1. Brain

• The brain is the center of thoughts, emotions, memory and speech.

Brain also control muscle movements and interpretation of sensory information (sight, sound, touch, taste, pain etc)

2. www.neuromds.com/lohe-faqs_ brain _ tumors .htm Brain Tumor 3. BRAIN TUMORS

An abnormal growth of tissue in the brain.

More than 17,000 brain tumors are diagnosed in the U.S. each year.

There are2classifications of brain tumors:

• 1. Benign Brain Tumors

• 2.Malignant Brain Tumors

4. Background

Estimated 18,400 primary malignant brain tumors will be diagnosed in 2004 10,540 in men & 7,860 in women.

Approximately 12,690 people will die from these tumors in 2004.

Accounts for1.4% of all cancers

Accounts for 2.4% of all cancerrelated deaths

5. BENIGN BRAIN TUMORS

Considered BENIGN if:

Its composed of non-cancerous cells

It has clearly defined borders

If its considered BENIGN:

It does not spread beyond the part of the brain where it originates

It can usually be completely removed

It is unlikely to recur

6. MALIGNANT BRAIN TUMORS

Do not have distinct borders

Tend to grow rapidly, increasing pressure in the brain

Can spread in the brain and spinal cord past where they originated

**Highly unusual for them to spread beyond theCENTRAL NERVOUS SYSTEM.

7. TYPES OF BRAIN TUMORS:

PRIMARY BRAIN TUMORS-

*Tumors that originate in theBRAIN

SECONDARY BRAIN TUMORS-

• *Tumors formed when cancer cells from another part of theBODYspread to the brain.

8. Symptoms

Tumors can effect any part of the brain and depending on what part(s) of the brain it affects can have a number of symptoms.

• Seizures

• Difficulty with language

• Mood changes

• Change of personality

• Changes in vision, hearing, and sensation.

• Difficulty with muscle movement

• Difficulty with coordination control

9. Glioma

In adults over 45 years of age 90% of all brain tumors are Gliomas

• Gliomas: A general category of cancer that includes astrocytomas, oligodendrogliomas, and ependymomas

10. Astrocytoma

Astrocytes brain cells abnormally dividing causing tumors called astrocytomas.

Astrocytes are glial cells that help nourish neurons they help repair damage

How the astroytomas are classified

• How close the cells are together within the tumor

• How abnormal the cells are

• How many of the cells are proliferating

• Whether or not there are blood vessels growing near the tumor

• Whether or not some of the cancer cells have degenerated or not

11. Oligodendrogliomas

These tumors start in mutated oligodendrocyte brain cells

Oligodendrocytes make myelin which help neurons transmit signals through the axons

These tumors may spread through cerebrospinal fluid pathways but typically do not usually spread to locations outside of the brain or spinal cord.

12. Ependymomas

Mutated ependymal cells

Ependymal cells line the ventricles in the central area of the brain and they line part of the pathway through which the cerebrospinal fluid travels

Theses mutated cells may block the cerebrospinal fluid from exiting the ventricles causing the ventricles to enlarge (hydrocephalus)

13. WHO GETS BRAIN TUMORS?

Brain tumors can develop at any age

Most common in:

• Children between the ages of 3-12

• Adults aged 55-65

• **MEN & CAUCASIONS ARE AT A HIGHER RISK OF DEVELOPING A BRAIN TUMOR

14. Bain Cancers in Adults

Adult brain cancers have been associated with organic solvents and pesticides and have been found inoccupational groups including farmers, firefighters, and health professionals who use preservatives such as formaldehyde. Hormonal factors may be involved in the development of meningioma, a predominantly female tumor

• • • (Kheifets, 2001).

15. Stem Cells in the Nervous System 16. Brain tumor stem cells were identified by intracranial transplantation ofCD133 +cells into adult NOD/SCID mouse forebrain. Singh et al. 2004 Nature 432: 396-401 CD133 + CD133 + CD133 - 17. CD133 neuronal stem cell marker Brain tumor stem cells were identified from human brain tumor samples byin vitroneurosphere assays normally used to isolate normal neural stem cells Singh et. al2003 Cancer Research 63: 5821-5828. GFAP = glial fibrillary acidic protein Brain Tumor Stem Cells: CD133 + 18. Risk Factors

Most brain cancers happen for reasons unknown, however some small risk factors are

• Radiation exposure

• Exposure to vinyl chloride

• Immune system disorders

19. Malignant neoplasms of the brain and central nervous system

second most common form of cancer in children (one sixth of their malignancies).

Recognized risk factors are

• high doses of ionizing radiation from such sources as radiotherapy and atomic bomb exposure,

• certain inherited and genetic conditions.

Results from some studies suggest that parental occupational exposure to ionizing radiation and substances encountered in the petroleum, chemical, and paper industries may increase brain cancer risk in children

• (Kheifets, 2001).

