sponsored by aiat.or.th and kindml, siit · find invariant representations of data if possible. 5....
TRANSCRIPT
Table of Contents
Chapter 1. Introduction .................................................................................................................... 1 1.1. What is Data Mining and Text Mining? .................................................................................. 1 1.2. Common steps in data mining and text mining ..................................................................... 2 1.3. Types of Data in Data Mining/Text Mining ............................................................................ 3 1.4. Some Data Mining Applications ............................................................................................. 9 1.5. Text Mining Application ....................................................................................................... 10 1.6. Types of Mining Tasks .......................................................................................................... 12
1.6.1. Classification or Categorization: Finding the class of an object ................................... 12 1.6.2. Prediction: Predicting the value for an object ............................................................. 14 1.6.3. Clustering/Deviation Detection: Grouping data/Detecting outliers ............................ 15 1.6.4. Association Analysis: Finding frequent co-occurrences ............................................... 17 1.6.5. Characterization and Discrimination: Describing a class or concept ........................... 20 1.6.6. Meta Functionalities: Link, Outlier, and Trend/Evolutional Analysis ........................... 22 1.6.7. Visualization ................................................................................................................. 23
1.7. Challenges in Data Mining and Text Mining ......................................................................... 26 1.8. Summary .............................................................................................................................. 28 1.9. Historical Bibliography ......................................................................................................... 29 Exercise ............................................................................................................................................. 30
Sponsored by AIAT.or.th and KINDML, SIIT
CC: BY NC ND
1
Chapter 1. Introduction
Data mining, also known as knowledge discovery, is a process to uncover hidden patterns from large-
scale data. Nowadays, it has attracted a great deal of attention in our society since there has been the
wide availability of huge amounts of recorded data, triggering an issue of information overload, and
the imminent need for turning such data into useful information and knowledge. Recently data
recorded in any storage have been growing up to the level of Giga (109) bytes or Tera (1012) bytes,
even Peta (1015) bytes in the near future. With this constant everlasting data generation, it generates
not only managerial issues but also challenging opportunities. Moreover, due to this data explosion
problem, nowadays people are drowning in this large amount of data, and starving for useful
knowledge. Towards efficient and effective utilization of huge amounts of data, data warehousing
with on-line analytical processing (OLAP) and data mining/knowledge discovery from databases
emerges to turn such large scattering data into useful systematic information and knowledge, using
availability of current cost effective computing power. While data warehousing with OLAP focuses
on more interactive manual exploring of interesting pattern, data mining seeks for a set of
autonomous methods in analyzing large amounts of data and extracting useful new knowledge
embedded in such data semi or fully automatically. While data mining is not new, it adopts
techniques from several traditional fields, such as machine learning, statistical reasoning and
information theory, to gain from observation of new complex phenomena the insight necessary to
increase our knowledge.
As an introductory material to a young and promising field of data mining and knowledge
discovery from data, the material in this book aims to provide basic data mining concepts and
techniques for revealing data patterns hidden in a large-scale data set, from the perspective of
database. Both technical background concepts and their examples are presented in order to make
readers obtain knowledge related to data mining and text mining effectively. This chapter describes
what data mining and text mining, including their approaches and applications. The readers will gain
more insight into the types of input data which mining can process, the types of output information
and knowledge that can be learned. They also can learn the types of algorithms that can be used to
extract patterns from the data to form pieces of information and knowledge, a number of issues
related to implementation, and challenging topics in data mining and text mining in the future.
1.1. What is Data Mining and Text Mining?
Data mining, also known as knowledge discovery in databases, refers to a set of methods to
extract or discover (mine) implicit, previously unknown, and potentially useful information or
knowledge from large amounts of data. The term “data mining” is a misnomer since its more
appropriate name is “knowledge mining.” There are also several other names, such as knowledge
extraction, data analysis, pattern analysis, data archaeology, data dredging, information
harvesting, business intelligence and so forth. An aim in data mining is to invent a set of methods
that seek regularities or patterns from a large-scale database automatically. Once strong patterns
are found, it is possible to use the pattern as generalization to make accurate predictions on
future data. Naturally during the mining process, a large number of patterns may be found but
only a small portion of this set is interesting and useful. The others tend to be spurious,
contingent on accidental coincidences in the particular dataset used. At this point, the important
issue is how to select those interesting patterns from a large pile of mined patterns. Moreover,
data found in real situation tend to be imperfect with garbling parts and/or missing values.
Methods in data mining need to be robust enough to cope with these imperfect data and to
extract regularities that are interesting and useful. Several core techniques in data mining come
Sponsored by AIAT.or.th and KINDML, SIIT
2
from statistical analysis and machine learning, which can take the data in and infer whatever
structure underlying such data is.
In contrast with data mining that deal with structured data, text mining handles the
unstructured or semi-structured textual data (such as journal articles, news articles and online
web contents), not formalized database records. It usually involves the process of structuring the
input text, by the way of syntactic (parsing), semantic, discourse, and/or pragmatic analysis, to
derive patterns within the structured data, and finally evaluation and interpretation of the output.
Text mining usually aims to obtain the results with high relevance, novelty, and interestingness.
One dominant different characteristic between data mining and text mining is preprocessing.
While preprocessing in data mining seems simple by just focusing on data cleansing, data
integration, data transformation, and data reduction, preprocessing operations in text mining
requires more in the identification and extraction of representative features for texts written in a
natural language. Not concerned in data mining, these preprocessing operations are responsible
for transforming unstructured data stored in text collections into a more explicitly structured
intermediate format. By this characteristic, text mining needs the exploitation of techniques and
methodologies from the areas of natural language processing and human language processing,
including information retrieval, information extraction, text classification, text clustering, and
corpus-based computational linguistics.
However, it is quite common to find many data mining techniques used in text mining works
and vice versa. The architectures in both areas are also very similar. For example, both data
mining and text mining rely on preprocessing steps, mining algorithms, and presentation and
visualization techniques to enhance the interpretation of discovered patterns.
1.2. Common steps in data mining and text mining
The common process of data mining (knowledge discovery) is composed of the following nine
steps as shown in Figure 1-1. In the first step, the developers and users need to discuss what the
application looks like, which prior knowledge they have or need, and what the final goal of the
application is. After we determine the application, a dataset to be mined is prepared in the
second step. The third and fourth steps are two forms of data preprocessing. In the third step, the
data-cleansing step is performed in order to eliminate the noise that may be included in the data
set. It is also possible for us, in the fourth step, to eliminate unrelated parameters (or variable) in
order to obtain an unbiased or invariant data representation. After these preprocessing steps, it
is necessary for us to choose the task of mining in the fifth step. The common types of mining
tasks are classification, regression, clustering, association analysis, outlier analysis and trend
analysis. The task type implies what we intend to obtain from the data. For each type of tasks,
there may be several possible algorithms or methods to achieve the tasks. For example, there
exist several classification methods, such as naïve Bayes classification, decision tree induction,
classification rule construction, instance-based classification (k-nearest neighbor), and support
vector machines. Therefore, the sixth step is to select the suitable algorithm to achieve the task.
The seventh step is the main step where the mining process is taken place. In general, the mining
process will produce a set of generalized patterns, which may be a large set or may include to
specific patterns, known as overfitting. To solve these problems, the eighth step provides
mechanisms to evaluate the obtained patterns and filter out the trivial (uninteresting) ones, or to
visualize the patterns in order to enable a user to view them in the form of graphical
representation and then facilitate them to find novel or interesting patterns. Finally, the
discovered knowledge is ready to be used for future application.
Sponsored by AIAT.or.th and KINDML, SIIT
3
1. Define the application, in the viewpoints of the
relevant prior knowledge and the end user's
goals.
2. Prepare a target data set used for knowledge
discovery or data mining.
3. Clean data, such as handling missing data fields,
reducing noise in the data, accounting for time
series, and transforming data to an appropriate
scale or format.
4. Reduce the number of parameters (variables) and
find invariant representations of data if possible.
5. Select a suitable task (classification, regression,
clustering, association analysis, and so on).
6. Select a suitable data mining algorithm for mining
based on the chosen task.
7. Perform data mining in order to find dominant
patterns.
8. Interpret and evaluate the patterns mined with a
sort of objective functions and/or perform
visualization to find interesting patterns
9. Consolidate and exploit knowledge discovered.
Figure 1-1: Steps in data mining
For text mining, a number of additional steps are needed in the second step, i.e.,
preprocessing unstructured or semi-structured textual data in the forms of documents. This step
is a necessary step to transform semi-structured or un-structured texts into a structured form
that is ready to perform data mining. Techniques and methodologies borrowed from the fields of
natural language processing (NLP) and human language technology (HLT) are needed for this
preprocessing. The other processes of text mining imitate the same steps with the process of data
mining.
1.3. Types of Data in Data Mining/Text Mining
This section describes a number of different data/text repositories for mining. Possible data
repositories for data mining are relational databases, transactional databases, temporal
databases, sequence databases, time-series databases, data streams, spatial databases, and
spatiotemporal databases¸ and multimedia databases while those for text mining are text
databases including offline and online electronic documents/texts, hypertext/hypermedia
databases, and digitalized document images. The challenges and techniques of data mining and
text mining may differ for each of the repository data types.
