snp’s: which method is best for your study?. snp detection methods available in the dna analysis...
TRANSCRIPT
SNP’s: Which SNP’s: Which Method is Best Method is Best for Your Study?for Your Study?
SNP Detection Methods SNP Detection Methods available in theavailable in the
DNA Analysis Facility DNA Analysis Facility
SequenceSequence SNaPshotSNaPshot Allelic Discrimination AssayAllelic Discrimination Assay DHLPCDHLPC SNPlexSNPlex
Joint RG Study
Unfortunately, little information is available regarding the specific advantages and limitations of even the most routinely used mutation detection techniques. The primary goal is to compare operational parameters for the most popular mutation/polymorphism screening methods.
In the first year of this joint proposal, we will conduct a pilot study engaging only members of the participating research groups: DSRG, FARG and NARG.
This pilot study will allow us to refine the survey design and prepare a broader based study for year 2 directed at the greater scientific community.
Sequencing MethodologySequencing Methodology
Your Lab:Your Lab: gDNA extractiongDNA extraction PCR amplification of region of interestPCR amplification of region of interest
DNA Analysis FacilityDNA Analysis FacilityCycle Sequence Reaction Sequence Run
Sequencing: Data Sequencing: Data AnalysisAnalysisTYMS SNP: TYMS SNP:
AAGTTTTTACACTTT(C/T)ATTTCTCTGTGAAGTTTTTACACTTT(C/T)ATTTCTCTGTGGCTGCT
Sequencing: Data Sequencing: Data AnalysisAnalysis
Observed Mixed Ratios of Observed Mixed Ratios of Heterozygous peaksHeterozygous peaks
Sequence Data AnalysisSequence Data AnalysisConfirmed Mixed Ratios of Confirmed Mixed Ratios of
Heterozygous peaksHeterozygous peaks
Joint RG Data: Joint RG Data: SequencingSequencing
Sample Sample ##
ForwardForward ReverseReverse
11 GG CC
22 GG CC
33 GG CC
44 GG CC
55 G/AG/A C/TC/T
66 GG CC
77 G/AG/A C/TC/T
88 G/AG/A C/TC/T
99 GG CC
1010 G/AG/A C/TC/T
1111 G/AG/A C/TC/T
1212 G/AG/A C/TC/T
TNF
GAGGGGCATG(A/G)GGACG
G
Joint RG Data: Joint RG Data: SequencingSequencing
AR SNP: AR SNP:
Forward sequence slips on CAG Forward sequence slips on CAG repeatrepeat
Joint RG Study Joint RG Study Sequence Data ComparisonSequence Data Comparison
TYMS, MTHFR, and TNF SNP’sTYMS, MTHFR, and TNF SNP’s 32/36 calls matched the true sample identity.32/36 calls matched the true sample identity.
Of the four calls missed:Of the four calls missed: 3 calls missed the 23 calls missed the 2ndnd allele when it was at allele when it was at
5%.5%. 1 call missed the 21 call missed the 2ndnd allele when it was at allele when it was at
12.5%.12.5%.
AR SNPAR SNP 12/12 calls matched the true sample identity 12/12 calls matched the true sample identity
in Reverse direction only.in Reverse direction only.
Sequence SummarySequence Summary
SequenceSequence
MultiplexMultiplex LimitedLimited
ThroughputThroughput MediumMedium
Advantages: well established technology, easy sample preparation, and can easily get confirmation from 2nd strand.Disadvantages: Some problems with sequence context, only limited ability to multiplex SNP’s.
SNaPshot MethodologySNaPshot MethodologyYour Lab:Your Lab:
gDNA extractiongDNA extraction PCR amplificationPCR amplification Purify PCR productPurify PCR product SNaPshot ReactionSNaPshot Reaction SAP treatment SAP treatment
DNA Analysis FacilityDNA Analysis Facility Add size standard and perform Genescan Add size standard and perform Genescan
RunRun
SNaPshot AnalysisSNaPshot AnalysisLiz 120 Size StandardLiz 120 Size Standard
Joint RG Data: SNapShotJoint RG Data: SNapShot
Joint RG Study Joint RG Study SNaPshot Data ComparisonSNaPshot Data Comparison
TYMS, MTHFR, TNF and AR SNP’sTYMS, MTHFR, TNF and AR SNP’s 44/48 calls matched the true sample 44/48 calls matched the true sample
identity.identity.
Of the 4 calls missed:Of the 4 calls missed: 3 calls missed the 23 calls missed the 2ndnd allele when it was allele when it was
at 5%.at 5%. 1 call missed the 21 call missed the 2ndnd allele when it was at allele when it was at
12.5%.12.5%.
SNaPshot SummarySNaPshot Summary
SequenceSequence SNaPshotSNaPshot
MultiplexMultiplex LimitedLimited Yes, 7-10 Yes, 7-10 SNP’sSNP’s
ThroughputThroughput MediumMedium MediumMedium
Advantages: this system is designed for multiplexing and you have two options: multiplex the SNaPshot reaction or pooled separate reactions.