• Methodologies are inconsistent to draw conclusions and there is potential for biased data with reporting.

20. Electric and Magnetic Field Exposure and Brain Cancer

hypothesized that EMF promotes the progression of cancer rather than initiating carcinogenesis.

Malignant gliomas: glioblastoma and astrocytoma

These brain tumors account for a large proportion of brain cancers in children.

Epidemiologic evidence is weak, but the studies are full of confounders.

21. Environmental exposures Ionizing radiation N - nitrosocompounds Pesticides Tobacco Electromagnetic frequencies Infectious agents Trauma Parental occupation Medications Vitamins 22. Childhood Brain Tumors (CBT)

Brain tumors are the most common solid tumors in children.

The incidence of CBT increased by 29% between 1973 and 1994.

Exposure to farm animals and pets have been considered possible risk factors (bacteria, pesticides, solvents and some animal oncogenic viruses).

Maternal exposure to pigs has been associated with excess risk to primitive neuroectodermal tumors.

Diets high in nitrosamines and low in specific vitamins provide some leads into the aetiology of CBT although much remains unknown

• • • (Yeni-Komshian & Holly, 2000).

23. Childhood Cancers

Childhood Brain Tumors

IONIZING RADIATION

MATERNAL DIET

(cured meats)

PESTICIDES(paternal farm, forestry, residential)

SOLVENTS

HYDROCARBONS

(fathers in the petroleum or chemical industries)

24. Childhood Cancers

Sympathetic Nervous System

SMOKING AND ALCOHOL

(maternal)

PATERNAL OCCUPATIONAL EXPOSURES

Agricultural, pesticides, hydrocarbons, rubber, paint, dusts, electrical components.

25. Childhood Cancers

Neuroblastoma

SOLVENTS

(benzene, alcohols, lacquer thinner, turpentine, diesel fuel): paternal occupational

