soluble form of t cell ig mucin 3 is an inhibitory molecule in t cell
TRANSCRIPT
of February 16, 2018.This information is current as
Immune ResponseInhibitory Molecule in T Cell-Mediated Soluble Form of T Cell Ig Mucin 3 Is an
Han-Gang Zhu, Han Xiao, Ling-Fei Han and Zuo-Hua FengHui Geng, Gui-Mei Zhang, Dong Li, Hui Zhang, Ye Yuan,
http://www.jimmunol.org/content/176/3/1411doi: 10.4049/jimmunol.176.3.1411
2006; 176:1411-1420; ;J Immunol
Referenceshttp://www.jimmunol.org/content/176/3/1411.full#ref-list-1
, 16 of which you can access for free at: cites 38 articlesThis article
average*
4 weeks from acceptance to publicationFast Publication! •
Every submission reviewed by practicing scientistsNo Triage! •
from submission to initial decisionRapid Reviews! 30 days* •
Submit online. ?The JIWhy
Subscriptionhttp://jimmunol.org/subscription
is online at: The Journal of ImmunologyInformation about subscribing to
Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:
Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:
Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2006 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,
is published twice each month byThe Journal of Immunology
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from
by guest on February 16, 2018
http://ww
w.jim
munol.org/
Dow
nloaded from
Soluble Form of T Cell Ig Mucin 3 Is an Inhibitory Moleculein T Cell-Mediated Immune Response1
Hui Geng, Gui-Mei Zhang,2 Dong Li, Hui Zhang, Ye Yuan, Han-Gang Zhu, Han Xiao,Ling-Fei Han, and Zuo-Hua Feng2
T cell Ig mucin 3 (Tim-3) has been found to play an important role in Th1-mediated auto- and alloimmune responses, but thefunction of soluble form of Tim-3 (sTim-3) remains to be elucidated. In this study, we report the inhibitory effect of sTim-3 on Tcell-mediated immune response. In this study, sTim-3 mRNA was found, among different tissues and organs, only in splenic cells,and the activation of splenocytes resulted in up-regulated production of both sTim-3 mRNA and protein. We constructed aeukaryotic expression plasmid, psTim-3, which expresses functional murine sTim-3. In C57BL/6 mice inoculated with B16F1melanoma cells, the growth of tumor was facilitated by the expression of this plasmid in vivo. Furthermore, sTim-3 inhibited theresponses of T cells to Ag-specific stimulation or anti-CD3 mAb plus anti-CD28 mAb costimulation and the production of cytokinesIL-2 and IFN-� in vitro. In tumor rejection model, sTim-3 significantly impaired T cell antitumor immunity, evidenced bydecreased antitumor CTL activity and reduced amount of tumor-infiltrating lymphocytes in tumor. Real-time PCR analysis ofgene expression in tumor microenvironment revealed the decreased expression of Th1 cytokine genes and the unchanged profileof the genes related to T regulatory cell function, suggesting that the inhibitory effect of sTim-3 on the generation of Ag-specificT cells in vivo is dominated by T effector cells rather than T regulatory cells. Our studies thus define sTim-3 as an immunoregu-latory molecule that may be involved in the negative regulation of T cell-mediated immune response. The Journal of Immunology,2006, 176: 1411–1420.
T he search for cell surface markers that can distinguish Th1from Th2 cells has led to the identification of a new genefamily: T cell Ig- and mucin domain-containing molecule
(TIM)3 family. The genes in this family are expressed in T cellsand encode the proteins containing an Ig V-like domain and amucin-like domain. To date, the TIM family consists of eightmembers in mice and three in humans, which might have impor-tant immunological function and biological effects (1–5). Amongthe members in this family, T cell Ig mucin 3 (Tim-3), which wasidentified as a negative regulator of immune responses, recentlyattracted much attention because of its important function in theregulation of immune-mediated disease (6–8). Previous study onTim-3 indicated the importance of Tim-3 ligand (Tim-3L) pathwayin the generation of T regulatory cells (Treg cells) and the limitedexpansion of Th1 cell populations. Treatment with anti-Tim-3mAb exacerbated the Th1-dependent autoimmune disease experi-mental autoimmune encephalomyelitis (6). In addition, the admin-istration of a soluble fusion protein, Tim-3-Ig, abrogated the in-
duction of peripheral tolerance. Based on these observations,Tim-3 was supposed to limit the expansion of Th1 cell populationsand contribute to the induction of tolerance in effector Th1 cells (7,8).
It was found that Tim-3 mRNA could be alternatively spliced toproduce two mRNA molecules. The longer one directs the syn-thesis of Tim-3 (i.e., full-length Tim-3), a type I transmembraneprotein that is preferentially expressed on differentiated Th1 cellsand has been identified as a cell surface marker distinguishingbetween Th1 and Th2 cells. The shorter one, without the regionencoding the mucin domain and transmembrane domain, was sup-posed to direct the synthesis of a splice variant of Tim-3. It wassupposed that the isoform of Tim-3 translated from the shorterTim-3 mRNA should be a soluble molecule (sTim-3), which, how-ever, has not been identified yet.
Many costimulatory molecules and immunoregulatory recep-tors, such as CD86, Fas, and CTLA-4, have native soluble mole-cules, and these soluble variants are important in controlling im-mune response as well as in susceptibility and resistance toautoimmune disease (9–11). The discovery of sTim-3 raised theissue of its function in regulating immune responses. Based on theobservation of Tim-3-Ig fusion proteins causing hyperproliferationof Th1 cells and inhibiting the generation of Treg cells, sTim-3was speculated to block the inhibitory effect of Tim-3, and pro-mote the expansion and differentiation of Th1 cell population (7,8). However, it has not been proved whether sTim-3-Ig reallymimicked the function of native sTim-3. To date, it is still not clearwhen sTim-3 is made during lymphocyte differentiation and whatits function might be. In this study, we provided the evidence forthe expression pattern of sTim-3 mRNA and the existence ofsTim-3 as a soluble molecule produced by the activated spleniclymphocytes. We constructed a recombinant expression plasmidencoding murine sTim-3, and investigated the effect of the ex-pressed product on T cell response in vivo and in vitro. sTim-3
Department of Biochemistry & Molecular Biology, Tongji Medical College, Hua-zhong University of Science & Technology, Wuhan, The People’s Republic of China
Received for publication July 6, 2005. Accepted for publication November 10, 2005.
The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by National Development Program (973) for Key BasicResearch (2002CB513100) of China and the National Natural Science Foundation ofChina (30471587).2 Address correspondence and reprint requests to Prof. Zuo-Hua Feng or Prof. Gui-MeiZhang, Department of Biochemistry & Molecular Biology, Tongji Medical College, Hua-zhong University of Science & Technology, Wuhan 430030, The People’s Republic ofChina. E-mail address: [email protected]; [email protected] Abbreviations used in this paper: TIM, T cell Ig- and mucin domain-containingmolecule; CHO, Chinese hamster ovary; DC, dendritic cell; Foxp3, forkhead tran-scription factor 3; HSP, heat shock protein; sTim-3, soluble form of T cell Ig mucin3; Tim-3, T cell Ig mucin 3; Tim-3L, Tim-3 ligand; Treg, T regulatory.
The Journal of Immunology
Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from
could inhibit T cell response to Ag-specific stimulation oranti-CD3 mAb plus anti-CD28 mAb costimulation in vitro. Theexpression of the plasmid encoding sTim-3 in vivo significantlyfacilitated the growth of tumor by impairing T cell-mediated an-titumor immunity.
