SPECTRUM OF TP53 TUMOR SUPPRESSOR GENE

MUTATIONS AND CODON 72 POLYMORPHISM IN

PAKISTANI FEMALE BREAST CANCER PATIENTS

ISHRAT AZIZ

M.Phil. (Punjab)

Dissertation in partial fulfillment of the requirement for

the award of Ph. D degree in Biological Sciences from

University of the Punjab, Lahore, Pakistan

School of Biological Sciences, University of the Punjab,

New Campus, Lahore 54590, Pakistan.

2011

A thesis submitted to university of the Punjab for the award of Ph. D degree in Biological Sciences (Molecular Genetics)

SPECTRUM OF TP53 TUMOR SUPPRESSOR GENE MUTATIONS IN

PAKISTANI FEMALE BREAST CANCER PATIENTS

By

ISHRAT AZIZ

M.Phil. (Punjab)

Supervisor

Prof. Dr. A. R. Shakoori

Distinguished National Professor & Director,

School of Biological Sciences,

University of the Punjab, New Campus,

Lahore 54590, Pakistan.

Place of Work

School of Biological Sciences, University of the Punjab, New Campus, Lahore 54590,

Pakistan.

The pink ribbon is an international symbol of breast cancer

awareness.

CONTENTS

Page no. Acknowledgements i List of Tables ii List of Figures iii Abstract v Introduction 1

Breast morphology and cancer 1 Possible causes of breast cancer 4 Tumor suppressor gene, TP53 gene 6 TP53 protein 8 TP53 pathway in normal cell 11 TP53 pathway in breast cancer 18

The TP53 pathway in breast cancer lacking TP53 mutations 18 The TP53 pathway in breast cancer by TP53 mutations 22

Sporadic mutations by TP53 gene 23 TP53 and hereditary breast cancer 23 TP53 gene polymorphisms 24 Progression in research on TP53 26 Status of breast cancer research in Pakistan 28 TP53 gene studies in Pakistan 32 Present study 35

Materials and Methods 36 Questionnaire preparation for patients and determining the status of Molecular epidemiology 36

Subjects 36 Sample preservation and transport 36 Pedigrees of families included in the present study 37

Family no. 1 37 Family no. 2 37 Family no. 3 38

DNA isolation 39 From blood samples 39 From frozen tissue 39

PCR amplification of specific region of Tp53 gene 40 Mutation detection 41 Heteroduplex formation 41 Mutation detection by temporal gradient gel electrophoresis (TTGE) 41 Sequencing of PCR amplified product 42 Analysis of TP53 mutations by IARC bioinformatics tools 42 Detection and restriction analysis of codon 72 polymorphisms 42 Analysis of questionnaires for determining epidemiology of breast cancer and the status of TP53 gene mutations in Pakistani population 43

Results 44 Mutations in exon 5-8 of TP53 gene. 44

Normal population 44 Sporadic breast cancer patients 45 TP53 gene mutation detection in familial breast cancer 49

Codon 72 polymorphism of TP53 gene. 51 Normal subjects 51 Sporadic breast cancer patients 52 Breast cancer families 53

Family 1 and family 2. 53 Family 3(Li.Fraumeni Syndrome family (LFS) 55

Epidemiological considerations based upon the samples included in this study 56 TP53 non- mutated patients 56

Provincial representation 56 Education status 57 Income level and feeding habit 57 Smoking status 58 Exposure to X-rays and type of food used for cooking food 58 Age of visitation 59 Menarche 59 Marital status 60 Number of children 60 Size of tumor 61 Hormonal level and nature of carcinoma 61 Familial breast cancer 63 Breast cancer patients with TP53 mutated genes 63

Conclusion. 65 Discussion. 66

TP53 gene mutations and polymorphisms in normal population of Pakistan 66 TP53 mutations 67

TP53 gene mutations in sporadic breast cancer patients of Pakistan 67 TP53 gene mutations in familial breast cancer patients 68

TP53 gene mutations in Li. Fraumeni Syndrome 68 TP53 polymorphism 69 Molecular significance of TP53 gene mutations detected in the present research 70 Significance of TP53 gene mutations and breast cancer in Pakistan 72

An early event in breast tumorigenesis 72 Frequency of mutations and its clinical value 73 Relation of BRCA1 to TP53 gene mutations 73 Relation of codon 72 polymorphism to TP53 gene mutations 74 Hotspots mutations of TP53 gene 74 Importance of the CpG site in TP53 mutations 74 TP53 as an epidemiological tool to test mutations in breast cancer 75 Prognostic significance 75 Predictor of the response 76

Relationship of TP53 gene mutations to classical and molecular epidemiology of breast cancer in Pakistan 76

Geographic variations 77

Urban, rural population and religion. 78 Socio-economic and education status 78 Cooking, eating habits and radiation exposure 79 Addiction and use of contraceptives 80 Early age breast cancer 80 Menstruation status 81 Marital status, parity and breast feeding 81 Family history 82 Clinical value of TP53 gene mutations 82

Tumor size 83 Tumor grade 83 Node involvement. 84 Laterality 84 Estrogen/ Progesterone (ER/PR) status 84 Type of Carcinoma 84

Conclusions 85 References 86 Appendices 118

Appendix-1 118

i

ACKNOWLEDGEMENTS

I am very thankful to my best friend, my Allah sohna, who never left me alone whenever I felt alone. Thousands drood and salams on Mohammad (SAW), the ideal of humanity. He taught me that how I can use my work for consoling my own soul by helping others. It is indeed my honor and pleasure to express my gratitude to Dr. A. R. Shakoori, my respected supervisor for his supervision, guidance, precious advice and kind behavior. How to think about a scientific problem beyond the boundaries and to write it in the boundaries of scientific writing rules was taught to me by him. Thank you sir. I am also thankful to Dr. Qasim Ahmed (Shaukat Khanum Hospital & Research Centre, Lahore, Pakistan) and Dr. Ute Hamman (Deutsches Krebsforschungszentrum, division of Molecular Genome Analysis Heidelberg, Germany) for their help in designing my scientific experiments. I am grateful to Higher Education Commission of Pakistan (HEC) for financial support and Central Cotton Research Institute (CCRI) and especially the secretary Pakistan Central Cotton Committee (PCCC), Mr. Gul Mohammad for moral support. The sampling for this research was made possible by the help of breast cancer families, research staff of Mayo hospital and Shaukat Khanum Hospital & Research Centre. I am really grateful to all of them. This work was performed at the School of Biological Sciences, University of the Punjab, Lahore, Pakistan in a friendly and intellectual environment provided by the Diractor General of the School Dr. Mohammad Akhtar, all the directors of school and administrative staff. I am thankful to all of them. I cannot forget the fragrant, brilliant and naughty environment of lab 7 of School of Biological Sciences. The circle of seven talkative persons who love to talk at the same time on same topic with different opinion. So thanks dear friends, Saadat Ali, Mohammad Shahid Nadeem, Akbar Ali, Mohammad Zawar Mustafa, AbduRauf, Shehzada Nadeem and Zaid Ullah. I am thankful to my friends at School of Biological Sciences, Sunbal, Asia and Nazia for their sincere friendship.My especial gratitude are also for Mehwish Khan, Arifa and Dr. Zubair for what they have done for me. My gratitude is for all the members of my family who prayed for my success, my ammi jaan (mother in-law), Qazi Tamam Abdullah (brother in-law); Nadia (sister in-law); Nuzhat (sister in-law); Eram (sister in-law); Hinna (sister in-law); their families and especial thanks to Ibtasam (sister in-law) who made my ways free to complete Ph.D and looked after my home and my children in my absence. The memories of innocent actions of my children, Eehab, Mujtaba and Abdul-Manan always made easy to work at lab. I like to express thanks to my dear brothers Sami, Shafqat , Tausif and beloved sister Iffat who always helped and prayed for my success. May Allah fulfill all the dreams of my father Abdullah (late) and my mother, Parveen who sacrificed their lives for us. How much can I thank my ammaji, Mumtaz and abbaji, Aziz ullah Khan, who reared me till now after the death of my father when I was of eleven years old. I am really thankful to Saad, my husband, for his love, really means for me. And, finally, to all of you that I did not mention in particular, THANK YOU!!!

ISHRAT AZIZ

ii

LIST OF TABLES Page no.

Table I. Genes involved in familial breast cancer 5 Table II. Comparison of the biological activities of the two polymorphic TP53 26 Table III. Primers for amplification of the TP53 gene 40 Table IV. Frequencies (%) of TP53 genotypes in control and breast cancer patients 53 Table V. Frequencies of TP53 genotype among F1 and F2 family members 54 Table VI. Clinical and genetic status of LFS family 56 Table VII. Comparison of breast cancer risk factors in patients having TP53 mutations 63

iii

LIST OF FIGURES

Page no.

Fig. 1. Breast anatomy 1 Fig. 2. Simplified anatomy of the female breast showing the major structural

components of the breast 3 Fig. 3. Progression of the breast cancer 4 Fig. 4.Localization of human TP53 gene is on large arm of seventeenth

chromosome and mapped on 13.1 position 6 Fig. 5. Organization of the humanTP53 gene 7 Fig. 6. Dendrogram showing sequence homology of TP53 gene 8 Fig. 7. TP53: from gene to protine 9 Fig. 8. Anatomy of TP53 gene and protein 10 Fig. 9. Control and release of TP53 11 Fig. 10. TP53 activation pathway by stress signals 12 Fig. 11. TP53 and metabolism 14 Fig. 12. Regulation of life and death by TP53 15 Fig. 13. Human TP53 isoforms 17 Fig. 14. Relationship between BRCA1 and TP53 gene signaling pathway 21 Fig. 15. Pedigree of familial breast cancer patient of family 1 37 Fig. 16. Pedigree of familial breast cancer patient of family 2 37 Fig. 17. Li. Fraumeni Syndrome like characters in Family 3 38 Fig. 18: Amplification of exons 5-8 of TP53 gene from two

tumor samples SKH86 and NUS10 44 Fig. 19. Detection of TP53 mutations in normal samples by

Temporal Temperature Gradient Gel Electrophoresis (TTGE) showing no difference in band mobility pattern 45

Fig. 20. TP53 mutation detection by TTGE in exon 7 of sporadic breast cancer patient SKH85 46 Fig. 21. Sequence of mutated band showing point mutation

at codon 248 in exon7 of TP53 gene 46 Fig. 22. TP53 mutation detection by TTGE in exon 7 of sporadic breast cancer patient, SKH86 47 Fig. 23. Sequence of mutated band showing point mutation at

codon 238 in exon7 of TP53 gene 47 Fig. 24. TP53 mutation detection in exon 8

of sporadic breast cancer patient (NUS-10) 48 Fig. 25. Sequence of mutated band showing point mutation at

codon 278 in exon 8 of TP53gene 48 Fig. 26. Detection of TP53 mutations in exon 5-8 of familial samples by

Temporal Temperature Gradient Gel Electrophoresis (TTGE) showing no difference in band mobility pattern 50

Fig. 27. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood samples of normal subjects 51

Fig. 28. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood samples of sporadic breast cancer patients 52

Fig. 29. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood,

iv

tumor and normal samples of sporadic breast cancer patients 52 Fig. 30. RFLP gel (4%) showing TP53 codon 72 polymorphism

in blood, tumor and normal samples of sporadic breast cancer patient 53 Fig. 31. RFLP gel showing TP53 codon 72 polymorphism in family 1 and 2 54 Fig. 32. RFLP gel showing TP53 codon 72 polymorphism in family 3 (LFS) 55 Fig. 33. Breast cancer patients from four provinces of Pakistan,

that reported at ShaukatKhanum Memorial Cancer Hospital for treatment and included in the present study 57

Fig. 34. Education status of patients registered at SKMCH 57 Fig. 35. (A) Income level and (B) feeding habit 57 Fig. 36. Smoking status of breast cancer patients 58 Fig. 37. Rays emission to cancer patients 58 Fig. 38. Age of patients at visitation 59 Fig. 39. Status of menarche 59 Fig. 40. Marital status, contraceptives use and menstruation 60 Fig. 41. Number of children of breast cancer patients 60 Fig. 42. Status of breast cancer 61 Fig. 43. Status of breast cancer 62 Fig. 44. Family history of breast cancer patients 63 Fig.45. 3 dimentional structures of TP53 gene mutations in breast 71

v

ABSTRACT

The tumor suppressor gene TP53 encodes a nuclear protein that prevents the cells from

dividing before DNA damage is repaired. Mutations in TP53 gene have effects on its

biological activities. The objectives of present study aims at determining the frequency TP53

mutations in sporadic, genetic lineage and analysis of the data i.e. questionnaire collected

from breast cancer patients from Pakistan, during the study.

Female breast cancer patients were recruited at Shaukat Khanum Memorial Cancer Hospital

& Research Centre and Mayo Hospital, Lahore Pakistan, from January 2005-December 2008.

A total of 150 sporadic breast cancer patients and three families with breast cancer cases

were included in the study. From all study participants, a blood sample and a piece of tissue

of normal and tumor both were collected. DNA was extracted and exons 5-8 (central region)

of TP53 gene were PCR amplified. Each sample was heteroduplexed with a normal control

sample (confirmed by sequencing). To screen TP53 mutations Temporal Temperature

Gradient Gel Electrophoresis (TTGE) was performed. The mutations were confirmed by

sequencing. Restriction Fragment Length Polymorphism (RFLP) was used for understanding

the status of codon 72, exon 4 of TP53 gene polymorphism (arg/arg) in Pakistan. The data

was analyzed using the R15 programme, provided by International Agency for Research on

Cancer. Three deleterious mutations were detected in the sporadic breast cancer patients, viz.,

codon 238 where TGT is mutated to TAT (cys to tyr), codon 248 where CGG is mutated to

CAG ( arg to glu), and codon 278 where CCT is mutated to TCT (pro to ser). These

mutations were not detected in normal breast tissue and blood samples of these patients. R15

analysis (IARC, 2011) of TP53 gene mutations showed that the mutations detected in

Pakistani breast cancer patients are reported most prevalent somatic mutations (codon 238 =

79 tumors, codon 248 = 779 tumors and codon 278 = 74 tumors) in breast cancer patients of

the world. Three-dimensional structures were predicted by 3D Viewer (software given on

IARC website) and found that all these three mutations are in DNA binding region of TP53

and could change the structure of protein and, therefore, affect its function. TP53 mutation

has not been observed in normal persons and breast cancer families blood samples. One

family was detected with Li-Fraumeni syndrome characters but TP53 mutations are not

found in it.

Although the polymorphism arg/arg, codon 72, exon 4 of TP53 gene is reported as a

functional relevant polymorphism that contributes to breast cancer development yet in the

vi

present study, genotype arg/pro and pro/pro, both polymorphisms were found more

significant in Pakistani breast cancer patients as compared to arg/arg with corresponding ratio

of arg/pro (53.3): pro/pro (34.6): arg/arg (12). Normal controls showed about the same

difference in ratio of arg/pro: pro/pro: arg/arg, (50:40:10).

Correlation of TP53 mutations with clinicopathological parameters (data collected by

questionnaire) was observed. Patients were divided into two groups; group 1 (TP53 non

mutated) and group 2 (TP53 mutated). As both groups have not shown any difference so no

prominent correlation between TP53 mutations and clinicopathological parameters was

found.

It is concluded that the frequency of TP53 gene mutations in DNA coding region (5-8 exon )

is low in Pakistani breast cancer patients. However, present study is in favor of the fact that

the frequency of TP53 gene mutations is different in different geographical areas. Genotype

arg/arg is less prevalent in the female breast cancer patients and normal population of

Pakistan. There was no significant correlation between TP53 mutation and tumor

aggressiveness e.g. nodal status, size, ER/PR, histopathology etc. Epidemiologically, no

carcinogen was found important as a causative factor of TP53 gene mutations in Pakistani

breast cancer patients.

1

INTRODUCTION

Breast morphology and cancer

The human breast is the upper ventral region in primates having left and right sides.

Both men and women develop breasts from the same embryological tissues. Female

contains the mammary gland that secretes milk used to feed infants. Anatomically, the

breasts are glands which produce milk in women and attached to rib’s wall by pectoral

muscles (Fig. 1). Each breast has one nipple surrounded by the areola and has several

sebaceous glands. The mammary glands are distributed throughout the breast. These are

drained to the nipple by 4 -18 lactiferous ducts, each duct has its own opening. The

remainder of the breast is composed of connective tissue (collagen and elastin) and

adipose tissue (fat). Each breast has 15 to 20 lobes. Through ducts milk gets to the nipple.

Blood vessels and lymph vessels are also present in the breast. The lymph nodes are

small, equal to pea and filter the lymph. Most of these nodes are under the arm (Reid and

Robert, 2008).

Fig. 1. Breast anatomy.

Upon receiving a pro-mitotic extracellular signal, G1 cyclin-CDK (Cycline dependent

kinases) become active to prepare the cell for S phase, promoting the expression of

transcription factors which promote the DNA replication. Unregulation of the cell cycle

components may lead to tumor formation. Some genes like TP53 etc. when mutate, may

cause the cell to multiply uncontrollably, forming a tumor (Cooper, 2000).

2

Primarily, the breast cancer begins in the cells of milk producing glands, or lobules

which are the passage for milk from the lobules to the nipple with little involvement of

the stromal tissues. The tumor cells may invade the healthy tissue of the breast and if they

get way into the lymph nodes they have a path to other parts of the body (Kumar et al.,

1997). The older cells remain alive along with new cells which formed regularly result in

the mass of extra cells called tumor (Oncolink, 2007; Reid and Robert, 2008). Following

changes take place in the breast, at stromal, ductal and glandular level due to any

abnormality in signaling pathway (Fig. 2):

Type I cyst

Type II cyst

Papiloma

Ductal hyperplasia ( malignant form is ductal carcinoma)

Sclerosing adenosis ( malignant form is inflammatory carcinoma)

Fibrocystic ( malignant form is lobular carcinoma)

Fibroadenoma ( malignant form is lobular carcinoma)

Figure 2 shows important histologic structure of breast where appearance of

common lesions usually appear. More severe form of these lesions causes breast cancer.

The breast cancer may be ductal cancer (effects the ducts), lobular (begins in the lobes of

the breast and often is found in both breasts) and inflammatory cancer (the breast appears

swollen and hot) (Grey, 1918; Reid and Robert, 2008). Formation of lump or thickening

in the breast or underarm, change in size or shape of the breast, nipple discharge or nipple

turning in scaling of the skin or nipple and ridges or pitting of the breast skin are

symptoms for alarm. The development of breast cancer can pass through the following

five stages:

Stage 0:

Recognized by abnormal cells

i. lobular carcinoma in situ, LCIS, lining the gland in the breast. This is a risk

factor for the future development of cancer, but this is not a cancer itself.

ii. ductal carcinoma in situ, DCIS, lining the duct.

LCIS is a risk factor for future development of cancer. Whereas women with DCIS have

an increased risk of getting invasive breast cancer in that breast.

3

Fig. 2. Simplified anatomy of the female breast showing the major structural components of the breast. The anatomic location of different lesions, the histology and sites of origin of potential lesions (taken from Santen , 2010).

Stage I: The tumor is less than 1 cm across, and has not spread into the surrounding

areas.

Stage II: The cancer is anywhere from 1-2 cm across, and has spread into the

surrounding areas including the lymph nodes.

Stage III: Cancer in the advanced stages, more than 2 cm across and has spread to the

lymph nodes. A type of cancer, associated with this is called inflammatory breast

cancer, the breast is inflamed because cancer is blocking the lymph nodes.

Stage IV: the cancer has spread out in the whole breast and the lymph nodes.

Remission: there is extremely high risk of reoccurrence of cancer in the first 5 years

after the absence of last known cancer.

Fig. 3. explains the progression from the earliest changes to breast cancer takes 5-10

years, based upon cancer doubling times of 1-6 months (Santen , 2010).

4

Fig. 3. Progression of the breast cancer. gradual progression from the HELU ( hyperplastic elongated lobular unit), ADH ( atypical ductal hyperplasia), DCIS and invasive breast cancer (IBC).

Possible causes of breast cancer

The sporadic breast cancer is caused by environmental factors, including

geographical variations (Denissenko et al., 1996), diet (Colditz et al., 1995), age (Hedau

et al., 2004), age of menarche, age of menopause, nulliparity, age of first child (Parkin et

al., 1992), chemical exposure, radiation, contraceptives intake (Stanford et. al., 1995),

smoking, alcohol intake (Perera et al.,1982) and due to gene mutations like TP53 (Martin

et al., 2003).

The Aneuploidy, change in chromosomal numbers and nucleotide changes are the

basis of origins of breast cancer. It is also related to many risk factors e.g. life-styles

associated with the hectic, consumer based trends of western countries. Like, the

consumption of more calories, eating fewer nutritive foods, doing less exercise, leading

to early menarche, obesity and ingestion of naturally occurring compounds which

quenches the free radicals and reduce oxidative stress on DNA.

A woman having family history (a mother, sister, or daughter with breast cancer),

previous history of breast cancer and having a genetic mutation, is more susceptible to

5

breast cancer (Martin et al., 2003). Three to ten percent of breast cancers may be due to

BRCA1 or BRCA2 gene or any of these genes with relation to TP53. If a woman is found

to carry either mutation, she has a 50% chance of getting breast cancer before she is 70

(IARC, 2011).

National institute of cancer of America (2011) has observed that breast cancer is

the most common malignant tumor in women of America and Europe. Every woman has

a risk of breast cancer. About 200,000 cases of breast cancer were diagnosed in the

United States in 2001. Breast cancer is the second cause of cancer death in American

women after lung cancer. The lifetime risk of any particular woman getting breast cancer

is about 1 in 8. Estimated new cases of 207,090 (female); 1,970 (male) and deaths 39,840

(female); 390 (male) from breast cancer were reported in the United States in 2010.

Table I: Genes involved in familial breast cancer (Bennett et al., 2000).

Disease Gene(s) Function Locus

Hereditary early onset breast

cancer BRCA1

cell cycle & DNA

repair 17q

BRCA2 DNA repair 13q

Ataxia-telangiectasis ATM DNA repair 11q

Cowden’s disease PTEN signal transduction &

cell cycle

10q

Li-Fraumeni syndrome TP53 cell cycle & DNA

repair

17q

CHK2 cell cycle & DNA

repair

Hereditary non polyposis colon

cancer also involved in familial

breast cancer

MSH 2, MLH

1

DNA repair 2p, 3p

PMS 1 & 2 DNA repair 2q, 7p

MSH6 DNA repair 2p

Human cancer or neoplasia is called as genetic disease at cellular level. Several

genes are involved in tumorigenesis (Table I). Nowel (1992) has explained the process

that the activation of transforming genes and inactivation of tumor suppressor genes get

started side by side. Detection of genetic disorders at DNA level is an important event in

6

tumorigenesis. In this process expression of genes causes production of unique proteins

in certain organs which governs the signals in cell cycle. These genes may get clustered

in certain families and populations and act like a genetic marker to understand the

epidemiology of disease and genetic susceptibility of certain populations (Oliver et al.,

2009). One of these genetic markers is TP53 which is widely used as prognostic marker

for understanding the genetics of certain population and epidemiology of certain endemic

disease like breast cancer.

Tumor suppressor gene, TP53 gene

TP53 with gene bank accession no. NM_000546; MIM#191170. It has

chromosomal location 17p13 (Fig. 4) and has eleven exons (Fig.5). The gene

encompasses 20 kb of DNA; 3.0 kb mRNA and 1179 bp open reading frame. Two new

genes homologous to TP53 have been discovered, p73, localized at lp36 and p63

localized at 3q27 (IARC, 2011). The reported work of Soussi et al. (2011) shows that

TP53 gene consists of 20303 nucleotides expressed into 393 amino acids. Out of eleven

exons. the first is non coding.

Fig. 4. Localization of human TP53 gene is on large arm of seventeenth chromosome and mapped on 13.1 position. The arrow indicates the 17p13.1 position on chromosome.

Functionaly active exons are, exon 2 (1-25 amino acids), exon 3 (26-33 amino

acids), exon 4 (34-126 amino acids), exon 5 (127-187 amino acids), exon 6 (187-225

amino acids), exon 7 (226-261 amino acids), exon 8 (262-307 amino acids), exon 9 (308-

332 amino acids), exon 10 (333-367 amino acids), exon 11 (368-393 amino acids).

7

Fig. 5. Organization of the humanTP53 gene. 22 000 bp; 11 exons (blue) coding for a 2.2 Kb mRNA. Translation begins in exon 2. Sizes of exons and introns are shown in bp (Taken with permission from Soussi , 2011).

TP53 gene is used as a model for study of molecular epidemiology. According to

Dumaz et al. (1994) for studying the origin of mutagenesis in the human population, a

model gene must exhibit the following properties:

i. Must be mutated in a large number of cancers.

ii. Mutation rate must be high

iii. Must be of small size and should alter mainly by point mutations.p

Dumaz et al.(1994) suggested that at present these characteristics are found in two

genes, the HRAS (Harvey rat sarcoma viral oncogene homolog (Homo sapiens))

oncogene and the TP53 gene. One of the disadvantages of HRAS is the less number of

codons (three) that are the target of mutations. In contrast, more than 100 of the 393

codons in the TP53 gene can be mutated. TP53 like gene is located also in other animals.

On the basis of sequence homology, Soussi et al. (2011) has given the evolutionary tree

(Fig. 6). TP53 gene is located on different chromosomes in other mammals (Vousden and

Lane, 2007):

chromosome 17 Chimpanzee chromosome 16 Macaque chromosome 11 Mouse chromosome 10 Rat chromosome 5 Dog chromosome 19 Cow chromosome 12 Pig chromosome 11 Horse

8

chromosome 2 Opossum

Fig. 6. Dendrogram showing sequence homology of TP53 gene (taken with the permission from Soussi., 2011). TP53 protein

In human, tumor repressor protein TP53 is encoded by the TP53 gene. The name

TP53 is given due to its molecular mass apperaence. It runs as a 53-kilo-Daltan proteine

on polyacrylamide gel. But on the basis of its amino acids residues, TP53’s mass is only

43.7 kDa. The high number of proline residues in the protein slows its migration and it

appears heavier (Ziemer et al., 1982). It comprises 393 amino acids. It is localized in

nucleus, widely expressed and it has five conserved domains between species. TP53

activity lost in human cancer by mutation of the TP53 gene itself and by loss of cell

signaling upstream or downstream (Vousden and Lane, 2007). TP53 can be divided into

five domains, from N-term to C-term (Baker et al., 1989; Crawford, 1983; Cho et al.,

1994; Soussi et al., 1994) (Fig.7).

I. A transactivation domain (1-42 codons)

II. A proline rich domain (63-97 codons)

III. A specific DNA binding domain (zinc binding) (102-292 codons)

IV. A tetramerization domain that includes a nuclear export signal (325-355 bp) with

nuclear localization signals (305-322 codons)

V. A negative regulatory domain (360-393 codons).

9

Fig.7. TP53: from gene to protin. TP53 gene which is localized on chromosome no. 17, has eleven exons and transcribed into a protein of five domains (transactivation domain (1-42 codons); Proline rich domain (63-97 codons); specific DNA binding domain (102-292 codons) (zinc binding); A oligomerization domain that include a nuclear export signal (323-356 bp) and a negative regulatory domain (360-393 codons). Phosphorylation and acetylation sites of protein are located in oligomerization and regulatory domains (taken from IARC., 2011). .

TP53 regulates the cell cycle so it is called as guardian of the genome. It is

encoded by a gene, which on mutations results into a cancer. This gene is mutated by

several ways e.g. genetic factors, viruses like adenoviruses and human papilloma viruses

(IARC, 2011). Mutations in TP53 gene are considered as the single most common cancer

DNA alteration and ultimately high susceptibility to cancer formation (Debra and

Leonard, 2007). Most of the TP53 gene mutations are clustered between exons 5 and 8

and are localized in four evolutionailry conserved domains i.e. domain II- V (Levine et

al., 1991, Caron-de-Fromentel and Soussi, 1992). Berns et al.(2000) found that 90%

mutations residing in DNA binding domain were related with the poorest prognosis.

These findings were confirmed by Soussi et al. (2011) where patients with missense

mutations affecting DNA binding or zinc binding displayed a very aggressive phenotype

with a short survival.

From N-terminus to C-terminus the eleven exons of TP53 are divided into three

major regions which are functionally important (Fig. 8) (Takahashi et al., 1989; Feki and

Irminer-Finger, 2004). The first functionally significant region is L2 loop (exon 6-7)

which is important for folding and stabilization of central part of the protein; L3 loop

(exon 7) containing 248 residue which contacts DNA directly and LSH motif (exon 8)

10

contacts DNA directly. According to IARC (2011), 90% of TP53 mutations are reported

from core domin having structural motifs.

Oren et al. (1981) reported that TP53 has a half-life of about 20 min and is

generally located in the cell nucleus. The protein is found in the cytoplasm during G1

then enters the nucleus during the G1/S transition, where it remains until the end of the

G2/M phase, after DNA synthesis it again is found in the cytoplasm Shaulsky et al.

(1990). TP53 preserves the genetic integrity of the cell by arresting the cell division to

repair DNA damage. As the tumor cells contain mutant TP53 so they are not able to

receive a growth arrest signal. If cell is incapable of DNA repair, TP53 would induce cell

death by inducing apoptosis (Lane et al., 1992).

Fig. 8. Anatomy of TP53 gene and protein. TP53 consists of 20303 nucleotides and 393 amino acids.

There are eleven exons. Functionaly active exons are, exon 2 (1-25 amino acides), exon 3 (26-33 amino

acides), exon 4 (34-126 amino acides), exon 5 (127-187 amino acides), exon 6 (187-225 amino acides),

exon 7 (226-261 amino acides), exon 8 (262-307 amino acides), exon 9 (308-332 amino acides), exon 10

(333-367 amino acides), exon 11 (368-393 amino acides). N- terminus (Amino terminal), contains a large

number of acidic residues, no basic residues and a large number of prolines (including many Pro-Pro pairs)

and is transcriptional activation domain of TP53 gene. Core domain (central region) of the protein which

contains several very hydrophobic regions and very few charged amino acids. This region is important for

the sequence specific complex with DNA binding. C-termius (carboxy terminal) is very hydrophilic and

contains many charged residues. It contains a domain necessary for the TP53 oligomerization, one primary

and two secondary nuclear localization signal sequences, mediated non specific DNA binding. Several

structural domains are involved in DNA binding region, L2 loop (exon 6-7) important for folding and

stabilization of central part of the protein; L3 loop (exon 7) containing 248 residue which contacts DNA

directly and LSH motif (exon 8) contacts DNA directly. According to IARC (2011), 90% of TP53

mutations are reported from core domain having structural motifs.

