studies on genetic transformation of black gram (vigna mungo l.)

STUDIES ON GENETIC TRANSFORMATION OF BLACK GRAM (VIGNA MUNGO L.) WITH COLD

INDUCED TRANSCRIPTOME GENE (ICE- 1) FOR ABIOTIC STRESS TOLERANCE

A

THESIS SUBMITTED TO THE ORISSA UNIVERSITY OF AGRICULTURE AND TECHNOLOGY,

BHUBANESWAR, ODISHA

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE IN AGRICULTURE (BIOTECHNOLOGY)

By

KUMARA SWAMY R.V

DEPARTMENT OF AGRICULTURAL BIOTECHNOLOGY COLLEGE OF AGRICULTURE

ORISSA UNIVERSITY OF AGRICULTURE & TECHNOLOGY BHUBANESWAR, ODISHA

2013

THESIS ADVISOR: DR. K. C.SAMAL

id1989667 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com

CERTIFICATE - I

This is to certify that the thesis entitled �STUDIES ON

GENETIC TRANSFORMATION OF BLACK GRAM (VIGNA

MUNGO L.) WITH COLD INDUCED TRANSCRIPTOME GENE

(ICE- 1) FOR ABIOTIC STRESS TOLERANCE� submitted in partial

fulfillment of the requirement for the award of the Degree of �MASTER

OF SCIENCE IN AGRICULTURAL BIOTECHNOLOGY� to the

Orissa University of Agriculture & Technology, Bhubaneswar is a record

of bona fide research work carried out by KUMARA SWAMY R.V.

(Adm.No.08ABT/11) under my guidance and supervision. No part of the

thesis has been submitted elsewhere for any degree or diploma or

published in any other form. All sorts of help and sources of information

availed during this investigation have been duly acknowledged.

(K.C. SAMAL)

Place: Bhubaneswar Chairman Date: Advisory Committee

Dr. K.C. SAMAL, Ph.D.

Associate Professor

Department of Agricultural Biotechnology,

College of Agriculture,

Orissa University of Agriculture & Technology,

Bhubaneswar- 751 003.

E-mail: [email protected]

CERTIFICATE � II

This is to certifying that the thesis entitled �Studies on genetic

transformation of black gram (Vigna mungo L.) With cold induced

transcriptome gene (ICE- 1) for abiotic stress tolerance� submitted by

KUMARA SWAMY R.V (Adm.No.08ABT/11) to the Orissa University

of Agriculture & Technology, Bhubaneswar�751003 in partial fulfillment

of the degree of �MASTER OF SCIENCE IN AGRICULTURAL

BIOTECHNOLOGY� has been approved by the student�s advisory

committee after oral examination in collaboration with external examiner.

ADVISORY COMMITTEE:

CHAIRMAN: Dr. K.C. Samal

Associate Professor Department of Agricultural Biotechnology College of Agriculture OUAT, Bhubaneswar _________________

MEMBERS:

Prof. G.R. Rout Professor and Head Department of Agricultural Biotechnology College of Agriculture OUAT, Bhubaneswar __________________

Prof. M. Kar Vice- chancellor OUAT, Bhubaneswar.

EXTERNAL EXAMINER: ____________________

ACKNOWLEDGEMENT

As a pretty long and eventful journey of my life is nearing an end, it is the right moment to extol my profound gratitude to the virtues of those who have directly or indirectly helped me during the tenure of this work. At this moment of accomplishment, my heart is overwhelmed with gratitude and I wish if these words could convey the subtle feelings.

I express my sincere gratitude to Prof. M. Kar, Vice-Chancellor and my advisor for their valuable advice and necessary suggestions during my work.

I am ineffable in expressing my heartfelt gratitude and indebtedness to the chairman of my advisory committee, Dr. K.C Samal, Associate Professor, Department of Agricultural Biotechnology, College of Agriculture, OUAT, Bhubaneswar, for his sweet gentility pulsated with undiminished enthusiastic support, inspiring guidance, constant supervision and encouragement throughout the course of my research period and teaching me how to be cool and patient in adverse situations.

I thank with great honour and reverential gratitude to Prof. G. R. Rout, Professor and Head, Department of Agricultural Biotechnology, College of Agriculture, OUAT, Bhubaneswar for his valuable advice, moral support, constructive criticism, relevant suggestion and facilities provided during the course of this investigation.