Materials and MethodsAnimals and cell lines
Female C57BL/6 and BALB/c mice, 6–8 wk old, were purchased from theCenter of Experimental Animals of Chinese Academy of Medical Scienceand Center of Medical Experimental Animals of Hubei Province, respec-tively. The animals were maintained in our facilities under pathogen-freeconditions. All studies involving mice were approved by the HuazhongUniversity of Science and Technology Animal Care and Use Committee.Chinese hamster ovary cell line (CHO), murine melanoma B16F1 cell line,and murine H22 cell line were purchased from the China Center for TypeCulture Collection, and cultured in DMEM supplemented with 10% FCS,10 mM HEPES, 2 mM L-glutamine, 100 mg/ml penicillin, and 100 U/mlstreptomycin. All cell culture reagents were obtained from Invitrogen LifeTechnologies.
Abs, cytokines, and reagents
Goat anti-mouse Tim-3 Ab was purchased from R&D Systems; hamsteranti-mouse-CD3 Ab was obtained from eBioscience. HRP-labeled donkeyanti-goat IgG Ab, HRP-labeled rabbit anti-mouse IgG Ab, and biotinylatedmouse anti-hamster IgG Ab were purchased from Proteintech Group. Anti-mouse CD3 (145-2C11) and anti-CD28 mAb (37.51) mAbs used for stim-ulating T cells were obtained from eBioscience. Murine GM-CSF, IL-4,IL-2, and ELISA kits for the assay of murine IFN-�, IL-2, and IL-4 werepurchased from eBioscience. Restriction enzymes HindIII, BamHI, BglII,and XbaI were purchased from Promega. Protein marker (SM0671) waspurchased from Fermantas.
Analysis of gene expression by conventional RT-PCR andreal-time PCR
Total RNA was extracted using the TRIzol reagent (Invitrogen Life Tech-nologies), and samples were incubated with RNase-free DNase I (Pro-mega) at 37°C for 30 min to avoid amplification/detection of contaminatinggenomic DNA. RNA concentration was measured spectrophotometrically,and equal amounts of RNAs were reverse transcribed.
Conventional RT-PCR was performed to confirm the existence ofsTim-3 mRNA vs Tim-3 mRNA. The cDNAs were amplified at 95°C fordenaturing, 54°C for annealing, and 72°C for extension. Conventional RT-PCR primers for mouse Tim-3 were 5�-TCCCTACACAGAGCTGTC-3�and 5�-CAGAAATGAAGGCGAGCC-3�. Primers were designed accord-ing to the sequences in 5� untranslated region and 3� untranslated region,which are identical in both Tim-3 and sTim-3 mRNAs. The expected prod-ucts are 932 bp for Tim-3 mRNA and 680 bp for sTim-3 mRNA. Primersfor mouse �-actin were 5�-ATGGGTCAGAAGGACTCCTATG-3� and 5�-ATCTCCTGCTCGAAGTCTAGAG-3�. The PCR products were separatedby electrophoresis on 1.5% agarose gel and stained with ethidium bromide.
Real-time quantitative PCR was performed in an ABI PRISM 7700sequence detection system using the 5�-nuclease method (TaqMan). Prim-ers and TaqMan probes were designed using the primer design softwarePrimer Express (Applied Biosystems), except those for �-actin, whichwere available commercially. To determine the expression of Tim-3mRNA and sTim-3 mRNA, we used two sets of primers and probes. Oneset was designed according to the sequence in mucin-like domain, and theexpected amplification product was from Tim-3 mRNA. Another set in-cluded the primer spanning the splice junction of sTim-3 mRNA, and theexpected amplification product was from sTim-3 mRNA. The sequence ofall primers and probes used in this study is shown in Table I. A total of 20ng of each of cDNA samples, except for 10 ng of �-actin cDNA, wasmixed with primers and TaqMan Universal PCR Master Mix in a totalvolume of 25 �l, as described in the manufacturer’s directions (protocol4304449; Applied Biosystems). The PCR was conducted using the follow-ing parameters: 50°C for 2 min, 95°C for 10 min, and 40 cycles at 95°C for15 s and 60°C for 1 min. Quantification of the expression of genes wasperformed using the comparative CT method (Sequence Detector User Bul-letin 2; Applied Biosystems). The expression level of each mRNA wasnormalized to �-actin mRNA and expressed as n-fold difference relative tothe control (calibrator). All PCR assays were performed in duplicate, andresults are represented by the mean values � SEM.
Spleen cells stimulated with heat shock protein (HSP) 70-peptide complex
To examine the expression of sTim-3 mRNA vs Tim-3 mRNA after acti-vation, spleen cells were stimulated with HSP70-peptide complex, as de-scribed previously (12, 13). Briefly, B16F1 melanoma peptides andHSP70, at the concentrations of 75 and 250 �g/ml, respectively, weremixed and incubated at 37°C for 2 h in the presence of 1 mM ADP and 1mM MgCl2. Freshly isolated splenocytes were cultured at a concentrationof 1 � 107 cells/ml in RPMI 1640 medium supplemented with 20 U/mlIL-2 in six-well culture plate in the presence of 0.75 �g/ml HSP70-peptidecomplex. The cells were passaged and restimulated with HSP70-peptidecomplex every 3 days for three times (totally stimulated for four times). Ateach time of passages, half of spleen cells were harvested for analysis withRT-PCR.
Construction of expression plasmid vectors
To construct the expression plasmids of Tim-3 and sTim-3, cDNA frag-ment encoding mouse Tim-3 was prepared by RT-PCR from C57BL/6spleen cells. The PCR primers were 5�-GGGAACCGAGAAGCTTAAAGCTATCCCTACACAG-3� (HindIII) corresponding to nt 1–34 and 5�-CAGAACCTCGGATCCGGTTGCCAAGTGACATA-3� (BamHI) com-plementary to nt 989–1020 of murine Tim-3 cDNA. Two cDNAs withdifferent sizes were digested and inserted into compatible enzyme restric-tion sites of pcDNA3.1 (Invitrogen Life Technologies). The constructedplasmids were designated as pTim-3 and psTim-3, respectively. For theconstruction of the plasmids expressing fusion proteins Tim-3-GFP (pTim-3-GFP) and sTim-3-GFP (psTim-3-GFP), both having GFP fragment at Cterminus, another antisense primer, 5�-AACCAGAAGATCTCGGATGGCTGCTGGCTGTTG-3� (Bgl II), was used for the amplification of Tim-3cDNA. Primers for the amplification of GFP fragment from pTracer plas-mid (Invitrogen Life Technologies) were: sense, 5�-GGTTGAAGATCTTGGCTAGCAAAGGAGAAG-3� (BglII) and antisense, 5�-GGCACTGGTTCTAGATCAATCCATGCCATGTGT-3� (XbaI). The two amplifiedfragments were digested by restriction enzymes HindIII and BglII, BglIIand XbaI, respectively, and recombinated with pcDNA3.1 digested withHindIII and XbaI. All cDNAs inserted into the constructed plasmids wereconfirmed by DNA sequencing.