L2 LSHL3

11

TP53 pathway in normal cell

TP53 is situated at the crossroads of a network of those signalling pathways

which are important for cell growth, regulation and apoptosis, induced by genotoxic and

non-genotoxic stresses. In normal unstressed cells, the level of TP53 is downregulated by

the binding of proteins such as MDM2 that promote TP53 degradation via the ubiquitin

pathway. As MDM2 is up regulated by TP53, it leads to a regulatory loop which keeps

TP53 level very low in a normal cells (Vousden & Lu, 2002). After stresses, activation of

TP53 takes place in two steps process. First TP53 protein level is increased by the

inhibition of its interaction with MDM2. Second, a series of modulator (kinases,

acetylases) will activates TP53 transcriptional activity. The phenomenon of control and

release of TP53 is illustrated in (Fig. 9).

Fig. 9. Control and release of TP53. After genotoxic or non-genotoxic stresses, activation of TP53 takes

place in two steps process. First TP53 protein level is increased by the inhibition of its interaction with

MDM2 and the other negative regulators. Second, a series of modulator (kinases, acetylases) will activates

TP53 transcriptional activity.

Release of the tight control over TP53 and activation of TP53 is a well established

response to stress. TP53 is sensitive to even low levels of DNA damage. According to

Vousden and Lane, (2007) after activation of TP53 many proteins have been found to

bind various regions of TP53 in order to regulate the specificity of its activity (Fig. 10).

Stress signals activate the pathway, the mediators intercept the pathway signals (ATM

sensitize the DNA damage, Chk2 is protein kinase involves in cell cycle arrest, P19ARF

12

stabilizes the TP53 by blocking shuttling of Mdm2). Mdm2 is negative regulator of TP53

so the mediators save the stability of TP53 activity in this main switch. The effectors of

this signaling pathway includes p300 and CBP which are the members of co activator

family, apoptosis stimulating protein of TP53 (ASPP1) and tumor necrosis factor

receptor-associated factors (TRAF and PCAF) (Soussi et al. 2011).

Fig. 10. TP53 activation pathway by stress signals. Upstream mediators (ATM, Chk2, p19, etc) detect the upstream signals. The master switch get off and after breaking the MDM2- TP53 relation, core regulation of TP53 takes place by its interaction with many proteins (ASPP family etc.) modulate its stability. After breakage of TP53-MDM2 relation by the help of effectors, downstream events get activated mainly transcriptional activation of transducers causes angiogenesis, growth arrest, DNA repair and apoptosis .

13

Downstream signaling (Fig. 10) includes a large series of genes that are activated

by the transactivating properties of TP53. This occurs by specific DNA binding of the

TP53 protein to a TP53 response element (TP53 RE) that is found either in the promoter

or in the intron of target genes. Regardless of the type of stress, the final outcome of

TP53 activation is either cell cycle arrest and DNA repair or apoptosis, but the

mechanism leading to the choice between these fates has not yet been discovered

(Vousden and Lane, 2007). In the case of downstream pathway, the active TP53

enhances the protein-protein interaction during transcriptional activation of transducers

(GD1, Glyceraldehyde 3- phosphate dehydrogenase;TSP1, Thrombospondin

antiagiogenesis; p21, RAS protein activator; The 14-3-3 (sigma) protein, a negative

regulator of the cell cycle, is a human mammary epithelium-specific marker that is

downregulated in transformed mammary carcinoma cells; Gadd45- Growth arrest and

DNA repair enhancer); p48, suppresses UV induced mutagenisis; p53 R2, ribo-

nucleotide reductase; XPC, Xerodermum pigmatosum gene; BAX gene of Bcl2 gene

family and involves in apoptosis; Puma is also modulator of apoptosis; Pig3, involved in

TP53 mediated cell death, Noxa, also a member of Bcl2 family and involves in apoptosis,

DR5, TNF-receptor family member and involves in apoptosis and FAS is considered as

receptor of death at surface of cell). The outcome of TP53 pathway is in the form of

angiogenesis, growrh arrest, DNA repair and apoptosis.

Recent studies have indicated a role for TP53 in determining the response of cells

to nutrient stress and in regulating pathways of glucose usage and energy metabolism

(Fig.11). Levine and Oren (2009) explained that metabolic stress results in low glucose

levels which activate TP53 through a pathway that involves AMP kinase (AMPK) and

has been proposed to contribute to the short-term survival of cells. . However, the loss of

this response in tumors that lack functional TP53 might also contribute to the capability

of these cells to continue to proliferate in nutrient-poor conditions, and so provide a

proliferative advantage to tumor cells that are attempting to grow abnormally. TP53 has

been shown to induce the expression of the copper transporter SCO2, which is required

for the assembly of cytochrome c.

14

Fig. 11. TP53 and metabolism. In response to nutrient stress, TP53 can become activated by AMP kinase (AMPK), promoting cell survival through an activation of the cyclin-dependent kinase inhibitor p21. Other functions of TP53include regulating respiration, through the action of SCO2, or in decreasing the levels of reactive oxygen species (ROS), through the actions of TIGAR (TP53-inducible glycolysis and apoptosis regulator).

One of the most interesting functions of TP53 is in the regulation of lifespan,

although whether TP53 helps or hinders the ageing process of human is not yet clear but

Sharpless and DePinho (2004) had observed that even a slight constitutive hyper

activation of TP53 results in an alarming premature ageing phenotype in mice. Vousden

and Lane (2007) had designed a model which explains the role of TP53 in deciding the

cell survival and death in condition of stress. In this model, TP53 responds to conditions

of low stress to play an important part in decreasing oxidative damage, and provides

repair functions to mend low levels of DNA damage. These activities of TP53 contribute

to the survival and health of the cell as well as to the prevention of the acquisition of

tumorigenic mutations, and might contribute to over all longevity and normal

development. By contrast, acute stress that results in a more robust induction of TP53

leads to the activation of apoptotic cell death and thereby the elimination of the damaged

cells (Fig.12).

15

Fig. 12. Regulation of life and death by TP53. TP53 responds to conditions of low stress to play an important part in decreasing oxidative damage, and provides repair functions to mend low levels of DNA damage. These activities ofTP53 causes the survival and health of the cell as well as the prevention of tumorigenic mutations, and control over all longevity and normal development. By contrast, acute stress that results in a more induction of TP53 leads to the activation of apoptotic cell death and so the elimination of the damaged cells.

TP53 protein has eight alternative splicing isoforms. The first isoform was first

described in 1987 (Matlashewski et. al., 1987). TP53 has following isoforms along with

wild type full length TP53 protein (Soussi et al., 2011) (Fig. 13).

(a) Wild type full length TP53

(b) TP53 beta: alternative splice of intron 9

(c) TP53 gamma: alternative splice of intron 9

(d) Delta 40: Initiation of translation at codon 40.

(e) Delta 40 beta: Inition of transition at codon 40,alternative splice of intron 9

(f) Delta 40 gamma: Initiation of translation at codon 40 alternative splice of intron 9

(g) delta 133: initiation of translation at codon 133

(h) delta 133 beta: initiation of translation at codon 133 + alternative splice of intron 9

(i) delta 133 gamma: initiation of translation at codon 133 + alternative splice of

intron 9

16

These isoforms are expressed in a wide range of normal tissues, so that the internal

promoter and the splicing of TP53 can be regulated. Moreover, TP53 protein isoforms

have different subcellular localizations, suggesting that each isoform can have different

biological activities.

Immunofluorescence experiments of the TP53 isoforms revealed that delta133p53

and p53beta are mainly localized in the nucleus with a minor staining in the cytoplasm.

Additionally, p53gama was found in the nucleus in most cells and in the cytoplasm in

some others, suggesting that p53gama could be shuttling between the nucleus and the

cytoplasm and that its subcellular localization can be regulated. Furthermore,

delta133p53beta protein was seen in the nucleus and the cytoplasm in most cells, with

10% of cells revealing the formation of delta133p53beta foci in the nucleus. Whereas

delta133p53beta and delta133p53gama isoforms differonly by the last 15 carboxy-

terminal amino acids, dalta133p53gama is exclusively localized in the cytoplasm,

indicating that the carboxy-terminal amino acids can modify the subcellular localization

of these isoforms (Bourdon et al., 2005).

TP53 isoforms can regulate fate of cell outcome in response to stress, by

modulating TP53 transcriptional activity in a promoter and stress-dependent manner. The

TP53 isoforms are abnormally expressed in several types of human cancers, suggesting

that they play an important role in cancer formation. The determination of TP53 isoforms

expression may help to link clinical outcome to TP53 status and to improve cancer

patient treatment. So the TP53 isoforms are expressed both at the mRNA and protein

levels. Moreover, the abnormal expression of the TP53 isoforms in different cancer types

suggests that their differential expression may disrupt the TP53 response and contribute

to tumor formation. Furthermore, it may provide an explanation to the difficulties in

many clinical studies to link TP53 status to cancer prognosis and treatment (Khoury and

Bourdon, 2010). Concerning to breast tissue, normal breast tissue expresses TP53,

p53beta, and p53gama but not the other TP53 isoforms. Only 25% of tumors present a

mutation of the TP53 gene, suggesting that TP53 and its pathway are inactivated by other

mechanisms (Chen et al., 2009).

17

Fig. 13. Human TP53 isoforms (taken with the permission of Soussi et al., 2011). Scheme of the TP53 gene and protein of Homo sapiens. Iniciation of transcription is indicated by red arrows. Exons are numbered. Noncoding exons are represented by blue boxes, intron 9 (i9) is represented by black box and coding exons are represented by white boxes. The size of the boxes is not proportional to the size of the exons. The second row of each diagram represents the protein and the black boxes represent amino-acid domains conserved through evolution. The icon (a) represents the wild type TP53 and remaining icons (b-i) represent the TP53 isoforms.

a) Wild type full length TP53 (393 residues) b) TP53 beta: normal splicing of exon 1-9 and alternative splice of intron 9 c) TP53 gamma: normal splicing of exon 1-9 and alternative splice of intron 9 d) Delta 40: Initiation of translation at codon 40. No splicing of intron 2. Intron 9 is fully spliced e) Delta 40 beta: Inition of transition at codon 40. No splicing of intron 2. Alternative splice of intron

9 f) Delta 40 gamma: Initiation of translation at codon 40. No splicing of intron 2. Alternative splice

with intron 9 g) delta 133: initiation of translation at codon 133. Splicing of exons 5-11. Intron 9 is fully spliced h) delta 133 beta: initiation of translation at codon 133. Splicing of exons 5-9. Alternative splicing

with intron 9 i) delta 133 gamma: initiation of translation at codon 133 + alternative splice of intron 9

18

TP53 pathway in breast cancer

Although the function of TP53 gene is the elimination of abnormal cells and

preventation of the neoplastic development but abrogation of the negative growth

regulatory functions of TP53 occurs in about all human tumors. The TP53 signalling

pathway is in ‘standby’ mode under normal cellular conditions. Activation occurs in

response to cellular stresses and upstream regulatory kinases. There are two TP53

dependent pathways which causes breast cancer:

1. The TP53 pathway in breast cancer lacking TP53 mutations.

2. The TP53 pathway in breast cancer by TP53 mutations.

1. The TP53 pathway in breast cancer lacking TP53 mutations

The frequency of mutations in breast cancer is lower than that in many other

common cancers (IARC, 2011). Following changes are reported in molecular

mechanisms which may affect tumor suppressor properties of wild-type TP53:

Changes in upstream regulators of TP53

ATM- TP53

The normal role of the ATM gene (ataxia telangiectasia) controls cell division and

its mutated form is involved in breast cancer. ATM invades TP53 cascade by affecting the

Chk2 pathway which directly affects TP53 gene. The altered form of the ATM gene is

closely linked to a childhood disorder of the nervous system called ataxia telangiectasia

(AT) which normally afflicts 1 in 40,000 children in the U.S. and 1 in 200,000 worldwide

each year (Hainaut and Hollstein, 2000).

Chk2- TP53

Chk2 is an upstream protein which transduces DNA damage to phosphorylation

of TP53. Chk2 is activated by ATM in response to double strand breaks and catalyses

phosphorylation of TP53. Raman et al., (2002) had studied that Chk2 mutations in

sporadic breast cancers are rare, but a significant proportion of such cases exhibit no or

reduced expression of Chk2.

19

HoxA5- TP53

Analysis of TP53 promoter has revealed the presence of several consensus-

binding sites for the homeo box protein HoxA5. In most of primary breast carcinomas,

expression of HoxA5 is significantly reduced. This is attributable to aberrant methylation

of the Hox A5 promoter (Levine and Oren, 2009).

Changes in TP53 transcriptional target genes:

14-3- 3σ - TP53

Changes in TP53 transcriptional target genes also affect the tumoregenesis

process. One such gene is 14-3- 3σ. This gene was originally identified in squamous

epithelium and down regulated in breast cancer cell lines. It is a direct transcriptional

target for TP53 and helps in maintenance of a G2 checkpoint. Analysis in primary breast

carcinomas showed that despite the absence of intragenic mutation, 14-3- 3σ reveled

methylation-dependent silencing in a very high proportion of cases (Ferguson et al.,

2000).

MDM2 - TP53

An important gene whose expression is directly up regulated by wild-type TP53 is

MDM2. Amplification and overexpression of MDM2 causes TP53 inactivation, but

amplification of MDM2 is not frequent in breast cancer (Quesnel et al.,1994).

p21Waf1 - TP53

p21Waf1 (also known as Cip1) is an inhibitor of the cyclin dependent kinases and

is directly induced by TP53. The Waf1 gene is not a frequent target for mutational

inactivation in breast cancers (Lukas et al.,1997).

PIG8- TP53

One of the most commonly deleted chromosomal regions in breast cancer is

11q23-q25. It contains a number of tumor suppressor loci, including ATM, Chk1 and

PIG8. The important gene is PIG8, a mediator of TP53 dependent apoptosis (Gentile et

al., 2001). So the any change in PIG8 causes impaired apoptosis in breast cancer.

20

Changes in TP53 co activators:

ASPP - TP53

Cofactors stimulate one or more of the wild-type properties of TP53. One such

family with possible involvement in breast cancer is ASPP. Two members of this family

(ASPP1 and ASPP2), are recently described. Expression of either ASPP1 or ASPP2

stimulates the pro-apoptotic function of wild-type TP53 by increasing TP53- dependent

induction of apoptotic effectors such as Bax and PIG3, while expression of non-apoptotic

proteins like p21Waf1 was much less affected. In primary breast cancers lacking TP53

mutation, expression of both ASPP1 and ASPP2 was reduced (Samuels-Lev et al., 2001).

BRCA1 - TP53

Another transcriptional coactivator for TP53 is BRCA1. BRCA1 gene on

chromosome 17q21 comprises about 100 kb of genomic DNA around the marker

D17S855 at 17q21.1 and consists of 24 exons, 22 of which encode a protein 1863 amino

acids long (Miki et al., 1994). The protein has a zinc-finger motif close to the N-

terminus. BRCA1 loss or mutation is highly associated with hereditary breast and ovarian

cancer (Rashid et al., 2006). Altered levels of BRCA1 expression are frequently found in

sporadic forms of breast cancer Malik et al. (2008), suggesting that control of BRCA1

transcription may also play a significant role in tumorigenesis (Siervi et al., 2010). As it

is a transcription factor gene and by ChK2 cascade it interacted with TP53 pathway

(Fig.14). The high proportion of breast and ovarian tumors from BRCA1 patients have

TP53 mutations, so loss of the TP53 checkpoint may further contribute to their tumor

genesis (Soussi et al., 1994; Crook et al., 1997; Xu et al.,1999).

Although somatic mutations in BRCA1 have not been described in sporadic breast

cancer but it is well known that germ-line mutations in BRCA1 causes breast and ovarian

cancer. Marin et al. (2000) have observed the frequency of deleterious TP53 mutations in

172 breast cancer families which have already BRCA1 and BRCA2 mutations. Greenblatt

et al. (2001) reported that patients having both TP53 and BRCA gene disorders have

mutations at A:T base pairs due to influence of DNA repair abnormalities.

21

Fig. 14. Relationship between BRCA1 and TP53 gene signaling pathway

So it may be suggested that BRCA1/BRCA2 function influences the type and

distribution of TP53 mutations seen in breast cancer (Gasco et al., 2003). According to

Blackwood and Weber (1998) and Crook et al. (1998), families with multiple cases of

early-onset of breast and ovarian cancers often carry mutations in tumour suppressor

genes, BRCAI (Chromosome #17) and BRCA2 (chromosome #13).

BRCA2- TP53

BRCA2 encodes a protein of 3418 amino acids. BRCA2 is composed of 27 exons

distributed over 70 kb of genomic DNA (Connor et al., 1997). The highest levels of

expression of BRCA2 have been found in breast. Friedman et al. (1998) and Lee et al.

(1999) also found the involvement of BRCA2 in tumor genesis but no direct relation of

TP53 and BRCA2 had been seen.

According to Bertwistle and Ashworth (1998) the majority (90%) of familial

breast cancers were found due to involvement of high penetrance genes BRCA1 or

BRCA2. Knudsen (1971) suggested that as the sporadic or germline mutations are found

important for most cases of familial breast cancer due to involvement of tumors

suppressor genes (e.g., BRCA1, BRCA2, TP53), so the model for the development of

22

tumors which was proposed by Knudson in his two-hit mutation theory get importance.

According to that theory, “germline loss-of-function mutation is inherited in one allele of

the gene and this is then followed by a second mutation involving a deletion or loss of

function in the remaining normal (wild-type) allele, which then initiates the path to

tumourigenesis”.

TP53 family members in breast cancer

Two structural and functional homologues of TP53 (p63 and p73) have been

described. Exclusive expression of p63 has been studied in myoepithelial cells of breast

cancer. Mutations in p73 are uncommon in human neoplasia, overexpression of p73. The

association of p73 with lymph node metastasis, vascular invasion and high-grade

malignancy is also studied (Dominguez et al., 2001).

2. The TP53 pathway in breast cancer by TP53 mutations

TP53 mutations are found in about 50-55% of all human cancers except breast

cancer (20%) (Hollstein et al., 1994). Most of these mutations are missense and found in

DNA binding sequence area which is important for its tumor suppressor function. The

pattern of missense mutations is important in deciding the status of prognosis in different

cancers (IARC, 2011). According to Petitjean et al. (2007) the intrinsic mutagenicity rate,

loss of transactivation activity and dominant negative activity are the important driving

forces that decides the TP53 mutation pattern.

According to Friedlander et al. (1996) some TP53 mutant proteins can activate

TP53 responsive sequence in the p21 gene (G1 arrest) but not usually the bax gene

(apoptosis). According to Levine (1997), in some cancers, MDM2 gene (an inhibitor of

TP53 transcriptional activation) gets amplified and effects TP53 cascade. The cancer

patients having genetic background of cancer are also important in getting TP53 gene

mutations. Soussi et al. (1994) has reported that four hot spots (codons 175, 248, 249 and

273 in 5-8 exons) contain 28% of all mutations. According to the Andersen et al. (1993),

more than 70% of TP53 mutations are related to 5-8 exons but not hot spot mutations and

about 4.4% of these mutations have been reported only once and their significance needs

to be analyzed.

23

Sporadic mutations by TP53 gene

The occurrence of missense mutations is more common in TP53 gene. Sporadic

mutations of TP53 gene are related to specific carcinogen exposure like tobacco smoke,

aflatoxin and UV etc. Soussi et al. (1994) has observed that TP53 is biological marker of

cancer in certain populations. While Crawford (1983) and Cho et al. (1994) has observed

that mutations in TP53 gene are derived from endogenous processes e.g., from errors

occurring during the various biological processes linked to DNA metabolism. The non-

mutated allele is usually lost. Due to presence of TP53 gene mutations only in tumour

tissue and its absence in healthy tissue from the same patient, Ory et al. (1994) has

suggested that TP53 mutations are truly deleterious and can inactivate TP53 function.

Rossner et al. (2009), has studied that the spectrum of sporadic mutations in

breast cancer is similar to that of other cancers, with less G:C to T:A transversions, and

more A:T to G:C transitions. It was observed in same studies that the frequency of TP53

mutations in breast cancer is related to geographical location, the environmental factors

and ethnicity. Deletions in TP53 gene of breast cancer patients of Japan and higher

frequency of transitions in African-American women had been reported (IARC, 2011).

TP53 and hereditary breast cancer

Hereditary breast cancer accounts for only 5–10% of all cases. Bennett et al.

(2000) has reviewed the population based studies of breast cancer and found that TP53

germline mutations are present in less than 1% of cases, even at young ages. Anderson

(1974) has postulated that the first degree relatives of affected individuals have a

considerably increased risk of breast cancer, and this risk is further increased by an early

age presence of the disease. Additionally, the susceptibility to breast cancer occurs

through both paternal and maternal lines and risk increases according to the number of

relatives affected. The involvement of different types of familial breast cancer genes had

been shown in Table I (page 5). Bennett et al. (2000) and Bertwistle and Ashworth

(1998) reviewed that the majority (90%) of familial breast cancer is due to the BRCA1 or

BRCA2 genes. The germline mutations of high risk cancer genes such as PTEN, TP53

and HNPCC-related genes are quite rare. Malkin et al. (1990) has reported the

association of TP53 gene with a rare Li-Fraumeni syndrome (LFS), an autosomal

24

dominant cancer syndrome in which gene carriers have a high risk of sarcomas in

childhood, breast cancer, brain tumors, leukemia and adrenocortical carcinoma. LFS was

first reported by Li and Fraumeni in 1969. Lavigueur et al. in 1989 and Patel and

Sakamoto in 2006 have reported the LFS incidence in the general population of America

which is rare. Each year, about 5-10 cases of soft tissue sarcoma occur per 1 million

children younger than 15 years. Li et al. (1992) observed no evidence for involvement of

a specific ethnic group for LFS or some frequency based on nationality. Birch et al.

(1994) observed that the probands in LFS families are mostly males diagnosed with soft

tissue sarcoma.

Malkin et al. (1990) reported that in comparison with general population, children

in families with LFS who survive an initial cancer have 83 times more risk of developing

a second cancer. Chances of developing a second cancer are 57% at 30 years after

developing the first cancer. The features of classical LFS are found in very small no, of of

families. Germline mutations of TP53 are present only in a very small number of familial

breast cancer cases outside LFS. Bell et al. (1999) has studied the presence of breast

cancer in LFS which is usually at a very early age (20–30 years) but germline mutations

were not related to the TP53 but Chk2 gene, the gene directly phosphorylates the site

where TP53 binds to Mdm2. This process prevents Mdm2 inhibition of TP53, increasing

the TP53’s stability and enhancing its DNA repairing role in response to DNA damage.

TP53 gene polymorphisms

Polymorphisms are variations in TP53 DNA sequence that have been found in

unaffected human populations. Most of TP53 polymorphisms are located in introns,

outside consensus splicing sites. The functional consequences of most of these single

nucleotide polymorohisms (SNPs) are unknown. Theoretically, they may affect TP53

protein function through enhanced mutability due to altered DNA sequence context,

increased splicing events and tissue-specific expression. According to the database IARC

(2011), as the protein of some intronic polymorphisms has not been described yet so

these polymorphisms are marked by their coding descriptions like intron 1 (c.1-10673

T>C, Hahn et al., 1993), intron 2 (c.74+ 38 C>G, Pleasants and Hansen, 1994), intron 3

(c96+41_96+ 56 del 16, Lazar et al., 1993), intron 6 (c.672+ 31 A>G, Peller et al.,1995),

25

intron 7 (c 782 + 72 C>T, Prosser and Condie,1991), intron 10 (c 1100 + 30 A>T, Buller

et al.,1995).The polymorphisms having defined proein description are codon 21 ( Ahuja

et al., 1990), codon 36 (Felix et al., 1994), codon 213 (Serra et al., 1992) and codon 47

(Felley-Bosco et al., 1993). Codon 72 (Arg/Pro) polymorphism has been reported to have

wide implications (Ara et al.,1990).

Among all these polymorphisms, three have been extensively studied (Whibley et

al., 2009). The Ser47 variant is a rare polymorphism in codon 47. which replaces the

proline residue necessary for recognition by proline-directed kinases. This polymorphism

is functionally significant and shows a decreased ability to transactivate two TP53 target-

genes, p53AIP1 and PUMA, but not other TP53 response genes, and to induce apoptosis

(Li et al., 2002). The intron 3 duplication has been found to be associated with increased

risk of colorectal cancer in a case-control study and correlated with a reduced level of

TP53 mRNA in lymphoblastoid cell-lines (Lazar et al., 1993).

The third most studied polymormphism of TP53 gene is of codon 72 which is

located within the proline-rich region. Due to codon 72 polymorphism, three varients are

observed in humans. Which are arg/pro, pro/pro and arg/arg. Although the protein with

arg/arg was reported to be more efficient in inducing apoptosis than the one with the pro

variant however, ethnic differences influenced the codon 72 allele frequencies (Ara et al.,

1990; Delacalle-Martin et al., 1990).

In the Northern hemisphere, the pro allele shows a North-South gradient, from

0.17 in Swedish Saamis to 0.63 in African Blacks (Beckman, 1994). In Western Europe

(France, Sweden, and Norway), North America (USA), Central and South America

(Mexico, Costa-Rica, Peru) and Japan, the most common allele is Arg72, with

frequencies ranging from 0.60 to 0.83. However, frequencies of Pro72 superior to 0.40

have been observed in African-Americans (Jin, 1995). A study suggests that these

latitude-dependent variations may be due to selection related to winter temperature and

not to UV radiation. Shi et al. (2009) observed that low average temperature, but not UV

radiation, was associated with high frequency of Arg72 in Eastern Asia.

IARC (2011) has provided the data for proving the significant association

between the codon 72 polymorphism and risk of cancer, although the results with regard

to most cancers, including breast are still under observation. According to Olschwang et

26

al. (1991) the arg/pro polymorphism is located in a proline rich region (residues 64–92)

of the TP53 protein. The region is involved in growth suppression and apoptosis

mediated by TP53 but not for cell cycle arrest. The two polymorphic variants of wild-

type TP53 have some different biochemical and biological properties (Table II).

Table II : Comparison of the biological activities of the two polymorphic TP53 (Olschwang, 1991). Properties TP53 arg 72 TP53pro72

Sensitivity to HPV protein E6 Sensitive Resistant

Induction of apoptosis High Moderate

Interaction with p73 (in the case

of mutant p53)

High Low

Association with response to

treatment

Poor Better

Interaction with transcriptional

machinery

Low High

Transactivation Moderate Higher

DNA binding Identical Identical

According to Beckman et al. (1994) the distribution of this polymorphism in the

general population is heterogeneous with a frequency of the Pro/Pro haplotype of 16% in

Scandinavian populations and 63% in Nigerian populations. The reason for this

North/South gradient is unknown at the present time. Many studies have investigated

whether one of the haplotypes could be associated with a higher susceptibility to develop

cancers. The results of these studies are very contradictory and have not demonstrated

any highly significant findings.

Progression in research on TP53

Crawford et al. (1981) discovered TP53 in 1979 as a protein which forms

oligomeric complex with the T antigen in the SV40 transformed cells and was considered

as an oncogene (Levine et al., 1991). Later on it was demonstrated that only the mutant

forms of TP53 had transforming properties and the gene was involved in the spectrum of

human cancers. These findings ranked this gene as tumor suppressor gene (Caron-de-

Fromentel and Soussi. 1992). First human TP53 gene was cloned by Matlashewski et al.

27

(1984). Maltzman (1984) demonstrated that TP53 is effected by UV damaged DNA.

Kaston and Kuerbitz (1993) reported the role of TP53 in signal transduction that helped

cells respond to cell damage. According to IARC (2011) TP53 has passed the following

journey from its discovery to 2010.

1979: Discovery of TP53 gene.

1983: TP53 was defined as an oncogene.

1985: Cloning of human TP53 gene.

1989: Wild type TP53 is defined as tumor suppressor.

1990: TP53 is found mutated in Li-fraumeni syndrome.

1990: TP53 is found as transcription factor.

1991: TP53 induces apoptosis.

1992: TP53-/- mice develop tumor spontaneously.

1993: TP53 is associated with worse prognosis in breast cancer.

1994: Discovery of crystal structure of TP53 with DNA.

1996: Hypoxia induces TP53.

1997; Role of Mdm2 with TP53 is discovered in mice.

1997: First TP53 associated gene TP73 is discovered.

1999: 10,000 TP53 mutations are described in human.

1999: TP53 plays role in cell repair.

2002: TP53 accelerates aging in mice.

2002: N-terminally truncated variant of TP53 discovered.

2003: Role of TP53 in remodeling of chromatin.

2004: Wild and mutant TP53 is targeted in gene therapy.

2005: Nine isoforms of TP53 are described.

2006: Direct role of TP53 in metabolism is discovered.

2007: TP53 regulates micro RNA.

2008: A dual role of TP53 in autophagy is discovered.

2009: Deficiency of TP53 plays an important role in cellular reprogramming

and stem cell production.

2010: The isoform D133P53 is directly transactivated by TP53 mediated apoptosis

28

Status of breast cancer research in Pakistan

Islamic Republic of Pakistan is an agricultural country. The administrative

divisions of the country are 4 provinces (Sindh, Punjab, Baluchistan and Pakhtoonkhua),

a territory (Federally Administered Tribal Area), 1 capital territory (Islamabad), and the

Pakistani administered portion of the Jammu and Kashmir region (Azad Kashmir and the

Gilgit-Baltistan).The estimated population of Pakistan is 162,419,946, with an annual

population growth rate of 2.03% (CIA, 2005).