AROMATIC AND ALIPHATIC HYDROCARBONS : parental occupation

26. Susceptibility Refers to something that has responsiveness and sensitivity; susceptibility genes confer a higher than normal risk associated with some pathology. Source: http://www.niehs.nih.gov/engenom/glossary.htm Gene-Environment Interaction The interaction between specific environmental exposure(s) and a specific gene (or genes) and their subsequent impact on human health. 27. Few genetic studies exist on pediatric brain tumors, in part because tissue from low-grade and brain stem tumors is not readily available, and also because individual centers have relatively few cases.Genetic changes in infiltrating astrocytomas involve genes in the p53 and RB pathways, and show alterations that are similar to infiltrating astrocytomas in adults.The PTC gene is mutated in a subgroup of medulloblastomas, and may lead to increased proliferation in granule cells that normally express this receptor.Further studies are needed to identify genetic alterations in pilocytic and low-grade astrocytomas, which account for 40% of brain tumors in children. 28. The absence of the tumor suppressor gene p53 has been demonstrated to play a role in the development of brain tumors in mice exposed transplacentally to a neurocarcinogen. When p53 heterozygous pregnant mice were administered intraperitoneal injections of ENU, 70% of the p53 null offspring rapidly developed primary brain tumors of glial origin ( Odaet al., 1997 ). 29. Inactivation of the common tumor suppressor protein p53 is believed to contribute to brain carcinogenesis in human astrocytomas and glioblastomas ( Santariuset al., 1997 ;ShiraishiandTabuchi , 2003andZupanskaandKaminska , 2002 ).Approximately one-third of malignant pediatric gliomas have mutations of p53, and these mutations are much less common in individuals under the age of three ( ShiraishiandTabuchi , 2003 ).P53 gene mutations and increased expression of the p53 protein are associated with shorter survival in these patients. 30. It has been demonstrated that adult glioblastomas can have amplification of the epidermal growth factor receptor (EGFR), mdm2, cyclin-dependent kinase 4 (CDK4), and platelet-derived growth factor receptor (PDGFR) (Di Sapio et al., 1992). One histochemical evaluation of pediatric astrocytic gliomas showed a pattern, similar to adults, of mutually exclusive p53 mutation or (EGFR) amplification (Di Sapio et al., 1992). There was minimal or no amplification of the genes for PDGFR, mdm2, and CDK4.In another histochemical study, 80% of high-grade pediatric gliomas were found to have EGFR activity, but only 7% had gene amplification ( Bredelet al., 1999 ).In a similar study of pediatric high-grade astrocytoma (anaplastic astrocytoma and glioblastoma), investigators found p53 mutations in 53% of the tumors and EGFR amplification in none, a pattern that differs from adult malignancies and some of the other results reported ( Cheng et al., 1999 ). 31. In adult tumors, ependymomas are associated with a loss of 22q ( Santariuset al., 1997 ) and rarely with p53 mutations, but when present, altered p53 expression is only found in high-grade ependymomas ( ShiraishiandTabuchi , 2003 ).Neurofibromatosis (NF) is linked to alterations in the tumor suppressor NF 1 and 2 genes on chromosomes 17q and 22q, respectively ( Santariuset al., 1997 ).Mutations in the von Hippel Lindau disease gene located on 3p are found with hemangioblastomas ( Santariuset al., 1997 ). 32. L oss of 17p Material in Childhood CNStumours I sochromosome17q inMedulloblastoma L oss of 22q Material in Childhood CNStumours - ERBB2 and ChildhoodMedulloblastoma 17q11.2-q12ERBB2( HER2 , NEU )- ChildhoodGliomaand NF1 17q11.2NF1 - NTRK3 andMedulloblastoma 15q25NTRK3( TRKC )10q25.1NEURL( H-NEU )- PTEN andastrocytoma 10q23.3PTEN( MMAC1 , MHAM , BZS )- PTCH andMedulloblastoma 9q22.3PTCH( PTC )- MYC andMedulloblastoma 8q24.12-q24.13MYC( CMYC , C-MYC )- VIPR2 Expression in Childhood PNET 7q36.3VIPR2 - VIPR1 Expression in Childhood PNET 3p22VIPR1( RCD1 , HVR1 )- ERBB4 and ChildhoodMedulloblastoma 2q34ERBB4 - GLUT1 Expression inEmbryonalCNSTumours 1p35-p31.3SLC2A1( GLUT1 )Topics Location Gene Mutated Genes and Abnormal Protein Expression 33. http://www.ehponline.org/members/2005/7986/7986.html The enzyme-aminolevulinic acid dehydratase (ALAD) , which catalyzes the second step of heme synthesis, can be inhibited by several chemicals, including lead, a potential risk factor for brain tumors, particularly meningioma. In this study we examined whether theALAD G177Cpolymorphism in the gene coding for ALAD is associated with risk of intracranial tumors of the brain and nervous system. We use data from a case-control study with 782 incident brain tumor cases and 799 controls frequency matched on hospital, age, sex, race/ethnicity, and residential proximity to the hospital. Blood samples were drawn and DNA subsequently sent for genotyping for 73% of subjects.ALADgenotype was determined for 94% of these samples (355 glioma, 151 meningioma, 67 acoustic neuroma, and 505 controls) . Having one or more copy of theALAD2allele was associated with increased risk for meningioma [odds ratio (OR) = 1.6 ; 95% confidence interval (CI) , 1.0-2.6], with the association appearing stronger in males (OR = 3.5 ; 95% CI, 1.3-9.2) than in females (OR = 1.2 ; 95% CI, 0.7-2.2) . No increased risk associated with theALAD2variant was observed for glioma or acoustic neuroma. These findings suggest that theALAD2allele may increase genetic susceptibility to meningioma.Key words: ALAD ,brain ,case-control ,meningioma ,polymorphism ,tumor .Environ Health Perspect113:1209-1211 (2005) . doi:10.1289/ehp.7986 available viahttp:// dx.doi.org /[Online 10 May 2005] 34. They found that theALAD2allele of the G177C polymorphism was associated with increased risk of meningioma, especially in males. Confirmation of their findings will require replication in other studies with a larger number of meningioma cases. If risk of meningioma is truly increased in individuals with theALAD2allele, the question arises as to whether the effect depends upon exogenous chemical exposures that act on