Cell transfection
CHO cells were transfected with indicated plasmid with Dosper liposomaltransfection reagent, according to the manufacturer’s protocol (BoehringerMannheim). In brief, CHO cells were grown to 60–80% confluence in24-well plates and then transfected with 1.0 �g/well indicated plasmidmixed with Dosper liposomal transfection reagent. The transfected cellswere selected in complete medium containing 1 mg/ml G418 (Invitrogen
Table I. Real-time quantitative PCR primers and probes
Tim-3 (�)CCACGGAGAGAAATGGTTCa
(�)CATCAGCCCATGTGGAAATFAM-CACAGACACTGGTGACCCTCC-TAMRA
sTim-3 (�)GATTAGACATCAAAGCAGGG(�)TACACTGGCCAACTTGCCTFAM-AAGTTATCGAGTTTGAGCCTT-TAMRA
IFN-� (�)CAGCAACAGCAAGGCGAAA(�)TTCCTGAGGCTGGATTCCGFAM-CCAGCGCCAAGCATTCAATGAGCT-TAMRA
IL-2 (�)TGGAGCAGCTGTTGATGGAC(�)CAATTCTGTGGCCTGCTTGGFAM-ACTCCCCAGGATGCTCACCTTC-TAMRA
TNF-� (�)CATCTACCTGGCACACGAGG(�)CTGGTACATTGAGCGCACCFAM-ATACCCCTTCCATGTGCCTCTCC-TAMRA
Foxp3 (�)TGCCACCTGGGATCAATGT(�)CCAGCAGTGGGTAGGATCCTTFAM-CTCTACTCTGCACCTTCCCACGCT-TAMRA
TGF-� (�)TGGCTTCTAGTGCTGACGC(�)TAGTTTGGACAGGATCTGGCFAM-CCACCTGCAAGACCATCGACA-TAMRA
IL-10 (�)GGTTGCCAAGCCTTATCGGA(�)ACCTGCTCCACTGCCTTGCTFAM-TGAGGCGCTGTCGTCATCGA-TAMRA
a (�), Forward primers; (�), reverse primers; FAM — TAMRA, probe.
1412 sTim-3 INHIBITS T CELL-MEDIATED IMMUNE RESPONSE
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from
Life Technologies), and were subsequently cloned by limiting dilution.Expression of pTim-3-GFP and psTim-3-GFP was observed using fluores-cence microscope. The supernatants of the cells transfected with psTim-3were collected for additional experiments.
Western blot analysis
For the detection of sTim-3 produced by the activated splenocytes, 72-hculture supernatants were concentrated using Freeze Dry System(Labconco). For the detection of sTim-3 produced by the expression ofpsTim-3 in vivo, livers from the mice were excised 48 h after transfectionand digested with collagenase and EDTA; the collected hepatic cells werecultured at a concentration of 5 � 106 cells/ml; and 48-h culture superna-tants were concentrated using the Freeze Dry system. The method of stan-dard Western blot for detection of protein has been previously described(10, 14). Briefly, the proteins were separated by SDS-PAGE, followed bytransfer onto nitrocellulose membranes (Bio-Rad). Membranes wereblocked with 3% BSA in Tween 20 plus TBS, and probed with the anti-mouse Tim-3 Ab at a concentration of 0.2 �g/ml. After incubation with thesecondary anti-goat Ab conjugated with HRP, membranes were exten-sively washed and the bound Abs were detected using the ECL WesternBlotting Detection System (Amersham Biosciences), according to the man-ufacturer’s instructions. To analyze the existence of anti-Tim-3 Ab in thesera of mice, 48-h supernatants of psTim-3-transfected cells were loaded tothe gel by using a comb without tooth, and the blot was prepared by normalprocedures. The membrane was carefully cut into strips. Each of the stripswas incubated with a different dilution of sera from mice, and then wentthrough the following normal procedures.
Isolation of T cells by MACS MultiSort
T cells were purified from spleen cells by magnetic cell sorting using aMiniMACS device. The separation procedure was conducted according tothe manufacturer’s instructions (Miltenyi Biotec). In brief, spleen cells atthe concentration of 107 cells/100 �l were incubated with T cell isolationkit for 15 min at 6–10°C. Spleen cell suspension was resuspended in de-gassed buffer and poured into the column reservoir. Labeled cells wereretained within the magnetized matrix of the column, whereas nonlabeledcells passed through and were collected as the nonmagnetic fraction. Toretrieve the magnetic fraction, the column was removed from the separator,and 1 ml of degassed buffer was added to the reservoir. The cells wereflushed out of the column with the aid of a plunger.
Preparation of Ag-loaded dendritic cells (DC)
Bone marrow-derived DC was prepared, as previously described (15, 16).In brief, bone marrow cells were flushed from the femurs and tibias of miceunder aseptic conditions, depleted of RBC, and then cultured at a concen-tration of 1 � 106 cells/ml in complete RPMI 1640 medium supplementedwith 10 ng/ml GM-CSF and 10 ng/ml IL-4. On day 6, nonadherent andloosely adherent cells were harvested and separated by 14.5% metrizamidecomplete medium gradients. DC was collected by gentle pipette aspirationand washed twice with complete medium, and then cultured in the presenceof 0.75 �g/ml HSP-B16F1 peptide complex (prepared by the same methoddescribed above). After 18 h of incubation, Ag-loaded DC was harvested,irradiated (3000 rad), and resuspended in HBSS for additional experiments.
Functional assay of sTim-3 in vitro
MACS MultiSort-purified T cells were cultured at a concentration of 2 �106 cells/ml in the presence of Ag-loaded DC (at a responder to stimulatorratio of 20:1) or a combination of anti-CD3 (coated, 5 �g/ml) and anti-CD28 (5 �g/ml) in complete RPMI 1640 medium containing serial dilu-tions of the supernatants of CHO cells transfected with psTim-3 (17–19).For blockage assay, the supernatants of psTim-3-transfected cells werepretreated with anti-mouse Tim-3 (10 �g/ml). To determine the prolifer-ation of T cells, 1.0 �Ci of [3H]thymidine was added on day 4, the cellswere cultured continuously for 18 h, and then the incorporation of [3H]thy-midine was measured in a MicroBeta TriLux liquid scintillation counter(Wallac). To detect the production of cytokines, the supernatants werecollected, and the concentrations of IFN-�, IL-2, and IL-4 were determinedby sandwich ELISA, according to manufacturer’s instructions.
FACS analysis
The purified T cells or B16F1 melanoma cells were washed with PBS andincubated with supernatants of CHO cells transfected with psTim-3-GFP for1 h at 37°C. In blocking experiment, supernatants of psTim-3-GFP-transfectedcells were pretreated with anti-mouse Tim-3 before the incubation with splenicT cells. After washing with PBS, the cells were used for flow cytometric
analysis. Parameters were acquired on a FACSCalibur flow cytometer (BDBiosciences) and analyzed with CellQuest software (BD Biosciences).
In vivo gene delivery and tumor growth studies
Plasmid DNA was prepared and analyzed, as described (13). All plasmidpreparations were free of detectable RNA, and endotoxin levels were �1.5EU/�g. Spectrophotometric analysis revealed 260/280 nm ratios �1.80.Purity and conformation of the prepared plasmid DNA were confirmed byagarose gel electrophoresis. On day 0, 1 � 105 B16F1 cells in 100 �l ofsterile 0.9% saline were inoculated in the right hind limbs of mice. On day2, the mice received the injection of 100 �g of plasmid DNA using thehydrodynamics-based gene delivery technique (20, 21). Mice tolerated thistreatment regimen well without obvious side effects after injection. Genedelivery was conducted every 3 days for four times in all. Tumor growthwas inspected by Vernier caliper measurement every other day from day 6after inoculation. Tumor volume was calculated according to the formulaV � (a � b2)/2, with a as the larger diameter and b as the smaller diameter.The mouse survival rate was also recorded.
Cytotoxicity assay
Splenic T cells from tumor-bearing mice were cultured at 1 � 107 cells/mland restimulated with Ag-loaded DC in RPMI 1640 medium supplementedwith 20 U/ml IL-2 for 5 days. B16F1 target cells were labeled withNa51CrO4 (0.1 �Ci/106 cells; Amersham Biosciences) at 37°C for 1 h.After extensive washing, target cells were incubated with effectors at dif-ferent E:T ratios in triplicate at 37°C for 4 h, and 51Cr released (cpm) intothe supernatants was measured in a gamma counter to calculate percentageof specific release. Specific lysis was determined as follows: percentage ofspecific release � 100 � (experimental release � spontaneous release)/(maximum release � spontaneous release). Spontaneous release was�20% of maximum release in all experiments.