I also owe my deep sense of gratitude and sincere thanks to Dr. A.B. Das, Associate Professor and I.C Mohanty Assistant Professor, Department of Agricultural Biotechnology for their timely advice, valuable suggestions and help at the time of need.

I thank with heartfelt gratitude and indebtedness to my great teachers who make my strengthen Dr. R.L Ravi Kumar, Professor, UAS(B), Dr. P.H. H. Ramanjini Gowda ,Professor, UAS(B), Dr.Mallikarjuna Gowda, Associate Professor UHS(B) and Dr.M.A. Shankar, Dean Director of Research, University of Agricultural Sciences, Bengaluru.

I would especially like to express my heartful gratitude to Prof. Lingaraj Sahaoo Dept. Biotechnology, Indian Institute of Technology, Guwahati, for providing gene construct as well as constant inspiration. I would also like to express my sincere thanks and gratitude to Department Seed Sciences for providing quality seed materials for my research work.

I also avail this opportunity to express my sincere gratefulness to my beloved seniors Mrs. Subhadra, Ms. Netravati ,Mr. Sairam, Mr. Anupam, Ms. Dipti, Mr. Pardip, Mr. Ravimdra, Ms. Divya, Mr.Yogesh, Ms. Seema, Ms. Bhanupriy, Mr. Pravin, Ms.

Sunanda, Ms. priyadharshini, Ms. Amrita, and Mr. Rahul for their prompt help and cooperation for the entire period of study.

Words fail to express my indebtedness with veneration and devotion to my friends Kundansingh, Ratanpal, Shyam, Shantosh, Shital, Ranjeev, Krishna and Ashuthosh who helped me in several ways for the completion of this venture. Due to their kind co-operation and friendly nature, I couldn�t recognise how the time passed away.

I also like to thank my juniors Kirath singh, Sachin, Navanath, Nihar, Dhamadri, and, Pallavi and Rinny for their help.

I am in dearth of words to thank my best friends Akash D., Raghu R , Rajani H.G., Rashmi H.P., Pramod, Prasanna, Prabhu, Sukruth and Vinyaraj who stood by me during all the hard times.

I wish to extend my sincere thanks Amiya, Preedip.M, Preedip B., Naik babu and saria for the help and assistance.

The financial assistance in form of DBT fellowship from the Department of Biotechnology, Ministry of Science and Technology, Government of India is greatly acknowledged.

I wish to extend my sincere gratitude to Mr. Atratran Kar, for his kind co-operation neat & clean editing and formatting of manuscript.

Above all, I am forever beholden to my loving parents, Vishwanath and Pramila B.S, Brother Chandan R.V and family members for their constant prayers, affection, moral support, personal sacrifice and sincere encouragement throughout the period of my studies.

Finally I bow to the lotus feet of Kalikamba Devi whose grace had endowed me the inner strength, patience, will power and health to complete this endeavour successfully.

A word of apology to those I have not mentioned in person and a note of thanks to one and all who worked for the successful completion of this endeavour.

Date: Place: Bhubaneswar (Kumara Swamy R.V.)

Name of student : KUMARA SWAMY R.V Admission No. : 08ABT/11 Title of the thesis : Studies on genetic transformation of black gram

(Vigna mungo L.) with cold induced transcriptome gene (ICE- 1) for abiotic stress tolerance

Degree for which thesis : M.Sc. (Agri.) Biotechnology is submitted Name of department : Department of Agri. Biotechnology, College of

Agriculture Orissa University of Agriculture & Technology Bhubaneswar, Odisha.

Year of submission : 2013 Name of the advisor : Dr. KAILASH CHANDRA SAMAL Associate professor, Dep. of Agri. Biotechnology, CA, OUAT, Bhubaneswar

