software and databases for managing and selecting molecular markers general introduction
DESCRIPTION
Software and Databases for managing and selecting molecular markers General introduction Pathway approach for candidate gene identification and introduction to metabolic pathway databases. Identification of polymorphisms in data-based sequences. Databases (General and Crop Specific) - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/1.jpg)
Software and Databases for managing and selecting molecular markers
General introduction
Pathway approach for candidate gene identification and introduction to metabolic pathway databases.
Identification of polymorphisms in data-based sequences
![Page 2: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/2.jpg)
Databases (General and Crop Specific)
Germplasm GRIN: http://www.ars-grin.gov/npgs/ TGRC: http://tgrc.ucdavis.edu/
Sequence NCBI: http://www.ncbi.nlm.nih.gov/ SGN: http://solgenomics.net/
Metabolic PlantCyc: http://www.plantcyc.org:1555/PLANT/server.html?
![Page 3: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/3.jpg)
New format to NCBI
![Page 4: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/4.jpg)
Access current and past scientific lit.
![Page 5: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/5.jpg)
Increased emphasis on phenotypic data
![Page 6: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/6.jpg)
Germplasm databases
![Page 7: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/7.jpg)
![Page 8: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/8.jpg)
![Page 9: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/9.jpg)
Crop specific germplasm resources
![Page 10: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/10.jpg)
Example: QTL for color uniformity in elite crosses
QTL Trait Origin
2 L, YSD S. lyc.
4 YSD S. lyc.
6 L, Hue ogc
7 L, Hue S. hab.
11 L, Hue S. lyc.Audrey Darrigues, Eileen Kabelka
![Page 11: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/11.jpg)
Carotenoid Biosynthesis: Candidate pathway for genes that affect color and color uniformity.
Disclaimer: this is not the only candidate pathway…
![Page 12: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/12.jpg)
http://www.arabidopsis.org/help/tutorials/aracyc_intro.jsp
Databases that link pathways to genes
![Page 13: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/13.jpg)
http://metacyc.org/
http://www.plantcyc.org/
http://sgn.cornell.edu/tools/solcyc/
http://www.arabidopsis.org/biocyc/index.jsp
http://www.arabidopsis.org/help/tutorials/aracyc_intro.jsp
External Plant Metabolic databasesCapCyc (Pepper) (C. anuum) CoffeaCyc (Coffee) (C. canephora) SolCyc (Tomato) (S. lycopersicum) NicotianaCyc (Tobacco) (N. tabacum) PetuniaCyc (Petunia) (P. hybrida) PotatoCyc (Potato) (S. tuberosum)
SolaCyc (Eggplant) (S. melongena)
Databases that link pathways to genes
![Page 14: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/14.jpg)
http://www.plantcyc.org:1555/
![Page 15: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/15.jpg)
![Page 16: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/16.jpg)
![Page 17: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/17.jpg)
Note: missing step (lycopene isomerase, tangerine)
![Page 18: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/18.jpg)
![Page 19: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/19.jpg)
Check boxes (Note: MetaCyc has many more choices, but no plants)
![Page 20: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/20.jpg)
![Page 21: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/21.jpg)
![Page 22: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/22.jpg)
![Page 23: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/23.jpg)
Scroll down page
Capsicum annum sequence retrieved
![Page 24: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/24.jpg)
![Page 25: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/25.jpg)
http://www.ncbi.nlm.nih.gov/
![Page 26: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/26.jpg)
Select database
![Page 27: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/27.jpg)
![Page 28: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/28.jpg)
Query CCACCACCATCCTCACTTTAACCCACAAATCCCACTTTCTTTGGCCTAATTAACAATTTT |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct CCACCACCATCCTCACTTTAACCCACAAATCCCATTTTCTTTGGCCTAATTAACAATTTT
Zeaxanthin epoxidase
Probable location on Chromosome 2
Alignment of Z83835 and EF581828 reveals 5 SNPs over ~2000 bp
![Page 29: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/29.jpg)
51 annotated loci
![Page 30: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/30.jpg)
Information missing from other databases is here…
Candidates identified in other databases are here
![Page 31: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/31.jpg)
![Page 32: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/32.jpg)
Comment on the databases:
Information is not always complete/up to date.