Histology and immunohistochemistry
Tumor tissues were surgically excised on day 16 after inoculation and fixedin 4% paraformaldehyde, embedded in paraffin, and sectioned. Sectionswere stained with H&E. Immunohistochemistry was performed with themethod of SP, as described (13, 22). The primary Ab was hamster anti-mouse CD3 Ab. Biotinylated Ab to hamster IgG was used as secondaryAb. The reaction product was visualized with the peroxidase-conjugatedstreptavidin system with 3,3-diaminobenzidine (Serva) as substrate. Im-ages were analyzed by HMIAS-2000 analyzer, and the mean value of area-integrated OD was calculated.
Data analysis
Results were expressed as mean value � SEM and interpreted byANOVA-repeated measures test, and mouse survival rate was interpretedby Wilcoxon’s rank test. Differences were considered to be statisticallysignificant when p � 0.05.
ResultsExpression analysis of sTim-3
Although the existence of sTim-3 mRNA in spleen cells has beenfound, the distribution of sTim-3 mRNA in different organs ortissues was still unknown. To this end, sTim-3 mRNA in normalmice was examined by RT-PCR. Total RNA was isolated frombone marrow, thymus, spleen, and also from other organs, includ-ing liver, brain, heart, lung, pancreas, and kidney of C57BL/6mice. RT-PCR results revealed that Tim-3 mRNA was existent inthe cells from thymus, bone marrow, and spleen, whereas sTim-3mRNA was existent only in splenic cells (Fig. 1A). Neither Tim-3mRNA nor sTim-3 mRNA was detectable in nonlymphoid organs(data not shown).
To investigate the expression pattern of sTim-3 and Tim-3mRNA in immune response, we first examined the expression ofthese mRNAs in freshly isolated and activated splenocytes withconventional RT-PCR. Tim-3 mRNA was observed in freshly iso-lated splenocytes from 12 of 12 mice, whereas sTim-3 mRNA wasobserved in 10 of 12 healthy subjects tested. HSP70-peptide com-plex has been served as effective immunogens to stimulate T cellsin vitro and in vivo (15, 16, 23, 24). The expression of both Tim-3mRNA and sTim-3 mRNA was up-regulated along with several
1413The Journal of Immunology
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from
rounds of stimulation with HSP70-peptide complex in vitro (Fig.1B). We then analyzed the expression of sTim-3 and Tim-3 furtherby real-time PCR. Under the conditions used for quantitative PCR,cDNA from either Tim-3 mRNA or sTim-3 mRNA could be am-plified independently by using two sets of primers (Fig. 1C, left).Quantitative PCR revealed that both Tim-3 mRNA and sTim-3mRNA were significantly increased after each round of stimula-tion, whereas there appeared to be a higher increase of sTim-3product than that of Tim-3 product. These results indicated that theexpression of Tim-3 gene was up-regulated after stimulation, andthe alternative splicing of mRNA favored the production of sTim-3mRNA after several rounds of stimulation.
To prove the existence of the translated product of sTim-3mRNA, the proteins in culture supernatants of splenocytes andCHO cells transfected with psTim-3 were analyzed with Westernblot. The results showed that a �24-kDa protein that binds spe-cifically with anti-Tim-3 Ab was detected in the cell-free super-natants of the actived splenocytes, but not in the culture superna-tants of freshly isolated splenocytes (Fig. 1D). The 24-kDa proteinwas also detected in the supernatants of CHO cells transfected withpsTim-3. The molecular mass of sTim-3, based on the predictedprotein size derived from the primary amino acid sequence, is21,865. Given that there are N-linked glycosylation sites and O-linked glycosylation sites in IgV domain of sTim-3 molecule, the
FIGURE 2. Analysis of protein encoded by sTim-3 cDNA. A, Analysis of the expressed Tim-3-GFP and sTim-3-GFP in the transfected CHO cells byfluorescence microscope; green fluorescence was found in CHO cells transfected with pTim-3-GFP (left), but scarcely in CHO cells transfected withpsTim-3-GFP (right). Images are representative of multiple microscopic fields observed in two individual experiments under same conditions. B, Analysisof the binding of sTim-3 to its putative ligand(s) on T cells by flow cytometric analysis. Curve 1, T cells alone; curve 2, T cells incubated with the expressionproduct of psTim-3-GFP pretreated with anti-mouse Tim-3; curve 3, T cells incubated with the expression product of psTim-3-GFP.
FIGURE 1. Expression pattern of sTim-3. A, Distribution of sTim-3 mRNA in the indicated organs or tissues was determined by conventional RT-PCR.Lanes 1 and 5, DNA markers (DL2000; TaKaRa Biotech); lane 2, splenocytes; lane 3, thymus; lane 4, bone marrow. B, Conventional RT-PCR analysisof sTim-3 mRNA and Tim-3 mRNA in freshly isolated splenocytes and activated splenocytes. Primers were the same as those in A. Splenocytes werestimulated with HSP70-peptide complex, as described in Materials and Methods. C, Quantification of Tim-3 mRNA and total Tim-3 transcripts in freshlyisolated and in vitro activated splenocytes by real-time PCR with primers and probes described in Tab 1. Real-time PCR primers were tested, and nocross-reactivity was found (left). The expression level of both Tim-3 mRNA and sTim-3 mRNA was significantly increased after each round of stimulation;however, there appears to be a higher increase of sTim-3 product than that of Tim-3 product. D, Detection of sTim-3 in the culture supernatants ofsplenocytes after the indicated round of stimulation (lanes 1–5) and transfected CHO cells (lanes 6 and 7) by Western blot analysis. Lane 1, withoutstimulation; lane 2, round 1; lane 3, round 2; lane 4, round 3; lane 5, round 4; lane 6, transfected with pcDNA3.1; lane 7, transfected with psTim-3.
1414 sTim-3 INHIBITS T CELL-MEDIATED IMMUNE RESPONSE
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from
results suggested that sTim-3 molecule was glycosylated and ex-pressed as a secreted form.
sTim-3 protein binds to its putative ligand(s)
To verify whether sTim-3 is capable of binding with its putativeligand(s), we constructed expression plasmids of sTim-3-GFP andTim-3-GFP. CHO cells were transfected with psTim-3-GFP andpTim-3-GFP, respectively. Green fluorescence was found in CHOcells transfected with pTim-3-GFP, but scarcely in CHO cellstransfected with psTim-3-GFP (Fig. 2A), indicating that sTim-3 ismostly secreted out, which further confirmed that sTim-3 is a sol-uble molecule. The binding of sTim-3-GFP to its putative ligand(s)on splenic T cells was determined by FACS analysis. The fluo-rescence intensity on T cells incubated with sTim-3-GFP was sig-nificantly increased as compared with control (Fig. 2B). When thesupernatants of psTim-3-GFP-transfected cells were pretreatedwith anti-mouse Tim-3 before the incubation with splenic T cells,the fluorescence intensity decreased nearly to the control level.These results clearly indicated that sTim-3 could bind to putativeTim-3 ligand(s).