Breast cancer is the most frequent cancer of women in Pakistan. The rate of breast

cancer in Pakistan is the highest in Asia, except for the Jews in Israel. Reproductive

factors as early marriages, multiple births and prolonged breast-feeding are the norm.

Early menarche, late menopause are the possible risk factors along with dietary factors

and obesity. The roles of BRCA1, BRCA2 and other genetic factors have not been

adequately studied in this population (Bhurgri et al., 2006).

Sohail and Alam (2007) reported that about one in every nine Pakistani women is

likely to suffer from breast cancer incidence. The incidence of breast cancer rate in

Pakistani women is higher as compared to the neighboring country India with similar

socio-cultural background; which may be due to the differences in diet, racial or genetic

factors. Mamoon et al. (2009) has compared the status of breast cancer of three decades

in Pakistan and observed that the age of presentation of cancer to doctor remains younger

as compared to the Western countries, decreasing tumor size due to relatively earlier

presentation in some cases, but no specific guidelines were given to the patients for early

presentation.

In absence of proper cancer registry system in Pakistan, the exact number of

patients is not known. However from the reports of research groups working in some

developed urban areas of Pakistan.Most of the work in Pakistan has been done on

determining the incidence rate, risk factors and clinico-pathological study of breast

cancer. A small number of reported works shows the research on molecular and genetic

aspects of breast cancer in Pakistan (Mamoon et al., 2009).

Kakarala et al. (2010) found that the incidence of breast cancer is higher in

Indian/Pakistani women as compared to Caucasians. According to Ahmad et al. (1991)

and Usmani et al. (1996) breast cancer is the most common malignancy in Pakistani

29

women, with an incidence of 15 –26% in the 30 to 49-year-old age group. The highest

incidence of breast cancer is reported from Karachi (Sindh province), the major city of

Pakistan (Bhurgri et al., 2000). According to the website of Shaukat Khanum Memorial

Cancer Hospital 92011) situated in Lahore, Punjab (the second biggest city of Pakistan)

the incidence of breast cancer is highest (24.18%) of all other cancers. Aziz et al. (2003)

from southern Punjab also shows the highest incidence of breast cancer in female breast

cancer patients. Zeb et al. (2008) reported high frequency of breast cancer from

Pakhtunkhua province of Pakistan. The reported work of Hussain et al. (2008) and Hanif

et al. (2009) also confirmed the given results from Pakhtunkhua province.

No study on incidence of breast cancer has been reported from Pakistani

administered portion of the Jammu and Kashmir region (Azad Kashmir), Balochistan and

the Gilgit-Baltistan. From Islamabad, Faheem et al. (2007) has studied the risk factors for

breast cancer in women who attended Nuclear Medicine, Oncology and Radiotherapy

Institute (NORI) hospital, Islamabad. A total of 150 female breast cancer patients were

included in the study. It was concluded that lack of breast-feeding, less parity, and

smoking are most significantly associated with breast cancer in females of Islamabad.

Breast cancer risk factors reported from capital city of Pakistan are comparable to

Western countries probably due to topographical factors and life style resemblance.

Different risk factors are considered liable for highest incidence of breast cancer

in Pakistan. According to Gilani and Kamal (2004) obesity in pre-menopausal women,

late menarche and consanguinity are the risk factors for breast cancer in Pakistani women

having age less than 45 years. Aziz et al. (2004) found a strong association between low

socio economic status, delay in diagnosis and limited access to doctors with advance

stage of cancer.

The paradigm of risk factors, which are seriously effective in western countries

are working inversely in Pakistan. Old age, family history, use of contraceptive, hormone

replacement therapy, exposure to radiation, alcoholism, smoking, higher socioeconomic

class, nulliparity, non breast feeding and unmarried females are considered as more prone

to breast cancer in West but clinico-pathologically the tumor status is not worse (Hall et

al., 2005).

30

In Pakistan however, most of the patients were reported in early age and were

sporadic cancer with no family history. Use of contraceptives, hormone replacement

therapy, radiation exposure, alcoholism and smoking is not common. Breast cancer

patients are usually of lower socioeconomic background. Mulltiparity, breast feeding and

marriages are in vogue. Clinico-pathologically patients came in last stages of cancer on

their first visit to oncologist. Usmani et al. (1996) had reported that most of the patients

came to see doctor when the size of the tumor was greater than 5 cm (66%) in grade III,

the morphological type of cancer was invasive ductal carcinoma (58%) and lymph node

metastases were present in 73% of the patients. They reported that 30-39 years is the peak

age of breast cancer incidence in Pakistani women. Most of the patients are multiparous

with an average of five children.

Ahmed et al.(1997) had carried out a retrospective study of breast cancer on 193

cases that were divided into 2 groups i.e. less than and more than 50 years age groups. In

the former group, 93% tumours were of grades II or III and approximately 51% were

estrogen receptors negative. In more than 50 years age group, 75% tumors were in grade

II and III, with almost 37% being estrogen negative tumors. Majority (75%) of the

patients had over 6 cms lump with equal number having positive lymph node status. All

these factors pointed to the fact that besides presenting late, the Pakistani population has

additional unfavourable prognostic factors.

The epidemiological and clinicopathological study of breast cancer patients in

Pakistan is done by Malik et al. (1992) reported the same results. In western countries, a

sharp increase in the detection of breast carcinoma, due to widespread use of

mammography, has led to a fall in breast cancer severances and mortality (Ahmed et al.,

2009).

The analysis of breast cancer patients data from two authentic institutes of cancer

treatment showed that (71% patients of Institute of Nuclear Medicine of Lahore and 63%

of Shaukat Khanum Memorial Cancer Hospital) presented in grade III and IV of breast

cancer due to lack of awareness of early detection of breast cancer (Gillani et al., 2003).

It is also confirmed by some other researchers that in Pakistani females, breast carcinoma

occurs at a younger age group with large size tumors at the time of first visit to doctor

and had frequent axillary lymph node metastasis. Infiltrating ductal carcinoma was the

31

most common type of tumour with predominance of high grade lesions (Siddiqui et al.,

2000, Malik 2002 and Ahmad et al., 2009).

Usmani et al. (1996) worked on epidemiology of breast cancer in 595 pregnant

and lactating women. They had reported that 61 patients who were pregnant or lactating

came to visit doctor first time at a late stage (70% in grade III) of disease because of

ignorance, social taboos, or fear of hospitalization and operation. The largest diameter of

the breast mass at presentation was 15 cm. Lymph nodes were involved in 70.5% of

cases. Multiparity, young marriages, malnutrition, and unhygienic conditions are ripe in

the rural environment of Pakistan. No oral contraceptives are used. Modern and

conventional methods of treatment did not increase the survival rate of these cancer

patients. Women delayed seeking medical evaluation because of their fears of disease,

disfigurement, and rejection by their husbands. Also implicated were a lack of training in

breast self-examination and the belief breast enlargement resulted from engorgement.

Despite modern treatment methods (mastectomy, radiation, and chemotherapy), the

median survival time was under 36 months in both groups. A survival analysis of

metastatic breast cancer in Pakistani patients was done by Siddiqui et al. (2000) and

noted that overall median survival was 2.83 years. Survival analyses of breast cancer

patients was done at Shaukat Khanum Memorial Cancer Hospital, Lahore, Pakistan by

Badar et al. (2005) and applied the Wilcoxon statistics for testing the equality of disease-

free survival distributions between groups of patients with tumor size greater than 5

versus less than or equal to 5 cm. For overall survival descending order was found with

the increased tumor diameter and nodal involvement. The work of Maqsood et al. (2009)

revealed that the lack of awareness regarding breast cancer and its screening practices are

main factors of worse situation of breast cancer in Pakistan.

Influence of the genetic and molecular factors on incidence of breast cancer has been

studied by some research groups. Liede et al. (2002) had studied the contribution of

BRCA1 and BRCA2 mutations to breast and ovarian cancer in Pakistan. To explore the

contribution of these genetic factors they have conducted a case-control study of 341 case

subjects with breast cancer. Female control subjects were from two major cities of

Pakistan (Karachi and Lahore). The prevalence of BRCA1 or BRCA2 mutations among

case subjects with breast cancer was 6.7%. Mostly mutations were unique to Pakistan.

32

Five BRCA1 mutations (2080insA, 3889delAG, 4184del4, 4284delAG, and IVS14-1A--

>G) and one BRCA2 mutation (3337C-->T) were found in multiple case subjects and

represent candidate founder mutations. The penetrance of deleterious mutations in

BRCA1 and BRCA2 is comparable to that of Western populations. These results suggest

that recessively inherited genes may contribute to breast cancer risk in Pakistan.

Prevalence of BRCA1 and BRCA2 mutations in Pakistani breast and ovarian cancer

patients was also observed by Rashid et al. (2006). The prevalence of BRCA1 or BRCA2

mutations was 42.8% for families with multiple cases of breast cancer, and was 50.0%

for the breast/ovarian cancer families. The prevalence of mutations was 11.9% for single

cases of early-onset breast cancer and was 9.0% for single cases of early-onset ovarian

cancer. There findings showed that BRCA mutations account for a substantial proportion

of hereditary breast/ovarian cancer and early-onset breast and ovarian cancer cases in

Pakistan.

Contribution of BRCA1 germline mutation in patients with sporadic breast cancer of

Pakistan was studied by Malik et al. (2008). From the sequence analysis no germline

mutation, one novel splice site mutation at exon 13 and five missense mutations were

detected. Rashid et al. (2008) has found no association of miscarriage and BRCA carrier

status in Pakistani breast/ovarian cancer patients with a history of parental consanguinity.

Rashid et al. (2008) has also found no association between BRCA mutations and sex ratio

in offspring of Pakistani BRCA mutation carriers.

TP53 gene studies in Pakistan

Due to alarming rate of breast cancer increase, molecular and genetic aspects of

breast cancer has been also studied in Pakistan. The prevalence of polymorphisms and

haplotypes of TP53 in Pakistani ethnic groups has been studied by Khaliq et al. (2000).

They also have investigated TP53 gene mutation (4-9 exons) in forty-one breast cancer

patients. The three biallelic polymorphisms studied in the TP53 gene were 16-bp

duplication in intron 3 and BstU I and Msp I restriction fragment length polymorphisms

in exon 4 and intron 6. The absence of the 16-bp duplication was recorded highest in the

Hazara; Msp I A1 allele frequency was higher in Makrani peoples. The absence of the 16-

bp duplication in combination with the BstU I pro and absence of Msp I restriction site

33

were observed in cancer patients. In the breast cancer patients, ten substitution mutations

were detected in the TP53 gene. The correlation of TP53 mutations with

clinicopathological presentation in seventy-four females with breast cancer has been

studied by Khaliq et al. (2001). Age, tumour size, nodal status and histopathology

assessed in patients with and without TP53 mutations were studied. It was found that ten

patients showed TP53 mutations in their tumor specimens while sixty-four had normally

functioning TP53 gene. Patients were divided into two groups, A (normally functioning

TP53), and B (mutated TP53). Intraductal carcinoma was found most frequent in group

A, while lymph nodes were involved in 67.19% in group A and 60% in group B. The age

of patients and clinical parameters (tumour size, nodal status and histopathological

diagnosis) were compared between the two groups and no statistically significant

correlation between TP53 mutations and clinicopathological parameters was found.

Immunohistochemical staining is considered an important tool for seeing the TP53

expression. This technique also provides help in detecting subgroups of those breast

carcinoma patients who are at high risk for decisions regarding chemotherapy. Some

researchers in Pakistan have used this technique for understanding the status of TP53 in

Pakistan. Aziz et al. (2001) had studied the relationship of TP53 expression with

clinicopathological variables and disease outcome in breast carcinoma patients. They

studied the expression of TP53 protein immunohistochemistry in 315 patient's tumour

specimens of infiltrating ductal carcinoma of breast from 1992 to 1997. These patients

also had axillary lymph nodes sampling. Axillary lymph node metastasis had found

significantly correlated with positivity of TP53 expression. Over expression of TP53 was

not proved as an independent prognosis marker. Bukhari et al. (2008) had reported a new

TP53 immunohistochemistry (IHC) scoring system. They concluded that the newly

proposed TP53 IHC scoring system will help histopathologists in making their

differential diagnosis among benign, premalignant, and malignant tumors. The

relationship of immunohistochemistry and scores of altered TP53 protein expression was

found closely related to the habits of the patients and histological grades and stages by

Bukhari et al. (2009) who worked on squamous cell carcinoma patients of Pakistan.

Estrogen and progesterone receptor and TP53 expression relation has been studied in

male breast carcinoma of Pakistani patients by Jamal et al. (2009). They reported that 45

34

cases of male breast carcinoma, including all the histological subtypes were assessed with

original pathology reports of each case investigated for the age, laterality of breast,

histological type of tumour and tumour grade. Tumour blocks of each case were retrieved

for immunohistochemical staining of estrogen and progesterone receptors and TP53

expression. According to their study majority of the cases were above 65 years of age,

invasive ductal carcinoma was the predominant carcinoma, estrogen- progesterone (ER

and PR) receptor was found positive in 95.5% of the cases and in 77.7% of the cases

TP53 gene expression was positive.

Except in Li faumeni syndrome families, TP53 gene mutations are not very frequent

in germline breast cancer cases. Ginsburg et al. (2009) have studied the TP53 gene

mutations in germline breast cancer patients of Pakistan. The entire TP53 gene was

screened in the germline DNA from ninty-five women of Pakistan, who were diagnosed

with breast cancer before age 30, and had previously been found to be negative for

BRCA1 and BRCA2 mutations. No TP53 mutation was found.

Status of TP53 gene mutations in other carcinomas had also been studied in Pakistan.

Ali (2009) has searched out the human papiloma virus association and TP53 mutation in

oral cavity cancer (squamous cell carcinoma) of Pakistani patients. A disrupted cell cycle

progression of hepatocytes was reported by Sarfraz et al. (2008) in chronic hepatitis C

virus (HCV) infection. Archival liver biopsy specimens of chronic HCV-infection of

fourty-six patients and five normal persons were analyzed by immunohistochemistry

using antibodies against proliferation marker Mdm-2, G1 phase marker Cyclin D1, S

phase marker Cyclin A, cell cycle regulators p21 (CDK inhibitor) and TP53 (tumor

suppressor protein), apoptotic protein Caspase-3 and anti-apoptotic protein Bcl-2. They

found an arrested cell cycle state in the hepatocytes of chronic HCV infection, regardless

of any association with genotype 3. They studied that cell cycle arrest is characterized by

an increased expression of p21, in relation to fibrosis, and of TP53 in relation to

inflammation. Furthermore, expression of p21 was independent of the TP53 expression

and coincided with the reduced expression of apoptotic protein Caspase-3 in hepatocytes.

The altered expression of these cell cycle proteins in hepatocytes which is suggestive of

an impaired cell cycle progression, could limit the regenerative response of the liver to

ongoing injury, leading to the progression of disease.

35

Present study

As the nature of TP53 mutations gives clues on the mechanisms that might have

caused the mutation and the presence of a TP53 mutation may provide information of the

tumor response to treatment and patient survival. In the absence of any previous

comprehensive study on TP53 gene mutations in breast cancer patients of Pakistan, it is

important to comprehensively investigate the prevalence of TP53 gene mutations and

codon 72 polymorphism in breast cancer patients of Pakistan. The present study aims at

determining the frequency of Sporadic TP53 mutations and codon 72 polymorphism

among the Pakistani breast cancer patients reporting at Shaukat Khanum Memorial

Cancer Hospital and Mayo Hospital of Lahore.

36

MATERIALS AND METHODS

Questionnaire preparation for patients and determining the status of mlecular

epidemiology

Every subject, recruited in this study was required to fill in a consent form

indicating his/her free willingness for participation in this study. A comprehensive

questionnaire aimed at collecting relevant information for epidemiological studies was

also required to be filled in by each participant. Some time the questionnaire was filled in

by research staff, based upon the information provided by the subject. A sample

questionnaire is given in appendix 1.

Subjects

One hundred female breast cancer patients were recruited at Shaukat Khanum

Memorial Cancer Hospital & Research Center, Lahore and fifty patients were recruited at

Mayo Hospital, Lahore, Pakistan, from January 2005- December 2008. The median age

of the patients was 40 years (range 18-65). From all the participants of this study, a blood

sample, normal breast tissue and tumor breast tissues were collected. Besides the above

sporadic breast cancer patients, three families, two from Lahore and one from Multan

were also included in the study. Fifty normal females, ranging from 18-65 years of age

were also included in this study for comparison purpose. These blood samples were

collected randomly from normal females belonging to different areas of Pakistan.

Sample preservation and transport

Blood samples (5-10 ml) were collected and transported to the laboratory in the

School of Biological Sciences in ice boxes at 4°C. The tissue samples (0.2-1g) were

collected in Eppendorf tubes (1.5ml)) and then immediately frozen in liquid nitrogen. The

frozen samples were transferred to the laboratory in dry ice boxes where they were

preserved at -70 °C until further processed.

Processing of stored tissue and blood samples were processed for isolation of

genomic DNA, PCR amplification of different regions of TP53 gene, Temporal

Temperature Gradient Gel Electrophoresis (TTGE), Restriction Fragment Length

37

Polymorphism (RFLP) and sequencing. Further analysis was done on the basis of

bioinformatics of IARC, R15 provided by International Agency for Research on Cancer.

Pedigrees of families included in the present study

Blood samples were collected from the families having incidence of breast cancer

in the family. Numbering of icons is according to the blood samples taken from the

patients and processed.

Family no. 1

Blood samples were taken from seven members of family no 1, belonged to

Lahore, which was extensively prone to breast cancer (Fig. 15).

Fig. 15. Pedigree of familial breast cancer patient of family 1 Square, male; Circle, Female. The solid icons represent the breast cancer patients. No. 1 represents 30 years old female with breast cancer, who married her 40 years old first cousin (#7).

Family no. 2

The blood samples of members of family 2, suffering from breast cancer (Fig.16)

and as belonging to Lahore, were collected for analysis.

Fig. 16. Pedigree of familial breast cancer patient of family 2. The pedigree of a family showing Breast ancer. Relationship of numbering is 1, daughter (40 years) and 2, mother (70 years).

38

Family no. 3 During data collection, I came across a family belonging to Multan having Li-

Fraumeni syndrome (LFS) like characteristics (Fig. 17). The spectrum of tumors, early

age of cancer onset and pathology reports were strongly suggestive of the Li-Fraumeni

syndrome.

Fig. 17. Li. Fraumeni Syndrome like characters in Family 3.: 1 is mother of five children, four

daughters and one son, of which two daughters died at the age of 4 years (e) with brain tumor and the other

at the age of 18 years (d) with soft tissue sarcoma metastasized as breast cancer. Blood was taken from two

daughters (2, 3) and a son (6). Blood samples were taken from three daughters (4, 5, 7) of (a) who died at

the age of 25 years with brain hemorrhage. Out of five daughters of (b) who died at the age of 40 years with

myocardial infection) two (8, 9) were available for sampling.

= normal male; = normal female; = died with (a) brain hemorrhage, (b) myocardial

infarction and = died with cancer (c): brain tumor, (d): soft tissue sarcoma metastasized to breast, (e):

brain tumor.

The following criteria were also used to further confirm the syndrome (Li and

Fraumeni, 1969, 1988). (i) A proband diagnosed with sarcoma when younger than 45

years, (ii) A first-degree relative with any cancer diagnosed when younger than 45 years,

and (iii) Another first- or second-degree relative of the same genetic lineage with any

cancer diagnosed when younger than 45 years or sarcoma diagnosed at any age.

6

39

DNA isolation

From blood samples (Grimberg et al., 1989)

One volume of buffer A (Red blood cell lysis buffer: 0.32 M sucrose, 10 mM Tris

HCl, 5 mM MgCl2, 0.75% Triton-X-100 pH adjusted at 7.6) was added to one volume of

blood and two volumes of cold, sterile, distilled, deionised water, vortexed gently and

incubated on ice for 2-3 minutes. The mixture was spun at 3500 rpm for 15 minutes at

4oC, the supernatant was discarded in 2.5% bleach solution and the pellet re-suspend in 2

ml of buffer A and 6 ml of water, centrifuged at 3500 rpm for 15 minutes at 4oC. 5 ml of

Buffer B ( 20 mM Tris-HCl, 4 mM Na2EDTA, 100 mM NaCl, pH adjusted to 7.4) and

500 µl of 10% SDS was added to pellet. Pellet was resuspended by vortexing vigorously

for 30-60 seconds. Then 50 µl of Proteinase K solution (20mg/ml) was added and then

incubated at 55oC for two hours in a water bath. The samples were cooled to room

temperature and then 4 ml of 5.3 M NaCl solution was added, vortexed gently for 15

seconds, spun at 4500 rpm for 15-20 minutes at 4oC. The supernatant was poured off into

a fresh tube, and an equal volume of cold isopropanol (stored at -20oC) was added. The

tubes were inverted 5-6 times gently to precipitate DNA. The DNA was removed with a

wide bore tip, transfered to a microfuge tube, and washed with 1 ml of 70% ethanol was

left to dry for 15-20 minutes at 37oC, suspended in 300-400 µl of Tris HCl, pH 8.5 and

left to re-dissolve overnight at room temperature. DNA was safely refrigerated.

From frozen tissue (Deb and Deb, 2003)

One gram tissue was placed in 10 ml lysis buffer (20mM Tris-HCl, pH 8.0, 5mM

ethylenediamine tetraaceticacid (EDTA), 400 mM NaCl, 1% sodium dodecyl sulfate and

proteinase K (20mg/ml) was added at 500 µg/ml. The mixture was incubated at 55oC

overnight with gentle constant mixing in a shaker. An equal volume of phenol-

chloroform-isoamyl alcohol (25:24:1) was added to the lysate, mixed gently and

centrifuged at room temperature for 5 min. at 1000x. The upper aqueous phase was

gently transferred to fresh tube to which then an equal volume of isopropanol was added.

The mixture was centrifuged at 13,000x for 15 min. The upper aqueous phase was

removed; 1ml of 70% ethanol was added to the pellet and centrifuged again. Then 70%

40

ethanol was removed and the pellet was dried in a lyophilizer. DNA was dissolved in TE,

pH 8.0 and stored at -20o C.

PCR amplification of specific region of TP53 gene

DNA isolated from blood and breast tissue was screened for TP53 mutations

using the following primers for polymerase chain reaction (Table III). Primer sequences

as reported by Sorlie et al. (2005) were used for mutation detection and those reported by

Langerød et al. (2002) were used for codon 72 polymorphism detection.

Table III. Primers for amplification of the TP53 gene

Table III. Primers for amplification of the TP53 gene

GC= cgcccgccgcgccccgcgcccgtcccgccgcccccgcccg

Amplification of the 4 different fragments representing exons 5-8, was done

according to optimized conditions given below. For 50 µl reaction mixture, following

ingredients were added in an eppendorf tube.

Ingredients Volume (µl)

Taq buffer (Fermentas)

MgCl2 (1.5mM)

dNTPs (2.5mM)

Taq DNA polymerase (5U/µl)

Genomic DNA (100ng)

Primer (F) 10 pmol

Primer (R) 10 pmol

Water

5

3

4

0.5

2

2.5

2.5

30.5

41

PCR amplification conditions for a portion of 5 and 6 exons were: 95 °C for 3

min, 94°C for 30 sec, 35 cycles each of 55 °C for 5 sec, 72 °C for 30 sec and final

extension at 72 °C 4 min. For 7 and 8 exons, the PCR conditions were 95 °C for 3 min,

94°C for 20 sec, 30 cycles each of 56 °C for 20 sec, 72 °C for 30 sec and final extension

at 72 °C for 5 min. PCR products were resolved on a 2% agarose gel and visualized with

ethidium bromide to ensure PCR amplification quality.

Mutation detection

Heteroduplex formation

For visualization of mobility difference between bands of normal and breast

cancer patients, samples in TTGE for mutation detection, heteroduplexes were formed.

PCR product (5 µl) of patient’s sample was mixed with 5 µl PCR product of normal

person’s sample and incubated in thermal cycler for 5 min. at 95 °C, 1 hour at 37 °C and

1 hour at 65 °C and then preserved at 4 °C.

Mutation detection by temporal gradient gel electrophoresis (TTGE)

In TGGE a constant denaturant gel along with a linear increase in the temperature

during electrophoresis is used for separation of PCR products. The optimal

electrophoresis conditions for separation of TP53 exons (5-8) mutants using TTGE were

determined from the theoretical melting profile calculated by the MacMelt computer

program, where the separation were at maximum, and taking into account that

temperature ramping would be performed during the electrophoretic run. The optimal

conditions determined by Alper et al. (2005) and Sorlie et al. (2005) were followed. The

stock solutions including 10% polyacrylamide/bisacrylamide, 1.75X TAE (2M Tris-

acetate, 50 mM EDTA, pH 8.0), 7M urea (210 g urea to 500 ml 1.75X TAE) and loading

buffer (0.1% bromophenol blue) was prepared. 400 µl of ammonium per sulphate (APS)

and 40 µl of TEMED (N.N.N.N-tetramethyl-ethylenediamine) were added to gel solution

just before pouring it into 16x16-cm glass plates with 1mm spacers. Two sets of plates

were used each time. 80 ml gel solution was loaded in two sets of plates (40 ml each) and

let it polymerized for about 60 min.The gel was prerun for about 15 min in the warm

buffer at 130V. PCR product (5 µl) was mixed with 5 µl of loading buffer and loaded into

42

the wells on the gel then electrophoresis was started at 130 V with the temperature range

58-70. The gels were stained in 1.75 X TAE containing 40 µl of ethidium bromaide for 5-

10 min and the bands were visualized on a UV transilluminator.

Sequencing of PCR amplified product

PCR product of the samples which showed different band mobility on TTGE gels

were sequenced for confirmation of mutations. PCR product was purified by DNA

extraction kit (Fermentas). The purified PCR product was quantified by loading the

product on 2% agarose gel. 90-120 ng of that product was loaded on the sequencing

column. The sequencing reactions were performed on an automated 377 ABI Prism DNA

sequencer using Big Dye Terminator Chemistry (Heiner et al., 1998). There are four

different dyes used to identify A, C, G and T extension reactions. Data was analyzed

using ABI sequencing analysis (v.3.41) and LASERGENE-SeqMan software.

Analysis of TP53 mutations by IARC bioinformatics tools

Following steps were involved in analysis of TP53 gene mutations by IARC

bioinformatics tools.

i) Confirmation of mutations by mutation validation tool (MUT-TP53, R15)

(Olivier et al., 2002).

ii) Reconfirmation of mutation by 2008_R2 release of the UMD_TP53

Mutation database (Hamroun et al., 2006).

iii) Analysis of world spectrum (sporadic and germline) of specific TP53

mutations which were detected in the present research

iv) Analysis of prevalence of these mutations

v) Analysis of effect of these mutations on function of protein (TP53)

vi) Analysis of effect of these mutations on structure of protein (TP53)

Detection and restriction analysis of codon 72 polymorphisms

Genomic DNA was amplified by the allele-specific polymerase chain reaction

(PCR), The PCR amplification produced a 199 bp fragment for the Pro allele and two

(113 bp + 86 bp) fragments for Arg as described by the Langerod et al. (2002). One

43

change was made in Langerod’s protocol that instead of using polyacrylamide gel

electrophoresis (PAGE), restricted fragments were visualized in 4% agarose gel which

was proved easier to handle, time saving and economic. The interpretation of bands was

done with the help of DNA ladder run along with the samples. Three types of band

patterns were observed after UV visualization of 4% agarose gel containing ethidium

bromide. Single band of 199 bp fragment size corresponded to homozygous pro

genotype, two bands of 86 bp and 113 bp fragment sizes corresponded to homozygous

Arg genotype, whereas three bands of 86 bp, 113 bp and 199 bp represented the

heterozygous arg/pro genotype. These results were in accordance with the band pattern

described by the Langerod et al. (2002).

Analysis of questionnaires for determining epidemiology of breast cancer and the

status of TP53 gene mutations in Pakistani population

The questionnaires collected from the breast cancer patients, included information

of their history, habits, epidemiological factors and clinic-pathological information which

was analyzed for determining the status of molecular epidemiology of TP53 gene.

Following steps were involved in this process:

i) The data from questionnaires (given to the patients) was transferred to

excel sheets of computer.

ii) Graphs were generated on the basis of collected data.

iii) Analysis of data and its relation to molecular epidemiology of TP53.

iv) Analysis of epidemiological factors detected in the present research in

global scenario.

44

RESULTS

Mutations in exon 5-8 of TP53 gene

The Temporal Temperature Gradient Electrophoresis (TTGE) was used for

detection of mutations in exons 5, 6, 7 and 8. All blood and tumor samples were

amplified for 190 bp band (126-160 codons) in exon 5 (Fig.18A), for 207 bp band (187-

224 codons) in exon 6 (Fig.18B), for 191 bp band (225-261 codons) in exon 7 (Fig.18C)

and for 240 bp band (262-307 codons) in exon 8 (Fig.18D) of SKH-86 and Nus-10.

A B C D

Fig. 18: Amplification of exons 5-8 of TP53 gene from two tumor samples SKH86 and NUS10. A, exon 5; B, exon 6; C, exon 7; D, exon 8. Lane M represents 50bp marker. Normal population

In present study 50 normal females, 25-60 years of age, with no breast cancer

history were selected as a control. Blood samples were proceeded for analysis of exons 5-

8 and their mutation pattern was observed by TTGE. Figure 19 shows TTGE pattern of

various exons of TP53 gene of normal subjects. There was no difference in band mobility

pattern which confirms the absence of mutation in normal samples. To confirm that there

was no mutation in normal samples, every sample was treated as follow:

i) Only PCR samples were loaded in the gel (non heteroduplexed)

ii) Samples were heteroduplexed with cancer patients sample (which was proved

negative for TP53 gene mutations in any of four exons) and then loaded on the gel.

45

A B C

D

Fig. 19. Detection of TP53 mutations in normal samples by Temporal Temperature Gradient Gel Electrophoresis (TTGE) showing no difference in band mobility pattern. A, exon 5; B, exon 6; C, Exon 7; D, exon 8 . M, 50 bp marker; 1(n), non heteroduplexed sample; 1(h), heteroduplexed sample 1; 2(n), non heteroduplexed sample 2; 2(h), heteroduplexed sample 2; 3(n), non heteroduplexed sample 3; 3 (h) heteroduplexed sample 3.