the heme synthesis pathway or is independent of such exposures. A direct effect of theALAD2polymorphism might be indicated if theALAD2allele has lower enzyme activity than theALAD1allele, given that the precursor ALA is thought to be neurotoxic and genotoxic (Silbergeld 2003). However, ALAD enzyme activity does not appear significantly different for the two alleles (Battistuzzi et al. 1981). Alternatively, it is possible that the increased risk of meningioma inALAD2individuals arises in the presence of chemicals that influence the heme synthesis pathway. Several chemicals have been shown to inhibit ALAD enzyme activity, including lead, trichloroethylene, bromobenzene, and styrene (Fujita et al. 2002). Polymorphic differences in enzyme binding or chemical uptake have been examined most extensively for lead, and individuals with theALAD2allele are generally reported to have higher blood lead levels than are individuals with theALAD1allele (Alexander et al. 1998; Bergdahl et al. 1997; Fleming et al. 1998; Hsieh et al. 2000; Shen et al. 2001; Wetmur et al. 1991; Ziemsen et al. 1986). 35. Probe1 (TGTGAAGCGGCTGG), specific to theALAD1allele, contained the FAM dye reporter. Probe 2 (TGTGAACCGGCTGG) was specific to theALAD2allele and contained the VIC dye reporter. The primers used were primers F (TGCCTTCCTTCAACCCCTCTA) and R (CAAGGGCCTCAGCATCTCTT). Step 1 of the assay-specific thermocycling process involved 2 min of UNG (uracil-DNA glycosylase) activation using AmpErase UNG (Applied Biosystems) at 50C. This was followed by 10 min of enzyme activation at 95C (step 2), 0.30 sec of template denaturation at 92C if using 3MGB quencher, or at 95C if using 3TAMRA quencher (step 3), and 1 min of assay-specific annealing at 60C (step 4). Steps 3 and 4 were repeated 49 times, after which the reaction was held at 4C. The plate was then read on the ABI 7900HT sequence detection system (Applied Biosystems), and the results of the allelic discrimination were graphed as a scatter plot of allele 1 reaction versus allele 2 reaction (SDS Software; Applied Biosystems), with each well of the 384-well plate represented as a spot on the graph. Four distinct clusters on the allelic plot represented the NTCs and three possible genotypes,ALAD1-1 ,ALAD2-2,andALAD1-2 , respectively. 36. Four distinct clusters on the allelic plot represented the NTCs and three possible genotypes,ALAD1-1 ,ALAD2-2,andALAD1-2 , respectively.Using a conservative call strategy that labeled a call as missing if the genotype was unclear,ALADgenotyping was successfully conducted for 94% of samples (93% of gliomas, 96% of meningiomas, 94% of acoustic neuromas, and 94% of controls). Missing values (noncalls) were generally equally likely to be from case or control samples. 37. Statistical analysis.We assessed statistically significant departure from Hardy-Weinberg equilibrium for controls using the chi-square test. Unconditional logistic regression was used to estimate odds ratios (ORs) and calculate 95% confidence intervals (CIs) for the effect of the variantALAD2allele, adjusting for study matching factors. We entered adjustment variables as indicator variables in the following categories: age in years (18-29, 30-39, 40-49, 50-59, 60-69, 70-79, 80-99); race/ethnicity (non-Hispanic white, Hispanic, African-American, other); sex (male, female); hospital (Phoenix, Boston, Pittsburgh); and residential proximity to the hospital in miles (0-4, 5-14, 15-29, 30-49, 50). Because the small number ofALAD2-2homozygotes precluded accurate estimation of risk forALAD1-2heterozygotes andALAD2-2homozygotes separately, these categories were combined for analysis.ALAD1-1homozygotes were the reference group. 38. 39. 40. Glutathione S-transferases GSTM1, GSTT1, and GSTP1 are phase II biotransformation enzymes that function on detoxification of a wide range of exogenous agents including carcinogens. In this study, the association between polymorphisms in these genes and primary brain tumor incidence was investigated in 228 Turkish individuals (75 patients with primary brain tumor and 153 controls). The prevalence of GSTM1 null genotype in the case group was 43%, compared to 24% in the control group, giving an odds ratio (OR) of 2.33 (95% confidence interval CI=1.24-4.39). No association was observed between the GSTT1 or GSTP1 Ile105Val polymorphism and brain tumor incidence. Polymorphisms in GSTM1, GSTT1, and GSTP1 did not show association with histopathologic type of brain tumor (glioma or meningioma). Analysis of the polymorphisms in the studied genes and smoking status of the brain tumor patients revealed no statistically significant association. The presented data clearly suggest a relation between brain tumor incidence with GSTM1 null genotype but not with GSTT1 or GSTP1 gene variants. 41. Population-based study of glutathione S-transferase mu gene deletion in adult glioma cases and controls. Carcinogenesis. 1997 Jul;18(7):1431-3Gene deletion at the glutathione S-transferase mu locus (GSTM1) has previously been associated with increased risk for environmentally-induced cancers (e.g. smoking-related lung cancer). Authors compared the prevalence of the GSTM1 homozygous deletion polymorphism in 158 Caucasian adults with gliomas with 157 controls. Cases and controls were drawn from a large population-based case-control study of brain cancers in six San Francisco Bay area counties. Overall, the prevalence of the GSTM1 deletion was similar in cases (83/158; 53%) and controls (78/157; 50%). Among brain tumor cases, analysis of variance modeling indicated a significant interaction of GSTM1 genotype and gender associated with age at diagnosis (P = 0.02). This effect was due to the fact that women with GSTM1 deletion were younger on average at diagnosis than women who were GSTM1 positive (43.9 years versus 52.4 years, respectively). Age at diagnosis among men was similar for those who were GSTM1 deleted and GSTM1 positive (49.4 years and 47.2 years, respectively). The younger age at diagnosis of GSTM1 null female cases compared with GSTM1 positive cases was observed in astrocytoma as well as the higher grade tumors (e.g. glioblastoma multiforme).