Expression of psTim-3 in vivo facilitates tumor growth
On the basis of the regulatory effect of sTim-3-Ig fusion protein onimmune response, sTim-3 was speculated to block the inhibitoryeffect of Tim-3, and promote expansion and differentiation of Th1cell population (7, 8). So, we tried to observe the inhibitory effectof sTim-3 on the growth of tumor in vivo by enhancing the im-mune response. To test this, in vivo transfection with psTim-3 wasperformed by the hydrodynamics-based gene delivery technique.Given that the hydrodynamics-based gene delivery by i.v. admin-istration of naked DNA is a simple and efficient method for theexpression of the secretory protein in vivo, and the technique isgaining increasing favor for studying the function of secretory pro-tein in vivo (20, 21), we first examined whether the transgene wasefficiently taken up and expressed by hepatic cells. As expected,conventional RT-PCR results confirmed that sTim-3 mRNA wasexpressed by hepatic cells transfected with psTim-3, but not incontrol hepatic cells (Fig. 3A). Western blot analysis revealed thatthe expressed product of psTim-3, a secretory molecule, was ex-istent in supernatants of hepatic cells and in serum of mice treated
FIGURE 3. sTim-3 facilitates thegrowth of tumor in vivo. A, Conven-tional RT-PCR analysis of the ex-pression of sTim-3 in liver cells.sTim-3 mRNA was only detected inhepatic cells transfected with ps-Tim-3. Lane 1, Hepatocytes of nor-mal mice; lane 2, hepatocytes ofmice treated with saline; lane 3,hepatocytes of mice treated withpcDNA3.1; lane 4, hepatocytes ofmice treated with psTim-3. B, West-ern blot analysis of sTim-3 expres-sion. Cell-free culture supernatants ofhepatic cells and sera samples werecollected and analyzed with Westernblot, as described in Materials andMethods. Lanes 1-4, Culture superna-tants of hepatocytes from normalmice, and mice treated with saline,pcDNA3.1, and psTim-3; lanes 5–8,sera from normal mice, and micetreated with saline, pcDNA3.1, andpsTim-3. C and D, C57BL/6 micewere inoculated with 1 � 105 B16F1cells (C), and BALB/c mice were in-oculated with 1 � 105 H22 cells (D).The mice were treated by i.v. injec-tion with psTim-3, pcDNA3.1, or sa-line. Tumor volume (left) and sur-vival rate (right) were monitored.Data from two identically performedexperiments were combined. E,B16F1 melanoma cells were incu-bated with sTim-3-GFP and analyzedby FACS. Fluorescence intensity onthe examined B16F1 melanoma cellswas not increased compared withcontrol. �, Significant difference be-tween groups (p � 0.05).
1415The Journal of Immunology
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from
with psTim-3 (Fig. 3B). Importantly, we found no obvious toxicitycaused by the injection of psTim-3 plasmid at dosage up to 200 �g/mouse. Extensive pathological examination and comparison of themice that received different injections showed no evidence of obvioustoxicities such as weight loss and the change of glutamic pyruvictransaminase and creatine levels in serum (data not shown).
To investigate the effect of sTim-3 on tumor growth in vivo,mice were inoculated with 1 � 105 B16F1 melanoma cells into thehind thigh muscle and then treated with in vivo transfection ofpsTim-3, pcDNA3.1, or injection of saline as control. Unexpect-edly, the growth of B16F1 melanoma was not suppressed, butfacilitated significantly in mice treated with psTim-3 as comparedwith control mice treated with pcDNA3.1 or saline (Fig. 3C). Thesurvival of psTim-3-treated tumor-bearing mice was also signifi-cantly shorter than that of control mice. All mice in the treatmentgroup had died within 28 days after tumor inoculation, whereas80% of mice in the control group were still alive on day 28 (Fig.3C). To examine whether the treatment with sTim-3 also facili-tated the growth of other type of tumor, we treated the BALB/cmice inoculated with hepatocarcinoma H22 cells in the same way,and similar effect of sTim-3 on tumor growth was also observed(Fig. 3D), suggesting that the facilitation of sTim-3 on tumorgrowth is not specific on the indicated tumor cells.
To exclude a direct effect of sTim-3 on tumor cell growth, tumorcell proliferation assay was performed by trypan blue exclusion.The proliferation of B16F1 melanoma cells in vitro was not facil-itated in the presence of supernatants from the psTim-3-transfectedcells (data not shown). In addition, B16F1 melanoma cells did notexpress putative Tim-3 ligand(s) as assessed by FACS analysisusing sTim-3-GFP (Fig. 3E). Thus, a direct effect of sTim-3 ontumor cells was excluded. Taken together, these results suggestedthat the impaired immune response might account for the effect ofsTim-3 on tumor growth in vivo.
sTim-3 inhibits T cell response in vitro
To test the notion, based on the above results, that sTim-3 is pos-sibly an inhibitory molecule in the control of cell-mediated im-mune response, we first investigated the effect of sTim-3 on T cellactivation in vitro. When T cells were stimulated with Ag-loadedDC, the supernatants containing sTim-3 significantly impaired theproliferation of T cells in a dose-dependent manner (Fig. 4A). Theinhibitory effect was abrogated if the expression product of ps-Tim-3, before added into stimulation system, was pretreated withanti-mouse Tim-3 (Fig. 4A). When we examined the effect ofsTim-3 on the activation of T cells by immobilized anti-CD3 mAband soluble anti-CD28 mAb, similar inhibitory effect was also ob-served (Fig. 4B). To determine whether sTim-3 has an effect on theproduction of cytokines, the culture supernatants were collected72 h after stimulation, and analyzed with ELISA for the productionof IL-2, IFN-�, and IL-4. When T cells were stimulated with Ag-loaded DC, the production of IL-2 and IFN-� by T cells in thepresence of sTim-3 was suppressed in a dose-dependent manner,but the production of IL-4 was little influenced by sTim-3 (Fig.4A). Same effect was observed in anti-CD3 mAb plus anti-CD28mAb costimulation system (Fig. 4B). In addition, anti-mouseTim-3 could abrogate the inhibitory effect of sTim-3 on the pro-duction of IL-2 and IFN-� by the activated T cells. These findings,taken together with the above results, suggested that the expressionproduct of psTim-3 was a functional molecule that had an inhib-itory effect on T cell response.
In vivo expression of psTim-3 impairs T cell antitumor immunity
To understand the potential mechanisms of sTim-3 responsible forpromoting the development of tumor in vivo, we investigated the
effect of sTim-3 on the generation of tumor-specific T cells.Splenic T cells were isolated from tumor-bearing mice with dif-ferent treatments on day 16 after tumor inoculation and restimu-lated in vitro. With the stimulation of Ag-loaded DC, T cells frommice treated with pcDNA3.1 or saline showed a high proliferativeresponse, but the response of T cells from mice treated with ps-Tim-3 was significantly impaired (Fig. 5A). Consistent with thisfinding, the cytotoxicity of T cells to B16F1 cells in psTim-3-treated group was also significantly lower than that in pcDNA3.1group or saline group (Fig. 5B), indicating that sTim-3 could im-pair T cell antitumor immune response in vivo.
H&E analysis of tissue sections showed that moderate infiltra-tion of inflammatory cells was observed in the tumor of micetreated with saline or pcDNA3.1, but the infiltration of inflamma-tory cells was scarce in the tumor of mice treated with psTim-3(Fig. 5C). The area-integrated OD of psTim-3 group (0.069 �0.03) was significantly lower than that of either saline group(0.223 � 0.04) or pcDNA3.1 group (0.227 � 0.04) ( p � 0.01).Immunohistochemical studies revealed that there was a differencein the intensity of T cell infiltration between tumors from controlmice and psTim-3-treated mice. The amount of CD3� cells inpsTim-3-treated group (19 � 4 positive cells per high power field)was significantly reduced as compared with that in saline group(49 � 12) or pcDNA3.1 group (51 � 14) ( p � 0.01), indicatingthat the amount of tumor-infiltrating T cells at tumor site in psTim-3-treated mice was significantly reduced. The decrease of tumor-infiltrating lymphocytes was not induced by anti-Tim-3 Ab, be-cause the Ab was not detectable in the sera of mice collected onday 16 after tumor inoculation (Fig. 5D). These results furtherreinforced that sTim-3 had an inhibitory effect on T cell response.