Display is not always optimal, and several steps may be needed to go from pathway > gene > potential marker.
Sequence data has error associated with it. eSNPs are not the same as validated markers.
Germplasm data may also have error (e.g. PI 128216)
There is a wealth of information organized and available.
![Page 33: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/33.jpg)
The previous example detailed how we might identify sequence based markers for trait selection.
Query CCACCACCATCCTCACTTTAACCCACAAATCCCACTTTCTTTGGCCTAATTAACAATTTT |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct CCACCACCATCCTCACTTTAACCCACAAATCCCATTTTCTTTGGCCTAATTAACAATTTT
Improving efficiency of selection in terms of 1) relative efficiency of selection, 2) time, 3) gain under selection and 4) cost will benefit from markers for both forward and background selection.
Remainder of Presentation will focus onWhere to apply markers in a programForward and background selectionMarker resourcesAlternative population structures and size
![Page 34: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/34.jpg)
Relative efficiency of selection: r(gen) x {Hi/Hd}
Line performance over locations > MAS > Single plant
Line-mean heritability (H) for color H H
Trait plant SE line SE Prop Vp SEBRIX 0.14 0.09 0.40 0.26Color-L 0.11 0.04 0.57 0.22 L-MAS 0.25 0.15Color-Hue 0.07 0.04 0.39 0.23 Hue-MAS 0.15 0.06Color unif. -L 0.14 0.11 0.63 0.25 Ldiff-MAS 0.28 0.16Color unif. -Hue 0.13 0.10 0.64 0.23 Hdiff-MAS 0.32 0.14
Indirect Selection
Comparison of direct selection with indirect selection (MAS).
![Page 35: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/35.jpg)
F1 50:50
BC1 75:25
BC2 87.5:12.5
BC3 93.75:6.25
BC4 96.875:3.125
Expected proportion of Recurrent Parent (RP) genome in BC progeny
Accelerating Backcross Selection
![Page 36: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/36.jpg)
Select for target allele
Select for RP genome at unlinked markers
Select for target allele
Select for RP recombinants at flanking markers
Select for RP genome at unlinked markers
Select for target allele
Select for RP recombinants at flanking markers
Select for RP genome on carrier chromosome
Select for RP genome at unlinked markers
Four-stage selection
Two-stage selection
Three-stage selection
References:
Frisch, M., M. Bohn, and A.E. Melchinger. 1999. Comparison of Selection Strategies for Marker-Assisted Backcrossing of a Gene. Crop Science 39: 1295-1301.
![Page 37: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/37.jpg)
Progeny needed for Background Selection During MAS
20 40 60 80 100 125 150 200Two-StageBC1 76.7 78.7 79.7 80.3 80.7 81.3 81.7 82.2BC2 90.3 91.9 92.8 93.3 93.6 93.9 94.0 94.6BC3 95.8 96.2 97.1 97.3 97.4 97.5 97.6 97.8Three-StageBC1 71.2 72.7 73.4 73.6 73.3 73.2 72.8 72.2BC2 86.1 87.2 88.5 89.3 90.2 90.7 91.3 91.8BC3 94.4 95.7 96.5 96.9 97.2 97.3 97.5 97.6
Q10 of RP genome in percentPopulation Size
Q10 indicates a 90% probability of success
From Frisch et al., 1999.