Sporadic breast cancer patients

In the present study, One hundred and fifty breast cancer patients were observed.

For comparative study, three types of samples e.g. blood, normal tissue and tumor tissue

were taken from each patient. For visualizing the difference of band mobility between

normal and mutated samples, every sample was heteroduplexed with a confirmed (by

sequencing) normal sample. In case of mutation detection two bands were observed due

to difference between patient and normal DNA pattern. Out of four exons (5-8),

mutations were detected in exons 7 and 8. The following mutations have been detected:

M 1(n) 1(h) 2(n) 2(h) 3(h) 3(n) 1(n) 1(h) 2(n) M 2(h) 3(n) 3(h) M 1(n) 1(h) 2(n) 2(h) 3(n) 3(h)

1(n) 1(h) 2(n) 2(h) 3(n) 3(h) M

46

1) TP53 mutation was detected in exon 7 of sporadic breast cancer patient,

SKH85 (Fig. 20). No mutation was detected in blood (B) and normal tissue (N) of this

patient. Only tumor tissue (T) showed the difference in mobility of band as compared to

normal.

Fig. 20. TP53 mutation detection by TTGE in exon 7 of sporadic breast cancer patient SKH85. B, Blood, no mutation (one band); N, Normal tissue, no mutation (one band) and T, Tumor tissue, mutation detected (two bands).

The mutated band was sequenced, which showed point mutation at codon 248

(highlighted in following figure, Fig.21).

Query 100 ATGGGCGGCA-GAACCAGAGGCCCA-CCTCACCATCATCACACTG-AA-AC-CCAG 150

|||||||||| ||||| |||||||| ||||||||||||||||||| || || ||||

Sbjct 978 ATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAG 1033

Fig 21. Sequence of mutated band showing point mutation at codon 248 in exon7 of TP53 gene.

According to MUT-TP53, a mutation was detected at codon 248 in which CGG has been

changed to CAG ( Arg to Glu = R to Q). Significance of above given mutation was

searched through data base IARC (2011) and found that it is an important misssense

mutation involving CpG site with genomic description 13380. Prevalence of this

mutation has been reported as a somatic mutation in 779 tumors and as a germline

mutation in 14 Li-Fraumeni families. L3 structural motif (exon 6-7) of TP53 was

involved which includes DNA binding site and protein becomes non functional.

Mutation

B N T

47

2) TP53 mutation was also detected in exon 7 of sporadic breast cancer patient

SKH86 (Fig.22). No mutation was detected in blood (B) and normal tissue (N) of this

patient. Only tumor tissue (T) showed the difference in mobility of band as compared

with normal.

Fig. 22. TP53 mutation detection by TTGE in exon 7 of sporadic breast cancer patient, SKH86. B, Blood, no mutation (one band); N, Normal tissue, no mutation (one band) and T, Tumor tissue, mutation detected (two bands).

The mutated band was sequenced, which showed point mutation at codon 238

(highlighted in following figure, Fig. 23).

ATCCACTACAACTACATGTATAACAGTTCCTGCATGGGCGGCA-GAACCGGAGGCCCA-CCTCACCATCATCACACTG-A

||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||

ATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGA

7174857

Fig. 23. Sequence of mutated band showing point mutation at codon 238 in exon7 of TP53 gene.

According to MUT-TP53 (Soussi et al., 2006), a mutation was detected in sample

SKH86T, at codon 238 in which TGT has been changed to TAT (Cys to Tyr = C to Y).

Significance of above given mutation was searched through data base IARC (2011) and

found that it is an important deleterious misssense mutation, not involving CpG site with

genomic description 13350. Prevalence of this mutation has been reported as a somatic

mutation in 79 tumors and as a germline mutation in 1 Li-Fraumeni families. L3

structural motif of TP53 was involved which includes DNA binding (zinc binding) site

and protein become non functional.

Mutation

T B N

48

3) TP53 mutation was detected in exon 8 of sporadic breast cancer patient NUS-

10 (Fig. 24). No mutation was detected in blood (B) and normal tissue (N). Only tumor

tissue (T) showed the difference in mobility of band as compared to normal.

Fig. 24. TP53 mutation detection in exon 8 of sporadic breast cancer patient (NUS-10). M, 50 bp marker; B, Blood, no mutation (one band); N, Normal tissue, no mutation (one band) and T, Tumor tissue, mutation detected (two bands).

The mutated band was sequenced, which showed point mutation at codon 278,

(highlighted in following figure, Fig.25).

Query 32 GCTTTGAGGTGCGTGTTTGTGCCTGTTCTGGGAGAGACCGGCGCACAGAGGAAGAGAATC

|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||

Sbjct 1057 GCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATC

Fig. 25. Sequence of mutated band showing point mutation at codon 278 in exon 8 of TP53gene.

According to MUT-TP53 (Soussi et al., 2006), a mutation was detected in sample

SKH86T at codon 278 in which CCT has been changed to TCT (Pro to Ser = P to

S).Significance of above given mutation was searched through data base IARC (2011)

and found that it is an important deleterious miss-sense mutation, not involving CpG site

with genomic description 13812. Prevalence of this mutation has been reported as a

somatic mutation in 74 tumors and as a germ line mutation in 2 Li-Fraumeni families. H2

structural motif of TP53 was involved which includes DNA binding (zinc binding) site

and protein becomes non functional.

M T N B M

Mutation

49

All the three type of mutations detected in this study were present in patients of

infiltrating ductal carcinoma. The three mutations presented in this study are missense

mutations due to change of following amino acids:

85T: codon 248 = G : A at CpG

86T: codon 238 = G : A

10T: codon 278 = C : T

TP53 gene mutations in familial breast cancer

The de novo germline mutations of TP53 gene are rare. About 50% of individuals

clinically diagnosed with LFS have a germline mutation in TP53. DNA sequence analysis

of the entire coding region and splice sites of TP53 can detect approximately 95% of

those mutations. Since LFS is an autosomal dominant cancer predisposition syndrome,

each child of an individual affected with LFS has a 50% (or 1 in 2) chance of inheriting

the disease-causing mutation (IARC 2011).

The rare TP53 gene mutations in familial breast cancer were checked in the

present study. During surveying the normal population for taking blood as control

sample, three families (F1: Familial breast cancer, F2: Familial breast cancer and F3:

Li.Fraumeni Syndrome (LFS) family) with breast cancer history were screened. For the

study, blood was taken from each member of family. DNA was extracted. 5-8 exons of

TP53 were amplified and checked for the mutations by TTGE.

For visualizing the difference of band mobility between normal and mutated

samples, every sample was heteroduplexed with a confirmed (by sequencing) normal

sample. No difference in mobility of bands was detected by TTGE (Fig. 26). Thus, the

present analysis may have suggested, whether the Li-Fraumeni syndrome includes

families with a genetic basis other than a TP53 germline mutation or with an inactivation

of this tumor suppressor gene through a mechanism other than a mutation in the coding

region of the TP53 gene.

50

(A) F1 F2 F3

(a) F1 F2 F3

(b)

F1 F2 F3

(c)

F1 F2 F3

(d)

(B)

Fig. 26. Detection of TP53 mutations in exon 5-8 of familial samples by Temporal Temperature Gradient Gel Electrophoresis (TTGE) showing no difference in band mobility pattern. (A) shows the pedigrees of families ; F1: Familial breast cancer, F2: Familial breast cancer and F3: Li.Fraumeni Syndrome (LFS). Icons in the pedigrees were numbered according to the sequence in which blood was taken and processed till TTGE and (B) shows the band pattern of familial breast cancer patients in exon 5-8 of TP53 gene. (a), exon 5; (b), exon 6; (c), Exon 7; (d), exon 8 . M,50 bp marker.

1 2 3 4 5 6 7 1 2 1 2 3 4 5 6 7 8 9 M

M 1 2 3 4 5 6 7 1 2 1 2 3 4 5 6 7 8 9

M 1 2 3 4 5 6 7 1 2 1 2 3 4 5 6 7 8 9

M 1 2 3 4 5 6 7 1 2 1 2 3 4 5 6 7 8 9

F1 F2 F3

51

Codon 72 polymorphism of TP53 gene

There are three polymorphic forms of codon 72 of TP53 gene, arg/pro, pro/pro

and arg/arg. The homozygosity of arg/arg is considered as prone to breast cancer. So for

understanding the pattern of codon 72 polymorphism in breast cancer patients of

Pakistan, DNA from blood of all normal, tumor and familial samples was also used for

analysis of polymorphism of codon 72 of TP53 gene. The technique Restriction Fragment

Length Polymorphism (RFLP) was used. A 199bp unrestricted fragment (Fig. 27) after

restriction with BstUI gave the following pattern for three different polymorphisms:

1. Presence of one band (199 bp) for homozygus proline (pro72/pro72)

(Fig. 27)

2. Presence of two bands (113 bp, 86 bp) for homozygus arginine

(arg72/arg72) (Fig. 27)

3. Presence of three bands (113 bp , 86 bp, 199 bp) for heterozygous

arginine-proline (Fig. 28B)

Normal subjects

Fig. 27. shows the RFLP pattern of codon 72 of TP53 gene in blood samples of

normal subjects. Homozygosity of arg/arg could be recognized as two bands of 113 bp +

86 bp (arg) and of pro/pro as 199 bp.

Fig. 27. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood samples of normal subjects. Pattern of two alleles of 113 bp + 86 bp (arg) and 199 bp (pro), Lane 1, uncut fragment (199bp); lane 2, Homozygus arginine (arg/arg), (lane 3), Homozygus praline (pro/pro); M, 50 bp marker.

1 2 3 M

199 bp 113 bp 86 bp

52

In 50 normal females, frequency of homozygous arginine was 10%; for

homozygotic proline it was 40%, and for heterozygotic arg/pro it was 50 %. Fig. 27

shows the banding pattern of two normal subjects as a reference.

Sporadic breast cancer patients

One hundred and fifty breast cancer patients were observed for arg/pro genotype.

Frequency of homozygotic arginine at codon 72 was 12 %, for homozygotic proline it

was 34.6 %, and for heterozygotic arg/pro it was 53.3 %.Although blood (B) samples

were used for detection of polymorphism (Fig. 28) but only those samples which proved

positive for TP53 gene mutations (SKH-85, SKH-86 and NUS-10) were checked for

codon 72 polymorphisms in tumor tissue (T), normal tissue (N) and blood samples (B)

(Fig. 29, 30 ). SKH-85 showed homozygous (pro/pro), but SKH-86 and NUS-10 (T, N,

B) showed heterozygosity (arg/pro) by showing presence of all the three bands.

Fig. 28. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood samples of sporadic breast cancer patients. A shows uncut fragment whereas B shows fragment restricted with BstUI of codon 72 in exon 4 of TP53 gene of breast tumor tissue of patient SKH 86 and NUS 10. M represents 50 bp marker.

Fig. 29. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood, tumor and normal samples of sporadic breast cancer patients. SKH-85 and SKH-86. Lane 1, normal tissue 85; lane 2, blood 85; lane 3, tumor tissue 85; lane 4, normal tissue 86; lane 5, blood 86; lane 6, tumor tissue 86 and M, 50 bp marker.

199bp 113bp 86bp

85N 85B 85T 86N 86B 86T M

Heterozgous (Arg/Pro)

Homozygous (Pro/Pro)

199 bp 199 bp 113 bp 86 bp

SKH M NUS 86 10

M SKH NUS 86 10

Lanes 1 2 3 4 5 6 7

A B

53

Fig. 30. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood, tumor and normal samples of sporadic breast cancer patient, Nus 10. M, 50 bp marker; lane 2, tumortissue 10; lane 3, blood 10; lane 4, normal tissue 10.

Table IV shows the of frequencies of TP53 genotypes in controls and breast cancer

patients. There is no significant difference between patients and controls regarding allele

frequencies.

Table IV. Frequencies (%) of TP53 genotypes in control and breast cancer patients

Genotypes Patients (%) Controls (%)

arg/arg 18 (12 %) 5 (10 %)

pro/pro 52 (34.6 %) 20 (40 %)

arg/pro 80 (53.3 %) 25 (50 %)

Total 150 50

Breast cancer families

Family 1 and 2

PCR for codon 72 polymorphism detection of familial breast cancer patients

(31A) gave unrestricted fragments (Fig.31B). Fig. 31C shows that electrophoresis in 4%

agarose gel gave an allele pattern for the heterozygus samples (arg/pro) which is different

to homozygous Arginine (arg/arg) and proline (pro/pro). Family1 shows all the three

genotypes of codon 72 polymorphism. The breast cancer patient, her two sisters and

mother are heterozygous arginine-proline (arg/pro), whereas brother is homozygous

arginine (arg/arg), one sister and husband were homozygous proline (pro/pro) (Fig.31C).

Family 2’s samples were amplified and the product was loaded on the gel (lanes 8-9)

(Fig. 31B). Fig. 31C shows the RFLP results. The family shows the genotype,

Heterozygus Arginine/Proline(Arg//Pro)

199 bp 113 bp + 86 bp

M 10T 10B 10N

Lanes 1 2 3 4

54

homozygous Proline (pro/pro) in both samples (lanes 8 and 9). Table V represents

comparison of frequencies of TP53 genotype among F2 and F3 family members. Family

1 has arg/pro genotype and both patients of family 2 have pro/pro genotype.

Family 1 Family 2

Family 1 Family 2

Fig. 31. RFLP gel showing TP53 codon 72 polymorphism in family 1 and 2. A, shows pedigree of families; B, unrestricted 199bp PCR product and C shows fragment restricted with BstUI of codon 72, exon 4 of TP53 gene of families. Family 1: 1, Patient, 2, sister, 3, sister, 4, mother, 5, brother, 6, sister, 7, patient’s husband. Family 2: 8, Mother, 9, daughter. M is 50 bp marker (lane 10). Table V. Frequencies of TP53 genotype among F1 and F2 family members.

Relative F1 F2

Patient arg/pro pro/pro

Mother arg/pro pro/pro

Husband pro/pro

Brother arg/arg

Sister pro/pro

Sister arg/pro

Sister arg/pro

1 2 3 4 5 6 7 1 2 M

199bp

199 bp 113 bp 86 bp

Homozygous Proline (Pro/Pro) Heterozygus arginine and proline (Arg/Pro) Homozygous arginine(Arg/arg)

1 2 3 4 5 6 7 1 2 M

A

B

C

55

Family no. 3 (Li.Fraumeni Syndrome family (LFS)

Fig. 32A shows the pedigree of LFS family, Fig. 32B shows the PCR

amplification before restriction with BstUI and Fig. 32C shows RFLP pattern of two

types of polymorphisms i.e. arg/pro and pro/pro .The family members, f1 (mother of

proband), f4 (f1’s niece), f5 (f1’s niece), f6 (f1’s son) and f7, f8 and f9 (f1’s niece) shows

heterozygus genotype; arginine and proline (arg/pro) and f2 (f1’s daughter), f3 (f1’s

daughter) shows homozygous genotype; proline (pro/pro).

Fig. 32. RFLP gel showing TP53 codon 72 polymorphism in family 3 (LFS). A, shows pedigree of LFS family , B, shows unrestricted 199bp PCR product and C shows fragment restricted with BstUI of codon 72 in exon 4 of TP53 gene. 1, mother; 2, daughter; 3, daughter; 4, niece; 5, niece; 6, son; 7, niece; 8, niece and 9, niece.

Table VI shows the clinical and genetic status of LFS family. It is obvious from

the table that TP53 mutation (5-8 exon) were absent in this family and the clustering of

heterozygous alleles arg/pro which may conforms the phenomenon of genetic

anticipation.

1 2 3 4 5 6 7 8 9 M

199bp

199 bp 113 bp+ 86 bp

Homozygous Proline (Pro/Pro) Heterozygus arginine and proline (Arg/Pro)

1 2 4 5 6 M 3 7 8 9

A

B

C

56

Table VI . Clinical and genetic status of LFS family

No. Sex Family members

(in relation to

F1)

Age(y) at blood samplin-g

Effect of any type of tumor

TP 53 mutation (5-8 exon)

Codon 72 polymorphism

f1 Female mother 56 Non effected

Negative

arg/pro

f2 Female F1’s daughter

21 Non effected

Negative arg/pro

f3 Female F1’s daughter

18 Non effected

Negative arg/pro

f4 Female F1’s niece 10 Non effected

Negative pro/pro

f5 Female F1’s niece 6 Non effected

Negative arg/pro

f6 Male F1’s son 27 Non effected

Negative arg/pro

f7 Female F1’s niece 3 Non effected

Negative arg/pro

f8 Female F1’s niece 16 Non effected

Negative pro/pro

f9 Female F1’s niece 20 Non effected

Negative arg/pro

Epidemiological considerations based upon the samples included in this study

For the determining the influence of epidemiological factors on breast cancer prevalence

and understanding the clinical value of somatic TP53 mutations, the clinical and

molecular data of one hundred and fifty breast cancer patients of Pakistan was assembled.

This data may be helpful in deciding the role of TP53 gene mutations in routine clinical

practice.

Patients were divided into two groups:

1. TP53 non- mutated patients

2. TP53 mutated patients

TP53 non- mutated patients

Provincial representation

Pakistan is divided into four provinces. Ninety two percent of the patients were from the

Punjab provinces, 7% were from Khyber Pakhtunkhua (NWFP) and only 1% was from

Balochistan. There was no patient from Sindh province (Fig. 33).

57

Fig. 33. Breast cancer patients from four provinces of Pakistan, that reported at Shaukat Khanum

Memorial Cancer Hospital for treatment and included in the present study.

Education status

Fig. 34 shows the personal history of breast cancer patients. A, shows that 51%

of breast cancer patients were uneducated (no formal education in school), 19% patients

had primary education (studied till class 2-5), 20% had secondary level (undergraduates)

and 10% were educated till university level (>/graduation).

Fig. 34. Education status of patients registered at SKMCH.

Income level and feeding habit

Fig. 35A shows that only 7% belonged to high income level (>20,000/month).

Fig. 35. (A) Income level and (B) feeding habit.

Punjab92%

N.W.F.P7%

Sindh0% Balochistan

1%

Education status

No education51%

Primary19%

Secondary20%

University level10%

Socio-economic status

High 7%

Middle33%

Low60%

Feeding habit

Vagitarian13%

Fat preference87%

A B

Feeding habit

Vagitarian13%

Fat preference87%

58

33% belonged to middle (>20,000/month) and 60% belonged to lower income

level (>20,000/month). Fig. 35B, shows that only 13% of patients prefer vegetables in

their diet and most of them preferred meet and products made up of animal fat.

Smoking status

Fig. 36 shows the smoking status of breast cancer patients. A, shows that

Fig.36. Smoking status of breast cancer patients. A, Active smoking and B, passive smoking.

3 % were smokers and 97% nonsmoker breast cancer patients participated in the

concerned study. In case of passive smoking (B) 36% patients close relatives (husband,

son, father) were smokers and 64% patients were not passive smokers.

Exposure to X-rays and type of food used for cooking food

IARC (2011) has reported that the X-rays and emissions from biomass (wood),

are also probable human carcinogens. So the information about residential area and the

way of cooking food by the patients was collected. Fig. 37 shows the relationship of

environmental emissions to incidence of breast cancer.

A B

Fig. 37. Assesment of role of exposure to X-ray and the fuel used for cooking on the incidence of

breast cancer patients reported at SKMCH. A, Fuel in use B, exposure.to X-rays.

Fuel in use of patients

Wood as fuel40%

Gas as fuel60%

Wood as fue

Gas as fuel

Cancerious exposure

X. Ray exposure7%

No imp. Exposure84%

Power statioexposure

3%

Sun light exposure6%

Sun

X. R

PowNo i

Relative's (husband, son, father) smoking

smoker36%

nonsmokers64%

Smoking status

nonsmokers97%

Smokers3%

A B

59

Fig. 37 shows the information on the type of fuel used for cooking food (A) and

exposure to X-rays and other carcinogens (B). Fig. 37A that 40% of the patients used

wood as fuel and 60% used gas. Fig. 37B shows that 6% have worked under intense

sunlight, 7% patients had exposure to X-rays and 3% had exposure to power station/

electric cables passing over their residences.

Age of visitation

Fig. 38 shows the age of patients. It was observed that 19 % of patients came to

see doctor at the age of 30 years, 36% of patients at the age of 40 years, 19 % of patients

at the age of 50 years, 10 % of patients at the age of 60 years and 16 % of patients at the

age of 70 years. So majority of patients (74%) visited the physicians in early age, i.e. 30-

50 years.

Fig. 38. Age of patients at visitation.

Menarche

Fig. 39 shows the age at which menarche started. It was 12 years for 11%

patients, 13 years for 42% of patients, 14 years for 28% of patients, was 15 years for 11%

patients, 16 years for 0% patients and 17 years for 1% patients and 18 years for 10% of

patients. It was concluded that early age of menarche was more prominent.

Fig. 39. Status of menarche.

(13 years)42%

(12 years)11%

(14 years)25%

(15 years)11%

(16 years)0%

(17 years)1%

(18 years)10%

<=30 years19%

<=50 years19%

<=60 years10%

<=70 years16%

<=40 years36%

60

Marital status

Fig. 40 shows that out of all the breast cancer patients only 5% were unmarried

and 95% were married. Out of total patients only 8% had used and 92% had not used any

type of contraceptive (B). Out of 150 patients (Fig.40 C) 7% had no regular menstruation

and 93% had regular menstrual cycle.

Fig. 40. Marital status, use of contraceptives and status of menstruation in the breast cancer

patients. A, marital status; B, use of

contraceptives; C, regularity of menstruation.

Number of children

Fig. 41. A shows that 5% breast cancer patients had 1 child, 29% had 2-3

children, 46% had 4- 6 children, 7% had 7-9 children, 5% had 10-12 children and 8%

were nulliparus.

Fig. 41. Number of children of breast cancer patients. A, number of children; B, ratio of child death

(before/after birth); C, breast feeding.

Use of contraceptives

not used92%

used 8%

contracept

not used

No. of childern

</ 3 Childern29%

</ 6 Childern46%

</9 Childern7%

</ 12 Childern5%

nulliparus8%

single5%

</ 3 Childern</ 6 Childern

</9 Childern</ 12 Childern

nulliparus

single

Ratio of childern death (before or after birth)

Childern died49%

Childern alive51%

Manstruation regularity

No regular 7%

regular93%

Breast feeding

Breast feeding (present)

81%

Breast feeding (absent)

19%

Marital status

Married 95%

unmarried 5%

Married unmarried

A B C

A B C

61

Children of 49% patients died before or after birth whereas those of 51% patients

children were all alive (Fig. 41 B). Fig. 41 C shows that 81% patients had breast fed their

children, whereas 19% did not.

Size of tumour

Fig. 42 shows the status of breast cancer. Fig. 42 A shows that 15% patients had breast

tumor size of 0.5-2 cm, 47% of the patients had 2.1- 3.5 cm, 19% had 3.6- 4.5 cm, 12%

had 4.6- 6 cm and 7% of patients had size of 6.1- 9 cm. Fig. 42 B shows the tumor grade:

only 2% patients had their tumors at grade 1, 47% had tumor grade 2 tumors and 51%

had grade 3 tumors. 62% breast cancer patients showed lymph node involvement whereas

38% patients did not shown lymph node involvement (Fig.42 C).

A B C

Fig. 42. Tumour size and tumour grade of breast cancer patients. A, Tumor size; B, Tumor grade; C,

Node involvement.

Hormonal level and nature of carcinoma

Estrogen and progesterone receptors (ER/PR) are the classical markers for

detecting prognosis of breast cancer. ER-/PR- tumors are considered more aggressive

because they do not depend on hormones for growth, so have worse prognosis. With

ER+/PR+ tumors medication has good effect to control the production of hormones, so

these tumors have good prognosis and the chances of survival of patient are high (Taneja

et al., 2010). The report of Immunohistochemistry (IHC) testing for estrogen and

progesterone receptors (ER/PR) was (obtained from patient’s personal history file) done

Tumor size (cm)

tumor size (0.5-2)15%

tumor size (2.1-3.547%

size (3.6-4.5)19%

tumor size (4.6-6)12%

tumor size (6.1-9)7%

Tumor grade

Tumor grade (1)2%

Tumor grade (2)47%

Tumor grade (3)51%

Node status

Node status(positive)

62%

Node status (negative)

38%NodNod

62

by Mayo and Shaukat Khanum hospital’s laboratories. Patients were categorized in four

classes.

ER+/ PR+ (positive expression of estrogen and progesterone

receptor)

ER+/ PR-(positive expression of estrogen and negative expression

of progesterone receptor)

ER-/ PR+ (negative expression of estrogen and positive

expression of progesterone receptor)

ER-/ PR-(negative expression of estrogen and progesterone

receptor)

Fig. 43A shows that 51% patients were ER+/ PR+, 37% were ER-/ PR-, 4%

patients were ER-/ PR+, 8% patients were of ER+/ PR- status. Fig. 43B shows that 86%

patients were suffering from in situ ductal carcinoma, 9% had invasive lobe carcinoma

and 5% patients had both types of breast cancer. Fig. 43C shows that 41% patients had

left breast involvement, 51% patients had right breast involvement, whereas only 1%

patients shows both sides involvement in breast cancer. The data about 7% patients was

not available.

A B C

Fig. 43. Estrogen and progesterone levels of breast cancer patients. A, Estrogen/ Progesterone (ER/PR)

status; B, type of breast carcinoma and C, laterality.

Lateralitydata not obtained

7%

both sides 1%

right breast51%

left breas41%

ER/PR

ER-/PR-37%

ER-/PR+4%

ER+/PR-8%

ER+/PR+51%

Type of Breast carcinoma

ID Ca86%

inv.lob.ca9%

both5%

63

Familial breast cancer

Fig. 44 shows that out of 150 patients 98% had sporadic breast cancer and only 2% had

familial background of breast carcinoma.

Fig. 44. Family history of breast cancer patients.

Breast cancer patients with TP53 mutated genes

Out of 150 breast cancer patients only 3 patients showed mutation in TP53 gene.

Table VII shows the comparison of breast cancer risk factors in patients having TP53

mutations.

Table VII. Comparison of characteristics of breast cancer and the risk factors in patients having TP53 mutations

FACTORS

P53 +IVE

(NUS-10)

TP53+IVE

(SKH-85)

TP53+IVE

(SKH-86)

TP53 mutation detected in the

present research

codon 278

C : T

Codon 248

G : A at

CpG

Codon 238

G : A

Structural dysfunction of TP53 gene

due to said mutation

Reported

IARC (2011)

Reported

IARC (2011)

Reported

IARC

(2011)

Type of codon 72 polymorphism

detected in the present research

arg/pro pro/pro arg/pro

Age >50 years

53 50

Sex female female female

Socio-economic status low low low

Profession house-wife house-wife house-wife

Education non secondary non

Urban and rural population rural rural rural

Family History

Familial2%

Sporadic98%

64

Religion islam islam islam

Knowledge about self examination no no no

Marital status married

married married

Any relative having breast cancer

(degree)

non non non

Age of menarche 13 12 14

Age of menopause

50 50 40

Tumor size >2 cm 2.5cm 7cm

Grade

3 3 3

Presence of tumor in right/left

breast

right right left

Node involvement yes yes yes

ER/PR status positive positive positive

Type of carcinoma IDC IDC IDC

Stage IV III III

Active smoking no no no

Passive smoking no husband husband

Use of contraceptives no no no

exposure to environmental risk

factor

no no no

No. of children 5 4 5

Childern died no no 1

Breast feeding yes yes yes

Ovary discordment no no no

Any other physical problem no no no

Usual diet included (meat

fonder/vegetarian)

mix fat fat

65

CONCLUSION

TP53 gene (5-8 exon) mutations were checked in Pakistani sporadic breast cancer

patients. Three deleterious mutations were detected in the sporadic breast cancer patients,

viz., codon 238 where TGT is mutated to TAT (cys to tyr), codon 248 where CGG is

mutated to CAG (arg to glu) and codon 278 where CCT is mutated to TCT (pro to ser).

These mutations were not detected in normal breast tissue and blood samples of these

patients. TP53 gene mutations were also checked in familial breast cancer patients

including LFS family. No mutation was detected in these families.

In the present study, genotype arg/pro and pro/pro, both polymorphisms were found more

significant in Pakistani breast cancer patients as compared to arg/arg with corresponding

ratio of arg/pro (53.3): pro/pro (34.6): arg/arg (12). Normal controls showed about the

same difference in ratio of arg/pro: pro/pro: arg/arg, (50:40:10). Exon 4 of TP53 gene

polymorphism was also checked in familial breast cancer patients and LFS family.

arg/pro and pro/pro genotypes were found dominant over arg/arg in these families.

Correlation of TP53 mutations with clinicopathological parameters (data collected

by questionnaire) was observed. Patients were divided into two groups; group 1 (TP53

non mutated) and group 2 (TP53 mutated). As both groups have not shown any

difference so no prominent correlation between TP53 mutations and clinicopathological

parameters was found. So it was concluded that TP53 mutations are present in breast

cancer patients of Pakistan but there was no significant correlation between TP53

mutation and tumor aggressiveness e.g. nodal status, size, ER/PR and histopathology etc.

However, TP53 is considered as a strong marker for the prediction of low survival rate

and increased chances of death in breast cancer (Aguiar et al. 2010). So for a better

understanding, further analysis of different types of TP53 mutations in other part of the

gene is required in order to investigate the prognostic potential of this marker in Pakistani

population.

66

DISCUSSION

TP53 gene mutations and polymorphisms in normal population of Pakistan

In the present study 50 normal females (18-65 years) with no breast cancer history

were selected as a control. No mutation in any of the samples for any of the exons 5-8

was detected. According to Mills (2005) in normal cells TP53 is expressed at extremely

low levels (~1000 molecules/cell) but it is strongly induced by cellular stress, DNA

damage, hypoxia or nucleotide deprivation and the concentration increasing by 5- to 100-

fold in most transformed and tumor cells. The TP53 gene mutations in normal population

without genetic lineage have been reported by Nakazawa et al. (1994) in normal skin

after UV exposure. TP53 mutations may however, be present in somatic cells of familial

cancer syndrome like Li fraumeni syndrome (Lovell et al., 2006). Overexpression of

serum TP53 mutation related with Helicobacter pylori infection which causes gastric

cancer was observed by Lopez-Saez et al. (2010) in population of Cadiz (Spain).