Because both effector CD4�CD25� T cells and TregCD4�CD25� cells express a putative Tim-3 ligand (7, 8), the im-pairment of antitumor immunity by sTim-3 might be the result ofeither impairing the function of effector CD4� T cells or activatingthe function of CD4� Treg cells. To understand the underlyingcellular mechanism contributing to the impaired antitumor immu-nity by sTim-3, we analyzed the expression of genes related to thefunction of tumor-infiltrating lymphocytes on days 4, 8, 12, and 16after inoculation of tumor cells by real-time quantitative PCR. Astriking feature of gene expression in sTim-3-treated mice, com-pared with control, was the down-regulated expression of IL-2,IFN-�, and TNF-� mRNA from day 8 to 16, suggesting that thedecreased expression of Th1 cytokines was involved in the im-pairment of cellular immunity (Fig. 6). But the expression of fork-head transcription factor 3 (Foxp3), IL-10, and TGF-� mRNA wasnot influenced as compared with control (Fig. 6). Because Foxp3,IL-10, and TGF-� are highly related to Treg cell phenotype andfunction (25–29), these results indicated that sTim-3 did not in-fluence Treg cells. Taken together, these results suggested thatsTim-3 did not influence Treg cells, but otherwise resulted in theprofound immune unresponsiveness of CD4� T effector cells.
DiscussionThe expression of sTim-3 mRNA, the existence of sTim-3 as asoluble protein, and its effect on T cell immune response weredetermined in this study. In initial experiments, we demonstratedthat sTim-3 mRNA was expressed only in spleen cells, but not inbone marrow, thymus, and nonlymphoid organs, suggesting thatsTim-3 is involved mainly in immune response and expressed inthe lymphocytes that have experienced immune response. This hy-pothesis was further proved by the experiments in which the ex-pression of sTim-3 mRNA in spleen cells could be up-regulated byrepeated stimuli, suggesting that the expression of sTim-3 relied on
1416 sTim-3 INHIBITS T CELL-MEDIATED IMMUNE RESPONSE
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from
the activation of lymphocytes and it might play a potentially im-portant role in the regulation of immune response.
We next proceeded to examine the existence of sTim-3’s proteinproduct and its ability to bind the putative ligand(s). In this study,we provided the evidence for the existence of sTim-3, which wasproduced as a soluble molecule from the activated lymphocytes. Inaddition, the transfection of cells with the expression vector car-rying sTim-3 cDNA also resulted in the production of sTim-3 as asoluble molecule. Furthermore, the analysis with FACS confirmedthat sTim-3 could bind to the putative Tim-3L on T cells. AlthoughsTim-3 mRNA in freshly isolated splenocytes was detectable byRT-PCR, a much more sensitive approach, the protein of sTim-3was not detectable by Western blot, suggesting that only a verylow ratio of freshly isolated splenocytes produces sTim-3.
On the basis of the regulatory effect of sTim-3-Ig fusion proteinon auto- and alloimmune responses, it was speculated that sTim-3might act to block the inhibitory effect of Tim-3-Tim-3L interac-tion, and promote the expansion and differentiation of Th1 cellpopulations. But when we tried, on the basis of the above specu-
lation, to augment the antitumor immune response by the expres-sion of sTim-3 in vivo, we observed an unexpected result. sTim-3did not inhibit, but facilitated the growth of tumor in vivo andshortened survival of tumor-bearing mice. The possibility of thedirect effect of sTim-3 on the growth of tumor cells was ruled outbecause B16F1 melanoma cells did not express the putative Tim-3ligand(s), and the growth of tumor cells in vitro was not influencedin the presence of sTim-3. Thus, we supposed that sTim-3 facili-tated tumor growth in vivo by impairing antitumor immunity. Theresults in our following experiments confirmed that the effect ofsTim-3 on immune response is not positive, but negative.
The results of our experiments in vitro showed that the responseof T cells to Ag-specific stimulation or anti-CD3 mAb plus anti-CD28 mAb costimulation was significantly suppressed in the pres-ence of sTim-3, and the blockade of sTim-3 with anti-Tim-3 Abrecovered the response of T cells to these stimuli, supporting thenotion that sTim-3 mediates the inhibitory effect in immune re-sponse. Besides the inhibition on the proliferation of T cells,
FIGURE 4. Effect of sTim-3 on T cell pro-liferation and cytokine production in vitro. Tcells purified from spleen cells of C57BL/6mice were stimulated in the presence of thesupernatants of CHO/psTim-3 cells or CHO/pcDNA3.1 cells, as described in Materials andMethods. In blockage assay, the supernatantsof CHO/psTim-3 cells were pretreated with anti-mouse Tim-3 (10 �g/ml) before the incubationwith T cells. The effect of sTim-3 on T cellproliferation after stimulation with Ag-loadedDC (A) or with anti-CD3 mAb plus anti-CD28mAb (B) was determined by 18-h [3H]thymi-dine uptake in triplicate wells. Supernatantswere collected 72 h after stimulation, and theconcentration of cytokines was determined bycytokine ELISA for IL-2, IFN-�, and IL-4.Data were expressed as mean � SEM.
1417The Journal of Immunology
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from
sTim-3 mainly suppressed the production of Th1 cytokines, IL-2and IFN-�, suggesting that sTim-3 could inhibit T cell response.
We then attempt to further understand the function of sTim-3 invivo: we expressed sTim-3 by in vivo transfection of the expres-sion plasmid and observed its effect on T cell antitumor response.The proliferation of T cells from sTim-3-treated mice was signif-icantly reduced when they were restimulated by Ag-loaded DC invitro, indicating that T cell antitumor immune response was inhib-ited by sTim-3 in vivo. Moreover, the antitumor CTL activity wassignificantly reduced by sTim-3, and the amount of T cells intumor tissue was also significantly decreased. To sum up, these
results further confirmed the inhibitory effect of sTim-3 on thegeneration of Ag-specific T cell immune response.
CD4� T cells that express Tim-3L could have played a signif-icant role in the suppression of antitumor immunity by sTim-3.CD4� T effector cells and CD4� Treg play distinctly differentroles in regulating host immune response against cancer. CD4�
effector (helper) T cells are required for the priming and mainte-nance of CD8� T cells, thus enhancing the overall immune re-sponse (29–32). Paradoxically, CD4� Treg cells can profoundlysuppress host immune response (33–36). Real-time RT-PCR anal-ysis of gene expression in tumor microenvironment revealed the
FIGURE 6. Effect of sTim-3 on the gene expressionin tumor microenvironment. Total RNAs were isolatedfrom half part of tumor tissues together with half part ofvicinal muscle tissues of tumor-bearing mice on days 4,8, 12, and 16 after inoculation of tumor cells. RelativemRNA levels of IL-2, IFN-�, TNF-�, Foxp3, IL-10, andTGF-� were measured with real-time quantitative PCRin five to eight mice from two experiments. The level ofeach mRNA was expressed as n-fold difference relativeto the saline control on day 4 (�, p � 0.05).
FIGURE 5. sTim-3 impairs genera-tion of Ag-specific T cells in tumor re-jection model. Splenic T cells were ob-tained from tumor-bearing mice withdifferent treatments and restimulated invitro with Ag-loaded DC. Proliferationof T cells was measured by [3H]thymi-dine incorporation (A), and the cytotox-icity of lymphocytes to B16F1 cellswas tested by a standard 4-h 51Cr re-lease assay (B). Data represent the av-erage � SEM from three independentexperiments. C, Microscopic findingsof tumor-infiltrating cells with differenttreatments. H&E staining (upper pan-els) and immunostaining for CD3(lower panels) were performed on day16 after inoculation of tumor cells. Theamounts of both infiltrating cells (up-per panels) and CD3� cells in the in-filtrating cells in psTim-3-treated groupwere significantly reduced as comparedwith those in control groups. Imagesare representative of multiple micro-scopic fields observed in three mice pergroup. D, Analysis of anti-Tim-3 Ab insera. Serum samples of psTim-3-treated mice were collected on day 16after tumor inoculation, and anti-Tim-3Ab in the sera was detected by Westernblot.