Relational Databases
A most typical data sources for mining may come from a relational database, which is a collection
of tables, each of which is assigned a unique name. Before obtaining the collection of relational
tables, database designers or developers may use a semantic data model, such as an entity-
relationship (ER) data model, as a tool to design the database. Here, each table consists of a set of
attributes (columns or fields) and usually stores a large set of tuples (records or rows). Each
Sponsored by AIAT.or.th and KINDML, SIIT
4
record (tuple) in a relational table represents an object identified by a unique key and described
by a set of attribute values. It is possible to join multiple tables to a table, and then apply a data
mining method on the integrated table. In general, relational databases may be used for both
operational purpose and management purpose. Often they are divided into operational
databases for the former level and data warehouses for the latter level, where mining process can
be taken place in both levels. Figure 1-2 shows two example files in a relational database: (a) one
with nominal attributes (label) and (b) the other with numeric attributes.
Case Fat Level (F) Protein Level (P) Glucose Level (G) Positive (C)
1 High High Normal Y 2 High High High Y 3 High Normal Normal Y 4 High Normal High N 5 Middle High High Y 6 Middle High Normal N 7 Middle Normal High N 8 Middle Normal Normal N 9 Low High Normal N
10 Low High High Y 11 Low Normal Normal N 12 Low Normal Normal N
(a) A data set with nominal attributes
Case Fat Level (F) Protein Level (P) Glucose Level (G) Positive (C)
1 270 18 80 Y 2 320 19 140 Y 3 300 10 90 Y 4 285 9 150 N 5 200 20 160 Y 6 170 21 100 N 7 190 12 130 N 8 130 13 95 N 9 100 20 80 N
10 95 19 140 Y 11 110 14 105 N 12 90 8 98 N
(b) A data set with numeric attributes
Figure 1-2: Two example files in a relational database; (a) one with nominal attributes, and (b)
the other with numeric attributes. Here, the mapping condition is as follows. Fat: high (>220),
middle (125-220), low (<125); Protein: normal (8-16) and high (>16); Glucose: normal (75-
120) and high (120).
Transactional Databases
Besides the relational databases, a transactional database can be used to keep events in the form
of a file where each record represents a transaction. Typically, each record in a transaction
database possesses a unique transaction identity number together with a list of the items making
up the transaction (such as items purchased in a store). Although it is possible to transform data
kept in a transactional database (Figure 1-3 (a)) into the form of a relational database (Figure 1-3
(b)), sometimes it is more convenient to store data in the former format. This format is usually
used when association rule mining (or frequent pattern mining) is applied to identify frequent
itemsets (the sets of items that frequently co-occur). More details can be found in Chapter 4.
Sponsored by AIAT.or.th and KINDML, SIIT
5
TID ITEMS
1 bowl, fish, ice, pepsi, shirt, water
2 bowl, fish, ice, pepsi, rice, sweet, water
3 fish, meat, orange, rice, shirt, sweet, water
4 ice, pepsi, rice, shirt, sweet, water
5 bowl, ice, meat, orange, pepsi, rice, water
6 fish, meat, orange, rice, shirt, sweet, water
7 meat, pepsi, rice, sweet, water
8 bowl, pepsi, rice, shirt, sweet, water
(a) Transactional database format
TID Bowl Fish Ice Meat Orange Pepsi Rice Shirt Sweet Water
1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 3 1 1 1 1 1 1 1 4 1 1 1 1 1 1 5 1 1 1 1 1 1 1 6 1 1 1 1 1 1 1 7 1 1 1 1 1 8 1 1 1 1 1 1
(b) Relational database format
Figure 1-3: A part of (a) a transactional database keeping sales records of a supermarket, and (b) its corresponding relational database.
Temporal Databases, Sequence Databases, Time-Series Databases, and Data Streams
Temporal databases typically store data in a relational format together with time-related
attributes. These temporal attributes usually represent timestamps with various different
meanings, such as stock exchange, inventory control, telecommunications, and system
monitoring. As more general, a sequence database stores sequences of ordered events, with or
without a concrete notion of time, such as customer shopping sequences, web click streams, and
biological sequences. Some sequence databases, called data stream, have no time notation, such
as video stream, speech stream and sensor signal stream. There is a tradeoff that most data
stream are presented in a rather low level of abstraction but what we are interested usually is
located in higher and multiple levels of abstraction. Because of this, we need multilevel and
multidimensional analysis for mining on stream data. A time-series database stores sequences of
values or events obtained over repeated measurements of time (e.g., hourly, daily, weekly), such
as data collected from the observation of natural phenomena (like temperature and wind). An
objective of mining on these types of data is to find evolutional characteristics of an object or an
event, or to understand the trend of changes for objects or events in the database, finally then to
support decision making and strategy planning. Examples are mining of banking data to suggest
a suitable scheduling for bank tellers according to the volume of customer traffic and mining
from stock exchange data to uncover trends that help planning investment. Moreover, it is also
possible to interpret web log in order to understand user behavior. Figure 1-4 show four
examples of temporal data, sequence data, DNA sequence data, and time-series data. The first
example includes the records of person name, location, date-from and date-to when one stays at
a place and then change his/her residence to another place. The second example presents a
sequential customer purchasing history with customer ID, date, time, location and purchasing
items with their prices in brackets. The third example shows a fragment of DNA sequence,
composed of four different characters, i.e., A, C, G and T. The last example expresses the time-
series records of birth rate (per 10,000) for 23-year-old women in U.S. during 1917 to 1975.
Sponsored by AIAT.or.th and KINDML, SIIT
6
Name Location From To
John Nuvo BigCity 01 September 1954 12 October 1998
John Nuvo SmallCity 13 October 1998 04 November 2006
John Nuvo BeachLand 05 November 2006 08 February 2009
Susan Dango RiceField 12 September 1956 30 July 1990
Susan Dango SmallCity 31 July 1990
Richard Navado RiverRock 15 April 1950 10 May 1998
Richard Navado IceCope 11 May 1998 23 March 2004
Richard Navado PizzaHut 24 March 2004
(a) An example of a temporal database related to -residence changing.
CusID Date Time Location ItemBought
C0001 10/11/2009 10:00 Central Station Apple ($10), Pepsi ($2), Gum ($1)
C0002 10/11/2009 11:00 Big C Burger ($3), Fish ($5), Bread ($3)
C0001 10/11/2009 14:00 Big C Rice ($10), Milk ($8), Bread ($3), Gum ($2)
C0004 11/11/2009 09:00 K-Mart Bread ($4), Coke ($2)
C0002 11/11/2009 12:00 Seven-Eleven Gum ($2), Sweet ($3), Potato ($3), Ham ($5)
C0001 11/11/2009 15:00 K-Mart Orange ($4), Magazine (6)
C0002 12/11/2009 11:00 Seven-Eleven Ham ($4), Bread ($3), Apple ($5), Water ($3)
C0003 12/11/2009 14:00 Central Station Rice ($12), Potato ($5), Butter ($6)
C0001 12/11/2009 15:00 BigC Diaper ($20), Butter ($4), Shirt ($20)
(b) An example of a sequence database related to customer purchasing history.
GAATTCTCTGTAAAAGAGTGGACCATTAAAGTAGAATTAATTGAAGGAATTCTCTGTAAGAGTACCAGGGAATTA
ATTAGGGTAGACCCATTGGGAAGGAATTCTGGCTGTAAGAGTACCATTAAAGTAGCCCCTTGAAGGGAATTTCTT
TGGCCCAAAGGGAAATAAGTAGAAAATTGAGAAACCCCCGGT
(c) A DNA sequence fragment
Year Birth Year Birth Year Birth Year Birth
1917 183.1 1932 131.5 1947 212.0 1962 252.8 1918 183.9 1933 125.7 1948 200.4 1963 240.0 1919 163.1 1934 129.5 1949 201.8 1964 229.1 1920 179.5 1935 129.6 1950 200.7 1965 204.8 1921 181.4 1936 129.5 1951 215.6 1966 193.3 1922 173.4 1937 132.2 1952 222.5 1967 179.0 1923 167.6 1938 134.1 1953 231.5 1968 178.1 1924 177.4 1939 132.1 1954 237.9 1969 181.1 1925 171.7 1940 137.4 1955 244.0 1970 165.6 1926 170.1 1941 148.1 1956 259.4 1971 159.8 1927 163.7 1942 174.1 1957 268.8 1972 136.1 1928 151.9 1943 174.7 1958 264.3 1973 126.3 1929 145.4 1944 156.7 1959 264.5 1974 123.3 1930 145.0 1945 143.3 1960 268.1 1975 118.5 1931 138.9 1946 189.7 1961 264.0
(d) A time-series: Births per 10,000 of 23 year old women, U.S., 1917-1975
Figure 1-4: Temporal data, sequence data, DNA sequence data and time-series data
Spatial Databases and Spatiotemporal Databases
Spatial databases contain information related to space, including points, lines and polygons.
Examples are geographic (map) databases, computed-aided design databases, and medical and
satellite image databases. Spatial data may be represented in the raster format (Figure 1-5 (a)),
consisting of n-dimensional bitmaps or pixel maps. They can also be represented in the vector
format (Figure 1-5 (b)), where roads, bridges, buildings, and lakes are represented as unions or
overlays of basic geometric constructs, such as points, lines, polygons, and the partitions and
Sponsored by AIAT.or.th and KINDML, SIIT
7
networks formed by these components. Incorporating temporal features into spatial databases,
the spatiotemporal databases also keep time component in spatial databases. Applications of
spatial and spatiotemporal databases are varied, such as routing and scheduling, city planning,
forestry and ecology planning to provide public service information regarding the location of
basic facilities such as telephone, and electric cables, pipes, and sewage systems.
