME SYNOPSIS - vcru.wisc.edu · vsearch(1) USER COMMANDS vsearch(1) NAME vsearch — chimera detection, clustering, dereplication and rereplication, FASTA/FASTQ ﬁle processing,

The Final Frontier Data Analysis - agilent.com · MBC, optical deduplication, etc. Must have bam file and MBC fastq • Tools for bioinformaticians capable of developing and debugging

CS-BWAMEM: A Fast and Scalable Read Aligner July 10 11 ...vast.cs.ucla.edu/sites/.../CS-BWAMEM_poster_0710_0.pdf · Achieve similar quality to BWA-MEM Input: FASTQ files Output: SAM

Supplementary Materials for...Mar 02, 2016 · Other supplementary material for this manuscript includes the following: Tables S1 to S6 (Excel format) 2 ... Illumina FASTQ reads were

Data Compression Strategy for Reference-Free Sequencing ... · There are many different file formats, such as FASTA, Multi-FASTA, FASTQ and SAM/BAM to store biological sequencing

KvarQ: targeted and direct variant calling from fastq ... · Figure 1 Simplified overview of scanning process and preparation. “Testsuites” are python source files that define

How to do differential expression analysis from Fastq ... · •Introduction: •Btrim is a fast and lightweight tool to trim adapters and low quality regions in reads from ultra

A look at the methods behind whole‐genome single ... · ‐ I’ll explain the dataformat for a fastq file in the next slide ‐ These fastq files are what gets transferred over

Maxime U. Garcia maxulysse.github.io @MaxUlysse @gau · FASTQ Files FASTQ: text-based format for storing both nucleotide sequence and corresponding quality scores. • At least 1

PRIME WATER KOREAweb.tradekorea.com/images/exh/202007/g-pair2/... · Prime Water Ionizer technologies such as Max Plates and Max Power - the heart of the most powerful home water

Ion AmpliSeq Cancer Panel - Roscoffapplication.sb-roscoff.fr/download/fr2424/abims/corre/ngs... · 2012. 4. 30. · including FASTQ, BAM, and VCF, which facilitate analysis in a wide

Illumina Output Fastq format and Quality control · Fastq format – fasta with qualities • p = the probability that the corresponding base call is wrong • Qualities – p = 0.1

Using Galaxy for NGS Data Analysis - albany.edu platform –RNA-seq pipeline usegalaxy.org •FASTQ file(s) •reference genome •GFF/GTF gene annotation file. 4/26/2017 5 ... Olga

Bisulfite-Sequencing Theory and Quality Control€¦ · FastQC: quality control for high throughput sequencing FastQ Screen: organism and contamination detection Hi-C mapping SeqMonk:

SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT Bioinformatics · 2016. 6. 17. · RNA-SEQ PIPELINE OVERVIEW Experiment Metadata Software Setup Sequence Data (fastq) preprocess Reference

Package ‘ShortRead’ - Bioconductor...Package ‘ShortRead’ July 14, 2020 Type Package Title FASTQ input and manipulation Version 1.47.2 Author Martin Morgan, Michael Lawrence,

Package ‘ShortRead’ - Bioconductor · 2020-07-06 · Package ‘ShortRead’ July 6, 2020 Type Package Title FASTQ input and manipulation Version 1.46.0 Author Martin Morgan,

1. Upload your files to galaxy 2. FASTQ-groomer on files (your … · Orange -> Sequence data Line 1: Read identifying metadata @WIGTC-HISEQ -> Instrument name 4 -> Flowcell lane

Praxis Extended RAS Panel Package Insert · —After demultiplexing, the Praxis Extended RAS Panel module generates intermediate files in the FASTQ format, which is a text format

Practical Linux Examples · Estimate the percentage of sequencing reads in the FASTQ file that contains the adapter “AGATCGGAAGAGC”. • Read file: cat D7RACXX.fastq • Select

Assembly, annotation, quantification Assembly.pdf · annotation GTF file Transcript identification StringTie Raw reads FASTQ file Genome sequence FASTA file Genome annotation GFF/GTF

BWAWholeGenomeSequencing v1.0 BaseSpaceAppGuide · 2018-09-11 · Introduction BWAWholeGenomeSequencingv1.0BaseSpaceAppGuide 3 Introduction AfterBaseSpace®generates the FASTQ files

RNA’Seq’ analysis’application.sb-roscoff.fr/download/fr2424/abims/corre/...NGS Data Basics: FASTQ format, PE data @C060CACXX:1:2108:04435:81967/1 AGAGAATGGTACAGGTACCAACAACATGCCATATGCATAGAGCAGCACAGAGCAACATAA

AUTOMOTIVE BROCHURE 080609 site update - nov 2009... · 2019. 7. 31. · SW041 Foaming Windshield Cleaner This windshield cleaner contains no alcohol, no ammonia and no silicones