1418 sTim-3 INHIBITS T CELL-MEDIATED IMMUNE RESPONSE
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from
decreased expression of Th1 cytokines, which was in good agree-ment with the results that sTim-3 inhibited T cell proliferation andproduction of IL-2 and IFN-� in vitro. The reduced expression ofIL-2, IFN-�, and TNF-� in the existence of sTim-3 indicated thatthe activation of CD4� T cells or the differentiation of naive CD4�
T cells into Th1 cells was suppressed. But the unimpaired expres-sion of Foxp3, IL-10, and TGF-� indicated that the developmentand function of CD4� Treg cells were not influenced by sTim-3.Therefore, the inhibitory effect of sTim-3 on T cell response wasdue to CD4� T effector cells rather than CD4� Treg cells.
Although the precise cellular and molecular interactions involv-ing sTim-3 and its ligand(s) remain to be fully elucidated, our dataindicate that the interaction between sTim-3 and the putativeTim-3L might constitute a mechanism through which the activa-tion of naive T cells by Ag is inhibited. The inhibitory effect ofsTim-3 could be mainly involved in the initial activation and ex-pansion of naive T cells. Given that the expression of sTim-3 wasup-regulated along with the repeated stimulation, the physiologicalfunction of sTim-3 might be the prevention of activation of morenaive T cells in later phase of immune response so to maintain thebalance of immune response.
Tim-3 has been identified as a putative marker for Th1, but notTh2 cells, whereas its role in the positive and negative control ofimmune responses is just being elucidated (6–8, 37, 38). To date,the in vivo functions of Tim-3 have remained largely unknown.Our preliminary study on membrane-bound Tim-3 revealed thatthe expression of Tim-3 in vivo by transfection with expressionplasmid in the established mouse B16F1 melanoma induced par-tially regression of tumor and enhanced T cell response (our un-published data), suggesting that the effect of Tim-3 on antitumorimmunity is a positive one. These results were consistent with amore recent study in which the administration of Tim-3� Th1 cellsfacilitated the development of tumor-specific CTL, suggesting thatTim-3� Th1 cells could be used to induce host antitumor responseand inhibit the development and growth of tumor (37). These dataoffer a new insight into the mechanism through which Tim-3 reg-ulates immune response of T cells, and add an additional level ofcomplexity to the current description of the role of Tim-3 in im-munoregulation. All of these data could reach a conclusion thatwill be quite different from that based on the observation of Tim-3-Ig fusion proteins causing hyperproliferation of Th1 cells andinhibiting the generation of Treg cells. This discrepancy could bepossibly attributed to the different structure of Tim-3-Ig and othermolecules on Th1 cells that could collaborate with Tim-3, but notsTim-3. It is possible that Tim-3, by collaboration with other mol-ecules on the surface of Th1 cells, could be capable of promotingthe activation of naive CD4� T cells at the initial phase, and ac-tivating CD4� Treg cells at the later phase of immune response.Tim-3-Ig might not have the biological function of either nativesTim-3 or Tim-3 because of the absence of cytoplasmic domainand not being anchored on the cellular membrane, but it can in-fluence, by binding to Tim-3L, the function of either native sTim-3or Tim-3. The further investigation of the function of Tim-3, thepotential collaboration of Tim-3 with other molecules on Th1, andthe potential regulation of Tim-3 vs sTim-3 mRNA and proteinwill be needed to reveal the complicated regulatory effects of Tim-3/sTim-3 on immune response in vivo.
AcknowledgmentsWe are grateful to Mu-Lan Yang, Zhi-Yong Gong, Yi-Nong Zhang, andMei-Rong Zheng for technical assistance, and Prof. You-Bing Ruan for herhelp and suggestions.
DisclosuresThe authors have no financial conflict of interest.
References1. McIntire, J. J., S. E. Umetsu, O. Akbari, M. Potter, V. K. Kuchroo, G. S. Barsh,
G. J. Freeman, D. T. Umetsu, and R. H. DeKruyff. 2001. Identification of Tapr(an airway hyperreactivity regulatory locus) and the linked Tim gene family. Nat.Immunol. 2: 1109–1116.
2. Kuchroo, V. K., D. T. Umetsu, R. H. DeKruyff, and G. J. Freeman. 2003. TheTIM gene family: emerging roles in immunity and disease. Nat. Rev. Immunol. 3:454–462.
3. Kumanogoh, A., S. Marukawa, K. Suzuki, N. Takegahara, C. Watanabe, E. S.Ch’ng, I. Ishida, H. Fujimura, S. Sakoda, and K. Yoshida. 2002. Class IV sema-phorin Sema4A enhances T-cell activation and interacts with Tim-2. Nature 419:629–633.
4. Umetsu, S. E., W. L. Lee, J. J. McIntire, L. Downey, B. Sanjanwala, O. Akbari,G. J. Berry, H. Nagumo, G. J. Freeman, D. T. Umetsu, and R. H. Dekruyff. 2005.TIM-1 induces T cells activation and inhibits the development of peripheral tol-erance. Nat. Immunol. 6: 447–454.
5. Meyers, J. H., S. Chakravarti, D. Schlesigner, Z. Illes, H. Waledner,S. E. Umestu, J. Kenny, X. X. Zheng, D. T. Umetsu, R. H. Dekrayff, et al. 2005.TIM-4 is the ligand for TIM-1, and the TIM-1-TIM-4 interaction regulates T cellsproliferation. Nat. Immunol. 6: 455–464.
6. Monney, L., C. A. Sabatos, J. L. Gaglia, A. Ryu, H. Waldner, T. Chernova,S. Manning, E. A. Greenfield, A. J. Coyle, R. A. Sobel, et al. 2002. Th1-specificcell surface protein Tim-3 regulates macrophage activation and severity of anautoimmune disease. Nature 415: 536–541.
7. Sanchez-Fueyo, A., J. Tian, D. Picarella, C. Domening, X. X. zheng,C. A. Sabatos, N. Manlongat, O. Bender, T. Kamaradt, and V. K. Kuchroo. 2003.Tim-3 inhibits T helper type 1-mediated auto- and alloimmune response andpromotes immunological tolerance. Nat. Immunol. 4: 1093–1101.
8. Sabatos, C. A., S. Chakravarti, E. Cha, A. Schubart, A. Sanchez-Fueyo,X. X. Zheng, A. J. Coyle, T. B. Strom, G. J. Freeman, and V. K. Kuchroo. 2003.Interaction of Tim-3 and Tim-3 ligand(s) regulates T helper type 1 responses andinduction of peripheral tolerance. Nat. Immunol. 4: 1102–1110.
9. Cheng, J. H., T. Zhou, C. Liu, J. P. Shapiro, M. J. Brauer, M. C. Kiefer, P. J. Barr,and J. D. Mountz. 1994. Protection from Fas-mediated apoptosis by a solubleform of the Fas molecule. Science 263: 1759–1762.
10. Jeannin, P., G. Magistrelli, J. P. Aubry, G. Caron, J. F. Gauchat, T. Renno,N. Herbault, L. Goetsch, A. Blaecke, P. Y. Dietrich, et al. 2000. Soluble CD86is a costimulatory molecule for human T lymphocytes. Immunity 13: 303–312.