(a) the raster format (b) the vector format
Figure 1-5: Spatial data represented: (a) the raster format and (b) the vector format
Multimedia Databases
Multimedia databases are repositories of image, audio, and video data, used in several
applications including picture content-based retrieval, voice-mail systems, video-on-demand
systems, and speech-based user interfaces that recognize spoken commands. In computer
systems, a multimedia database may keep one or more primary media file types such as .txt
(documents), .jpg (images), .swf (videos), .mp3 (audio) and so on. A multimedia data are loosely
classified into three main categories; (1) static media (time-independent, i.e. images and
handwriting), (2) Dynamic media (time-dependent, i.e. video and sound bytes), and (3)
dimensional media (i.e. 3D games or computer-aided drafting programs – CAD). For multimedia
data mining, storage and search techniques need to be integrated with standard data mining
methods. Some promising tools are the construction of multimedia data cubes, the extraction of
multiple features from multimedia data, and similarity-based pattern matching.
Text Databases: Offline and Online Electronic Documents/Texts
Text databases consist of information in the form of sentences or paragraphs, such as journal
articles, e-books, product descriptions and specifications, reports and notes, or other documents,
stored in either offline or online environments. Some text databases are unstructured, such as
electronic documents and plain text (without tags) on the World Wide Web (Figure 1-6). Some
text databases are partially structured or semi-structured, such as e-mails and web pages with
specified tags (Figure 1-7). Some text databases are highly structured such as library catalogues.
Sponsored by AIAT.or.th and KINDML, SIIT
8
Such text databases with highly regular structures typically can be implemented using relational
database systems. Mining processes in text databases includes summarization, categorization,
clustering, information retrieval and document association.
Data mining is the process of extracting patterns from data. As more data are gathered, with the amount of data
doubling every three years [1] data mining is becoming an increasingly important tool to transform these data into
information.
….
To avoid confusion with the other sense, the terms data dredging and data snooping are often used. Note, however,
that dredging and snooping can be (and sometimes are) used as exploratory tools when developing and clarifying
hypotheses.
Figure 1-6: An example of a plain text without tags.
Figure 1-7: An example of book records with structure (source: http://lib.siit.tu.ac.th/)
Hypertext/Hypermedia Databases
A hypertext is a text with references or links (called hyperlinks) to other text that the reader can
access promptly by following a hyperlink in the text, usually by a mouse click or key press
sequence (Figure 1-8). Hypermedia is a logical extension of hypertext in which graphics, audio,
video, plain text and hyperlinks are integrated together to create a non-linear medium of
information. Recently hypertexts or hypermedia databases have become major descriptions of
objects in both online and offline environments. Users can find information of interest by
traversing from one object via links to another. This link information provides new opportunities
and challenges for data mining. For example, with link information, we can improve performance
of text classification/clustering and relevant ranking process. Apart from text information,
known as web usage mining, it is also possible to interpret user access patterns via the usage of
hypertexts or hypermedia, in order to improve system design and user behavior analysis.
Sponsored by AIAT.or.th and KINDML, SIIT
9
(a) a hypertext with links
[Source]
<b>Hypertext</b> is text displayed on a computer with references (<a href="/wiki/Hyperlinks"
title="Hyperlinks">hyperlinks</a>) to other text that the reader can immediately access, usually by a mouse
click or keypress sequence. Apart from running text, hypertext may contain tables, images and other
presentational devices. Other means of interaction may also be present, such as a bubble with text appearing
when the mouse hovers over a particular area, a video clip starting, or a form to complete and submit. The
most extensive example of hypertext today is the <a href="/wiki/World_Wide_Web" title="World Wide
Web">World Wide Web</a>.</p>
(b) the source of the hypertext
Figure 1-8: An example of a hypertext with its source
(source: http://en.wikipedia.org/wiki/Hypertext)
1.4. Some Data Mining Applications
Data mining can be applied in wide and diverse areas. Some major applications are listed below.
Data Mining in Retail Industry Data
Finding interesting patterns from large amounts of data on sales, customer shopping records,
goods transportation, consumption, and service, provides useful information and knowledge for
managing retail industry. Data mining in retail databases can help us identify customer shopping
behaviors, patterns, and trends. This information will be useful to improve the quality of
customer service, achieve better customer retention and satisfaction, enhance goods
consumption ratios, design more effective goods transportation and distribution policies, and
reduce the cost of business. Recently the popularity of conducting business transactions online
(e-commerce) has increased the quantity of data collected continues to expand rapidly.
Exploiting data mining on the databases to pursue purchasing patterns can help guide the design
and development of data warehouse structures, manage effective sales campaigns, retain
customer with personalized product recommendations and targeted services.
Data Mining in Financial Data
Currently, a wide variety of financial services have been offered, such as deposit, withdrawal,
loan, foreign exchange, and investment. Financial data collected from these services are relatively
reliable with high quality. Therefore, data analysis and/or data mining (knowledge discovery) on
Sponsored by AIAT.or.th and KINDML, SIIT
10
these data are realistic and useful. For example, data analysis enables us to view the average,
total, maximum, minimum, trend, outlier and other statistical characteristics of each financial
resource (e.g., deposit, credit, fund, stock, etc), together with their changes by time period, by
geographical region, by customer sector, and by other factors. It is possible to cluster or
categorize customers into a set of target groups for marketing purpose, such as loan payment
prediction and credit policy analysis. Data mining in financial data can also support the detection
of money laundering and other financial crimes. To detect money laundering and other financial
crimes, it is necessary to integrate information from multiple databases for finding unusual
patterns, such as large amounts of cash flow at certain periods, by certain groups of customers.
Data Mining in Telecommunication Data
At present telecommunication industries has generated a tremendous amount of data. Falling
into three categories; the call detail data presenting the calls traversing within the
telecommunication networks, the network data describing the state of the hardware and
software components used in the network, and the customer data indicating the
telecommunication usage conducted by customers. Data mining can be used to uncover useful
information hidden in these three data sets to identify telecommunication fraud, identify
network faults, and improve marketing performance. Fraudulent activity costs the
telecommunication industry millions of dollars per year. With data mining techniques, we can
detect potential fraudulent actions and usage patterns; identify misconducts to gain fraudulent
entry to other customers’ accounts; and reveal unusual patterns that may harm the system itself,
such as busy-hour frustrated call attempts, as well as router/switch congestion. With data mining,
we can find the software/hardware-related problem inside the telecommunication system.
Moreover, finding some frequent sequential patterns, such as frequent calling patterns, we can
promote such as the sales of specific long-distance and cellular phone combinations and improve
the availability of particular services in the region.
Data Mining in Biological Data
Recently, biotechnology has become popular with many potential usages. Its quick advancement
triggers an explosive growth of biological data, such as those in genomics, functional genomics,
proteomics, and biomedical studies. Applications include the identification and comparative
analysis of human genomes and other species’ genomes (by discovering sequencing patterns,
gene functions, and evolution paths), the investigation of genetic networks and protein pathways,
and the innovation in new pharmaceuticals and advances for cancer treatment. Known as
bioinformatics, the field of biological data mining is broad, rich, and dynamic.
1.5. Text Mining Application
While text mining involves a knowledge-based process, where a user interacts with a document
collection, its tasks and applications are vast. Analogous to data mining, text mining, (alternately
referred to as text data mining) aims to extract useful information from data sources through the
identification and exploration of interesting patterns. Some typical text mining tasks are text
categorization, text clustering, concept/entity extraction, production of granular taxonomies,
sentiment analysis, document summarization, and entity relation modeling (i.e., learning
relations between named entities). A number of text mining applications are given below.
Text Mining for Biomedical Applications
With accelerated growth of online biomedical information, a set of computational tools are
required to filter public biomedical text databases and to highlight their relevant information in a
Sponsored by AIAT.or.th and KINDML, SIIT
11
well-organized and coherent manner. For example, it is possible to find large numbers of
apparent correlations when we analyze relationships among thousands of genes by analyzing
gene-gene relationships stated in biomedical research articles related to mRNA expression
profiling experiments with cDNA microarrays and oligonucleotide chips. A large pile of
biomedical literatures provides us a great chance to detect hidden relationship.
Text Mining for Security Applications
Recently information security has evolved from just focusing on data or actions related to the
network and server layers to including text contents, such web and email, transmitted through
the network, in the application layer. Recently a number of powerful software packages are
developed to monitor web content, radio broadcasting, and cellular/telephone speech in order to
find certain keywords. When the keywords are found, the web result and/or speech results will
be recorded and analyzed. One of dominant systems related this text mining for security issues is
the classified ECHELON surveillance system development by the United States National Security
Agency (NSA) in partnership with the UK, Canada, Australia and New Zealand. Besides this,
AeroText, and Attensity are software marketed towards security applications, by analyzing plain
text sources such as online news article. Text categorization enables us to understand the
difference among characteristics of normal and malicious user behaviors from the log entries
generated by an online application server.
Text Mining for Marketing Applications
Text mining also could help marketing professionals use the mined information for finding
nuggets in order to make good decisions. As a simple type of text mining, search engines (or
information retrieval systems) can help us find a way to improve our daily tasks. For example,
one can type a set of keywords related to his/her interesting topic to find a set of existing related
documents that may help. Moreover, text mining can help us to find relationship among different
keywords using concept clustering, indexing, association, feature extraction, information
visualization, and summarization. This innovative technology helps marketing professionals
identify hidden information that could leverage business opportunities, with visually interactive
tools to depict patterns and relationships between keywords that form user-friendly interfaces.