In addition to gene mutations, several reports have focused on 14 known

polymorphisms of TP53 gene. Polymorphism at codon 72 in exon 4 was studied both in

normal and breast cancer patients in the present work. Codon 72 polymorphism is

considered important because the presence of homologous arginine (arg/arg) increases

the chances of development of cancer (IARC, 2011).

In the present study pro/pro showed the enhanced frequency in normal population

compared to homologous arginine (arg/arg). The frequency of homozygotic arginine was

10%, for homozygotic proline it was 40%, and for heterozygotic arg/pro it was 50%.

Dumont et al. (2003) have suggested that the TP53 proline 72 variant is associated with

increased risk of cancer due to a decreased ability to induce apoptosis.

Khaliq et al. (2000) had studied the differences in allele frequencies of three

polymorphisms of TP53 gene including codon 72 polymorphism among different ethnic

groups of Pakistan. For comparing the results of present work with Khaliq et al. (2000)

study, allele frequencies were determined using genotypic frequencies for codon 72

polymorphism. It was observed that in present study the allele frequency of Pro allele in

normal persons was 0.65 whereas Khaliq et al. (2000) had reported 0.50 for Punjabi

population. So it may be concluded that as Khaliq et al. (2000) had also reported the

67

apparently higher frequency of Pro allele but this difference may be due to small sample

size of normal persons (50) and gender bias as only female subjects were included in the

present study. Pro allele frequency in normal population is reported to be 0.55 by

Ghasemi et al. (2010) from Iran. According to Mojtahedi et al. (2010) the frequency of

Pro allele varies from 0.17 – 0.63 in populations with different ethnic backgrounds.

TP53 mutations

Sporadic breast cancer patients of Pakistan

Breast cancer is the most common malignancy in Pakistani women, with an

incidence of 15-26% in the 30 to 49 year old age group (Rasool et al., 1987; Ahmad et

al.1991 and Usmani et al. 1996). Most of breast cancers are sporadic and arise from

somatic mutations (Chang et al. 1993; Greenblatt et al. 1994). Approximately 37% breast

malignancies are due to mutations in the TP53 tumor suppressor gene (Mcbride et al.,

1986; Hartmann et al., 1997).

In the present study blood, normal breast tissue and tumor breast tissues of same

patient of one hundred and fifty breast cancer patients were analyzed for mutations in 5-8

exons of TP53 gene. No mutation was detected in any of 5-8 exons of TP53 genes in the

blood samples and normal breast tissues. Point mutations were however detected in the

three tumor tissues.

The mutations detected in the present study were analyzed by MUT-TP53 (Soussi

et al. 2006). A mutation R248Q was found in codon 248 of exon 7 in the sample

SKH85T, collected from Shaukat Khanum Memorial Cancer Hospital and Research

Centre. The composition of codon in this mutation changed from CGG (Arginine) to

CAG (Glutamine). Another mutation C238Y was found in codon 238 of exon 7 in the

sample SKH86T which was also collected from Shaukat Khanum Memorial Cancer

Hospital and Research Centre. In this case the composition of the codon was changed

from TGT (Cystine) to TAT (Tyrosine). The third mutation P278S was found in codon

278 exon 8 in the sample Nus10T collected from Mayo Hospital, Lahore. Composition of

this codon changed from CCT (Proline) to TCT (Serine).

The above described mutations are truly acquired mutations, present only in

tumor tissue and absent in healthy tissue from the same patient. These alterations were

68

found in the highly conserved blocks of TP53 which are functionally important regions of

the protein. The analysis of the properties of these mutants revealed that due to these

mutations in gene, transactivational activity of TP53 may be affected (Ory et al., 1994).

Familial breast cancer patients

No TP53 mutation was detected in any of the families studied. Laloo et al. (2003,

2006) and Walsh et al. (2006) have also reported that it is very difficult to find TP53

germline mutation in families having no relation with Li. Fraumeni syndrome and

BRCA. The comparison of TP53 polymorphisms has also been done in the present study.

Family no. 1 has all the three categories of polymorphisms whereas family 2 is

homozygous for proline.

Li. Fraumeni Syndrome (LFS)

LFS was first reported by two physicians Li and Fraumeni in 1969 but the genetic

basis of LFS remained elusive for many years. Few years before the occurrence of

germline TP53 gene mutations in 6 families with LFS was reported (Birch et al, 1994).

The present study has not confirmed the relationship between LFS family and the TP53

gene (exon 5-8) mutations. It may be due to involvement of some other exons or gene.

Bell et al. (1999) reported that the breast cancer in LFS, which occurs usually at a very

early age (20–30 years), is not related to the TP53 gene. Instead another gene CHK2 gene

was involved.

The LFS family (family 3) in this study showed both pro/pro and arg/pro

polymorphisms. With the passage of time any of these polymorphisms may become more

prominent at an earlier age, due to the phenomenon of genetic anticipation (McInnis,

1996). Anticipation is a phenomenon, as a genetic disorder is passed on to the next

generation, the symptoms of disorder become more prominent at an earlier age. Bougeard

et al. (2006) reported that the distribution of the arg/arg, arg/pro, and pro/pro genotypes

was 41%, 46%, and 13%, respectively in familial breast cancer patients and it was

observed that the mean age of tumor onset in affected carriers of the arg allele was 21.8

years and in pro/pro patients 34.4 years.

69

TP53 polymorphism

Incidence of somatic TP53 polymorphism on the arg72 allele in breast carcinomas

explains that it gives breast epithelial cells a growth advantage, which may enhances the

risk of malignant growth and development of cancer. It may also be possible that the

arg72 changes the ability of mutant TP53 protein to bind and affects the other proteins

such as, TP73 (Dicome,1999).The codon 72 polymorphism has been reported as a

modifier which interacts with TP73-induced apoptosis (Marin, 2000).

It is reported that coexistence of the codon72 polymorphism with a mutation

could modify the TP53 protein structure, causing an altered transcription pattern

(Campomenosi, 2001). So the observation of codon 72 polymorphism along with

mutation status in one hundred and fifty patients was also included in the present study.

The patients who proved positive for TP53 gene mutations were also checked for codon

72 polymorphisms. SKH-85 shows pro/pro but SKH-86 and NUS-10 (tumor tissue,

normal tissue and blood) shows heterozygosity arg/pro. Overall, the status of codon 72

polymorphism in one hundred and fifty breast cancer patients showed that the frequency

was 12 % arg/arg, 34.6 % for pro/pro and 53.3 % for arg/pro.

Since there is found no difference between frequencies of genotypes of patients

and controls so it may be predicted that polymorphisms in codon 72 of TP53 gene was

not associated with breast cancer in Pakistani patients. Our results are in agreement with

similar studies on bladder cancer (Toruner, 2001) and breast cancer (Tommiska et al.,

2005) reported from other laboratories. These results also coincide with those of

Khadang et al. (2007) on breast cancer in Iran but are contrary to some other reports on

prevalence of this polymorphism in cervical cancer (Santos, 2005; Siddique, 2005;

Storey et al.1998, Tenti et al., 2000), lung (Wang et al., 1998; Pierce et al., 2000), colon

(Sayhan et al., 2001), bladder (Kuroda et al., 2003; Soulitzis et al., 2002), skin

(Dokianakis et al., 2002) and breast (Langerød et al. 2002).

The present study shows the dominance of proline genotype compared with

arginine . According to Dumont et al. (2003), the TP53 proline 72 variant is associated

with increased risk of cancer due to a decreased ability to induce apoptosis. Proline allele

as a risk factor for breast cancer is also shown by others (Sjalander et al., 1996 Weston et

al., 1997). Tommiska et al. (2005) suggested that codon 72 polymorphism, particularly

70

the pro/pro genotype, is an independent prognostic factor in patients with breast cancer

and provides evidence that patients harboring this genotype will have a reduced survival.

According to the Langerod et al. (2002), breast cancer patients with the pro/pro genotype

demonstrated less sensitivity to chemotherapy. The dominance of proline allele is also

observed by Khalique et al. (2000). In the present study, frequency of proline is higher

than arginine. A strong association between the arg/arg genotype and breast cancer was

reported in Turkish patients (Buyru et al. 2003). Similarly, Langerod et al. (2002)

reported a growth advantage of breast carcinoma cells with the arginine 72 allele in

Norwegian population. Papadakis et al. (2000) reported arg/arg genotype as a risk factor

for breast cancer in Greek population. In India, the arg/pro genotype in patients with lung

cancer was associated with early progression of the disease, compared with arg/arg

carriers (Jain et al., 2005). Matakidou et al. (2003), however, did not find any

relationship between TP53 codon 72 polymorphism and risk of lung cancer after meta

analysis. Zehbe et al. (1999) also reported a higher risk of cervical carcinoma in patients

harboring the TP53 arginine variant. Some investigators reported an increased frequency

of the arginine allele in breast cancer patients as compared to controls (Wang et al., 1998;

Papadakis et al., 2000; Suspitsin et al., 2003).

As the above discussion showed that both homozygotic polymorphisms arg/arg

and pro/pro along with TP53 gene mutation may cause worse prognosis so it may be

claimed that both the arginine and proline genotypes affect the TP53 gene mutation

pattern but selection of either polymorphism (arg/arg or pro/pro) may be forced by

differences in geographical variation (Tommiska et al., 2005).

Molecular significance of TP53 gene mutations detected in the present research

Three missense mutations detected in the present study (codon 238 = G → A,

codon 248 = G →A at CpG and codon 278 = C→T) in DNA binding region of TP53

and could change the structure of protein and, therefore, affect its function (IARC, 2011).

Fig. 45 shows three-dimentional structures of wild type and mutant forms of human TP53

protein (.gene bank accession no. NM_000546; MIM#191170). Fig. 45 A, C and E

represents the position of codons 238, 248 and 278 in wild-type human TP53 protein. The

red color ribbon (Fig.45 B, D and F) represents the region in the mutant protein where

71

negibouring amino acids residues of mutant amino acids interact abnormally to bring a

change in the protein structure. These structures were predicted by 3D Viewer software

given on IARC website (http://www-p53.iarc.fr/structureanalysis.html). The input

sequences were the gene bank reference sequences for wild-type protein and deduced

protein sequences from mutant gene sequences observed in the present study.

Fig.45. 3 dimentional structures of TP53 gene mutations in breast A) Arrow shows the position of codon 238 on the TP53 structure B) Arrow shows the change in the TP53 structure due to insertion of mutant codon 238 C) Arrow shows the position of codon 248 on the TP53 structure D) Arrow shows the change in the TP53 structure due to insertion of mutant codon 248 E) Arrow shows the position of codon 278 on the TP53 structure F) Arrow shows the change in the TP53 structure due to insertion of mutant codon 278

72

Basicaly two types of mutations were detected in three tumor samples in the present study:

1. G>A in sampes 85T from SKMCH&RC and G>A in sample 86T from

SKHMC&RC

2. C>T in sample 10T from Mayo Hospital

According to Yu (2000), Hoeijmakers (2001) and Eachkoti et al. (2007) the G:C>

A:T transition mutation (G to A or C to T base change) can be the result of silenced O6-

methyl guanine transferase (O6MGMT) allele, bearers of which cannot remove

carcinogen induced O6-methyl guanine adducts and thus seems to be predisposed to

mutations in key genes like TP53. To establish a correlation between the two needs study

of methylation MGMT allele in TP53 mutation bearers.

It is reported by Snyderwine (2007) that the 2-amino-1-methyl-6-phenylimidazo

pyridine (PhIP), a potent carcinogen (a heterocyclic amine) contained in cooked meat and

fish is a major inducer of mammary carcinogenesis because it forms DNA adducts in

human mammary epithelial cells which causes the induction of mutations. This fact is

also proved by rodent model ( Sinha et al., 2000 ).

Significance of TP53 gene mutations and breast cancer in Pakistan

As the present investigation is the comprehensive report on TP53 gene mutations

spectrum in breast cancer patients of Pakistan, the following analysis is based on the

experimental work and the data collected from questionnaires for determining the breast

cancer epidemiology and status of TP53 gene mutations in Pakistani population, in

comparison with similar type of studies done in other laboratories of world.

An early event in breast tumorigenesis

In the present study the clinicopathological data collected from the patients for

identifying the type of breast tumor genesis after a somatic TP53 mutation shows that

infiltrating ductal carcinoma was the pathological event found in 86% of breast cancer

patients. The three sporadic breast cancer patients having TP53 gene mutations were also

characterized by infiltrating ductal carcinoma. Pezeshki et al. (2001) who studied TP53

gene mutations in infiltrating ductal carcinoma, have shown that 17 out of 37 (46%)

infiltrating ductal carcinoma patients showed TP53 gene mutations. Ho et al. (2000) and

73

Done et al. (2001a,b) have shown that TP53 mutations occur in ductal carcinoma in situ

(DCIS) before the development of invasive breast cancer, and that the frequency

increases from around zero in low-grade DCIS to 30–40% in high-grade DCIS. These

results point to an important role of TP53 alterations early in the carcinogenic process of

the breast.

Frequency of mutations and its clinical value

It has been observed from the collected data in the present study that the

frequency of large tumors is higher (47%) than small tumors. Node negative (38%)

patients were found considerably less than the node positive patients (62%). Borresen-

Dale (2003) reported variable frequency of TP53 gene mutations in different populations.

Borresen-Dale (2003) and Oliever et al. (2006) found same common clinical factors in

breast cancer patients i.e. the incidence of positive nodes and larger tumor size with TP53

gene mutations. Present study is also in agreement with the above given facts, as in all

the three TP53 positive breast cancer patients which were checked for mutations in 5-8

exons and their clinical reports verified the presence of positive node status and larger

tumor size.

Relationship of BRCA1 and TP53 gene mutations

The sample Nus-10 which shows TP53 gene mutation in the present study, was

used as a specimen in another study, contribution of BRCA1 germ line mutation in

patients with sporadic breast cancer, (Malik et al., 2008). SSCP analysis and sequencing

confirms the mutation in exon 13, leading to splice site truncation which has not been

reported in Breast Information Core database. Olivier et al. (2002) have reported that

BRCA1 function is gateway to the mutation in TP53 gene. Liede et al. (2002) had studied

Pakistani population for sporadic BRCA1/2 and found 42 out of 341 patients with

BRCA1 mutations. Rashid et al. (2006) have studied the mutation level of BRCA1/2 in

Pakistani breast cancer families, but no relationship of TP53 has yet been studied with

BRCA1 and BRCA2.

74

Relationship of codon 72 polymorphism to TP53 gene mutations

The present study shows 12% frequency of homozygotic arginine, 34.6% for

homozygotic proline and 53.3% for heterozygotic arg/pro at codon 72. As very low

frequency of arg/arg polymorphism has been observed in breast cancer patients so no

direct relation of homozygotic arginine with breast cancer could be suggested. Our results

are in agreement with those from other laboratories. Khadang et al. (2007) did not show

any such relationship in Iranian patients. Whereas Langeod et al. (2002) established an

association between breast cancer and homozygous arginine.

Hotspots mutations of TP53 gene

The spectrum of TP53 gene mutations shows that this tumor suppressor gene

contains multiple hotspots, highly mutable nucleotide which reflects effects of different

endogenous and exogenous factors shaping the mutation process in specific tissues

(Glazko et al., 2006). The hot spot mutation has been detected in codon 248 of SKH85T.

According to the IARC (2011), codon 248 mutation is highly significant in breast cancer.

Khaliq et al. (2000) also reported this mutation from Islamabad, Pakistan. Shojaie and

Tirgari (2008) reported TP53 gene mutations in codon 248 of exon 7 as a risk factor in

Iranian women with breast cancer. Souici et al. (2000) worked on codon 248 and

confirmed it as a risk factor related to environmental carcinogens.

Importance of the CpG site for TP53 mutations

G-A transition mutation has been detected in this study in codon 248 of SKH85T

which is important due to presence of the CpG site, since 35% of germ line mutations in

human diseases occur at CpG dinucleotides, presumably as a result of 5-methylcytosine-

>T transitions (Fearon and Jones, 1992), The establishment and maintenance of DNA

methylation patterns in the mammalian genome are essential for normal development and

the post-synthetic modification of cytosine to form 5-methylcytosine at CpG sites is

catalyzed by a DNA (cytosine-5) methyltransferase. This enzyme catalyzes the

methylation of both unmethylated DNA and hemimethylated DNA generated,

postreplicatively. Surprisingly, 5-methylcytosine also contributes to the formation of an

extraordinarily high percentage of mutations in the tumor suppressor genes in somatic

75

cells. For example, more than 50% of somatic mutations in the TP53 gene occur at CpG

dinucleotides. Magewu and Jones (1994) showed that mutations at codon 248 in exon 7

with C-T and G-A transitions account for at least 10% of the total mutations.

TP53 as an epidemiological tool to test mutations in breast cancer

Borresen-Dale (2003) has shown that the frequency of TP53 gene mutations

varies in different populations due to different risk factors. It is observed in present study

that the frequency of TP53 gene mutations (exon 5-8) is low as compared with these

reported in the west. So it may be predicted that environmental factors and dietary habits

of particular population affects the frequency of TP53 gene variations. Hill and Sommer

(2002) have described the pattern of TP53 mutations which differs among 15

geographically and ethnically diverse populations. Diverse TP53 mutation patterns in

breast cancer are consistent with a significant contribution by a diversity of exogenous

mutagens. According to Hill and Sommer (2002) diet is an important factor which may

affect different frequency of TP53 gene mutations in differnent populations. They proved

the hypothesis that breast tissue may be uniquely sensitive to lipophilic mutagens because

of its different architecture i.e. tiny islands of cancer-prone mammary epithelial cells,

surrounded by a sea of adipocytes. Mammary epithelial cells may be differentially

susceptible to released lipophilic mutagens preferentially concentrated in adjacent

adipocytes and originating in the diet. So it may be concluded that TP53 gene can be used

as a "mutagen test," in breast cancer. The relative frequencies of the different types of

mutation can be used as an epidemiological tool to explore the contribution of exogenous

mutagens vs. endogenous processes in different populations.

Prognostic significance

In the present study, the three mutations detected are alterations of codon 238, 248, and

278. These codons belonged to most important area i.e. DNA binding region of TP53 gene (5-8

exons). According to Borresen et al. (1997) patients with mutations effecting or disrupting

the zinc binding domains L2 and L3 (codons 163–195 and 236–251) have worse

prognosis as compared to the patients with mutations elsewhere. Berns et al. (2000)

found that mutations affecting amino acids directly involved in DNA binding, many of

76

these residing in the zinc binding domain, were related with the poorest prognosis. These

findings were confirmed in a study by Alsner et al. (2000) where patients with missense

mutations affecting DNA binding or zinc binding displayed a very aggressive phenotype

with a short survival. and the prognosis for mutations in the conserved regions was worse

than for mutations in the non conserved regions.

Predictor of the response

The reported studies verify that the mutations detected in DNA binding region (as

in present study) are important predictor of therapy response. Aas et al. (1996) has

observed the affect of doxorubicin (a DNA damaging drug) in 63 breast cancers patients

and found that the patients having mutations in the zinc binding domains had resistance

to the drug. The same research group has also found the same results in an experiment on

90 patients (Geisler et al., 2001). Berns et al. (2000) studied the response of TP53

mutations to tamoxifen (DNA damaging drug). A total of 243 patients were included in

the study. Patients having TP53 mutations in amino acids of DNA binding domain

showed the least response to tamoxifen and chemotherapy. In another study, carried out

by Kandioler-Eckersberger et al. (2000), it was observed that patients having TP53 gene

mutatons and were treated with FEC (fluorouracil, epirubicin, cyclophosphamide)

showed no response. So it may concluded that TP53 mutations have significant clinical

implication and the respected knowledge could be use as an important prediction for

observing the response of cancer treatment.

Relationship of TP53 gene mutations to classical and molecular epidemiological

parameters of breast cancer in Pakistan

That cancer arises from somatic mutations is considered to be derived from

mutagen exposure and endogenous processes. Classical epidemiological studies have

tried to seek associations between cancers in high risk populations and exposures to

mutagens but elusive in the case of breast cancer. So it is important to be equivocal (both

by classical and molecular epidemiology) for studying the pattern of mutations for the

gene like TP53 in which there is at least a fourfold variation in incidence between racially

and geographically diverse populations.

77

Geographic variations

Although the cancer of the breast is one of the leading cancers in Pakistan but the

frequency of TP53 gene mutations observed in present study is low (2%). By comparing

the published reports from Pakistan and all over the world, this astonishing fact was

observed that frequency of TP53 gene mutations is different in different geographical

areas, even in the same country.

The breast cancer patients who took part in present research were considered as

representatives of all over the country because SKMCH&RC and Mayo Hospitals are

tertiary care centers and have referrals from all over the country, yet most of the patients

(92%), were from warm topographic neighbor areas of Lahore, Punjab, Pakistan and have

shown low frequency of TP53 gene mutations. In contrast, Khaliq et al. (2000) worked

on forty-one patients of Islamabad and its related areas which are cold and snowy and

reported 24.4 % of TP53 gene mutations.

The same fact is also evident from the reports from India. Hedau et al. (2004),

found 3% TP53 gene mutations in breast cancer patients of Dehli, India (summer are

long and warm and is 262.79 miles away from Lahore, Pakistan). In contrast, Eachkoti et

al. (2007) reported 44% of TP53 mutations in sporadic breast cancer patients of Kashmir

(coldest areas of India). The distance between Kashmir (occupied by India) and

Islamabad and its related northern areas (Pakistan) is approximately 50 Km (somewhere

it is less than 50 km). Both areas have resemblance in atmosphere and anthropology.

Surprisingly, similar type of trend is observed in other parts of the world. For

example, study in different areas of Japan shows different frequencies of TP53 gene

mutations. Sapporo (Japan) shows 71% (Blaszyk et al. 1996), Aomori (Japan) shows

56% (Hartmann et al. 1996) and Tokyo (Japan) shows 25% of TP53 gene mutations in

breast cancer patients (Tsuda et al. 1993). According to Wikipedia, Sapporo is the coldest

place of Japan, it snows a lot in winter. Aomori is also a famous city of Japan for snow

fall whereas Tokyo has hot humid summer and mild winter.

The frequency of TP53 gene mutations reported from different areas of United

States of America is also variable. According to Oliver et al. (2002) the frequency of

TP53 gene mutations in breast cancer patients of USA is 45%, in Detroit black is 34%

78

(Blaszyk et al. 1994) and in new Orleans black/white is 15% (Shiao et al. 1995). From

western countries it is confirmed by Ambrosone et al. (1996) and Denissenko et al.

(1996) that the pattern of TP53 mutations in breast tumors varies between black and

white women and also between Japanese and western women which suggests that these

groups differ in their environmental exposure to carcinogens or in their susceptibility to

those exposures. According to Shimizu et al. (1991), since Japanese women born and

lived in America has same rate of breast cancer as of American women so it is the

significant effect of environment on the rate TP53 gene mutation of breast cancer and not

the genetic variation.

Urban, rural population and religion

Most of the subjects in present study originated from rural area or suburban areas

who migrated to urban areas. Rana et al. (1997) and Bhurgri et al. (2007) have also

reported similar type of habitat of cancer patients in Pakistan. Feuer et al. (1993),

however, did not find any significant difference in urban and rural population.

Out of 150 breast cancer patients (present study) only one patient was Christian

and was a nun, all the remaining patients were muslims. So distribution on the basis of

religion was not possible yet. Jussawalla and Jain (1977) from India had studied the

frequency of breast cancer among different religious groups. The highest incidence, 1.5–

2.1 times, was observed in Parsi population while the Hindu, Muslim or Christian

populations have low incidence of breast cancer. The three patients detected positive for

TP53 gene mutations in present study were Muslim and belonged to rural areas of

Punjab. Although TP53 relation to ethnic population has been searched out (Khaliq et al.,

2000) but no direct relation to any religion was observed. According to Eachkoti et al.

(2007), nine out of 15 patients having TP53 mutations belonged to rural areas in occupied

Kashmir, India.

Socio-economic and education status

Socio-economic status is an important factor for breast cancer. In present study,

most of the patients belonged to low and lower middle class and low educational status.

From India, Headau et al. (2004) made similar type of observations. It is in contrast with

the findings of Feuer et al. (1993), according to whom women of high socio-economic

79

status are at greater risk of breast cancer than women of low socio-economic status with

possible reasons including differences in reproductive factors, lifestyle factors, and

greater numbers of higher educated women attending mammography screening.

In the present study the three sporadic breast cancer patients detected positive for

TP53 gene mutations belonged to low socio-economic status. Although no significant

study is available for determining the relation of TP53 gene mutations in breast cancer to

socio-economic status of patients yet the socio-economic status is related to life style,

eating habits and exposure to carcinogens, which may influence the ratio of TP53

mutations in a population. Baker et al. (2010) had associated the TP53 gene mutations in

breast cancer patients with low socio- economic background.

Cooking, eating habits and radiation exposure

IARC (2011) has reported that the household coal combustion emissions are

carcinogenic to humans and that emissions from biomass and wood are also probable

human carcinogens. In the present study, wood was in use of 40% people so this factor

may prove a possible risk factor of breast cancer in Pakistani population.

Present study shows that there is high intake of red meat (87%) in breast cancer

patients including patients found positive for TP53 gene mutations. The findings of

Khalique et al. (2000) coincide with the present research. The high intake of fats,

organochlorines and polychlorinated biphenyls which are present in many Pakistani food

stuffs can be implicated to this fact. According to Prera (1982) nutrition plays a causative

role in more then 30% of cancers by the type of food eaten in certain area, amine

generated during the cooking, by certain type of addiction and the chemicals present in

food. It has also been found that intake of red meat increases the glycemic level which

effects the TP53 gene pathway (Slattery et al., 2002). Zheng, (1998) reported that

although meat intake is directly related to the release of heterocyclic amines which cause

breast cancer but the formation of cancer is more dependent on the method of cooking

food. Yet more grilled, broiled and cooked food causes more release of heterocyclic

amines, so the chances of breast cancer increase.

According to Daniel et al. (1989) the frequent exposure to X-rays and other

radiations may increase the risk of breast cancer. In the present study, 7% patients passed

80

through intense x-rays exposure and 3% had power station exposure due to their

residence near power stations which may prove a risk factor.

Addiction and use of contraceptives

Out of one hundred and fifty patients, 97% were active smokers and just 3% were

passive smokers (by active smoking of husband/ son/ father) was 36% and no patient was

addicted for any drug or alcohol.Conway et al. (2002) observed that cigarette smoking

modify the prevalence and spectrum of TP53 gene mutations in breast cancer patients.

Due to genotoxic effect of smoking there is difference in mutational spectra between

smokers and nonsmokers.

According to Kropp and Claude (2002) passive smokers have same risk of breast

cancer as of active smokers. Pursianen et al. (2000) have observed that the spousal ETS

(environmental tobacco smokers) has two fold more risk of TP53 gene mutations as

compared to active smokers and G>A is prominent type of TP53 gene mutation in

passive smokers. It is interesting to know that in present study, out of three TP53 gene

mutation positive breast cancer patients two (SKH 85 and SKH 86) were passive smokers

(spousal ETS) and both had G>A mutation.

Most of the breast cancer patients who have taken part in the present study (92%)

were not using any type of contraceptive and all the three TP53 mutations positive

patients were also non users. Jardines et al. (2010) postulated that the risk of breast

cancer is related with the early formulations of oral contraceptives and its duration but the

new low dose contraceptives have no relation with breast cancer. No direct relationship

of contraceptives and TP53 gene mutations in breast cancer has been proved.

Early age breast cancer

The major burden of breast cancer in Pakistan is on early age breast cancer (30-50

years). India, which is close neighbor of Pakistan, coincides with present research and

deviates from west (Headau et al. 2004). In contrast to present study , Parkin and

Iscovich (1997) studied that the incidence of breast cancer is relatively very high in the

females of late age in the west. The median age of patients in present study was 40 years.

Rangan (2008) reported that, only 1% women of forty years age having breast cancer

harbor TP53 gene mutations. So it may be concluded that TP53 gene mutation is not the

81

reason of early age breast cancer in Pakistan. From India, Makwane and Saxena (2009)

also confirmed the present results by their findings. Moreover, the three patients who

proved positive for TP53 in the present research were above 50 years of age, confirmed

that TP53 gene mutations are more prominent in late adolescence.

Menstruation status

According to the “estrogen window hypothesis” of the etiology of breast cancer it

is suggested that unopposed estrogen stimulation is the most favorable state for tumor

production and that normal progesterone secretion reduces susceptibility. According to

Henderson et al. (1985) breast cancer risk is directly related to the cumulative number of

regular ovulatory cycles. MacMahon et al. (1982) suggested that late age at menarche (13

years) and early menopause (40-50 years) are the risk factor for breast cancer.

Now if we compare the above given studies with present study then it becomes obvious

that hormonal and reproductive factors are playing an important part in enhancing breast

cancer ratio in Pakistan. In Pakistani breast cancer patients the age at menarche is 13

years (42%), 51% patients were at menopause level and 93% patients had regular

menstruation during the said period. Rana et al. (1997), Bhurgri et al. (2007) and Headau

et al, (2004) are in agreement with present study while according to Parkin et al. (1992)

breast cancer is a post menopausal disease in the west.

This study also shows that all the three breast cancer patients were

postmenopausal. The postmenopausal status was significantly associated with increased

risk of TP53 gene mutations (Overgaard, 2000). The relation of TP53 to hormonal

control is also proved by Jerry et al. (2002) who proposed a model of developmental

vulnerability to breast cancer. In this model, the mammary epithelium is related to TP53

activity during mammary gland development. The results focus attention on TP53 as a

molecular target for therapies to reduce the risk of breast cancer.

Marital status, parity and breast feeding

No significant relationship has been estimated between marital status, parity,

breast feeding and breast cancer risk in the present study. 95% of patients were married.