11. Oaks, M. K., and K. M. Hallett. 2000. A soluble form of CTLA-4 in patients withautoimmune thyroid disease. J. Immunol. 164: 5015–5018.
12. Feng, Z. H., B. Huang, G. M. Zhang, D. Li, and H. T. Wang. 2002. Investigationon the effect of peptides mixture from tumor cells inducing anti-tumor specificimmune response. Sci. China Ser. C 45: 361–369.
13. He, Y. F., G. M. Zhang, X. H. Wang, H. Zhang, Y. Yuan, D. Li, and Z. H. Feng.2004. Blocking programmed death (PD)-ligand(s)-PD-1 interactions by localgene therapy results in enhancement of antitumor effect of secondary lymphoidtissue chemokine. J. Immunol. 173: 4919–4928.
14. Sun, X., M. Valel, E. Leung, J. R. Kanwar, R. Gupta1, and G. W. Krissansen.2003. Mouse B7–H3 induces antitumor immunity. Gene Ther. 10: 1728–1734.
15. Fields, R. C., K. Shimizu, and J. J. Mule. 1998. Murine dendritic cells pulsed withwhole tumor lysates mediate potent antitumor immune responses in vitro and invivo. Proc. Natl. Acad. Sci. USA 95: 9482–9487.
16. Asavaroengchai, W., Y. Kotera, and J. J. Mule. 2002. Tumor lysate-pulsed den-dritic cells can elicit an effective antitumor immune response during early lym-phoid recovery. Proc. Natl. Acad. Sci. USA 99: 931–936.
17. Tamura, H., H. D. Dong, G. F. Zhu, G. L. Sica, D. B. Flies, K. Tamada, andL. Chen. 2001. B7–H1 costimulation preferentially enhances CD28-independentT-helper cell function. Blood 97: 1809–1816.
18. Dong, H. D., G. F. Zhu, K. Tamada, and L. Chen. 1999. B7–H1, a third memberof the B7 family, co-stimulates T-cell proliferation and interleukin-10 secretion.Nat. Med. 5: 1365–1369.
19. Dong, H. D., S. Strome, D. R. Salomao, H. Tamurai, F. Hirano, D. B. Flies,P. C. Roche, P. C. Roche, J. Lui, G. Zhui, et al. 2002. Tumor-associated B7–H1promotes T-cell apoptosis: a potential mechanism of immune evasion. Nat. Med.8: 793–800.
20. Wang, G., M. Tschoi, R. Spolski, Y. Y. Lou, K. Ozaki, C. G. Feng, G. Kim,W. J. Leonard, and P. Hwu. 2003. In vivo antitumor activity of interleukin 21mediated by natural killer cells. Cancer Res. 63: 9016–9022.
21. Herweijer, H., and J. A. Wolff. 2003. Progress and prospects: naked DNA genetransfer and therapy. Gene Ther. 10: 453–458.
22. Wiendl, H., M. Mitsdoerffer, V. Hofmeister, J. Wischhusen, A. Bornemann,R. Meyermann, E. H. Weiss, A. Melms, and M. Weller. 2002. A functional roleof HLA-G expression in human gliomas: an alternative strategy of immune es-cape. J. Immunol. 168: 4772–4780.
23. Rubinstein, M. P., A. N. Kadima, M. L. Salem, C. L. Nguyen, W. E. Gillanders,and D. J. Cole1. 2002. Systemic administration of IL-15 augments the antigen-specific primary CD8� T cells response following vaccination with peptide-pulsed dendritic cells. J. Immunol. 169: 4928–4935.
24. Liu, B., A. M. DeFilippo, and Z. Li. 2002. Overcoming immune tolerance tocancer by heat shock protein vaccines. Mol. Cancer Ther. 1: 1147–1151.
25. Hori, S., N. Takashi, and S. Shimon. 2003. Control of regulatory T cells devel-opment by the transcription factor Foxp3. Science 299: 1057–1061.
1419The Journal of Immunology
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from
26. Fontenot, J. D., M. A. Gavin, and A.Y. Rudensky. 2003. Foxp3 program thedevelopment and function of CD4�CD25� regulatory T cells. Nat. Immunol. 4:330–336.
27. Cobbold, S. P., R. Castejon, E. Adams, D. Zelenika, L. Graca, S. Humm, andH. Waldmann. 2004. Induction of foxp3� regulatory T cells in the periphery ofT cells receptor transgenic mice tolerized to transplants. J. Immunol. 172:6003–6010.
28. Terabe, M., and J. A. Berzofsky. 2004. Immunoregulatory T cells in tumor im-munity. Curr. Opin. Immunol. 16: 157–162.
29. Mocellin, S., E. Wang, and F. M. Marincola. 2001. Cytokines and immune re-sponse in the tumor microenvironment. J. Immunother. 24: 392–407.
30. Janssen, E. M., E. E. Lemmens, T. Wolfe, U. Christen, M. G. von Herrath, andS. P. Schoenberger. 2003. CD4� T cells are required for secondary expansion andmemory in CD8� T lymphocytes. Nature 421: 852–856.
31. Marzo, A. L., B. F. Kinnear, R. A. Lake, J. J. Frelinger, E. J. Collins,B. W. Robinson, and B. Scott. 2000. Tumor-specific CD4� T cells have a major“post-licensing” role in CTL mediated anti-tumor immunity. J. Immunol. 165:6047–6055.
32. Corthay, A., D. K. Skovseth, K. U. Lundin, E. Røsjø, H. Omholt, P. O. Hofgaard,G. Haraldsen, and B. Bogen. 2005. Primary antitumor immune response mediatedby CD4� T cells. Immunity 22: 371–383.
33. Wang, H. Y., D. A. Lee, G. Peng, Z. Guo, Y. Li, Y. Kiniwa, E. M. Shevach, andR. F. Wang. 2004. Tumor-specific human CD4� regulatory T cells and theirligand(s): implication for immunotherapy. Immunity 20: 107–118.
34. Onizuka, S., I. Tawara, J. Shimizu, S. Sakaguchi, T. Fujita, and E. Nakayama.1999. Tumor rejection by in vivo administration of anti-CD25 (interleukin-2receptor �) monoclonal antibody. Cancer Res. 59: 3128–3133.
35. Nagler-Anderson, C., A. K. Bhan, D. K. Podoksky, and C. Terhorst. 2004. Con-trol freaks: immune regulatory cells. Nat. Immunol. 5: 119–122.
36. Piccirillo, C. A., and A. M. Thornton. 2005. Cornerstone of peripheral tolerance:naturally occurring CD4�CD25� regulatory T cells. Trends Immunol. 25:374–380.
37. Simmons, W. J., M. Koneru, M. Mohindru, R. Thomas, S. Cutro, P. Singh,R. H. DeKruyff, G. Inghirami, A. J. Coyle, B. S. Kim, and N. M. Ponzio. 2005.Tim-3� T-bet� tumor-specific Th1 cells colocalize with and inhibit developmentand growth of murine neoplasms. J. Immunol. 174: 1405–1415.
38. Khademi, M., Z. Illes, A. W. Gielen, M. Marta, N. Takazawa, C. Baecher-Allan,L. Brundin, J. Hannerz, C. Martin, R. A. Harris, et al. 2004. T cells Ig- andmucin-domain-containing molecule-3 (TIM-3) and TIM-1 molecules are differ-entially expressed on human Th1 and Th2 cells and in cerebrospinal fluid-derivedmononuclear cells in multiple sclerosis. J. Immunol. 172: 7169–7176.
1420 sTim-3 INHIBITS T CELL-MEDIATED IMMUNE RESPONSE
by guest on February 16, 2018http://w
ww
.jimm
unol.org/D
ownloaded from