Text Mining for Academic Applications
Many academic articles have been provided online in both abstract and full texts to public or for
commercial purposes, e.g. CiteSeer, ACM portal, Elsevier ScienceDirect, SpringerLink, PubMED,
MS Academic Search, Google scholars and DBLP. As the most basic function, text mining can help
us properly index documents for later retrieval of similar academic articles. It also assists us to
group similar articles for literature review or other purposes, to provide semantic cues to
machines to answer specific queries, to find relations among a set of multiple articles for deep
analysis.
Text Mining for Patent Analysis
Generally, patent documents express important research and development results. However,
they are usually lengthy with rich technical terminology, resulting in needing high human efforts
for analyses. From many million patent documents in a patent database, one may need to find
those similar to a given or intended one. An emerging application of text mining is to search
patents based on similarity to assist patent engineers or decision makers in patent analysis.
Sponsored by AIAT.or.th and KINDML, SIIT
12
1.6. Types of Mining Tasks
As stated in Section 1.3, there are various possible types of databases and information
repositories on which we can apply data mining or text mining to find the intuitive, valid, useful
and novel patterns. In general, there are two classes of data mining tasks as follows.
1. Descriptive mining targets for characterizing some general properties of the data in the
database without any use for guessing a future event, such as characterization,
discrimination, clustering and association rule mining or frequent pattern mining.
2. Predictive mining aims to build a model that is used later for making prediction of related
events or prospective events, by making use of information hidden in the current data,
such as classification, numeric prediction, and pattern recognition.
After having a set of data to be mined, we have to determine which kind of mining tasks to be
performed. In many cases, we may have no idea on what kinds of interesting patterns we can find
from the data and hence we may take a strategy to search for several different kinds of patterns
in parallel. Mining multiple kinds of patterns may accommodate different user expectations or
applications. Besides the type of patterns to be mined, in several cases, we need to consider a
mechanism to guide users to search for and discover interesting patterns at various granularities
(different levels of abstraction) with interactive environment, and to allow user to track topic
changing among different time periods. Moreover, since some patterns may not hold for all of the
data in the database, a measure of certainty or “trustworthiness” is usually associated with each
discovered pattern. The following indicates some common types of data mining tasks.
1.6.1. Classification or Categorization: Finding the class of an object
Classification (or categorization) is a common task in human activities that involves decision or
forecast in an unknown or a future situation, using currently available information. As another
point of view, classification is the process of constructing a model (or function) that describes
and distinguishes different data classes or concepts, for the purpose of being able to use the
model to predict the class of objects whose class label is unknown later. The derived model is
based on the analysis of a set of training data (i.e., data objects whose class label is known). In
some areas, classification is referred as pattern recognition, discrimination, or supervised
learning, in contrast with unsupervised learning or clustering where no classes are predefined
but they are inferred from the data. There have been several applications of classification to solve
scientific, industrial and commercial problems. Some typical classification tasks are the detection
of the letter from a character image (such as an automatic postcode reader), the credit-status
assignment for a customer on the basis of financial and other personal information, and the
preliminary diagnosis of a patient’s disease during waiting for definitive test results.
In learning a classification model, there exist various forms in expressing the model derived.
Some common forms are classification (IF-THEN) rules, decision trees, mathematical formulae,
or neural network. Given a sample dataset in Figure 1-9 (a), the examples of these forms are
shown in Figure 1-9 (b)-(d) and Figure 1-10, respectively. A decision tree is a flow-chart-like tree
structure, where each node denotes a test on an attribute value, each branch represents an
outcome of the test, and tree leaves represent classes or class distributions. Decision trees can
easily be converted to classification rules. A neural network, when used for classification, is
typically a collection of neuron-like processing units with weighted connections between the
units. There are many other methods for constructing classification models, such as naïve
Bayesian classification, support vector machines, and k-nearest neighbor classification.
Sponsored by AIAT.or.th and KINDML, SIIT
13
Outlook Temp. Humidity Windy Play
sunny hot high false no sunny hot high true no
overcast hot high false yes rainy mild high false yes rainy cool normal false yes rainy cool normal true no
overcast cool normal true yes sunny mild high false no sunny cool normal false yes rainy mild normal false yes sunny mild normal true yes
overcast mild high true yes overcast hot normal false yes
rainy mild high true no
(a) A sample data set (the Play-Tennis data set)
1. If (Outlook = ”Overcast”) then Play = “Yes” 2. If (Humidity = ”Normal” and Windy = “False” ) then Play = “Yes” 3. If (Temp = ”Mild” and Humidity = “Normal” ) then Play = “Yes” 4. If (Outlook = ”Rainy” and Windy = “False” ) then Play = “Yes”
(b) Classification rules
(c) Decision Tree
Play(yes) = 0.6 * outlook(sunny) + 1.0 * outlook(overcast) + 0.2 outlook(rainy) + 0.1 * temp(hot) + 0.2 * temp(mild) + 0.2 * temp(cool) + 0.5 * humidity(high) + 0.8 * humidity(normal) + 0.6 * windy(false) + 0.3 * windy(true)
Play(no) = 0.3 * outlook(sunny) + 0.1 * outlook(overcast) + 0.7 outlook(rainy) + 0.2 * temp(hot) + 0.1 * temp(mild) + 0.3 * temp(cool) + 0.7 * humidity(high) + 0.1 * humidity(normal) + 0.3 * windy(false) + 0.8 * windy(true)
(d) Linear regression equations
Figure 1-9: Three classification models: (a) a sample classification dataset, (b) classification
(IF-THEN) rules, (c) a decision tree, and (d) mathematical formulae (linear equations).
Outlook
Windy Humidity
sunny rainy
overcast
high normal
Yes
No Yes
false true
Yes No
Sponsored by AIAT.or.th and KINDML, SIIT
14
Figure 1-10: An example of an artificial neural network.
1.6.2. Prediction: Predicting the value for an object
While classification predicts categorical (discrete, unordered) labels, prediction forecasts
continuous-valued functions. Also called numeric prediction, the prediction is applied to estimate
missing or unavailable numerical data values rather than class labels. It is intuitive that the term
‘prediction’ points to both numeric prediction and class label prediction. However, in several
literatures it usually refers to numeric prediction while label prediction is called classification.
Prediction also encompasses the identification of distribution trends based on the available data.
For example, it is possible to predict the potential sales amount of a product given its price, or the
performance of a computer given its components.
Regression analysis, a statistical methodology developed by Sir Frances Galton (1822–1911),
is most often used for numeric prediction. Although there are other methods as well in numeric
prediction, in fact scientists and researchers often use the terms “regression” and “numeric
prediction” synonymously. It is also possible to apply classification techniques (such as artificial
neural networks, decision trees, support vector machines, and k-nearest-neighbor classifiers) for
prediction, and on the other hand, numeric prediction techniques (i.e., regression analysis) for
classification. Regression analysis aims to model the relationship between one or more
independent or predictor variables, which are discrete- or continuous-valued, and a dependent
or response variable, which is continuous-valued. In data mining or knowledge discovery, the
predictor variables are the attributes of interest expressing each training tuple (example),
possibly in the form of an attribute vector. In general, the values of the predictor variables are
known. Even some of them may be missing, it is possible to apply statistical techniques to
recover and handle such cases. On the other hand, the response variable is the target value to be
predicted, also called the predicted attribute. Some common models for prediction are linear
regression, regression tree and model tree as shown in Figure 1-11 (b)-(d), given a sample
dataset in Figure 1-11 (a) where ‘Play’ is the target value and the four preceding variables
(‘Outlook’, ‘Temp’, ‘Humidity’ and ‘Windy’) are predictor variables.
play=yes
play=no
outlook=sunny
outlook=overcast
outlook=rainy
temperature=hot
temperature=mild
temperature=cool
humidity=high
humidity=normal
windy=true
windy=false
Sponsored by AIAT.or.th and KINDML, SIIT
15
Outlook Temp. Humidity Windy Play
90 40 80 10 5 95 32 85 80 10 50 35 90 20 80 10 24 80 5 95 15 10 50 15 85 20 12 55 90 15 55 9 45 95 80 85 22 95 25 10 95 7 50 5 100 5 26 45 10 85
80 25 40 80 95 45 24 85 85 90 40 37 60 15 75 25 23 90 95 20
(a) A sample data set (the real-valued Play-Tennis data set)
Play = 149.3 – 0.171*outlook – 0.273*temp – 0.298*humidity – 0.359*windy
(b) Linear regression equation
L1: Play = 14.2 – 0.24*temp + 0.04*windy L2: Play = 100.3 – 0.07*windy L3: Play = 53 + 0.29*humidity + 0.15*windy L4: Play = 69.3 + 0.9*temp + 0.29*humidity L5: Play = 7.1 + 0.14*humidity
(c) Regression Tree (d) Model Tree
Figure 1-11: Four common forms of numeric prediction models: (a) A sample prediction data
set (b) Linear regression equation, (c) Regression tree, and (d) Model tree.
Both classification and prediction may need to be preceded by relevance analysis, which
attempts to identify attributes that do not contribute to the classification or prediction process.
These attributes can then be excluded.