ABSTRACT

Black gram (Vigna mungo L. Hepper, syn. Phaseolus mungo L.) is one of the

most important pulse crops grown in India. It belongs to the family Fabaceae. It is a

day neutral, warm season, annual legume crop commonly grown in semi-arid to sub-

humid low land tropics and sub-tropics. It is originated in India and has been

cultivated from ancient times. India is the largest producer and consumer of black

gram in the world. The production and productivity of black gram is severely

affected by number of biotic and abiotic stresses. Low temperature seriously

affects the productivity and production of black gram in the Northern and

Eastern parts of India. Classical breeding for tolerance to low temperature have

achieved limited success due to the absence of adequate and satisfactory level of

genetic variability within the available germplasm and genes conferring resistance to

biotic and abiotic stress are mostly available in many wild relatives. But these genes

can be successfully transferred to cultivated crop like black gram, employing

biotechnological tools. ICE1 gene, one of the potential genes conferring resistance to

abiotic stress, has been identified and isolated from Arabidopsis. It is an upstream

transcription factor and a positive regulator of CBF-3 which plays a critical

role in cold tolerance in Arabidopsis. The present study was under taken to

introduce cold tolerance in the popular cultivar of Blackgram �T-9�. For this

purpose, an efficient in-vitro regeneration and transformation protocol was first

standardized. Callus was induced from leaf as well as shoot tip explants on MS

medium supplemented with 3 mg/l 2.4.D, 1mg/l Kinetin and 0.2% cocoanut water.

In spite of several combinations of Phytohormones, vitamins and other organic

compounds in MS medium, organogenesis from callus was not achieved. Direct

regeneration through multiple shoot induction was achieved using cotyledonary

node and shoot tip as explants. Multiple shoots were induced on MS medium

supplemented with 3.0 mg/l BAP and 0.05mg/l IBA. MS medium supplemented

with TDZ (0.1mg/l) and IBA (0.05mg/l) also induced better multiple shoot

induction. Multiple shoots were subcultured on the shoot elongation MS medium

fortified with 1.0 mg/l GA3. The best rooting from multiple shoots were achieved

on MS medium fortified with 0.5 mg/l NAA as well as 0.25 mg/l NAA. The genetic

transformation through co-cultivation has been established by using cotyledonary

node explants inoculated with EHA-105 Agrobacterium strain harbouring a binary

vector pCAMBIA2301 containing Neomycin phosphotransferase (nptII) gene as

selectable marker, ß-glucuronidase (GUS) as a reporter gene and ICE-1gene.

Important parameters like optical density, pre-culture period and co-cultivation time

were standardized to maximize the transformation frequency. Optical density of 0.6

at 600nm, co-cultivation period of 3 days (72 hours) and Pre-culture period of 4

days (96 hours) were found suitable for optimum transformation and better survival

frequency. Lethal dose of Kanamycin was found to be 80 mg/l which inhibits the

growth and proliferation of untransformed/ control plants. Transformation

efficiency on the basis of Kanamycin selection was found to be 9.23%. Transient

GUS expression percentage was observed about 95% in transformed shoots after

screening on selection medium containing antibiotics. Transformed plantlets were

hardened in the greenhouse in pots containing soil: sand: vermicompost (1:1:1).

Based on PCR analysis with nptII primer transformation efficiency was found to be

about 1.53%.