Just 8% were nulliparus. 81% of patients breast fed their children. Reports published

82

from Pakistan by Rana et al. (1997), Bhurgri et al. (2007) and Headau et al. (2004) from

India are in agreement with above given facts. Yet Colditz et al. (1995) and Stanford et

al.(1995) are in contrast to our results who studied that early age marriage and pregnancy,

breast feeding and parity decreases the breast cancer risk in women of western countries.

Cuzick (2008) however studied that breast feeding is protective but breast cancer risk is

increased (4.3%) per cumulative year of breast feeding.

An important fact observed in the present study that 49% of patients were those

mothers, who have live births along with children aborted or died after few months of

birth. Lambe et al. (2004) worked in Sweden and gave same results concluded that child

abortion and child death after birth may be an important risk factor for breast cancer.

All the three TP53 mutation positive patients in this study were married, had

parity and fed breast milk to their child. One of them (SKH-86) had an abortion was

observed also by Simao et al. (2002) also did not observed any relationship of TP53 gene

mutations and these classical risk factors.

Family history

According to the study of Colditz et al. (1993) the risk of breast cancer is doubled

among women with a first-degree relative diagnosed with breast cancer. In the present

study, however only three patients having familial history were observed. The findings of

Rana et al. (1997) and Bhurgri et al. (2007) are in agreement with the present study.

No TP53 gene mutation was observed in three families during the present study. Headau

et al. (2004) from India is in agreement with our study. Prosser et al. (1991) are of the

opinion that a mutation on another TP53 gene of same locus (17p) may be involved in

familial breast cancer.

The clinical value of TP53 gene mutations

Time of diagnosis used for determining the chance of reoccurrence of disease,

required treatment and patient survival (Cuzick, 2008). TP53 mutations are considered as

important prognostic marker, which influence the prognosis of breast cancer (Olivier et

al. 2006). Olumi et al. (1990) studied that the patients having TP53 mutations of those

amino acids, which are directly involved in DNA or zinc binding region displayed a very

83

aggressive clinical phenotype. Olivier et al. (2006) had also done a mega study for

observing the clinical value of somatic TP53 gene mutations and concluded that TP53

gene mutations have potential uses in clinical practice. From the clinical reports of the

patients, information about following clinical factors was collected which gives us a

scenario of clinical risk factors and their effect in Pakistani breast cancer patients

especially in background of TP53 gene mutations.

Tumor size Most of the patients reported to the hospital with large tumor size even up to 9cm and

only 15% patients came to the hospitals with 0.5-2 cm tumor size. This data coincides

with findings of Usmani et al. (1996) and Siddiqui et al. (2000) who worked on

morphological features of breast carcinoma in Pakistan and found that mostly patients

were presented with tumor larger up to 9cm. In the present study, patients having TP53

gene mutations also presented with large tumor size. The study of Olivier et al. (2006)

and Overgaard et al. (2000) also coincides with the present study.

Tumor grade According to Rosen (2001) the rate of death due to grade III with 90% occurrence is eight

years. In present study, 51% of patients presented themselves to the doctors in grade III .

Usmani et al. (1996) and Siddiqui et al. (2000) postulated that presentation grade III

gives the reasons for late presentation i.e. unavailability of physicians, no female

physicians, being shy to discuss or show the breast lesions to physicians and lump being

painless. Two of three TP53 mutation positive patients (SKH-85 and SKH-86) presented

themselves in grade III, while the TP53 mutation positive patient NUS-10 presented in

grade IV. According to Baker et al (2010) there is significant association between grade

III and occurrence of TP53 mutations. Olumi et al. (1990) has postulated the reason that

due to loss of heterozygosity (LOH) of chromosome 17p (the TP53 gene is on

chromosome 17p) occurred only in grade III tumors.

84

Node involvement Sixty two percent of breast cancer patients presently studied showed the involvement of

axillary lymph nodes. Patients with TP53 mutations also showed involvement of lymph

nodes. Usmani et al. (1996), Siddiqui et al. (2000) and Alsner et al. (2000) are in

agreement with the present work.

Laterality Although there is no significant difference in involvement of right and left breast,

however right breast showed higher percentage (51%) of involvement. Although Rosen.

(2001) is not in favour of link between laterality and breast cancer survival, however

Weiss et al. (1996) studied laterality in USA and found that left breast involvement is

significant in breast cancer patients of any race or of any stage of cancer. No significant

association was observed between laterality and TP53 gene mutations.

Estrogen/ Progesterone (ER/PR) status ER+/PR+ status of hormones (Estrogen and Progesteron) was observed both in

TP53 positive and negative breast cancer patients who participated in present study. The

studies of Usmani et al. (1996), Siddiqui et al. (2000) from Pakistan also confirmed the

present results. No significant correlation between ER/PR status and TP53 mutations was

observed by Pezeshki et al. (2001) in Iranian patients. While the association of ER/PR-

negative tumors with TP53 gene mutations with poor prognosis is reported by Taneja et

al. (2010) from West.

Type of Carcinoma More then 86% patients showed infiltrating ductal carcinoma (IDC) and all the

TP53 positive patients had IDC. The results of Usmani et al. (1996), Siddiqui et al.

(2000) and Alsner et al. (2000) coincides with the results of study in this regard.

85

CONCLUSIONS

1. It is concluded that the frequency of TP53 gene mutations in DNA coding

region (5-8 exon) is low in Pakistani breast cancer patients. However

present study is in favor of the fact that the frequency of TP53 gene

mutations is different in different geographical areas, even in the same

country.

2. Genotype pro/pro and arg/pro (codon72 polymorphism) is more prevalent

as compared to arg/arg in the female breast cancer patients and normal

population of Pakistan.

3. No significant correlation between TP53 mutation and tumor

aggressiveness (nodal status, size, ER/PR and histopathology etc.) was

observed.

86

REFERENCES

Aas, T., Borresen, A.L., Geisler, S., Smith-Sorensen, B., Johnsen, H., Varhaug, J. E.,

Akslen, L. A. and Lonning, P. E., 1996. Specific P53 mutations are

associated with de novo resistance to doxorubicin in breast cancer patients.

Nat. Med., 2:811–814.

Achatz, W. I. M. and Hainaut, P., 2005. TP53 Gene and Li-Fraumeni Syndrome. Appl.

Cancer Res., 25 (2): 51-57.

Aguiar, C., Cordeiro-Silva, F., Carvalho, A. A. and Louro, I . D., 2010. Comparison of

DGGE and immunohistochemistry in the detection of TP53 variants in a

Brazilian sample of sporadic breast tumors. Mol. Biol Rep. DOI

10.1007/s11033-010-0440-4.

Ahmad, M., Khan, A. H. and Mansoor, A., 1991. The pattern of malignant tumors in

northern Pakistan. J. Pak. med. Assoc., 11: 270-273.

Ahmad, Z., Khurshid, A., Qureshi, A., Idress, R., Asghar, N. and Kayani, N.,2009.,

Breast carcinoma grading, estimation of tumor size, axillary lymph node

status, staging, and nottingham prognostic index scoring on mastectomy

specimens. Indian J. Pathol. Microbiol.. 52(4): 477-481.

Ahuja, H. G., Testa, M. P. and Cline, M. J., 1990. Variation in the protein coding region

of the human p53 gene. Oncogene, 5: 1409-1410.

Ali, S. M. A., 2009. Human papiloma virus (HPV) association and p53 mutation in oral

cavity (squamous cell carcinoma) cancers of Pakistani patients: it’s

correlation with histologic variables and disease out come. Ph.D thesis.

Baqai Medical University. Karachi.

Allred, D. C., Clark, G. M., Elledge, R., Fuqua, S. A. W., Brown, R. W., Chamness, G.

C., Osborne, C. K. and Mcguire, W. L., 1993. Association of p53 protein

expression with tumor cell proliferation rate and clinical outcome in node-

negtative breast cancer. J. natl. Cancer Inst., 85: 200-206.

Alper, M. Z., Lulecl, G. and Wong, C. J. L., 2005. Mutation analysis by the use of

temporal temperature gradient gel electrophoresis. Turk. J. med. Sci., 35:

279-282.

87

Alsner, J., Yilmaz, M., Guldberg, P., Hansen, L. L. and Overjaard, J., 2000.

Heterogeneity in the clinical phenotype of TP53 mutations in breast cancer

patients. Breast can. Res. 2(suppl.1) P4.04.

Ambrosone, C. B., Freudenheim, J. L., Graham, S., Marshal, J. R., Vena, J. E. and

Brasure, J. R., 1996. Cigarette smoking, N-acetyltransferase 2 genetic

polymorphisms, and breast cancer risk. J. Am. med. Assoc., 276:1494–501.

American Cancer Society, 1999. Cancer facts and figures. American Cancer Society.

Atlanta, GA.

Anderson, D. E., 1974. Genetic study of breast cancer; identification of a high risk group.

Cancer, 34: 1090–1097.

Andresen, I. T., Holm, R., Nesland, J. M., Heimdal, K.R., Ottestad, L. and Borresen,

A.L., 1993. Prognostic significance of TP53 alterations in breast

carcinoma. Br. J. Cancer, 68: 540-548.

Aoubala, M., Murray-Zmijewski, F., Khoury, M., Perrier, S., Fernandes, K., Prats, A.

C., Lane, D. and Bourdon, J. C. 2010. D133P53, directly transactivated by

p53, prevents p53-mediated apoptosis without inhibiting p53-mediated

cell cycle arrest. Breast Cancer Res., 12 (Suppl 1): P8.

Ara, S., Lee, P. S., Hansen, M. F. and Saya, H.,1990. Codon 72 polymorphism of the

TP53 gene. Nucl. Acids Res., 18: 4961.

Athlin, L., Beckman, G. and Beckman, L., 1996. p53 polymorphisms and haplotypes in

breast cancer. Carcinogenesis, 17: 1313–1316.

Aziz, S., Pervez, S., Khan, S., Siddiqui, T., Kayani, N., Israr, M. and Rahbar, M., 2003.

Case control study of novel prognostic markers and disease outcome in

pregnancy /lactation-associated breast carcinoma. Pathol. Res. Pract.,

199(1): 15-21.

Badar, F., Moid, I., Waheed, F., Zaidi, A., Naqvi, B. and Yunus, S., 2005. Variables

associated with recurrence in breast cancer patients-the Shaukat Khanum

Memorial experience.Asian Pac.J. Cancer Prev., 6(1): 54-57.

Baker, L. Quinlan, P.R., Patten, N., Ashfield, A., Birse-Stewart-Bell, L. J., McCowan, C.,

Bourdon, J.C., Purdie, C. A., Jordan, L.B., Dewar, J. A., Wu, L. and

Thompson, A. M., 2010. p53 mutation, deprivation and poor prognosis in

88

primary breast cancerp53m, deprivation and poor prognosis in breast

cancer. Br. J. Cancer, 102: 719-726.

Baker, S. J., Fearon, E. R., Nigro, J., Hamilton, S., Preisinger, A. C., Jessup, J. M., van-

Tuinen, P., Ledbetter, D. H., Barker, D. F., Nakamura, Y., Whyte, R. and

Vogelstein, B., 1989. Chromosome 17 Deletions and p53 gene mutations

in colorectal carcinomas. Science, 244:217-221.

Barnes, D. M., Dublin, E. A., Fisher, C. J., Levison, D.A. and Millis, R.R., 1993.

Immunohistochemical detection of p53 protein in mammary carcinoma: an

important new independent indicator of prognosis? Hum. Pathol., 24: 469-

476.

Beckman, G., Birgander, R., Sjalander, A., Saha, N., Holmberg, P. A., Kivela, A. and

Beckman, L., 1994. Is p53 polymorphism maintained by natural selection?

Hum. Hered., 44: 266-270.

Bell, D. W., Varley, J. M., Szydlo, T. E., Kang, D. H., Wahrer, D. C., Shannon, K. E.,

Eeles, R., Evans, D. G., Houlston, R., Murday, V., Narod, S., Peretz, T.,

Peto, J., Phelan, C., Zhang, H. X., Lubratovich, M., Verselis, S. J.,

Isselbacher, K. J., Fraumeni, J. F., Birch, J. M., Li, F. P., Garber, J. E. and

Harber, D. A., 1999. Heterozygous germ line CHK2 mutations in Li-

Fraumeni syndrome. Science, 24: 2528 – 2531.

Benard, J., Douc-Rasy, S. and Ahomadegbe, J. C., 2003. The TP53 family members and

human cancers. Hum. Mutat., 21:182– 191.

Bennett, C. I., Gattas, M. and Teh, B. T., 2000. The management of familial breast

cancer. The Breast, 9: 247-263.

Berns, E.M., Foekens, J.A., Vossen, R., Look, M.P., Devilee, P., Henzen- Logmans, S.

C., van-Staveren, I. L., van-Putten, W. L., Inganas, M., Meijer-van-

Gelder, M. E., Cornelisse, C., Claassen, C. J., Portengen, H., Bakker, B.

and Klijn, J. G., 2000. Complete sequencing of TP53 predicts poor

response to systemic therapy of advanced breast cancer. Cancer Res., 60:

2155–2162.

Beroud, C. and Soussi, T., 2003. The UMD-p53 database: new mutations and analysis

tools. Hum. Mutat., 21:176- 181.

89

Bertwistle, D., and Ashworth, A., 1998. Functions of the BRCA1 and BRCA2 genes.

Curr. Opin. Genet. Dev., 8: 14–20.

Bhurgri, Y., Bhurgri, A., Hassan, S. H., Zadi, S. H. M., Rahim, A., Shankarnarayan, R.

and Parkin, D. M., 2000. Cancer incidence in Karachi Pakistan, first

results from Karachi Cancer registry. Int. J. Cancer, 85: 325-329.

Bhurgri, Y., Bhurgri, A., Nishter, S. Ahmed, A., Usman, A., Pervez, S., Ahmed, R.,

Kayani, N., Riaz, A., Bhurgri, H., Bashir, I. and Hassan, S. H., 2006.

Pakistan - Country Profile of Cancer and Cancer Control 1995-2004. J.

Pak. Med. Assoc., 56 (3): 124-130.

Bhurgri, Y., Kayani, N., Faridi, N., Pervez, S., Usman, A., Bhurgri, H., Malik, J., Bashir,

I., Bhurgri, A., Hasan, S. H. and Zaidi, S.H., 2007. Patho-epidemiology of

breast cancer in Karachi '1995-1997. Asian Pac. J. Cancer Prev., 8(2):

215-220.

Biorad, 2004. The DCode universal mutation detection system, catalog number 170-

9080, TTGE. P.35.

Birch, J. M., Alston, R. D., McNally, R. J., Evans, D. G., Kelsey, A. M., Harris, M.,

Eden, O. B. and Varley, J. M., 2001. Relative frequency and morphology

of cancers in carriers of germline TP53 mutations. Oncogene, 20: 4621-

4628.

Birch, J. M., Hartley, A. L., Tricker, K. J., Prosser, J., Condie, A., Kelsey, A. M., Harris,

M., Jones, P. H., Binchy, A. and Crowther, D.,1994. Prevalence and

diversity of constitutional mutations in the p53 gene among 21 Li-

Fraumeni families. Cancer Res., 54: 1298-1304.

Blackwood, M. A. and Weber, B.L. 1998. BRCA1 and BRCA2: From molecular genetics

to clinical medicine. J. clin. Oncol., 16: 1969-1977.

Blaszyk, H., Hartmann, A., Tamura, Y., Saitoh, S., Cunningham, J. M., McGovern, R.

M., Schroeder, J. J., Schaid, D. J., Li, K., Monden, Y., Morimoto, T.,

Komaki, K., Sasa, M., Hirata, K., Okazaki, M., Kovach, J. S. and Sommer,

S. S., 1996. Molecular epidemiology of breast cancers in northern and

southern Japan: the frequency, elustering and patterns of p53 gene

90

mutations differ among these two low risk population, Oncogene, 3:2159-

2166.

Blaszyk, H., Vaughn, C.B., Hartmann, A., McGovern, R. M., Schroeder, J. J. and

Cunningham, J., 1994. Novel pattern of p53 gene mutations in an

American black cohort with high mortality from breast cancer. Lancet,

343: 1195-1197.

Boodram, L., 2004. Extraction of genomic DNA from whole blood. Department of Life

Sciences, The University of the West Indies: http://www.protocol-

online.org/

Børresen-Dale, A. L., 2003. TP53 and breast cancer . Hum. Mutat., 21: 292-300.

Børresen-Dale, A. L., Lystad, S. and Langerød, A., 1997. Temporal temperature gradient

gel electrophoresis on the DCode system. Biol. Rad. Bull., 2133: 12–13.

Bougeard, G., Desurmont, B. S., Tournier, I., Vasseur, S., Martin, C., Brugieres, L.,

Chompret, A., Paillerets, B. B., Lyonnet, L. D., Pellie, C. B. and

Frebourg, T., 2006. Impact of the MDM2 SNP309 and p53 Arg72Pro

polymorphism on age of tumour onset in Li-Fraumeni syndrome. J. med.

Genet., 43: 531–533.

Bourdon, J. C., Fernandes, K.,Murray-Zmijewski, F., Liu, G., Diot, A., Xirodimas, D. P.,

Saville, M. K.and Lane, D. P. 2005. p53 isoformscan regulate p53

transcriptional activity. Genes Dev., 19: 2122–2137.

Buckbinder, L., Talbott, R., Valesco-Miguel, S., Takenaka, I., Faha, B., Seizinger, B. R.,

and Kley, N., 1995. Induction of the growth IGF-binding protein 3 by p53.

Nature, 377: 646–649.

Bukhari, M. H., Niazi, S., Anwar, M., Chaudhry, N. A., 2008. Naeem S. Prognostic

significance of new immunohistochemistry scoring of p53 protein

expression in cutaneous squamous cell carcinoma of mice. Ann. Acad. Sci.

1138: 1-9.

Bukhari, M. H, Niazi, S. and Chaudhry, N. A., 2009. Relationship of

immunohistochemistry scores of altered p53 protein expression in relation

to patient's habits and histological grades and stages of squamous cell

carcinoma. J. Cutan. Pathol., 36(3): 342-349.

91

Buller, R. E., Skilling, J. S., Kaliszewski, S., Niemann, T. and Anderson, B., 1995.

Absence of significant germ line p53 mutations in ovarian cancer patients.

Gynecol. Oncol., 58 (3): 368-374.

Buyru, N., Tigli, H. and Dalay, N., 2003. p53 codon 72 polymorphism in breast cancer.

Oncol. Rep., 10:711- 714.

Calbiochem. 2009. www. Calbiochem.com/ p53.

Callahan, R., 1992. p53 mutations, another breast cancer prognostic factor. J. natl.

Cancer Inst., 84: 826-827.

Campomenosi, P., Monti, P., Aprile, A., Abbondandolo, A., Frebourg, T.,Gold, B.,

Crook, T., Inga, A., Resnick, M. A., Iggo, R. and Fronza, G., 2001. p53

mutants can often transactivate promoters containing a p21 but not Bax or

PIG3 responsive elements. Oncogene, 20: 3573–3579.

Caron-de- Fromentel, C. and Soussi, T., 1992. The p53 tumor suppressor gene: a model

for investigating human mutagenesis. Genes Chrom. Cancer, 4:1-15.

Cattoretti, G., Rilke, F., Andrealo, S., D’ Amato, L. and Delia, D., 1988. p53 expression

in breast cancer. Int. J. Cancer, 41: 178-183.

Chang, F., Syrjanen, S. and Kurvinen, K., 1993. The tumor suppressor gene a common

cellular target in human carcinogenesis. Am. J. Gastroenterol, 88: 174-

186.

Chen, P. L., Chen, Y. M., Bookstein, R. and Lee, W. H., 1990. Genetic mechanisms of

tumor suppression by the human p53 gene. Science, 250: 1576-1580.

Chen, J., Ng, S. M., Chang, C., Zhang, Z., Bourdon, J. C., Lane, D. P. and Peng, J. 2009.

p53 isoform D113p53 is a p53 target gene that antagonizes p53 apoptotic

activity via BclxL activation in zebrafish. Genes Dev., 23: 278–290.

Cho, Y. J., Gorina, S., Jeffrey, P. D. and Pavletich, N. P., 1994. Crystal structure of a

p53 tumor suppressor DNA complex: understanding tumorigenic

mutations. Science, 265: 346-355.

CIA The World Fact book 2005. Pakistan. http://www.odei.gov.

cia/publications/factbook/geos/pk.html.

92

Colditz, G .A., Willett, W. C. and Hunter, D. J., 1993., Family history, age, and risk of

breast cancer. Prospective data from the Nurses Health Study. J. Am. med.

Assoc., 270 (3): 338-343.

Colditz, G. A., Hankinson, S. E. and Hunter, D. J., 1995. The use of estrogens and

progestins and the risk of breast cancer in postmenopausal women. N.

Engl. J. Med., 332:1589-1593.

Collaborative Group on Hormonal Factors in Breast Cancer. 1996. Breast cancer and

hormonal contraceptives: collaborative reanalysis of individual data on

p53. 297 women with breast cancer and 239 women without breast cancer

from 54 epidemiological studies. Lancet, 347:1713-1727.

Connor, F., Bertwistle, D., Mee, P. J., Ross, G. M., Swift, S., Grigorieva, E., Tybulewicz,

V. L. and Ashworth, A., 1997. Tumorigenesis and a DNA repair defect in

mice with a truncating BRCA2 mutation. Nature Genet., 17: 423–430.

Conway, K., Sharon, N., Edmiston, Cui, L., Drouin, S. S., Pang, J., He, M., Tse, C.,

Geradts, J., Dressler, L.,Liu, E. T., Millikan, R. and Newman, B., 2002.

Prevalence and spectrum of p53 mutations associated with smoking in

breast cancer. Cancer Res., 62:1987- 1995.

Crawford, L. V., Pim, D. C., Gurney, E. G., Goodfellow, P. and Taylor-Papadimitriou, J.,

1981. Detection of a common feature in several human tumor cell lines-a

53,000 dalton protein. Proc. natl. Acad. Sci., 78:41-45.

Crawford, L., 1983. The 53,000-dalton cellular protein and its role in transformation. Int.

Rev. exp. Pathol., 25: 1-50.

Crook, T., Brooks, L. A., Crossland, S., Osin, P., Barker, K. T., Waller, J., Philp, E.,

Smith, P. D., Yulug, I., Peto, J., Parker, G., Allday, M. J., Crompton, M.

R. and Gusterson, B. A., 1998. p53 mutation with frequent novel codons

but not a mutator phenotype in BRCA1- and BRCA2-associated breast

tumors. Oncogene, 17: 1681– 1689.

Crook, T., Crossland, S., Crompton, M. R., Osin, P. and Gusterson, B. A., 1997. p53

mutations in BRCA1 associated familial breast cancer. Lancet, 350: 638–

639.

93

Cooper, G. M., (2000). The cell: a molecular approach "Chapter 14: The Eukaryotic Cell Cycle.

Washington, D.C: ASM Press. http://www.ncbi.nlm.nih.gov/books/NBK9876/.

Cuzick, J., 2008. Assessing risk for breast cancer. Breast Caner. Res., 10 (suppl. 4):S13.

Daniel, A. H., John, E. L., Michele, M. M., Wendy, V., Benjamin, S. H., Harris and John,

D. B., 1989. Breast cancer in women with scoliosis exposed to multiple

diagnostic X rays. J. natl. cancer Inst., 81 (17): 1307-1312.

Deb, S., and Palit, S., 2003. P53 protocols, Mutations analysis of p53 in human tumors. .

In: Methods in molecular biology 234: 220-223. Totawa, New Jersey,

07512, USA.

Debra, G. B. and Leonard, A. B. 2007. Molecular pathology in clinical practice.

Chap.22: 251. Springer, Spring Street, New York, 10013. USA.

Delacalle-Martin, O., Fabregat, V., Romero, M., Soler, J., Vives, J. and Yague, J., 1990.,

Accll polymorphism of the p53 gene. Nucl. Acids Res, 18: 4963.

Denissenko, M. P., 1996. Preferential formation of benzo(a) pyrene adducts at the lung

cancer mutational hot spot in p53. Science, 274: 430-432.

Dicomo, C. J., Gaiddon, C. and Prives, C., 1999. p73 function is inhibited by tumor-

derived p53 mutants in mammalian cells. Mol. Cell. Biol., 19: 438–1449.

Diller, L., Kassel, J., Nelson, C. E., Gryka, M. A., Litwak, G., Gebhardt, M., Bressac, B.,

Ozturk, M., Baker, S. J., Vogelstein, B. and Friend, S. H., 1990. p53

functions as a cell cycle control protein in osteosarcomas. Mol. Cell Biol.,

10: 5772-5781.

Dokianakis, D. N., Koumantaki, E., Billiri, K. and Spandidos. D. A., 2002. p53 codon 72

polymorphism as a risk factor in the development of HPV-associated non-

melanoma skin cancers in immunocompetent hosts. Int, J. mol. Med., 5:

405-409.

Dominguez, G., Silva, J. M., Silva, J., Garcia, J. M., Sanchez, A., Navarro, A., Gallego,

I., Provencio, M., Espana, P. and Bonilla, F. 2001. Wild type p73

overexpression and high-grade malignancy in breast cancer. Breast

Cancer Res. Treat., 66:183-190.

94

Done a, S. J., Arneson, C. R., Ozcelik, H., Redston, M. and Andrulis, I. L., 2001. P53

protein accumulation in non-invasive lesions surrounding p53 mutation

positive invasive breast cancers. Breast Cancer Res. Treat., 65:111–118.

Done b, S. J., Eskandarian, S., Bull, S., Redston, M. and Andrulis, I. L., 2001. p53

missense mutations in microdissected high-grade ductal carcinoma in situ

of the breast. J. natl. Cancer Inst., 93: 700–704.

Dumaz, N., Stry, A., Soussi, T., Dayagrosjean, L. and Sarasin, A., 1994. Can we predict

solar ultraviolet radiation as the causal evnt in human tumors by analyzing

the mutation spectra of the p53 gene? Mutat. Res., 307: 375-386.

Dumont, P., Leu, J. I., Della, Pietra. A. C., George, D. L. and Murphy, M., 2003. The

codon 2 polymorphic variants of p53 have markedly different apoptotic

potential. Nature Genet., 33:357-365.

Dworniczak, D. B., Wolff, J., Poremba, C., Schafer, L. K., Ritter, J., Gullotta, F., Jirgens,

H. and Becker, W., 1996. A new germline TP53 gene mutation in Li-

Fraumeni syndrome family. Cancer, 32A (8): 1359-1365.

Eachkoti, R., Hussain, I., Afroze, D., Aziz, A. S., Jan, M., Shah, A. Z., Das, C. B. and

Siddiqi, A. M., 2007. BRCA1 and TP53 mutation spectrum of breast

carcinoma in an ethnic population of Kashmir, an emerging high-risk area.

Cancer Lett., 248: 308–320.

El-Bayoumy, K. 1992. Environmental carcinogens that may be involved in human breast

cancer etiology. Chem. Res. Toxicol., 5: 585–590.

El-Deiry, W.S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J.M., Lin,

D., Mercer, W. E., Kinzler, K.W. and Vogelstein, B., 1993. WAF1, a

potential mediator of p53 tumor suppression. Cell, 75: 817–825.

Evans, D. G., Birch, J. M., Thorneycroft, M. and McGown, G. J. M., 2002. Low rate of

TP53 germline mutations in breast cancer/sarcoma families not fulfilling

classical criteria for Li-Fraumeni syndrome. J. med. Genet., 39: 941-944.

Faheem, M., Khurram, M., Jafri, I. A., Mehmood, H., Hasan, Z., Iqbal, G. S., Maqsood,

F. and Jafri, S. R. A. 2007. Risk factors for breast cancer in patients

treated at NORI Hospital, Islamabad. J. Pak. Med. Assoc., 57: 242-245.

95

Fearon, E. R. and Jones A. P., 1992. Progressing towards a molecular description of

colorectal cancer development. Fed. Am. Soc. exp. Biol., 6: 2783-2790.

Feinstein, E., Gale, R. P., Reed, J. and Canaani, E., 1992. Expression of the normal p53

gene induces differentiation of k562 cells. Oncogene, 7: 1852-1857.

Feki, A. and Irminer-Finger, I., 2004. Mutational spectrum of TP53 mutations in primary

breast and ovarian tumors. Critic. Rev. Oncol. Hematol., 52: 103-116.

Felix, C. A., Brown, D. L., Mitsudomi, T., Ikagaki, N., Wong, A., Wasserman, R.,

Womer, R.B. and Biegel, J. A., 1994. Polymorphism at codon 36 of the

p53 gene. Oncogene, 9: 327-328.

Felley-Bosco, E., Weston, A., Cawley, H. M., Bennett, W. P. and Harris, C. C., 1993.

Functional studies of a germ-line polymorphism at codon-47 within the

p53 gene. Am. J. Hum. Genet., 53: 752-759.

Ferguson, A.T., Evron, E., Umbricht, C. B., Pandita, T. K., Chan, T. A., Hermeking, H.,

Marks, J. R., Lambers, A. R., Futreal, P. A., Stampfer, M. R., Sukumar, S.

2000. High frequency of hypermethylation at the 14-3- 3σ locus leads to

gene silencing in breast cancer. Proc. Natl Acad. Sci. USA., 97: 6049-

6054.

Ferlay, J., Bray, F., Pisane, P. and Parkin, D. M., 2000. Cancer incidence,mortality and

prevalence worldwide. Globocan (CDROM).IARC Press.

Feuer, E. J., Wun, L. M. and Boring, C. C., 1993. The life time risk of developing breast

cancer. J. natl. Cancer Inst., 85: 892-897.

Fischer, S. and Lerman, L. 1983. DNA fragments differing by single base-pair

substitutions are separated in denaturing gradient gels: correspondence

with melting theory. Proc. natl. Acad. Sci., 80: 1579–1583.

Frebourg, T., Barbier, N., Yan, Y. X., Garber, J. E., Dreyfus, M., Fraumeni, J., Li, F. P.

and Friend, S. H., 1995. Germ-line p53 mutations in 15 families with Li-

Fraumeni syndrome. Am. J. Hum. Genet., 56: 608-615.