1.6.3. Clustering/Deviation Detection: Grouping data/Detecting outliers
Another important activity in the learning process of our daily life is cluster analysis. From our
childhood, we learn how to distinguish between two different types of objects, say cats vs. dogs
or car vs. bus, by developing subconscious clustering schemes continuously. Conceptually, we
identify dense and sparse regions in object space and, then find out overall distribution patterns
and interesting correlations among data attributes. Unlike classification and prediction where
each data object (for example, each row in the tables of Figure 1-9 (a) and Figure 1-11 (a)) has
Outlook
Windy Humidity
> 75 < 35
35-75
>= 65 < 65
L3
L1 L2
<50 >=50
L4 L5
Outlook
Windy Humidity
> 75 < 35
35-75
>= 65 < 65
81.25
8.33 97.5
<50 >=50
88.33 17.5
Sponsored by AIAT.or.th and KINDML, SIIT
16
assigned a class label or a value (the target variable which is the rightmost column in the tables),
clustering processes data objects without considering a class label. Also called data
segmentation in some areas, clustering partitions large data sets into groups according to their
similarity. For clustering, the class labels do not exist in the training dataset since they are not
concerned. The aim of clustering is to group data into a set of clusters (groups) and then to give a
unique label for each cluster. Normally, the input objects are clustered or grouped based on the
criterion of maximizing the intraclass similarity and minimizing the interclass similarity. In other
words, clusters of objects are generated under the criterion that the objects within a cluster have
high similarity with one another, but are highly dissimilar to the objects in other clusters.
Semantically, each cluster is recognized as a class of objects. As a by-product, it is possible to
detect outliers and their deviation from the norms.
At present, cluster analysis has been widely used in several applications, including concept
formation, pattern recognition, market research, biology data analysis, land usage analysis,
speech processing, document processing and image processing. In concept formation, clustering
can be applied to develop concepts based on the common properties of objects, events, or
qualities with abstraction and generalization. In pattern recognition, clustering can be used to
identify different areas of interest. In market research, clustering can help discover distinct
groups in the existing customers and then characterize these customer groups based on their
purchasing activities or patterns. In biology data analysis, clustering may assist biologists to
derive plant and animal taxonomies, to categorize genes with similar functionality, and to gain
insight into structures inherent in populations. In land usage analysis, clustering can be applied
to identify similar land usage area from an earth observation database or to detect groups of
houses in a city according to house type, value, and geographic location, as well as to find groups
of automobile insurance policy holders with a high average claim cost. In speech processing,
clustering can be used to grouping similar features (feature vectors) to reduce the variety of
features and then improve the recognition rate. In document processing, clustering can also be
used to help classify documents on the WWW for information discovery. In image processing,
clustering may help segment an image into a group for further exploration. Clustering can also be
used to detect outliers which are unusual objects deviating from the norm of any cluster. These
outliers sometimes are more interesting than common cases. Some typical applications of outlier
detection are the monitoring of criminal activities in the Internet and the detection of credit card
fraud in electronic commerce. Alternatively, clustering is often used as a preprocessing step for
other algorithms, such as classification, association analysis (or frequent pattern mining),
characterization, and attribute subset selection, which would then operate on the detected
clusters and the selected attributes or features. A major advantage of this clustering-based
preprocess is adaptability to changes and helps find out useful features that distinguish different
groups. Figure 1-12 shows various types of cluster representation: (a) the conceptual
representation of clustering (three clusters with some outliers), (b) Non-overlapping clusters
(three clusters), (c) Overlapping clusters (three clusters), (d) Hierarchical clustering, and (e)
Probabilistic clustering. Intuitively clusters usually have no overlap as shown in Figure 1-12 (b)
but in some cases, some clusters may be overlapped with one another as shown in Figure 1-12
(c). Clustering can also facilitate taxonomy formation, that is, the organization of observations
into a hierarchy of classes that group similar events together as shown in Figure 1-12 (d). It is
possible to allow objects to be in more than one cluster or even in all clusters with some
probabilities as shown in Figure 1-12 (e).
Sponsored by AIAT.or.th and KINDML, SIIT
17
(a) Conceptual representation: three clusters with some outliers
(b) An example: three non-overlapping clusters with their elements
(c) Three overlapping clusters (d) Hierarchical Clustering
1 2 3
a 0.8 0.1 0.1 b 0.4 0.4 0.2 c 0.1 0.5 0.4 d 0.1 0.8 0.1 e 0.5 0.3 0.2 f 0.4 0.5 0.1 g 0.4 0.2 0.4 h 0.2 0.1 0.7 i 0.7 0.1 0.2 j 0.1 0.1 0.8 k 0.2 0.7 0.1
(e) Probabilistic Clustering
Figure 1-12: Various types of cluster representation
1.6.4. Association Analysis: Finding frequent co-occurrences
Co-occurrence analysis is to find frequent patterns, which are patterns that occur frequently in
data. There are several kinds of frequent patterns, including itemsets, subsequences, and
substructures. Typically, a frequent itemset refers to a set of items that frequently appear
together in a transactional database, such as coffee and sugar. A frequent subsequence is a
sequence of items that occurs often in sequence, such as the pattern that customers tend to
purchase a notebook first, followed by a digital camera, and then a memory card. A frequent
substructure refers to structural forms, such as graphs, trees, or lattices, which occur often. The
substructure may be a combination of itemsets or subsequences. Mining frequent patterns leads
to the discovery of interesting associations and correlations within data. For example, the rule
found in the sales data of a supermarket would indicate that if a customer buys onions and
Cluster 1 Cluster 2 Cluster 3
h
c b
e
f
d
a
g i j
k
h
c
b
e
f d
a g
i j
k
h
c
b
e
f d
a g
i j
k
d k b a e i g f c j h
Sponsored by AIAT.or.th and KINDML, SIIT
18
potatoes together, he or she is likely to buy beef. Such information can be used as the basis for
decisions about marketing activities such as, e.g., promotional pricing or product placements.
In addition to the above example from market basket analysis on retailing databases,
association analysis are employed today in many application areas including web usage mining,
intrusion detection and bioinformatics. Web usage mining is the application of associations to
analyze and discover interesting patterns of user’s usage data from web log, both incoming log
(Web Server Log) and outgoing log (Proxy). After the Internet becomes a powerful tool for
communication and collaboration, many organizations have a web server that generates and
collects large volumes of data collected in server log. These logs keep track of the usage records
of the user’s behavior when the user browses or makes transactions on the web site. By
analyzing frequent access pattern, it is possible to provide better services, including target or
cross marketing, customer relationship management, pricing and promotional campaigns,
according to the needs of users or web-based applications. The most naïve application is a web
analysis tool that simply provided mechanisms to report user activity as recorded in the servers,
such as the number of accesses to the server, the times or time intervals of visits as well as the
domain names and the URLs of users of the web server. Besides simple applications, at present
more sophisticated pattern discovery tools and pattern analysis tools are emerged to discover
and analyze interesting patterns. As another potential application of association analysis,
network intrusion detection system (IDS) can provide a security protection mechanism as
complementary to the firewall. Since it can discern and respond to the hostile behavior of the
computer and network resource, recent this topic has become a hot area in network security.
Recently there has been a great amount of research works applying data mining in biology
field. Research on bioinformatics, also called biocomputing and computational biology, is a
promising infant field that uses computers and information technology in molecular biology and
develops algorithms and methods to manage and analyze huge volumes of any type of biological
data from individual molecules to organisms to overall ecology. Major applications include
sequence analysis, genomics, and proteomics. Sequence analysis aims to study molecular
sequence data for inferring the function, interactions, evolution, and perhaps structure of
biological molecules. It is important to develop effective methods to compare and align biological
sequences and discover biosequence patterns. Genomics involves the analysis of the context of
genes or complete genomes (the total DNA content of an organism) within the same and/or
across different genomes. Proteomics is the sub-field of genomics concerned with analyzing the
complete protein complement, i.e. the proteome, of organisms, both within and between different
organisms. Mining semantics from DNA and proteins sequences, long linear chains of chemical
components, is a challenging issue. An automatic alignment of DNA or proteins sequences lines
up sequences to achieve a maximal level of identity or the highest degree of similarity between
sequences. Two sequences are homologous if they share a common ancestor. The degree of
similarity obtained by sequence alignment can be useful in determining the possibility of
homology between two sequences. Such an alignment also helps determine the relative positions
of multiple species in an evolution tree, which is called a phylogenetic tree.
Figure 1-13 shows an example of association rule mining in a toy transactional database of
retail industry. The example consists of six sales transactions, shown in two formats: transaction
format (a) and relational format (b). Given 50% minimum support and 66% confidence, the
mined frequent itemsets and frequent rules (association rules) are shown in (c) and (d),
respectively. As another example, Figure 1-14 displays a temporal sale summary of three
products in six periods. The original format (a) can be transformed to the transactional database
format (b). Given 50% minimum support and 66.67% confidence, the mined frequent itemsets
and frequent rules (association rules) are shown in (c) and (d), respectively.
Sponsored by AIAT.or.th and KINDML, SIIT
19
Transaction ID Items 1 coke, ice, paper, shoes, water 2 ice, orange, shirt, water 3 paper, shirt, water 4 coke, orange, paper, shirt, water 5 ice, orange, shirt, shoes, water 6 paper, shirt, water
(a) A simple transactional database for retailing ( )
Transaction ID coke ice orange paper shirt shoes water 1 1 1 1 1 1 2 1 1 1 1 3 1 1 1 4 1 1 1 1 1 5 1 1 1 1 1 6 1 1 1
(b) The relational table corresponding to the above transactional database
Itemset Trans Freq.