![Page 38: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/38.jpg)
Two-Stage Selection 60 80 100 125BC1 2880 3840 4800 6000BC2 900 1164 1416 1716BC3 228 264 300 348
Total Marker points 4008 5268 6516 8064Cost 0.15 601.2 790.2 977.4 1209.6
0.20 801.6 1053.6 1303.2 1612.80.25 1002.0 1317.0 1629.0 2016.0
Three-Stage SelectionBC1 2880 3840 4800 6000BC2 492 708 960 1308BC3 250 444 504 576
Total Marker points 3622 4992 6264 7884Cost 0.15 543.3 748.8 939.6 1182.6
0.20 724.4 998.4 1252.8 1576.80.25 905.5 1248.0 1566.0 1971.0
Population Size
Marker Data Points required (Modified from Frisch et al., 1999; based on assumption of 12 chromosomes; initial selection with 4 markers/chromosome)
![Page 39: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/39.jpg)
For effective background selection we need:
Markers for our target locus (C > T SNP for Zep)
Markers on the target chromosome (Chrom. 2)
Markers unlinked to the target chromosome (~2 per chromosome arm)
![Page 40: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/40.jpg)
http://www.tomatomap.net
http://sgn.cornell.edu/
![Page 41: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/41.jpg)
Ovate
![Page 42: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/42.jpg)
![Page 43: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/43.jpg)
HBa0104A12
![Page 44: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/44.jpg)
![Page 45: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/45.jpg)
![Page 46: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/46.jpg)
55 polymorphic markers
44 polymorphic markers
![Page 47: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/47.jpg)
Where can we expect to be?
n = 1 n = 2 n = 3 n = 4 n = 5-10 n > 10Total 806 596 106 34 22 38 10
n = 1 n = 2 n = 3 n = 4 n = 5-10 n > 10Total 127 not tested 64 22 11 23 7
Proportion 0.16 0.60 0.65 0.50 0.61 0.70
TA496 ESTs with SNPs VS H1706 BAC sequences
Where EST Coverage = Allele Coverage
Data based on estimated ~42% of sequence, therefore expect as many as 300 markers for a cross like E6203 x H1706
analysis by Buell et al., unpublished
![Page 48: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/48.jpg)
DOS
UNIX
CygWin (Unix emulator)
BLAST
BLAST
BioPerl
Perl
BioPerl
Perl
Cyc
NCBI
When is the time to move from reliance on public databases to in house pipelines?
In-house database
![Page 49: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/49.jpg)
![Page 50: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/50.jpg)
Complete genome sequences are available for:
Soybean, Corn, Potato, Tomato, Cucumber, and more are coming….
![Page 51: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/51.jpg)
DOS
UNIX
CygWin (Unix emulator)
BLAST
BLAST
BioPerl
Perl
BioPerl
Perl
Cyc
NCBI
When is the time to move from reliance on public databases to in house pipelines?
In-house database
![Page 52: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/52.jpg)
QTL’s mapped in a bi-parental cross may not be appropriate for MAS in all populations…
Marker allele and trait may not be linked in all populations.
Genetic background effects may be population specific.
Original association may be spurious.
QTL detection is dependent on magnitude of the difference between alleles and the variance within marker classes.
Confirmation of phenotype along the way is very important!
![Page 53: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/53.jpg)
Take home messages:
Marker resources exist for forward and background selection in elite x elite crosses in tomato.
Marker resources are currently not sufficient for QTL discovery in bi-parental or AM populations; they will soon be.
The best time to use genetic markers : early generation selection
Restructuring of breeding program to integrate markers may include: 1) Increasing genotypic replication (population size) at the expense of replication (consider augmented designs). 2) Collecting objective data.
![Page 54: Software and Databases for managing and selecting molecular markers General introduction](https://reader030.vdocument.in/reader030/viewer/2022021401/5681451c550346895db1ddeb/html5/thumbnails/54.jpg)
References:
Kaepler, 1997. TAG 95:618-621.
Frisch, et al., 1999. Crop Science 39: 1295-1301.
Knapp and Bridges, 1990. Genetics 126: 769-777.
Yu et al., 2006. Nature Genetics 38:203-308.
Van Deynze et al., 2007. BMC Genomics 8:465www.biomedcentral.com/content/pdf/1471-2164-8-465.pdf