Friedlander, P., Haupt, Y., Prives, C. and Oren, M. 1996. A mutant p53 that discriminates

between p53-responsive genes cannot induce apoptosis. Mol. Cell Biol.,

16: 4961–4971.

96

Friedman, L. S., Thistlethwaite, F. C., Patel, K. J., Yu, V. P., Lee, H., Venkitaraman, A.

R., Abel, K. J., Carlton, M. B., Hunter, S. M., Colledge, W. H., Evans, M.

J. and Ponder, B. A., 1998. Thymic lymphomas in mice with a truncating

mutation in BRCA2. Cancer Res., 58: 1338–1343.

Fujiwara, T., Grimm, E. A., Mukhopadhyay, T., Zhang, W. W., Owenschaub, L. B. and

Roth, J. A., 1994. Induction of chemosensitivity in human lung cancer

cells in vivo by adenovirus-mediated transfer of the wild-type p53 gene.

Cancer Res., 54: 2287- 2291.

Garber, J. E., Burke, E. M., Lavally, B. L., Billett, A. L., Sallan, S. E., Scott, R. M.,

Kupsky, W. and Li, F. P., 1990. Choroid plexus tumors in the breast

cancer-sarcoma syndrome. Cancer (Phila.), 66: 2658-2660.

Garber, J. E., Goldstein, A. M., Kantor, A. F., Dreyfus, M. G. and Fraumeni, J. F. J.,

1991. Follow-up study of twenty-four families with Li-Fraumeni

syndrome. Cancer Res., 51: 6094-6096.

Gasco, M., Yulug, G. I. and Crook, T., 2003. TP53 Mutations in familial breast cancer:

functional aspects. Human mutat., 21: 301-306.

Geisler, S., Lonning, P. E., Aas, T., Johnsen, H., Fluge, O., Haugen, D. F., Lillehaug, J.

R., Akslen, L. A., and Borresen-Dale A. L., 2001. Influence of TP53 gene

alterations and c-erbB-2 expression on the response to treatment with

doxorubicin in locally advanced breast cancer. Cancer Res., 61: 2505–

2512.

Gentile, M., Ahnstrom, M., Schon, F. and Wingren, S. 2001. Candidate tumour

suppressor genes at 11q23-q24 in breast cancer: evidence of alterations in

PIG8, a gene involved in p53-induced apoptosis. Oncogene, 20: 7753-

7760.

Ghasemi, N., Karimi-Zarchi, M., Mortazavi-Zadeh, M., R., and Atash-Afza, A. 2010.

Evaluation of the frequency of TP53 gene codon 72 polymorphisms in

Iranian patients with endometrial cancer. Cancer Genet.Cytogenet.

196(2):167-170.

Gilani, G.M. and Kamal, S., (2004). Risk factors for breast cancer in Pakistani women

aged less than 45 years. Ann. Hum. Bio. 31, (4): 398-407.

97

Ginsburg, M. O. Bukhari, R. M., Aziz, Z.,Young, R., Lynch, H., Ghadirian, P., Robidoux,

A., Londono, J., Vasquez, G., Gomes, M., Costa, M. M., Dimitrakakis, C.,

Gutierrez, G., Pilarski, R., Royer, R. and Narod, A. S., 2009. The

prevalence of germ-line TP53 mutations in women diagnosed with breast

cancer before age 30. J. Hum. Genet., 52: 694–697.

Glazko, V. G., Babenko, N. V., Koonin, V. E., and Rogozin, B. I., 2006. Mutational

hotspots in the TP53 gene and, possibly, other tumor suppressors evolve

by positive selection. Biol. Direct, 1 (1): 4.

Grey, H., 1918. Anatomy of the human body. www.Bartleby.com.

Greenblat, M. S., Bennett, W. P., Hollstein, M. and Harris, C. C., 1994. Mutations in the

p53 tumor suppressor gene: clues to cancer etiology and molecular

pathogenesis. Cancer Res., 54: 4855-4878.

Greenblatt, M. S., Chappuis, P. O., Bond, J. P., Hamel, N. and Foulkes, W. D., 2001.

TP53 mutations in breast cancer associated with BRCA1 or BRCA2 germ-

line mutations: distinctive spectrum and structural distribution. Cancer

Res., 61: 4092–4097.

Grimberg, J., Nawoschik, S., Belluscio, L., McKee, R., Turck, A., and Eisenberg, A.,

1989. A simple and efficient non-organic procedure for the isolation of

genomic DNA from blood. Nucl. Acids Res.,17: 8390.

Hahn, M., Serth, J., Fislage, R., Wolfes, H., Allhoff, E., Jonas, V. and Pingoud, A., 1993.

Polymerase chain reaction detection of a highly polymorphic VNTR

segment in intron 1 of the human p53 gene. Clin. Chem., 39: 549–550.

Hainaut, P. and Hollstein, M., 2000. p53 and human cancer: the first ten thousand

mutations. Adv. Cancer Res., 77: 81-137.

Hall, I. J., Moorman, P. G., Millikan and R. C., Newman, B., 2005. Comparative analysis

of breast cancer risk factors among African-American women and White

women. Am J Epidemiol., 161: 40-51.

Hamroun, D., Kato, S., Ishioka, C., Claustres, M., Beroud, C. and Soussi, T. 2006. The

UMD TP53 database and website: update and revisions. Hum. Mutat.,

27(1):14-20.

98

Hartley, A. L., Birch, J. M., Tricker, K., Wallace, S. A., Kelsey, A. M., Harris, M. and

Jones, P. H., 1993. Tumor in the Li-Fraumeni cancer family syndrome.

Cancer Genet. Cytogenet., 67: 133-135.

Hartmann, A., Blaszyk, H., Kovach, J. S. and Sommar, S. S., 1997. The molecular

epidemiology of P53 gene mutations in human breast cancer. Trends

Genet., 13: 27-33.

Hartmann, A., Blaszyk, H., Saitoh, S., Tsushima, K., Tamura, Y., Cunningham, J. M.,

McGovern, R. M., Schroeder, J. J., Sommer, S. S., and Kovach, J. S.,

1996. High frequency of p53 gene mutations in primary breast cancers in

Japanese women, a low-incidence population, Br. J. Cancer, 73: 896–901.

Hedau, S., Jain, N., Husain, A. S., Mandal. K. A., Ray, G., Shahid, M., Kant, R., Gupta,

V., Shukla, K. N. Deo, V. S. and Das, C. B., 2004. Novel germline

mutations in breast cancer susceptibility genes BRCA1, BRCA2 and p53

gene in breast cancer patients from India. Breast Cancer Res. Treat., 88:

177–186.

Hemminki, K. and Granström, C., 2002. Morphological types of breast cancer in family

members and multiple primary tumors: is morphology genetically

determined? Online http:// breast-cancer research.com/content/4/4/R7.

Henderson, B. E., Ross R. L. and Ludd, H., 1985. Do regular ovulatory cycles increase

breast cancer risk? Cancer, 56:1206-1208.

Hill, K. A. and Sommer, S. S., 2002. p53 as a mutagen test in breast cancer. Environ.

Mol. Mutagen, 39: 216–227.

Hirata, K., Okazaki, M., Kovach, J. S. and Sommer, S. S., 1996. Molecular epidemiology

of breast cancers in northern and southern Japan: the frequency, clustering,

and patterns of p53 gene mutations differ among these two low-risk

populations, Oncogene, 3: 159–2166.

Hisada, M., Garber, J. E. and Fung, C. Y., 1998. Multiple primary cancers in families

with Li- Fraumeni syndrome. J. Natl. Cancer Inst., 90(8): 606- 611.

Ho, G. H., Calvano, J. E., Bisogna, M., Borgen, P. I., Rosen, P. P., Tan, L. K. and

VanZee, K. J., 2000. In microdissected ductal carcinoma in situ, HER-

99

2/neu amplification, but not p53 mutation, is associated with high nuclear

grade and comedo histology. Cancer, 89: 2153– 2160.

Hofseth, L. J. Hussain, S. P. and Harris, C. C., 2004. p53: 25 years after its discovery.

Trends pharmacological Sci., 25 (4). 171-181.

Hoeijmakers, J. H. J., 2001. Genome maintenance mechanisms for preventing cancer,

Nature, 411: 366–374.

Hollstein, M., Rice, K., Greenblatt, M. S., Soussi, T., Fuchs, R., Sorlie, T., Hovig, E.,

Smith-Sorensen, B., Montesano, R., and Harris, C. C., 1994. Database of

p53 gene somatic mutations in human tumors. Nucl. Ac. Res., 22: 3551–

3555.

Hulka, B. S., 1991. ASPO Distinguished Achievement Award Lecture. epidemiological

studies using biological markers: issues for epidemiologists. Cancer

Epidemiol. Biomarkers Prev., 1: 13–1 9.

IARC (International Agency of Research on Cancer TP53 Mutation Database, 2011:

http://p53.free.fr/Database/p53_mutation_dist.pdf.

Deb, S., and Palit, S., 2003. In: Methods in molecular biology, Chap 15. P53 protocols,

Mutations analysis of p53 in human tumors. 234:220-223. Totawa, New

Jersey, 07512. USA.

Jain, N., Singh, V., Hedau, S., Kumar, S., Daga, M. K., Dewan, R., Murthy, N. S, Husain,

S. A. and Das, B. C., 2005. Infection of human papillomavirus type18 and

p53 codon 72 polymorphism in lung cancer patients from India. Chest,

128: 3999- 4007.

Jamal, S., Mushtaq, H., Mubarik, A. and Malik, T. M., 2009. Estrogen receptor,

progesterone receptor, HER2/neu, P53 and Ki-67 status of male breast

carcinomas in Pakistan. Asian Pac. J. Cancer Prev., 10(6): 1067-1070.

Jardines, L., Goyal, S., Fisher, P., Weitzel, J. and Royce, M., 2010. Risk factors,

screening, genetic testing, and prevention. In: Cancer management: a

multidisciplinary approach. volume 12, CMP Medica, New York, USA.

Jerry, J. D., Minter, M. L., Becker, A. K. and Blackburn, C. A., 2002. Hormonal control

of p53 and chemoprevention. Breast Cancer Res., 4: 91-94.

100

Jin, X., Wu, X., Roth, J. A., Amos, C. I., King, T. M., Branch, C., Honn, S. E. and Spitz,

M. R. 1995. Higher lung cancer risk for younger African-Americans with

the Pro/Pro p53 genotype. Carcinogenesis.; 16(9): 2205- 2208.

Jussawalla, D. J. and Jain, D. K., 1977. Breast cancer and religion in greater Bombay

women: an epidemiological study of 2130 women over a 9-year period.

Br. J. Cancer, 36: 634–638.

Kakarala, M., Rozek, L., Cote, M., Liyanage, S. and Brenner, D. E. 2010. Breast cancer

histology and receptor status characterization in Asian Indian and

Pakistani women in the U.S. - a SEER analysis. BMC Cancer, 10: 191.

Kandioler-Eckersberger, D., Ludwig, C., Rudas, M., Kappel, S., Janschek, E., Wenzel,

C., Schlagbauer-Wadl, H., Mittlbock, M., Gnant, M., Steger, G. and

Jakesz. R., 2000. TP53 mutation and p53 overexpression for prediction of

response to neoadjuvant treatment in breast cancer patients. Clin. Cancer

Res., 6: 50–56.

Kastan, M. B. and Kuerbitz, S. J., 1993. Control of G1 arrest after DNA damage.

Environ. Hlth Perspect., 5: 55–58.

Khadang, B., Fattahia, J. M., Taleib, A., Dehaghanic, S. A. and Ghaderi, A., 2007.

Polymorphism of TP53 codon 72 showed no association with breast

cancer in Iranian women. Cancer Genet. Cytogenet., 173: 38- 42.

Khoury, P. M. and Bourdon, J., 2010. The isoforms of p53 protein. Cold Spring Harb.

Perspect. Biol. 2(3): a000927.

Khaliq, S., Hameed, A., Khaliq, T., Ayub, Q., Qamar, R., Mohyuddin, A., Mazhar, K.

and Qasim-Mehdi S., 2000. P53 mutations, polymorphisms, and

haplotypes in Pakistani ethnic groups and breast cancer patients. Genet.

Test., 4(1): 23- 29.

Khaliq, T., Afghan, S., Naqi, A., Haider, M. and Islam, A. 2001. P53 mutations in

carcinoma breast - a clinicopathological study. J. Pak. med. Assoc., 51(6):

210-213.

Knudsen, A. G., 1971. Mutation and Cancer: statistical study of retinoblastoma. Proc.

natl. Acad. Sci. USA., 68: 820– 823.

101

Kropp, S. and Claude, J. 2002. Active and Passive Smoking and Risk of Breast Cancer by

age 50 year among German women.Am. J. Epdemiol. 156(7): 616-626.

Krypuy, M., Ahmed, A. A., Etemadmoghadam, D., Hyland, J. S., Australian Ovarian

Cancer Study Group, DeFazio, A., Fox, B. S., Brenton, D. J., Bowtell, D.

D. and Dobrovic, A., 2007. High resolution melting for mutation scanning

of TP53 exons 5–8. BMC Cancer, 7: 168.

Kumar, V., Cotran, R. and Robbins, S. 1997. The breast. Etiology and pathogenisis. In:

Pathologic basis of diseases. 8th ed., Chapter 23, pp.450-455.

Kuroda, Y., Tsukino, H., Nakao, H., Imai, H., Katoh, T., 2003. p53 codon 72

polymorphism and urothelial cancer risk. Cancer Lett., 189: 77- 83.

Lalloo, F., Varley, J. and Ellis. D., 2003. Prediction of pathogenic mutations in patients

with early-onset breast cancer by family history. Lancet, 361: 1101– 1102.

Lalloo, F., Varley, J. and Moran, A., 2006. BRCA1, BRCA2 and TP53 mutations in very

early-onset breast cancer with associated risks to relatives, Eur. J. Cancer,

42: 1143– 1150.

Lambe, M., Cerrato, R., Askling, J. and Hsieh C. C., 2004. Maternal breast cancer risk

after the death of a child. Int. J. cancer,110:763–766.

Lane, D., Shields, M. T., Ullrich, S. J., Appella, E. and Mercer, W. E., 1992. Growh

arrest induced by wild-type p53 protein blocks cells prior to or near the

restriction point in late G1 phase. Proc. natl. Acad. Sci. USA., 89: 9210-

9214.

Langerød, A., Bukholm, K. R. I., Bregård, A., Lønning, E. A., Andersen, I. T., Rognum,

O. T., Meling, I. G., Lothe, A. R., and Børresen-Dale, L. S., 2002. The

TP53 codon 72 polymorphism may affect the function of TP53 mutations

in breast carcinomas but not in colorectal carcinomas. Cancer Epidemiol.

Biomark. Prevent., 11: 1684-1688.

Lavigueur, A., Maltby, V., Mock, D., Rossant, J., Pawson, T. and Bernstein, A., 1989.

High incidence of lung, bone, and lymphoid tumors in transgenic mice

overexpressing mutant alleles of the p53 oncogene. Mol. Cell. Biol., 99:

3982- 3991.

102

Lazar, V., Hazard, F., Bertin, F., Janin, N., Bellet, D. and Bressac, B., 1993. Simple

sequence repeat polymorphism within the p53 gene. Oncogene, 8: 1703-

1705.

Lee, H., Tainer, A. H., Friedman, L. S., Thislethwaite, F. C., Evans, M. J., Ponder, B. and

Venkitaraman, A. R., 1999. Mitotic checkpoint inactivation fosters

transformation in cells lacking the breast cancer susceptibility gene,

BRCA2. Mol. Cell, 4: 1– 10.

Leiros, G. J., Galliano, S. R., Sember, M. E., Kahn, T., Schwarz, E. and Eiguchi, K.,

2005. detection of human papillomavirus DNA and p53 codon 72

polymorphism n prostate carcinomas of patients from Argentina. BMC

Urol., 2490: 5-15.

Levine, A. J., 1997. p53, the cellular gatekeeper for growth and division. Cell. 88:323-

331.

Levine, A. J., Momand, J. and Finlay, C. A., 1991. The p53 tumour suppressor gene.

Nature, 351: 453-456.

Levine, A. J. and Oren, M. 2009. The first 30 years of p53: growing ever more complex.

Nat Rev Cancer. 9(10): 749–758.

Li, F. P. and Fraumeni, J. F., 1969a. Rhabdomyosarcoma in children: epidemiologic study

and identification of a familial cancer syndrome. J. natl. Cancer Inst., 43:

1365-1373.

Li, F. P., and Fraumeni, J. F. Jr., 1969b. Soft tissue sarcomas, breast cancer, and other

neoplasms. A familial syndrome? Ann. Intern. Med., 71: 747-752.

Li, F. P. and Fraumeni, J. F. J., 1992. Predictive testing for inherited mutations in cancer-

susceptibility genes. J. clin. Oncol., 10: 1203- 1204.

Li, F. P. and Fraumeni, J. F. Jr., Mulvihill, J. J., Blattner, W. A., Dreyfus, M. G., Tucker,

M. A. and Miller, R. W., 1988. A cancer family syndrome in twenty-four

kindreds. Cancer Res., 48: 5358- 5362.

Li, F. P., Garber, J. E., Friend, S. H., Strong, L. C., Patenaude, A. F., Juengst, E. T.,

Reilly, P. R., Correa, P. and Fraumeni, J. F. Jr., 1992. Recommendations

on predictive testing for germ line p53 mutations among cancer-prone

individuals. J. natl. Cancer Inst.,84: 1156- 1160.

103

Li, T., Lu, Z. M., Guo, M., Wu, Q. J., Chen, K. N., Xing, H. P., Mei, Q. and Ke, Y.,

2002. p53 codon 72 polymorphism (C/G) and the risk of human

papillomavirus-associated carcinomas in China. Cancer, 95: 2571-2576.

Liede, A., Malik, A. I., Aziz, Z., Rios, L. D. P., Kwan, E. and Narod, A. S., 2002.

Contribution of BRCA1 and BRCA2 mutations to breast and ovarian

cancer in Pakistan. Am. J. Gent., 71: 595- 605.

Lilbbe, J., von-Ammon, K., Watanabe, K., Hegi, M. E. and Kleihues, P., 1995. Familial

brain tumour syndrome associated with a ~53 germline deletion of codon

236. Brain, 5: 15- 23.

Lopez-Saez, J., Gómez-Biondi, V., Santamaría-Rodriguez, G., Dominguez-Villar, M.,

Amaya-Vidal, A., Lorenzo-Peñuelas, A. and Senra-Varela, A., 2010.

Concurrent overexpression of serum p53 mutation related with

Helicobacter pylori infection. J. Exp. Clin. Cancer Res., 29(1): 29-65.

Lovell, D. P., 2006. Population genetics of induced mutations. Environ. Mol. Mutag., 25:

65- 73.

Lovell, W. W., Winter, R., B. and Morrissy, R. T., 2006. Pediatric Orthopaedics. Chap.

14. pp. 496. Lippincott Williams and Wilcins, Philadelphia, PA 19106,

USA.

Lowe, S. W., Ruley, H. E., Jacks, T. and Housman, D. E., 1993. p53-dependent

apoptosis modulates the cytotoxicity of anticancer agents. Cell, 74: 957-

967.

Lukas, J., Groshen, S., Saffari, B., Niu, N., Reless, A., Wen, W. H., Felix, J., Jones, L.

A., Hall, F. L. and Press, M. F., 1997. WAF1/Cip1 gene polymorphism

and expression in carcinomas of the breast, ovary and endometrium. Am.

J. Pathol. 150: 167-175.

MacMahon, B., Trichopoulos, Brown, D., Anderson, A. P., Aoki, K., Cole, P., de Waard,

F., Kanrantemi, T., Morgan, R. W., Purde, M., Ravnihar, B., Stormby, N.,

Westland, K. and Woo, N. C. 1982. Age at menarche, probability of

ovulation and breast cancer risk. Int. J. Cancer, 29: 13-16.

104

Magewu, A. N. and Jones A. P., 1994. Ubiquitous and tenacious methylation of the CpG

Site in codon 248 of the p53 gene may explain its frequent appearance as a

mutational hot spot in human cancer. Mol. Cell Biol.,14 (6): 4225-4232.

Makwane, N. and Saxena, A., 2009. Study of mutations in p53 tumor suppressor gene in

human sporadic breast cancer. Ind. J. Clinic. Biochem., 24 (3) 223-228.

Malik, A. F., Ashraf, S., Kayani, A. M., Jiang, G. W., Mir, A., Ansari, M., Baloch, A. I.,

and Rafshan, S., 2008. Contribution of BRCA1 germline mutation in

patients with sporadic breast cancer. Int. Sem. Surg. Oncol., 5:21.

Malik, I. A., 2002. Clinico-pathological features of breast cancer in Pakistan. J. Pak.

med. Assoc., 52 (3): 100-104.

Malkin, D., Li, F. P., Strong, L. C., Fraumeni, J. F., Nelson, C. E., Kim, K. D., Kassel, J.,

Gryka, M. A., Bischoff, F. Z., Tainsky, M. A. and Friend, S.H., 1990.

Germ Line p53 mutations in a familial syndrome of breast cancer,

sarcomas, and other neoplasms. Science. 250: 1233-1238.

Maltzman, W. and Czyzyk, L., 1984. UV irradiation stimulates levels of p53 cellular

tumor antigen in nontransformed mouse cells. Mol. Cell Biol., 4 (9):

1689–1694.

Mamoon, N., Sharif, M. A., Mushtaq, S., Khadim, M. T. and Jamal, S., 2009. Breast

carcinoma over three decades in northern Pakistan. Are we getting

anywhere? J. Pak. med. Assoc., Suppl., 2:279-282.

Maqsood, B., Zeeshan, M. M., Rehman, F., Aslam, F., Zafar, A., Syed, B., Qadeer, K.,

Ajmal, S. and Imam, S. Z., 2009. Breast cancer screening practices and

awareness in women admitted to a tertiary care hospital of Lahore,

Pakistan. Pak Med Assoc., 59(6):418-421

Marin, M. C., Jost, C. A., Brooks, L. A., Irwin, M. S., O’Nions, J., Tidy, J. A., James, N.,

McGregor, J. M., Harwood, C. A., Yulug, I. G., Vousden, K. H., Allday,

M. J., Gusterson, B., Ikawa, S., Hinds, P. W., Crook, T. and Kaelin, W. G.

J. 2000. A common polymorphism acts as an intragenic modifier of

mutant p53 behaviour. Nat. Genet., 25: 47–54.

Martin, M. A., Kanetsky, A. P., Amirimani, B., Colligon, A. T., Athanasiadis, G. , Shih,

A. H., Gerrero, M. R., Calzone, K., Rebbeck, R. T. and Weber L. B.,

105

2003. Germline TP53 mutations in breast cancer families with multiple

primary cancers: is TP53 a modifier of BRCA1? J. med. Gen., 40 (4): e34.

Matakidou, A., Eisen, T. and Houlston, R. S., 2003. TP53 polymorphisms and lung

cancer risk a systemic review and meta-analysis. Mutagenesis, 18: 377-

385.

Matlashewski, G., Lamb, P., Pim, D., Peacock, J., Crawford, L.and Benchimol, S., 1984.

Isolation and characterization of a human p53 cDNA clone: expression of

the human p53 gene. Embo. J., 3 (13): 3257–3262.

Matlashewski, G., Pim, D., Banks, L. and Crawford, L., (1987). Alternative splicing of

human p53 transcripts. Oncogene Res., 1: 77-85.

McBride, O.W., Merry, D. and Givol, D., 1986. The gene for human p53 cellular tumor

antigen is located on chromosome 17, short arm 15p13. Proc.natl. Acad.

Sci. USA., 83: 130-134.

McDonald, F. and Ford, C. H. J., 1991. Oncogenes and tumor supressor genes.

Information Press, Oxford, pp.1- 16.

McInnis, M. G., 1996. Anticipation: an old idea in new genes. Am. J. Hum. Genet., 59:

973– 979.

McInnis, M. G., McMahon, F. J., Chase, G. A., Simpson, S. G., Ross, C. A. and DePaulo

J. R., 1993. Anticipation in bipolar affective disorder. Am. J. Hum.

Genet., 53: 385–390.

Mcintyre, D. H. and Mcintyre, P. A., 1942. The problem of brain tumor in psychiatric

diagnosis. Am. J. Psychiat., 98: 720- 726.

Melnik, Y., Slater, E. P., Steinitz, R. and Davies, M. A., 1979. Laterality and survival.

Neoplasma, 95(3): 291-293.

Mercer, W. E., Shields, M. T., Amin, M., Sauve, G. J., Appella, E., Romano, J. W. and

Ullrich, S., J., 1990. Negative growth regulatin in a glioblastoma tumor

cell line that conditionally expresses human wild-type p53. Proc. natl.

Acad. Sci., USA., 87: 6166-6170.

Mercer, W. E., Shields, M. T., Lin, D., Appella, E. and Ulrich, S. J.,1991. Growth

suppression induced by wild-type p53protein is accompanied by selective

106

down-regulation of proliferating-cell nuclear antigen expression. Proc.

natl. Acad. Sci. USA., 88: 1958-1962.

Miki, Y., Swensen, J. and Shattuck-Eidens, D., 1994. A Strong candidate for the breast

and ovarian cancer susceptability gene BRCA1. Science, 266: 66– 71.

Mills, A. A., 2005. p53: link to the past, bridge to the future. Genes Dev., 19: 2091-2099.

Miyashita, T. and Reed, J. C., 1995. Tumor suppressor p53 is a direct transcriptional

activator of the human bax gene. Cell, 80: 293–299.

Mojtahedi Z., Hashemi, S. B., Khademi, B., Karimi, M., Haghshenas, M., R., Fattahi, M.,

J. and Ghaderi, A. 2010. P53 codon 72 polymorphism association with

head and neck squamous cell carcinoma Braz. j. otorhinolaryngol., 76(3)..

316-320.

Nakazawa, H., English, D., Randell, N. P., Nakazawa, K., Martel, N., Armstrong, K. B.

and Yamasaki, H., 1994. UV and Skin cancer specific TP53 gene mutation

in normal skin as a biologically relevant exposure measurement. Proc.

natl. Acad. Sci. USA, 91: 360-364.

NIC. National institute of cancer America, (2011). http://www.cancer.gov/

cancertopics/ types/breast.

Nishigaki, K., Husimi, Y. and Tsubota, M., 1986. Detection of diference in higher order

structure between highly homologus single stranded DNA by low

temperature denaturant gradient gel electrophoresis. J. Biochem., 99 (3):

663- 671.

Norberg, T., Lennerstrand, J., Inganas, M. and Bergh, J. 1998., Comparison between p53

protein measurements using the luminometric immunoassay and

immunohistochemistry with detection of p53 gene mutations using cDNA

sequencing in human breast tumors. Int. J. Cancer, 79: 376– 383.

Nowell, P. C., 1992. Biology of disease: cancer, chromosomes and genes. Lab. Invest.,

66: 407-419.

Oliver, M., Hollstein, M., and Hainaut, P., 2009. TP53 Mutations in Human Cancers:

Origins, Consiquences and clinical use.http://cshperspectives.cshlp.org/

Olivier M. and Hainaut, P., 2001. TP53 mutation patterns in breast cancers: searching for

clues of environmental carcinogenesis. Semin. Cancer Biol., 11: 353– 360.

107

Olivier, M., Eeles, R., Hollstein, M., Khan, M. A., Harris, C. C. and Hainaut, P., 2002.

The IARC TP53 database: new online mutation analysis and

recommendations to users. Hum. Mutat., 19: 607– 614.

Olivier, M., Langer, A., Carrieri, p., Bergh, J., Klaar, S., Eyfjord, J., Theillet, C.,

Rodriguez, C., Lidereau, R., Bie' che, I., Varley, J., Bignon, Y.,

Uhrhammer, N., Winqvist, R., Jukkola-Vuorinen, A., Niederacher, D.,

Kato, S., Ishioka, C., Hainaut, P., and Borresen-Dale, L. A., 2006. The

clinical value of somatic TP53 gene mutations in 1,794 patients with

breast cancer. Clin. Cancer Res., 12(4): 1157- 1167.

Olschwang, S., Laurentpuig, P., Vassal, A., Salmon, R. J. and Thomas, G., 1991.

Characterization of a frequent polymorphism in the coding sequence of the

Tp53 gene in colonic cancer patients and a control population. Hum.

Genet., 86: 369- 370.

Olumi, A.F., Tsai, Y.C. Nichols, P.W., Skinner, D.G., Chain. D.R., Bender. L.I. and

Jones, P.A., 1990. Allelic loss of chromosome 17p distinguishes high

grade from low grade transitional cell carcinomas of the bladder. Cancer

Res., 50: 7081-7083.

Oncolink., 2007. http://www.oncolink.com/search/search.cfm

Oren, M., Maltzman, W. and Levine, A. J,. 1981. Post-translational regulation of the 53

K cellular tumor antigen in normal and transformed cells. Mol. Cell

Biol.,1: 101-110.

Ory, K., Legros, Y., Auguin, C. and Soussi, T., 1994. Analysis of the most representative

tumor-derived p53 mutants reveals that changesin protein conformation

are not correlated with loss of transactiation or inhibition of cell

proliferation. EMBO J., 13: 3496- 3504.

Osborne, H. R., Houben, A.W., Tijssen, C. C., Coebergh, W.W. and van Duijn, M. C.,

2001. The genetic epidemiology of glioma. Neurology, 57: 1751- 1755.

Overgaard, J., Yilmaz, M., Guldberg, P., Hansen, L. L., and Alsner, J., 2000. TP53

mutation is an independent prognostic marker for poor outcome in both

nodenegative and node-positive breast cancer. Acta Oncol., 39(3): 327 –

333.

108

Papadakis, E. N., Dokianakis, D. N. and Spandidos, D. A., 2000. p53 codon 72

polymorphism s a risk factor in the development of breast cancer. Mol.

Cell. Biol. Res. Commun., 3: 389-392.

Parkin, D. M. and Iscovich, J., 1997. Risk of cancer in migrants and their descendants in

Israel: II. Carcinomas and germ-cell tumors. Int. J. Cancer, 70: 654– 660.