Itemset Trans Freq.
Itemset Trans Freq. coke 14 2
ice, orange 25 2
orange, shirt, water 245 3
ice 125 3
ice, paper 1 1
paper, shirt, water 346 3 orange 245 3
ice, shirt 25 2
paper 1346 4
ice, water 125 3
shirt 23456 5
orange, paper 4 1
shoes 15 2
orange, shirt 245 3
water 123456 6
orange, water 245 3
paper, shirt 346 3
paper, water 1346 4
shirt, water 23456 5
(c) Frequent itemsets (minimum support = 3 (i.e., 0.50 or 50%))
Here,
Left Items (L) Right Items (R) support confidence ice water 3/6 = 0.50 3/3 = 1.00
water ice 3/6 = 0.50 3/6 = 0.50 orange shirt 3/6 = 0.50 3/3 = 1.00
shirt orange 3/6 = 0.50 3/5 = 0.60 orange water 3/6 = 0.50 3/3 = 1.00
water orange 3/6 = 0.50 3/6 = 0.50 paper shirt 3/6 = 0.50 3/4 = 0.75
shirt paper 3/6 = 0.50 3/5 = 0.60 paper water 4/6 = 0.67 4/4 = 1.00 water paper 4/6 = 0.67 4/6 = 0.67
shirt water 5/6 = 0.83 5/5 = 1.00 water shirt 5/6 = 0.83 5/6 = 0.83
orange, shirt water 3/6 = 0.50 3/3 = 1.00 orange, water shirt 3/6 = 0.50 3/4 = 0.75
shirt, water orange 3/6 = 0.50 3/5 =0.60 water orange, shirt 3/6 = 0.50 3/6 = 0.50
shirt orange, water 3/6 = 0.50 3/5 =0.60 orange shirt, water 3/6 = 0.50 3/3 = 1.00
paper, shirt water 3/6 = 0.50 3/3 = 1.00 paper, water shirt 3/6 = 0.50 3/4 = 0.75
shirt, water paper 3/6 = 0.50 3/5 =0.60 water paper, shirt 3/6 = 0.50 3/6 = 0.50
shirt paper, water 3/6 = 0.50 3/5 =0.60 paper shirt, water 3/6 = 0.50 3/4 = 0.75
(d) Association rules (minimum confidence = 0.67 or 66.67%)
Figure 1-13: Association Rules with Minimum Support = 0.5 and Minimum Confidence = 0.67
Sponsored by AIAT.or.th and KINDML, SIIT
20
t0 t1 t2 t3 t4 t5 t6 pepsi up - up - up - - shirt down down up down up - up water - - down down - down -
(a) A toy temporal database (t: time)
Transaction Items t0(L) + t2(R) pepsiL-up, shirtL-down, pepsiR-up, shirtR-up, waterR-down t1(L) + t3(R) shirtL-down, shirtR-down, waterR-down t2(L) + t4(R) pepsiL-up, shirtL-up, waterL-down, pepsiR-up, shirtR-up t3(L) + t5(R) shirtL-down, waterL-down, waterR-down t4(L) + t6(R) pepsiL-up, shirtL-up, shirtR-up
(b) The corresponding transactional database when time gap is fixed to 2
Itemset Freq.
Itemset Freq. pepsiL-up 3
pepsiL-up, shirtR-up 3
shirtL-down 3
pepsiL-up, waterR-down 1 shirtL-up 2
shirtL-down, shirtR-up 1
waterL-down 2
shirtL-down, waterR-down 3 pepsiR-up 2
shirtR-down 1 shirtR-up 3 waterR-down 3
(c) Temporal frequent itemsets (minimum support = 2.5 (i.e., 0.50 or 50%))
Left Items Right Items support confidence pepsiL-up shirtR-up 3/5 = 0.60 3/3 = 1.00
shirtL-down waterR-down 3/5 = 0.60 3/3 = 1.00
(d) Temporal association rules (minimum confidence = 0.50 or 50%)
Figure 1-14: Temporal Association rules
1.6.5. Characterization and Discrimination: Describing a class or concept
While classification, prediction, clustering and association mining are common in their purpose
to automate knowledge discovery, characterization and discrimination, as alternatives, aim to
support users in finding knowledge semi-automatically by providing summarized or contrast
information of classes or concepts. It is useful to describe such individual classes and concepts in
summarized, concise, and even more precise terms. These descriptions can be obtained by data
characterization, such as summarizing the data of the class with general terms, or data
discrimination, in the form of comparing the target class with one or a set of comparative
classes, or the combination of data characterization and discrimination.
Data characterization refers to a summarization of the general characteristics or features of a
target class of data. For example, to study the characteristics of food products whose sales
decreased by 10% in the last year, the data related to such products can be collected by executing
an SQL query. For this issue, one method for effective data characterization (summarization) is
the form of cube–based OLAP (OnLine Analytical Processing) roll-up operation performed as
user-controlled data summarization along a specified dimension. The output of data
characterization can be presented in various forms, such as line or cursive graphs, pie charts, bar
charts, multidimensional data cubes, and multidimensional tables with crosstabs. As more
generalized forms, the resulting descriptions can also be presented as generalized relations or in
rule form.
Sponsored by AIAT.or.th and KINDML, SIIT
21
In contrast, data discrimination is a comparison of the general features of target class data
objects with the general features of objects from one or a set of contrasting classes. The target
and contrasting classes can be specified by the user, and the corresponding data objects retrieved
through database queries for comparison. For example, the user may like to compare the general
features of food products whose sales decreased by 10% in the last year with those whose sales
increased by at least 30% during the same period. The methods used for data discrimination are
similar to those used for data characterization. While the forms of output presentation for
discrimination descriptions may be similar to those for characteristic descriptions, the
discrimination descriptions should include comparative measures that help distinguish between
the target and contrasting classes. Figure 1-15 shows (a) a sample set of sales data, (b) line graph
and (c) pie graph. In addition, Figure 1-16 displays its (a) bar graph and (b) multidimensional
tables with crosstabs.
Product Sales ($)
Product A Product B Product C Product D January 2011 2000 1200 1800 2200
February 2011 3000 2000 2500 4000 March 2011 1500 2000 3200 4400
April 2011 2400 3000 1200 3700 May 2011 2500 1500 800 2000 June 2011 3100 3200 1100 4000 July 2011 2400 2800 2400 4200
August 2011 1200 800 1000 1800 September 2011 3500 2500 2000 3200
October 2011 4000 2000 1400 3500 November 2011 2000 3000 2400 4500 December 2011 2400 2100 1800 3200
(a) A sample set of sales data
(b) Line graph (c) Pie graph
\
Figure 1-15: Data characterization and discrimination (1):
(a) a sample set of sales data, (b) line graph and (c) pie graph.
0
500
1000
1500
2000
2500
3000
3500
4000
4500
Product A
Product B
Product C
Product D
Product A
2000
Product B
1200
Product C
1800
Product D
2200
January 2011
Sponsored by AIAT.or.th and KINDML, SIIT
22
(a) bar graph
Product Sales ($)
Product A Product B BKK TKO TOTAL BKK TKO TOTAL
January 2011 2000 2400 4400 1200 3200 4400 February 2011 3000 2000 5000 2000 2800 4800
March 2011 1500 3000 4500 2000 2400 4400 April 2011 2400 2200 4600 3000 2000 5000 May 2011 2500 2600 5100 1500 2500 4000 June 2011 3100 3500 6600 3200 2800 6000 July 2011 2400 2200 4600 2800 2500 5300
August 2011 1200 1000 2200 800 3000 3800 September 2011 3500 3000 6500 2500 2800 5300
October 2011 4000 4500 8500 2000 3400 5400 November 2011 2000 2500 4500 3000 3200 6200 December 2011 2400 2600 5000 2100 2800 4900
(b) multidimensional tables with crosstabs
Figure 1-16: Data characterization and discrimination (2):
(a) bar graph, and (b) multidimensional tables with crosstabs.
1.6.6. Meta Functionalities: Link, Outlier, and Trend/Evolutional Analysis
The classical functions, i.e., classification, prediction, clustering, association mining,
characterization, and discrimination, can be applied in more application-oriented tasks, including
link analysis, outlier analysis and trend/evolutional analysis. As an instance of multi-relational
data mining, link mining encompasses a range of tasks in both descriptive and predictive
modeling. It may use classification, clustering and association to mine knowledge from linked
relational domains. With the introduction of links, there are potential new tasks, such as inferring
the existence of a link, predicting the numbers of links, predicting the type of link between two
objects, finding co-references, and discovering subgraph patterns. A more recent application on
link analysis is mining in social networks, where relationships between people are represented
as links in a graph. Link-based object classification predicts the category of an object based not
only on its attributes, but also on its links, and on the attributes of linked objects. Web page
classification is a well-recognized example of link-based classification. It predicts the category of
0
500
1000
1500
2000
2500
3000
3500
4000
4500
Jan
20
11
Feb
20
11
Mar
20
11
Ap
r 2
01
1
May
20
11
Jun
20
11
Jul 2
01
1
Au
g 2
01
1
Sep
20
11
Oct
20
11
No
v 2
01
1
Dec
20
11
Product A
Product B
Product C
Product D
Sponsored by AIAT.or.th and KINDML, SIIT
23
a web page based on word occurrence (words that occur on the page) and anchor text (the
hyperlink words, that is, the words you click on when you click on a link), both of which serve as
attributes. A similar approach can also be applied to classify articles in journal publication
databases using bibliography information. A classification task is to predict the topic of a paper
based on word occurrence, citations (other papers that cite the paper), and co-citations (other
papers that are cited within the paper), where the citations act as links. In many cases, a database
may contain data objects that do not comply with the common behavior or model of the data.