Disadvantages: primers need to be specifically designed, primers >30bp need to be HPLC purified, optimization of the SNaPshot reaction can take time.
Real-time qPCR MethodReal-time qPCR Method
Allelic Discrimination Assay Allelic Discrimination Assay MethodologyMethodology
Your Lab:Your Lab: gDNA extractiongDNA extraction PCR amplification with 2 dual-labelled probesPCR amplification with 2 dual-labelled probes
DNA Analysis FacilityDNA Analysis Facility Perform End point plate read and Analysis Perform End point plate read and Analysis
Allelic Discrimination Allelic Discrimination Assay:Assay:
Data AnalysisData Analysis
Joint RG DataJoint RG Data
Joint RG DataJoint RG Data
Joint RG DataJoint RG Data
Joint RG DataJoint RG Data
Joint RG DataJoint RG Data
Joint RG DataJoint RG Data
Joint RG Study Joint RG Study ADA Data ComparisonADA Data Comparison
TYMS and MTHFR (both alleles represented)TYMS and MTHFR (both alleles represented) 19/24 calls matched the true sample identity.19/24 calls matched the true sample identity.
Of the 5 calls that were missed:Of the 5 calls that were missed: 2 calls missed the 22 calls missed the 2ndnd allele when it was at 5%. allele when it was at 5%. 2 calls missed the 22 calls missed the 2ndnd allele when it was at 12.5%. allele when it was at 12.5%. 1 call missed the 21 call missed the 2ndnd allele when it was at 25%. allele when it was at 25%.
TNF and AR SNP’s (no 2TNF and AR SNP’s (no 2ndnd allele present) allele present) 16/24 calls matched the true sample identity. 16/24 calls matched the true sample identity. 8 heterozygous samples were miscalled as 8 heterozygous samples were miscalled as
homozygous.homozygous.
Allelic Discrimination Allelic Discrimination Assay:Assay:
SummarySummary
SequencSequencee
SNaPshoSNaPshott
ADAADA
MultipleMultiplexx
LimitedLimited Yes, Yes,
7-10 7-10 SNP’sSNP’s
NoNo
ThroughThroughputput
MediumMedium MediumMedium HighHigh
Advantages: ABI has a huge collection of pre-designed SNP assays so little optimization is needed.
Disadvantages: can’t multiplex.
DHPLC MethodolgyDHPLC MethodolgyYour LabYour Lab
gDNA extractiongDNA extraction Design specific primersDesign specific primers PCR amplification PCR amplification
DNA Analysis FacilityDNA Analysis FacilityRun sample on Transgenomic Wave Run sample on Transgenomic Wave
DHPLC Data AnalysisDHPLC Data Analysis
Joint RG DataJoint RG DataMTHFR SNP
Joint RG DataJoint RG DataAR SNP was unable to be
interpreted.
Joint RG Study Joint RG Study DHPLC Data ComparisonDHPLC Data Comparison
TYMS and MTHFR SNP’sTYMS and MTHFR SNP’s 19/24 calls matched the true sample identity.19/24 calls matched the true sample identity.
Of the 5 missed calls:Of the 5 missed calls: 2 calls missed the 22 calls missed the 2ndnd allele when it was at allele when it was at
5%.5%. 2 calls missed the 22 calls missed the 2ndnd allele when it was at allele when it was at
12.5%12.5% 1 sample was a low signal.1 sample was a low signal.
AR and TNF SNP’sAR and TNF SNP’s AR: all calls undeterminedAR: all calls undetermined TNF: couldn’t design suitable primersTNF: couldn’t design suitable primers
DHPLC SummaryDHPLC Summary
SequencSequencee
SNaPshotSNaPshot ADAADA DHPLCDHPLC
MuliplexMuliplex LimitedLimited Yes,Yes,
7-10 7-10 SNP’sSNP’s
NoNo NoNo
ThroughpuThroughputt
MediumMedium MediumMedium HighHigh HighHigh
Advantages: high throughput screening method
Disadvantages: can only distinguish heterozygous from homozygous with no ability to make actual base calls, some sequence parameters can make primer design difficult.
SNPlex MethodologySNPlex Methodology
SNP’s: Which Method is SNP’s: Which Method is Best for Your Study?Best for Your Study?
SequenceSequence SNaPshotSNaPshot ADAADA DHPLCDHPLC SNPlexSNPlex
MultiplexMultiplex LimitedLimited Yes,Yes,
7-10 7-10 SNP’sSNP’s
NoNo NoNo Yes,Yes,
48 SNP’s48 SNP’s
ThroughpThroughputut
MediumMedium MediumMedium HighHigh HighHigh HighHigh
How many SNP’s?How many SNP’s?How many samples?How many samples?
DNA Analysis FacilityDNA Analysis Facility
The facility provides:The facility provides: Consultations on Consultations on
assay selection.assay selection. Comprehensive Comprehensive
support for assay support for assay design.design.
Fast and inexpensive Fast and inexpensive sample processing.sample processing.
Comprehensive Comprehensive support for data support for data analysis.analysis.