Parkin, D. M., Muir, C. S. and Whelan, S. L., 1992. Cancer incidence in five continents.

Comparability and quality of data. Publication no.120. IARC.

Patel, K. and Sakamoto, M. K., 2006. Li. Fraumeni syndrome: www.emedicines.com.

Peller, S., Kopilova, Y., Slutzki, S., Halevy, A., Kvitko., K. and Rotter, V., 1995. A novel

polymorphism in intron 6 of the human p53 gene: a possible association

with cancer predisposition and susceptibility. DNA Cell Biol., 14: 983 -

990.

Perera, F. P., 1987. Molecular cancer epidemiology: a new tool in cancer prevention. J.

natl. Cancer Inst.,78: 887–898.

Perera, F. P., Poirier, M. C., Yuspa, S. H., Nakayama, J., Jaretzki, A., Curnen, M. M.,

1982. A pilot project in molecular cancer epidemiology: determination of

benzopyrene–DNA adducts in animal and human tissues by

immunoassays. Carcinogenesis, 3: 1405–1410.

Petitjean, A., Achatz, M., Borresen-Dale, I.W., Hainaut, P. and Olivier, M., 2007.TP53

mutations in human cancers: functional selection and impact on cancer

prognosis and outcomesTP53 mutations in human cancers. Oncogene 26,

2157-2165.| doi:10.1038/sj.onc.1210302.

Petitjean, A., Mathe, E., Kato, S., Ishioka, C., Tavtigian, S. V., Hainaut, P. and Olivier,

M., 2007. Impact of mutant p53 functional properties on TP53 mutation

patterns and tumor phenotype: lessons from recent developments in the

IARC TP53database Hum.Mutat.28(6):622-629.

Pezeshki, M. A., Farjadian, S., Talei, A., Vasei, M., Gharesi-Fard, B. , Doroudchi, M. and

Ghaderi, A., 2001. p53 gene alteration and protein expression in Iranian

women with infiltrative ductal breast carcinoma. Cancer Lett., 169: 69-75.

Pierce, L. M., Sivaraman, L., Chang, W., Lum, A., Donlon, T., Seifried, A., Wilkens, L.

R., Lau, A. F. and Le-Marchand, L. 2000. Relationships of TP53 codon 72

109

and HRAS1 polymorphisms with lung cancer risk in an ethnically diverse

population. Cancer Epidemiol. Biomark. Prev., 9: 1199-1204.

Pietsch, E. C., Humbey, O. and Murphy, M. E. 2006. Polymorphisms in the p53 pathway.

Oncogene, 25: 1602- 1611.

Pleasants, L. M. and Hansen, M. F., 1994. Identification of a polymorphism in intron 2 of

the p53 gene. Hum. Genet., 93: 607-609.

Pluquet, O. and Hainaut, P., 2001. Genotoxic and non-genotoxic pathways of p53

induction. Cancer Lett., 174: 1-15.

Prera, F. B. and Weinstein, I. P., 1982 .Molecular epidemiology and carcinogens- DNA

adduct detection new approaches to study of cancer causations. J. Chron.

Dis., 35: 581-600.

Prosser, J. and Condie, A. 1991. Biallelic apaI polymorphism of the human p53-gene

(TP53). Nucl. Acids Res., 19: 4799.

Prosser, J., Elder, P.A., Condie, A., MacFadyen, I., Steel, C. M. and Evans H. J., 1991.

Mutations in p53 do not account for heritable breast cancer: a study in five

affected families.Br. J. Cancer, 63: 181-184.

Pursianen, K., Boffetta, P., Kannio, A., Nyberg, F., Pershagen, G., Mukeria, A.,

Constintanescu, V., Fortes, C. and Benhamou, S. 2000. p53 mutations and

exposure to environmental tobacco smoke in a multicenter study on lung

cancer. Cancer Res, 60: 2906-2911.

Quesnel. B., Preudhomme, C., Fournier, J., Fenaux, P., Peyrat, J. P. 1994. MDM2 gene

amplification in human breast cancer. Eur. J. Cancer., 30A: 982-984.

Raman, V., Martensen, S. A., Reisman, D., Evron, E., Odenwald, W. F., Jaffee, E.,

Marks, J., Sukumar, S. 2000. Compromised HOXA5 function can limit

p53 expression in human breast tumours. Nature, 405: 974-978.

Rana, F., Younus, J., Muzammil, A., Raza, S., Siddiqui, S. K., Khan, U., Hameed, S., and

Shah, A. M., 1997. Breast cancer epidemiology in Pakistani women. J.

Coll. Phys.Surg. Pak., 8(1): 20- 23.

Rangan, A. 2008. NSW Breast Cancer institute. http://www.bci.org.au/index.

Rashid, U. M., Zaidi, A., Torres, D., Sultan, F., Benner, A., Naqvi, B., Shakoori, A. R.,

Seidel-Renkert, A., Farooq, H., Narod, S., Amin, A. and Hamann U. 2006.

110

Prevalence of BRCA1 and BRCA2 mutations in Pakistani breast and

ovarian cancer patients. Int. J. Cancer, 119: 2832-2839.

Rashid, M. U., Torres, D., Rasheed, F., Sultan, F., Shakoori, A. R. Amin, A. Schlaefer.

K., and Hamann, U., 2008. No association of miscarriage and BRCA

carrier status in Pakistani breast/ovarian cancer patients with a history of

parental consanguinity. Br. Can. Res. Treat. 116 (1). 211. 213.

Rasool, M. I., Malik, M. I., Luqman, M. and Khalilullah. 1987 .The clinicopathological

study of carcinoma breast. Pakistan J. med. Res., 6:135-136.

Reich, N. C. and Levine, A. J. 1984. Growth regulation of a cellular tumour antigen, p53

in non transformed cells. Natur, 308. 199-201.

Reid, R. and Robert, F. 2008. Pathology illustrated.www.amazon.com.

Rosen, P. P. 2001. Rosen’s breast pathology.2ND ed. Lippincott Williams and Wilkins.

Philadelphia.,PA, 19106. pp. 326.

Rossner Jr, P., Gammon, M. D., Zhang, Y. J., Terry, M. B., Hibshoosh, H., Memeo, L.,

Mansukhani, M., Long, C. M., Garbowski, G., Agrawal, M., Kalra, T. S.,

Gaudet, M. M., Teitelbaum, S. L., Neugut, A. I. and Santella, R. M., 2009.

Mutations in p53, p53 protein overexpression and breast cancer survival.

J. Cell mol. Med., 13(9B): 3847–3857.

Samuels-Lev, Y., O., Connor, D. J., Bergamaschi, D., Trigiante, G., Hsieh, J. K., Zhong,

S., Campargue, I., Naumovski, L., Crook, T. and Lu, X., 2001. ASPP

proteins specifically stimulate the apoptotic function of p53. Mol. Cell, 8:

781-794.

Santan, R. J., 2010. Benign breast diseases in women. www.endotext.org.

Santos, A. M., Sousa, H., Catarino, R., Pinto, D., Pereira, D., Vasconcelos, A., Atos, A.,

Lopes, C. and Medeiros, R., 2005.TP53 codon 72 polymorphism and risk

for cervical cancer in Portugal. Cancer Genet. Cytogenet., 159:143-147.

Sarfraz, S., Hamid, S., Siddiqui, A., Hussain, S., Pervez, S. and Alexander, G., 2008.

Altered expression of cell cycle and apoptotic proteins in chronic hepatitis

C virus infection. BMC Microbiol. 8: 133.

111

Sayhan, N., Yazici, H., Budak, M., Bitisik, O., and Dalay, N., 2001. p53 codon 72

genotypes in colon cancer: association with human papillomavirus

infection. Res. Commun. mol. Pathol. Pharmacol.,109: 25- 34.

Schlichtholz, B., Bouchind’homme, B., Pages, S., Martin, E., Liva, S., Magdelenat, H.,

Sastre-Garau, X., Stoppa-Lyonnet, D. and Soussi. T., 1998. p53 mutations

in BRCA1-associated familial breast cancer. Lancet, 352: 622- 635.

Sebastian, S., Azzariti, A., Silvestris, N., Porcelli, L., Russo, A. and Paradiso, A., 2010.

P53 as the main traffic controller of the cell signaling network. Front.

Biosci., 15: 1172-1190.

Serra, A., Gaidano, G. L., Revello, D., Guerrasio, A., Ballerini, P., Dallafavera, R. and

Saglio, G. 1992. A new Taql polymorphism in the p53 gene. Nucl. Acid.

Res., 20: 928.

Shaukat Khanum Hospital. 2011. www.shaukatkhanum.org.pk.

Sharpless, N. E. and DePinho, R. A., 2004. Telomeres, stem cells, senescence, and

cancer. J. Clin. Invest.,113:160–168.

Shaulsky, G., Benzeev, A. and Rotter, V., 1990. Subcellular distribution of the p53

protein during the cell cycle of Balb/c 3T3 cells. Oncogene, 5: 1707-1711.

Shaulsky, G., Goldfinger, N., Peled, A. and Rotter, V. 1991. Involvement of wild-type

p53 in pre-B-cell differentation in vitro. Proc. natl. Acad. Sci., 88: 8982-

8986.

Shi , H., Tan, S. J., Zhong, H., Hu, W., Levine, A., Xiao, C. J., Peng, Q. i XB., Shou, W.

H., Ma, R. L., Li, Y., Su, B. and Lu, X., 2009. Winter temperature and UV

are tightly linked to genetic changes in the p53 tumor suppressor pathway

in Eastern Asia. Am. J. Hum. Genet., 84(4): 534-541.

Shiao, Y. H., Chen, V.W., Scheer, W. D., Wu, X. C. and Correa, P. 1995. Racial

disparity in the association of p53 gene alterations with breast cancer

survival. Cancer Res., 55:1485–1490.

Shimizu, H., Ross, R.K, Bernstein, L., Yatani, R., Henderson, B. E., Mack, T. M., 1991.

Cancers of the prostate and breast amongJapanese and white immigrants

in Los Angeles County. Br. J. Cancer, 63:963– 966.

112

Shojaie, N. and Tirgari, F. 2008. Detection of somatic mutation of codon 248 of p53 gene

between Iranian women with breast cancer. Int. J. Clin. Pract.,1: 27-32.

Siddique, M. M., Balram, C., Fiszer-Maliszewska, L., Aggarwal, A., Tan, A., An, P.,

Soo, K. C. and Sabapathy, K., 2005. Evidence for selective expression of

the 53 codon 72 polymorphs: implications in cancer development. Cancer

Epidemiol. Biomark. Prev.,.14: 2245- 2252.

Siddiqui, M. S., Kayani, N., Sulaiman, S., Hussainy, A. S., Shah, S. H. and Muzaffar, S.,

2000. Breast carcinoma in Pakistani famales: a morphological study of

572 breast specimens. J. Pakistan. med. Assoc., 50(6).174-177.

Siervi, A. D., Luca, P. D., Byun, J. S., Di, L. J., Fufa, T., Haggerty, C. M., Vazquez, E.,

Moiola, C., Longo, D. L. and Gardner, K. 2010. Transcriptional

autoregulation by BRCA1. Cancer Res. 70(2): 532–542.

Simão, T. A., Ribeiro, F. S., Amorim, L. M. F., Albano, R. M., Andrada-Serpa, M.

J.,Cardoso, L. E. B., Mendonça, G. A. and Moura-Gallo, C. V., 2002.

TP53 mutations in breast cancer tumors of patients from Rio de Janeiro,

Brazil: Association with risk factors and tumor characteristIcs. Int. J. Can.

101(1): 69-73.

Sinha, R., Gustafson, D. R., Kulldorf, M., Wen, W. Q., Cerhan, J. R., Zheng, W., 2000.

2-Amino-1-methyl-6-phenylimidazo pyridine, a carcinogenin high-

temperature-cooked meat, and breast cancer risk. J. Natl. Cancer Inst.,

92:1352–1354.

Snyderwine, E. G., 2007. Mammary gland carcinogenesis by food derived heterocyclic

amines: metabolism and additional factors influencing carcinogenesis by

2-Amino-1-methyl-6- phenylimidazo[4,5-b]pyridine (PhIP). Environ. Mol.

Mutagen. 39: 165–170.

Sjalander, A., Birgander, R., Hallmans, G., Cajander, S., Lenner, P., Athlin, L., Beckman,

G. and Beckman, L., 1996. p53 polymorphisms and haplotypes in breast

cancer. Carcinogenesis,7:1313- 1316.

Sohail, S. and Alam, S. N., 2007. Breast cancer in Pakistan–awareness and early

detection. J. Coll. Phys. Surg. Pak., 7: 711–712.

113

Sorlie, T., Johnsen, H., Phuong, Vu., Elisabeth, G., Lind.- Lothe, R. and Borresen- Dale,

L. A., 2005. Mutation screening of the TP53 gene by temporal

temperature Gradient gel electrophoresis. Methods Mol. Biol., 291: 207-

216.

Souici, C. A., Mirkovitch, J., Hausel, P., Keefer, K. L. and Felley-Bosco, E., 2000.

Transition mutation in codon 248 of the p53 tumor suppressor gene

induced by reactive oxygen species and anitric oxide-releasing compound.

Carcinogenesis, 21(2): 281-287.

Soulitzis, N., Sourvinos, G., Dokianakis, D. N. and Spandidos, D. A., 2002. p53 codon 72

polymorphism and its association with bladder cancer. Cancer Lett., 179:

175- 183.

Soussi, T., (2011). http://p53.free.fr/

Soussi, T. and Beroud, C., 2001. Assessing TP53 status in human tumours to evaluate

clinical outcome. Nat. Rev. Cancer, 1: 233–240.

Soussi, T., Béroud, C., Hamroun, D. and Rubio-Nevado, J. M., 2011. P53 mutation

handbook. http://p53/free.fr.

Soussi, T., Legros, Y., Lubin, R., Ory, K. and Schlichtholz, B., 1994. Multifactorial

analysis of p53 alteration in human cancer-a review. Int. J. Cancer, 57: 1-

9.

Soussi, T., Rubio-Nevado, J. M. and Ishioka, C., 2006. MUT-TP53: a versatile matrix for

TP53 mutation verification and publication. Hum. Mutat., 27: 1151-1154.

Srivastava, S., Zou, Z. Q., Pirollo, K., Blattner, W. and Chang, E. H., 1990. Germ-line

transmission of a mutated p53 gene in a cancer-prone family with Li-

Fraumeni syndrome. Nature, 348: 747-749.

Stanford, J. L., Weiss, N. S. and Voigt, L. F., 1995. Combined estrogen and progestin

hormone replacement therapy in relation to risk of breast cancer in

middle-aged women. J. Am. med. Assoc., 274:137.

Storey, A., Thomas, M., Kalita, A., Harwood, C., Gardiol, D., Mantovani, F., Breuer, J.,

Leigh, I. M., Matlashewski, G. and Banks, L., 1998. Role of p53

polymorphism in the development of human papillomavirus-associated

cancer. Nature, 393: 229-234.

114

Streuli, C., 2004. The molecular basis of breast cancer prevention and treatment. Breast

Cancer Res., 6:179-180.

Strong, L. C., Stine, M. and Norsted, T. L., 1987. Cancer in survivors of childhood soft

tissue sarcoma and their relatives. J. natl. Cancer Inst., 79: 1213-1220.

Suspitsin, E. N., Buslov, K. G., Grigoriev, M. Y., Ishutkina, J. G., Ulibina, J. M.,

Gorodinskaya, V. M., Pozharisski, K. M., Berstein, L. M., Hanson, K. P.,

Togo. A. V. and Imyanitov, E. N., 2003. Evidence against involvement of

p53 polymorphism in breast cancer predisposition. Int. J. Cancer,103:

431-433.

Tabori, U., Nanda, S., Druker, H., Lees, J. and Malkin, D. 2007.Younger age of cancer

initiation is associated with shorter telomere length in Li-Fraumeni

syndrome. Cancer Res., 67 (4): 1415-1418.

Takahashi, T., Nau, M. M., Chiba, I., Birrer, M. J., Rosenberg, R. K., Vinocour, M.,

Levitt, M., Pass, H., Gazdar, A. F. and Minna, J. D. 1989. p53- a frequent

target for genetic abnormalities in lung cancer. Science, 246: 491-494.

Taneja, P., Maglic, D., Kai, F., Zhu, S., Kendig, R. D., Fry, E. A. and Inoue, K. 2010.

Classical and Novel Prognostic Markers for Breast Cancer and their

Clinical Significance. Clinic. Medicine Insights: Oncology . 4: 15-34.

Tenti, P., Vesentini, N., Rondo-Spaudo, M., Zappatore, R., Migliora, P., Carnevali, L.,

Ranzani, G. N., 2000. p53 codon 72 polymorphism does not affect the risk

of cervical cancer in patients from northern Italy. Cance Epidemiol.

Biomark. Prev., 9: 435-438.

Thor, A.D., Yandell, D.W. 1993. Prognostic significance of p53 over expression in node

negative breast carcinoma-preliminary studies support cautious support

cautious optimism. J. natl. Cancer Inst.,85: 176-177.

Toguchida, J., Yamagucbi, T., Dayton, S. H., Beau- Lilbbe, J., von-Ammon,

K.,Watanabe, K., Hegi, M. E. and Kleihues, P., 1995. Familial brain

tumour syndrome associated with a ~53 germline deletion of codon 236.

Brain, 5: 15-23.

Tommiska, J., Eerola, H., Heinonen, M., Salonen, L., Kaare, M., Tallila, J., Istimaki, A.,

von- Smitten, K., Aittomaki, K., Heikkila, P., Blomqvist, C. and

115

Evanlinna, H., 2005. Breast cancer patients with p53 Pro72 homozygous

genotype have a poorer survival. Clin Cancer Res., 11: 098-103.

Toruner, G. A., Ucar, A., Tez, M., Cetinkaya, M., Ozen, H. and Ozcelik, T., 2001. p53

odon 72 polymorphism in bladder cancer: no evidence of association with

increased risk -invasiveness. Urol. Res., 29:393-395.

Tsuda, H., Iwaya, K., Fukutomi, T. and Hirohashi, S., 1993. p53 mutations and c-erbB-2

amplification in intraductal and invasive breast carcinomas of high

histologic grade, Jpn. J. Cancer Res., 84: 394–401.

Tybulewicz, V. L. and Ashworth, A., 1997. Tumorigenseis and a DNA rapair defect in

mice with a truncating BRCA2 mutation. Nat. Genet., 17: 423–430.

Usmani, K., Khanum, A., Afzal, H. and Ahmad, N. 1996. Breast carcinoma in Pakistani

women. J. environ. Pathol. Toxicol. Oncol., 15. 251-253.

Varley, J. M., McGown, G., Thorncroft, M., Santibanez-Koref, M. F., Kelsey, A. M.,

Tricker, K. J., Evans, D. G. and Birch, J. M., 1997. Germ-line mutations

of TP53 in Li-Fraumeni families: an extended study of 39 families.

Cancer Res., 57: 3245-3252.

Varley, J. M., Thorncroft, M., McGown, G., Appleby, J., Kelsey, A. M., Tricker, K. J.,

Evans, D. G. and Birch, J. M., 1997. A detailed study of loss of

heterozygosity on chromosome 17 in tumours from Li- Fraumeni patients

carrying a mutation to the TP53 gene. Oncogene, 14: 865–871.

Vousden, K. H. and Lane, D. P., 2007. p53 in health and disease. Nat. rev., (8): 275-283.

Vásquez, A., Ahrné, S., Pettersson, B. and Molin, G., 2001. Temporal temperature

gradient gel electrophoresis (TTGE) as a tool for identification of

Lactobacillus casei Lactobacillus paracasei, Lactobacillus zeae and

Lactobacillus rhamnosus. Lett. appl. Microbiol., 32: 215-219.

Vousden, K., H. and Lu, X., 2002. Live or let die: the cell's response to p53. Nat. Rev.

Can., 2: 594-604.

Vousden, K. H. and Lane, D. P., 2007. TP53 in health and disease. Nature Rev. Molec.

Cell Biol. 8: 275-283.

Walsh, T., Casadei, S. and Coats, K. H., Swisher, E., Stray, S. M., Higgins, J., Roach, K,

C., Mandell, J., Ming, K., Lee, Ciernikova, S., Foretova, L., Soucek, P.

116

and King, M. C., 2006. Spectrum of mutations in BRCA1, BRCA2,

CHEK2 and TP53 in families at high risk of breast cancer. J. Am.

med.Assoc. 295: 1379 –1388.

Wang, Y. C., Lee, H. S., Chen, S. K., Yang, S. C. and Chen, C.Y., 1998. Analysis of K-

ras gene mutations in lung carcinomas: correlation with gender,

histological subtypes, and clinical outcome. J. Cancer Res. clin. Oncol.,

124: 517-22..

Wang-Gohrke, S., Rebbeck, T. R., Besenfelder, W., Kreienberg, R. and Runnebaum, I.

B., 1998. p53 germline polymorphisms are associated with an increased

risk for breast cancer in German women. Anticancer Res., 18: 2095-2099.

Weiss, A .H.,Devesa, S. S. and Brinton, A. L. 1996. Laterality of breast cancer in the

United States. Cancer Causes Cont., 7:539-543.

Weston, A. and Godbold, J. H., 1997. Polymorphisms of H-ras-1 and p53 inbreast cancer

and lung cancer: a meta-analysis. Environ. Hlth. Perspect., 105(Suppl.4):

919–926.

Weston, A., Pan, C. F., Ksieski, H. B., Wallenstein, S., Berkowitz, G. S., Tartter, P. I.,.

Bleiweis, I. J., Brower, S. T., Senie, R. T. and Wolff, M. S. 1997. p53

haplotype determination in breast cancer. Cancer Epidemiol. Biomarkers

Prev., 6:105-112.

Whibley, C., Pharoah, P. D., and Hollstein, M, 2009. P53 polymorphisms: cancer

implications. Nat. Rev.Cancer, 9(2): 95-107.

Wikipedia. 2008. http://en.wikipedia.org/wiki/Mammary_ductal_carcinoma.

Wittwer, C. T., Reed, G. H., Gundry, C. N., Vandersteen, J. G. and Pryor, R. J., 2003.

High-resolution genotyping by amplicon melting analysis using LC Green.

Clin. Chem., 49(6 Pt 1):853-860.

Xu, X., Wagner, K.U, Larson, D., Weaver, Z., Li, C., Ried, T., Hennighausen, L.,

Wynshaw-Boris, A. and Deng, C. X.,1999. Conditional mutation of

BRCA1 in mammary epithelial cells results in blunted ductal

morphogenesis and tumour formation. Nature Genet., 22: 37–43.

117

Yu, M., Ryu, D. and Snyderwine, E. G., 2000. Genomic imbalance in rat mammary gland

carcinomas induced by 2-amino-1-methyl-6-phenylimidazo(4,5-

b)pyridine, Mol. Carcinog., 27: 76–83.

Zeb,aA., Rasool, A. and Nasreen, S., 2008. Cancer incidence in the districts of Dir (North

West Frontier Province), Pakistan: A Preliminary study. J. Chin. Med.

Assoc.71(2): 62-65.

Zehbe, I., Voglino, G., Wilander, E., Genta, F. and Tommasino, M., 1999. Codon 72

olymorphism of p53 and its association with cervical cancer. Lancet,

354:218-219.

Zelada-Hedman, M., Borresen-Dale, A. L., Claro, A., Chen, J., Skoog, L. and Lindblom,

A., 1997. Screening for TP53 mutations in patients and tumours from 109

Swedish breast cancer families. Br. J. Cancer, 75: 1201–1204.

Zheng, W., Gustafson, D. R., Sinha, R., Cerhan, J. R., Moore, D. and Hong, C. P. 1998..

Well-done meat intake and the risk of breast cancer. J. Natl. Can. Inst.

90:1724-9.

Zhu, Z. Z., Cong, W. M., Zhu, G. S., Liu, S. F., Xian, Z. H., Wu, W.Q., Zhang, X. Z.,

Ang, Y. H. and Wu, M. C., 2005. Association of p53 codon 72

polymorphism with enetic susceptibility to hepatocellular carcinoma in a

Chinese population. World J. Gasteroentrol., 22: 632-635.

Ziemer, M. A., Mason, A. and Carlson, D. M., 1982. Cell-free translations of proline-

rich protein mRNAs. J. Biol. Chem. 257 (18): 11176–11180.

118

APPENDICES

Appendix-1

Proforma for the project of “Spectrum of TP53 tumor suppressor gene mutations in Pakistani breast cancer patients SCHOOL OF BIOLOGICAL SCIENCES University of the Punjab, Lahore, Pakistan

PATIENT INFORMATION SHEET Title of the Project: Spectrum of TP53 tumor suppressor gene mutations in

Pakistani breast cancer patients You are being asked to participate in a multi-center research study. In order to decide whether or not you should agree to be part of this research study, you should understand enough about its risks and benefits to make an informed judgment. This process is known as informed consent. Purpose of the research project: Breast Cancer (BC) is one of the most frequent cancers in Pakistan. The number of cases of BC cancer diagnosed has increased in recent years. Currently there are a number of treatments available for BC. From previous research we are able to advise patients with particular breast cancers the treatment or combination of treatments best suited to them. Within the research laboratory, we are working with and developing new techniques to look at genes and their protein products in cancer cells. The small amount of fresh tissue we have will be used in a variety of ways. The most important of these will be directed to improvements in the diagnosis and treatment of breast cancer. There are many causes for breast cancers. One of the major causes may be mutation(s) in certain genes. You have been diagnosed as having BC. The tissue retrieved by this procedure will be used in a study for analysis of any kind of mutation(s) in these genes. Confidentiality, privacy and disclosure of information The outcome of this research and your hospital records will be kept confidential. What are the benefits involved? It is not possible to predict whether any personal benefits will result from your participation in this research project. The information obtained from this research will be used scientifically and may be of benefit to patients with BC in future. Are there any risks involved?

119

The tissue we wish to collect is no longer needed for your medical care and would normally be destroyed if we did not collect it for use. Therefore, there are no physical risks to you in donating your tissue. You will not be required to take any medication or undergo any treatment that is not usually indicated for your therapy. There will be no risk to your health or ability to receive appropriate therapy. What if I do not want to donate my tissue? The choice to donate your tissue is entirely up to you, and no matter what you decide it will not affect your care in any way. You are under no obligation to donate your tissue. If you change your mind at any time, just contact us and let us know you do not want us to use your tissue. Any remaining tissue will be discarded. Will I find out about the results of the research using my tissue? You will receive the result of your surgery from your doctor, but you may not receive results of the research done with your tissue. This is because research can take many years and uses tissue samples from a large number of people and so will not affect your care right now. Who can I contact if I have more questions? We encourage you to call us with any concerns or questions you may have. You can contact following persons; Professor Dr. A. R. Shakoori Meritorious Professor & Director School of Biological Sciences, University of the Punjab, Lahore Cell: 03334673255 E mail: arshak@brain.net.pk

Dr. Qasim Ahmed Shaukat Khanum Memorial Cancer Hospital & Research Centre, Johar Town Lahore Tel: 042-5180725 E-mail: qahmed@skm.org.pk

120

SCHOOL OF BIOLOGICAL SCIENCES University of the Punjab, Lahore, Pakistan Title of the Project: Spectrum of p53 tumor suppressor gene

mutations in Pakistani breast cancer patients PATIENT CONSENT FORM

Project Title:

Patient Name:

Name of Surgeon:

Please read this section carefully and indicate whether you consent to each of these items.

1. I have read and understood the Patient Information Sheet and I have been given a copy to keep. All my questions have been answered to my satisfaction.

Yes/No

2. I have had the opportunity to fully consider my donation of tissue for cancer research purpose and understand that I may withdraw my consent at any time and for any reason and this will not affect my care now or in the future.

Yes/No

3. I consent to make a gift of my tissue/blood for use in any aspect of cancer research.

Yes/No

4.

I understand that I am consenting to make a 'gift' of tissue for use in any aspect of cancer research and waive all claims to patents, commercial exploitation, property or any material or products which may form part of or arise from this study.

Yes/No

5. I understand that some research projects may include genetic research, and the results of such investigations will not be made available to me.

Yes/No

6.

I understand that information will be collected from my medical records and stored on a computer database and that my identity and privacy will be protected at all times. No information about me or my family will be revealed in any research results.

Yes/No

7. You may contact me in the future to ask my permission to take part in more research.

Yes/No

8. I give permission for follow-up data to be collected from my medical records.

Yes/No

(Doctor/Health Professional/Research Team Member).…………………………………. has explained to me and I understand the consequences involved in participation in the collection of material and data for this cancer research project.

121

SIGNATURE…………………………………………….DATE…………………………………… INDEPENDENT WITNESS (someone who is not a member of the research team) NAME:………………………………………………SIGNATURE…………………...…………DATE………….……. WITNESS (research team member) NAME:………………………………………………SIGNATURE………………………..……..DATE…………………

122

QUESTIONNAIRE FOR THE BREAST CANCER PATIENTS

Title of Project: Spectrum of p53 tumor suppressor gene mutations in Pakistani breast cancer patients

Serial no.-________________ Date__________

General information

Name ------------------------- Date of birth ------------------------- Education ------------------------- Sex ------------------------- Marital status ------------------------- Age when married ------------------------- Any relative having breast cancer (degree) ------------------------ Monthly income ------------------------ Profession ------------------------ Religion ------------------------ Knowledge about self examination ------------------------ Address ----------------------- Age at menarche ----------------------- Regularity of menstrual cycle ---------------------- Age at menopause --------------------- Active smoking ----------------------- Passive smoking ---------------------- Fuel in use ---------------------- Alcohol intake ----------------------- Use of contraceptives ----------------------- Use of any other drug ----------------------- No. of children ----------------------- No. of miscarriages/child deathes ---------------------- Breast feeding ---------------------- Ovary discordment --------------------- Usual diet included (meat fonder/vegetarian) -------------------- Any other physical problem --------------------- Environmental exposure ---------------------------

123

Clinical information Tumor type ----------------------- Tumor size ----------------------- Tumor grade ---------------------- ER/PR status ---------------------- Node status ----------------------- Clinical stage ----------------------- Laterality -----------------------

Research article