These data objects are known as outliers. Such deviated data can be treated as noise or
exceptions. However, in some applications such as fraud detection, such rare events can be more
interesting than the more regular ones. Outlier mining is implemented with statistical tests to
find objects that substantially are diverged from the norm of any other cluster and then to
consider them as outliers. Besides statistical or distance measures, deviation-based methods is
an alternative to identify outliers by examining differences in the main characteristics of objects
in a group. Trend and evolution analysis describes and models regularities or trends for objects
whose behavior changes over time. Although this may include characterization, discrimination,
association and correlation analysis, classification, prediction, or clustering of time-related data,
distinct features of such an analysis include time-series data analysis, sequence or periodicity
pattern matching, and similarity-based data analysis.
1.6.7. Visualization
Visualization is an important process in order to utilize the result of data mining or knowledge
discovery efficiently. The visualization is known as a set of techniques to construct visual objects,
including images, diagrams, or animations to communicate abstract or concrete ideas, concepts,
thought and findings to specific audiences or public on what one intends to convey. Currently
visualization has ever-expanding applications in science, education, engineering (e.g. product
visualization), interactive multimedia, medicine, chemical informatics, bioinformatics, in the field
of computer graphics. Recently, the development of animation has provided advance
visualization, especially producing interactive and dynamic contents.
Two levels of visualization in the field of data mining/knowledge discovery are information
visualization and knowledge visualization. Information visualization means the way of using
computer-aided tools to explore large amount of abstract data in order to make us catch the
figure of information more efficiently and effectively. This area is originally posted up by the User
Interface Research Group at Xerox PARC. Major steps in information visualization are selecting,
transforming and representing abstract data in a form that facilitates human interaction for
exploration and understanding. Two main aspects of information visualization are dynamics of
visual representation and the interactivity. More advance techniques allow users to modify the
visualization format or pattern in real-time manner, then to provide multi-access to various
perceptions of patterns and structural relations in the abstract data in question.
Analogous to information visualization, knowledge visualization uses visual aids/tools and
computer and non-computer based visualization methods complementarily, to convey or
communicate knowledge among people in society in order to improve the transfer of knowledge.
Visual formats may be in the forms of sketches, diagrams, images, objects, interactive
visualizations, etc. While information visualization makes use of computer-supported tools to
derive new insights from facts or data, knowledge visualization aims to transfer insights and
create new knowledge in groups, including patterns, rules, prediction results, experiences,
attitudes, values, perspectives, opinions and expectations by using various complementary
visualizations.
Sponsored by AIAT.or.th and KINDML, SIIT
24
Sex
Male Female
(a) Mosaic plots (1 dimension)
Sex Male Female
Na
tio
na
lity
Ov
ers
ea
Lo
cal
(b) Mosaic plots (2 dimension)
Male Female
Young Mid Aged Young Mid Aged
Ov
ers
ea
Na
tio
na
lity
Lo
cal
(c) Mosaic plots (3 dimension)
Figure 1-17: Mosaic plots for representing association mining results
Sponsored by AIAT.or.th and KINDML, SIIT
25
(a) 3D Bar Graph
Left-Hand-Side Right-Hand-Side Support Confidence orange fish 0.012 0.75
banana shoes, shirt 0.014 0.85
fish, meat television 0.015 0.67
milk rice 0.102 0.56 shirt pork 0.105 0.25
apple orange water 0.043 0.91
television oven, radio 0.025 0.67
(b) Simple representation of association rules
Figure 1-18: Bar graph and simple representation of representing association mining results
As some examples, the knowledge in the form of association mining results can be visualized
through Mosaic plots as shown in Figure 1-17 as well as 3D bar graph or simple table form, as
shown in Figure 1-18. Mosaic plots display association rules in a 2D plane including the box
showing the co-occurrence frequency. They directly illustrate interestingness measure, showing
differences of confidence. An association rule can also be expressed in a 3D bar graph where the x
axis indicates the rule’s left-hand-side, the y axis displays the rule’s right-hand-side, the z axis
shows the rule’s support level, and a bar in this 3D space indicates the rule’s support by height
and the rule’s confidence by color. A naïve representation for an associate rule is in the form of a
table, where the first column indicates the rule’s left-hand-side, the second column shows the
rule’s right-hand-side, and the next two columns illustrate the rule’s support and confidence,
respectively.
Besides visualization of mining results, a more general functionality is visual data mining,
which integrates data mining and data visualization in order to discover implicit and useful
knowledge from large data sets. It includes data visualization, mining result visualization, mining
process visualization, and interactive visual data mining. Audio data mining uses audio signals to
indicate data patterns or features of data mining results. Image data mining displays images as
data patterns or mined result.
Sponsored by AIAT.or.th and KINDML, SIIT
26
1.7. Challenges in Data Mining and Text Mining
In this section, we describe some major considerations in data mining and text mining related to
data and knowledge heterogeneity, mining techniques, user interaction, and mining performance.
Several of them are current and future research topics.
Data and Knowledge Heterogeneity
Nowadays electronic data collection technology and database technology bring about titanic
amounts of data stored in several types of databases, data warehouses and other data
repositories. .While some generated data, such as those with relational tables or transaction
tables, are simple, some data are complex data objects, e.g. hypertext and multimedia data,
spatial data, or temporal data. Although it enables us to track events occurred widespread, it also
triggers a most important issue on how to handle tremendous data, which may come to the
system with various sources, different forms, diverse timing, and disperse granularity. It is a very
challenging topic for mining information and knowledge from such heterogeneous databases
and/or global information systems connected in both local- and wide-area computer networks
(typically the Internet). The discovery of knowledge from different sources of structured, semi-
structured, or unstructured data with diverse data semantics poses great challenges to data
mining. Data mining and knowledge discovery may help reveal high-level data
regularities/patterns in multiple heterogeneous databases (such as text, audio, visual,
multimedia, geographical and web databases) that are usually hard to detect by single simple
query systems but may improve information exchange and interoperability among users.
Moreover, mining from web contents, web structures, web usages and web dynamics becomes
one of very challenging and fast-evolving fields in data mining and knowledge discovery. Besides
heterogeneity in input data, as the discovered output, knowledge or pattern can be in various
primitive forms and often should be in a mixed format. In general, the output format depends on
the type of data analysis and knowledge discovery tasks, e.g., data characterization, data
discrimination, classification, prediction, clustering, association and correlation analysis, outlier
analysis, and evolution analysis. Based on the type of the tasks, numerous different data mining
techniques have been developed. Clearly, it is unrealistic to expect a single system to mine all
kinds of data with diverse data types and different mining goals. Therefore, specific data mining
systems are required for mining specific kinds of data. However, it is necessary to consider
appropriate methods to combine or integrate results from different data mining systems to
achieve higher-level goals that are usually complicated.
Interactive Mining and Visualization
Besides traditional static mining where single-pass mining is often assumed, alternatively
interactive mining of knowledge is needed in several situations, including mining at multiple
levels of abstraction, mining at different time period or granularities (e.g. day, week or year), and
mining in different points of view. Since it is difficult to know exactly what can be discovered
within a database, it will be practical if the data mining process can be done in an interactive
manner. For large-scaled databases, a sort of sampling techniques may be used to facilitate
interactive data exploration, as well as reduction of computational complexity. Such interactive
mining allows users to point down to find more specific patterns or to refine data mining results
based on newly provided user request. Normally novel useful unknown knowledge can be found
by drilling down, rolling up, slicing and dicing, and pivoting through both the data space and
knowledge space interactively, like what OLAP (online analytical processing) can perform on
data cubes. According to this concept, the user can interact with the data mining system to view
Sponsored by AIAT.or.th and KINDML, SIIT
27
data and discovered patterns at multiple granularities and from different angles. Towards
interactive data mining, we may need a sort of query languages for ad-hoc query. Analogous to
SQL (structured query language) used for querying in relational databases, a high-level data
mining query language need to be developed to enable users to describe situations for ad hoc
data mining tasks. The language will be used to represent the specification of the relevant sets of
data for analysis, the domain knowledge, the kinds of knowledge to be mined, and the conditions
and constraints to be enforced on the discovered patterns. Moreover, it should be incorporated
into a database query language and optimized for efficient and flexible interactive mining.
Towards efficient interactive mining, instead of text-based input data, text-based queries and
text-based mining results, presentation and visualization of input data, queries and mining
results is an essential component. Representing input data graphically will help us perceive input
data directly and then improve the interpretation of input data. The visualization of a query will
simplify the process that users make a query to a system to discover what they intends to find.
Via this support, even novice users in using a computer can utilize the system. Moreover,
discovered knowledge should be expressed in visual representations or other expressive forms
so that the knowledge can be easily understood and directly usable by humans. This requires the
system to adopt expressive knowledge representation techniques, such as trees, tables, crosstabs,
matrices, rules, graphs, charts, or curves. For text mining, it may be in the form of document
graphs, phrase graphs, named entity graphs and so on.
Background Knowledge Exploitation, Data Pre-preprocessing and Pattern Evaluation
Background knowledge, information, or data regarding the domain on focus, may be required in
order to guide the discovery process towards what we look for, and/or allow discovered patterns
to be expressed in concise terms and at different levels of abstraction. Domain knowledge related
to databases, such as integrity constraints and deduction rules, can help us focus and speed up a
data mining process, or judge the interestingness of discovered patterns. For example, in a client
information system, we might set beforehand that rules connecting the client’s address and
telephone are not interesting since it seems trivial. This property relates to the normalization
process in relational databases. Relational candidate keys can be background knowledge in this
case. As another case, in a market basket database, we might assign that the interestingness of a
rule is proportional to the occurrence frequency of the rules multiplied by a function responsive
to the prices of the items. By this, it will set more interestingness to the rules of high frequency
that involve expensive items. Generally, there are several methods to introduce background
knowledge to the system. A practical system should have a function to support users to use such
knowledge (application-dependent criteria) to distinguish interesting and trivial patterns.
As a specific application, it is possible to exploit background knowledge to handle noisy or
incomplete data. While the data stored in a database may reflect noise, exceptional cases, or
incomplete data objects, knowledge related to the regularity of data can help us to clean noisy
data, to handle exceptional data, or to complement incomplete data. By this preprocessing, when
mining data regularities, we can avoid overfitting of the data and then improve the quality of the
discovered patterns. Data cleaning methods and data analysis methods can handle noise, as well
as outlier mining methods can cope with the discovery and analysis of exceptional cases.
With the help of background knowledge, it is possible to evaluate patterns to find the
interesting ones. Normally a data mining system can discover thousands (or up to hundreds of
thousands) of patterns. Naturally, many of them are not interesting to the given user, either
because they represent common knowledge or lack of novelty. Several challenges focus on
developing techniques to assess interestingness of discovered patterns, with background
knowledge as subjective measures representing the value of patterns based on user expectations
Sponsored by AIAT.or.th and KINDML, SIIT
28
or beliefs. The background knowledge in the form of user-specified constraints or interestingness
expectation can be used to guide the discovery process and then reduce the search space.
Overfitting
In fields of statistics and machine learning, overfitting occurs when a statistical or learned model
describes random error or noise instead of the underlying relationship or knowledge. Overfitting
generally occurs when the model is overlearned and becomes excessively complex, such as
having too many parameters relative to the number of observations. In the conceptual level,
overfitting is triggered since the criterion used for training the model is not the same as the
criterion used to judge the effectiveness of a model. In particular, a model is trained by
maximizing its performance on some set of training data. However, its effectiveness is
determined not by its performance on the training data but by its capability to perform well on
unseen data. During generalization of the model, overfitting occurs when the model begins to
memorize the training data rather than learning to generalize from the model. As an extreme
example, a simple model can learn to perfectly predict the training data simply by memorizing
the training data in its entirety but this model will typically fail drastically on unseen data, as it
has not learned to generalize at all. We can solve the overfitting problem by stopping
generalization of a model at some early stage before the model becomes too complex and fit with
the data used for learning.
Performance and Scalability
Another important concern in data mining and text mining is performance and scalability of
mining algorithms. Normally, towards effective information extraction from a huge amount of
data in databases, data and text mining algorithms must be efficient and scalable. That is, the
execution time of those algorithms has to be acceptable, even for a large-scale database. Towards
this, a solution may come from development of a more efficient mining algorithm, parallelization
of mining algorithms, incremental mining or constraint-based mining. In many cases, it is
possible to modify original algorithms or introduce new algorithms to speed up or scale up
mining on a large-scale database, using appropriate indexing and other optimization techniques,
such as FP-Tree (Han et al., 2000), Prefix-tree (Crahne and Zhu, 2003), OP (Liu et al., 2002),
Array-based approach (Grahne and Zhu, 2003), and PrefixSpan (Pei et al., 2001; Pei et al., 2004).
Moreover, the increasing size of databases, the wide distribution of data, and the computational
complexity of data mining techniques motivate the development of parallel and distributed data
mining algorithms. Normally a parallel algorithm will divide the data into partitions and then
process them in parallel. The results obtained for the partitions will be merged into the final
solution. By this parallelism, we can fasten the mining process. Another approach to avoid the
expensive cost of performing data mining is incremental data mining where the mining process is
performed on only the newly coming data without having to mine the entire data again “from
scratch.” With lower cost, such algorithms perform knowledge modification incrementally to
revise and strengthen the previously discovered patterns or knowledge.
The issues described in this section are main challenges in the future of data mining
technology. Furthermore, some additional issues relate to applications, privacy, and the social
impacts of data mining.
1.8. Summary
With development of database technology, database management systems are used in place of
primitive file processing with the development of query and transaction processing. Further
Sponsored by AIAT.or.th and KINDML, SIIT
29
progress has led to the increasing demand for efficient and effective advanced data analysis tools,
as a result of the explosive growth in data collected from applications, including business and
management, government administration, science and engineering, and environmental control.
Data mining is the task of discovering interesting patterns from large amounts of data. It is still a
young interdisciplinary field, drawing from several areas such as database systems, data
warehousing, statistics, machine learning, data visualization, information retrieval, and high-
performance computing. Other contributing areas include neural networks, pattern recognition,
spatial data analysis, image processing, signal processing, and many application fields, such as
business, economics, and bioinformatics.
A knowledge discovery process includes application definition, dataset preparation, data
cleaning and transformation, task selection, algorithm selection, data transformation, data
mining, pattern interpretation and evaluation, and knowledge consolidation and exploitation.
Interesting data patterns can be extracted from relational databases, transactional databases, as
well as other types of information repositories, such as spatial, time-series, sequence, text,
multimedia, and legacy databases, data streams, speech, movie, and the World Wide Web. Data
mining tasks include the discovery of concept/class descriptions, associations and correlations,
classification, prediction, clustering, trend analysis, outlier and deviation analysis, and similarity
analysis. The mined patterns should represent knowledge which is easily understood by humans;
valid on test data with some degree of certainty; and potentially useful and novel. To guide the
discovery process, measures of pattern interestingness can be either objective or subjective.
Objective measures include support, confidence, conviction and lift while subjective measures
are those specified manually by human, such as novelty, interestingness and creativeness.
Challenges in data mining and text mining are knowledge heterogeneity, interactive mining
and visualization, background knowledge exploitation, data pre-preprocessing and pattern
evaluation, mining performance and scalability.
1.9. Historical Bibliography
The early collection of research works on knowledge discovery in databases or data mining was
edited by Piatetsky-Shapiro and Frawley (1991) and later by Fayyad, et al. (1996). Thereafter,
many data mining books have been published in recent years, such as Predictive Data Mining by
Weiss and Indurkhya (1998). As a statistical book, Hastie, Tibshirani, and Friedman (2001) wrote
a statistical-oriented book, namely “The Elements of Statistical Learning.” As a good recent book,
Han and Kamber (2004) have published a book namely Data Mining: Concept and Techniques. As
a more practice book with Java implementation, Witten and Frank (2003) have published a
practical book in order to illustrate how to use the Weka system and then currently the third
edition in 2011 (Witten et al., 2011). For automatic association analysis, Piatetsky-Shapiro
(1989) describes analyzing and presenting strong rules discovered in databases using different
measures of interestingness. Based on the concept of strong rules, Agrawal et al. (1993)
introduced association rules for discovering regularities between products in large-scale
transaction data recorded by point-of-sale (POS) systems in supermarkets. Link mining is a
newly emerging research area that is at the intersection of the work in traditional link analysis
(Jensen and Goldberg, 1998), hypertext and web mining (Chakrabarti, 2002), relational learning
and inductive logic programming (Dzeroski and Lavrac, 2001), and graph mining (Cook and
Holder, 2000). Last, Kandel and Bunke (2004) provide a good introduction to mining techniques
in time series.
Sponsored by AIAT.or.th and KINDML, SIIT
30
Exercise
1. Describe what difference between data mining and text mining are.
2. Describe the steps of data mining process.
3. Describe the major additional characteristics of temporal databases, compared to
conventional relational databases or transactional databases.
4. List some examples of data mining applications on medical databases.
5. Explain what interestingness is, how it is different from criteria to discover knowledge and
why we need to consider the interestingness in data mining.
6. Explain how to apply data mining to find interesting patterns from Web. Here, three possible
mining sources on the web are (1) Web Log, (2) Web Content, and (3) Web Structure.
7. Explain how text mining helps in finding useful information from electronic documents, such
as WIKIpedia.
8. Explain how classification and clustering differ from each other.
9. Provide explanation which of numeric prediction or classification is harder.
10. Give some examples of supervised learning, unsupervised learning and semi-supervised
learning.
11. Explain what effects from outliers on the mining results are.
12. Plot a line graph, a bar graph, a pie graph for the following data related to flood in Thailand
during 2011.
Water Level (cm)
Sukhothai Ayutthaya Pathumthani Bangkok
January 2011 100 50 20 40 February 2011 200 100 50 60
March 2011 300 150 100 80 April 2011 500 200 150 60 May 2011 600 300 200 70 June 2011 500 400 300 80 July 2011 450 500 400 100
August 2011 400 650 550 150 September 2011 300 800 600 200
October 2011 250 700 700 400 November 2011 300 600 850 500 December 2011 200 550 750 550
Sponsored by AIAT.or.th and KINDML, SIIT