CONTENTS

CHAPTER PARTICULARS PAGE

I INTRODUCTION 1-9

II REVIEW OF LITERATURE 10-62

III MATERIALS AND METHODS 63-79

IV EXPERIMANTL RESULT 80-103

V DISCUSSION 104-111

VI SUMMARY AND CONCLUSION 112-114

BIBLIOGRAPHY i-xliii

APPENDIX xliv-liii

LIST OF TABLES

TABLE TITLE PAGE

1 Taxonomic classification of Black gram 1

2 Nutrition composition of black gram 5

3 Area, Production and Productivity of Blackgram in Major States (2011-12)

7

4 ICE1-CBF/DREB1-dependent signalling components conferring plant cold tolerance

24

5 Amount of stock solutions added to the media 70

6 PCR reaction mixture 77

7 PCR conditions followed 77

8 cDNA sequence (5�-3�) of ICE1 gene (2559 b) 79

9 Effect of surface sterilants on the aseptic culture and survival of explant

81

10 Effect of plant growth regulators (PGR) on callus induction of black gram cultivar �T-9�

82

11 Effect of plant growth regulators on shoot multiplication from shoot tip and cotyledon node

85

12 Effect of plant growth regulators on shoot elongation of multiple shoots

89

13 Effect of plant growth regulators on rooting of multiple shoots

91

14 Detection of lethal concentration of Kanamycin for selection medium

94

15 Effect of pre-culture period on co-cultivation 95

16 Effect of Duration on co-cultivation 96

17 Determine the sensitivity of Agrobacterium to various level of cefotaxime

98

18 Transient GUS expression percentage 101

19 Transformation efficiency based on kanamycin selection and PCR analysis

101

LIST OF PLATES

PLATE TITLE PAGE

1 Botanical description of black gram 3

2 Explant source for regeneration and transformation 65

3 Effect of plant growth regulator on callus induction from leaf explant

84

4 Effect of plant growth regulator on callus induction from shoot tip explant

84

5 Effect of plant growth regulators on shoot multiplication from shoot tip and cotyledon node

87

6 Effect of plant growth regulators shoot elongation of multiple shoots

90

7 Effect of plant growth regulators on rooting of multiple shoots

90

8 Hardening of plantlets 93

9 Determination of Kanamycin sensitivity 100

10 Kanamycin based selection transformants 100

11 GUS histochemical assay 102

12 PCR analysis of Putative transformants using nptII as Primer

103

LIST OF FIGURS

FIGURE TITLE PAGE

1 Scheme illustrating the molecular response of plants to low-temperature stress

20

2 The CBF (C-repeat-binding factor) pathway in plants. 22

3 Schematic map of vector pCAMBIA2301 66

4 Linear map of T-DNA region of vector pCAMBIA2301

66

5 Effect of plant growth regulator on callus induction of the black gram cultivar T-9

88

6. Effect plant growth regulator on shoot multiplication from shoot tip and cotyledon node

88

7. Effect of plant growth regulator on shoot elongation of multiple shoot

92

8. Effect of plant growth regulator on rooting of multiple shoot

92

9 Effect of pre-culture period on co-cultivation 97

10. Effect of duration on co-cultivation 97

ABBREVIATION

BAP : Benzylamino purine CaMV : Cauliflower Mosaic Virus cDNA : Complementary deoxyribonucleic acid cm : centimetre cv. : Cultivar DMSO : Dimethylsulphoxide DREB : Drought responsive binding element EDTA : Ethylene diamine tetra acetic acid Fig. : Figure g : Gram GFP : Green Fluorescent Protein GUS : â-glucuronidase ha : Hectare HCl : Hydrochloric acid h : Hours hpt : Hygromycin phosphotransferase IAA : Indole-3-acetic acid IBA : Indole-3- butyric acid Kn : Kinetin l : Litre LB : Luria Bertani Luc : Luciferase M : Molar mg : Milligram min. : Minute ml : Millilitre MS : Murashige and Skoog medium M.W. : Molecular weight mg/l : Milligram per Litre N : Normal NAA : á-Naphthalene acetic acid NaOH : Sodium hydroxide Npt : Neomycin phosphotransferase nm : Nanometre OD : Optical density PCR : Polymerase chain reaction rpm : Revolution per minute TE : Tris-EDTA TDZ : Thidiazuron T : Treatment pH : Hydrogen ion concentration µM : Micro molar µg : Microgram 2,4-D : 2,4-Dichlorophenoxy acetic acid

1

INTRODUCTION

Black gram (Vigna mungo L. Hepper) (2n-22) is popularly known as

Urad in Hindi, Biri in Odia and Uddu in Kannada. It belongs to the Family

Fabaceae. It is the third most important pulse crop in India after chickpea and

pigeon pea and grown mostly as a fallow crop in rotation with cereals. Its

reference that has also been found in Vedic texts such as Kautilya�s �Arthasasthra�

and in �Charak Samhita� lends support to the presumption of its origin in India.

India is the largest producer and consumer of black gram in the world.

1.1 TAXONOMICAL CLASSIFICATION OF BLACK GRAM

Black gram belongs to the sub-genus Ceratotropis of the genus Vigna.

The genus �Vigna�, together with the closely related genus Phaseolus, forms a

complex taxonomic group, called Phaseolus-Vigna complex. Verdcourt (1970).

Two botanical varieties have been recognized in V.mungo. V.mungo var.

mungo is the cultivated form of black gram and V.mungo var.silvestris is the

wild ancestral form of black gram.They are diploid in nature with 2n=2x=22.

Blackgram have small genome sizes estimated to574 Million Base pairs (Mbp).

Table.1 Taxonomic classification of Black gram

Kingdom Plantae Subkingdom Tracheobionta Super division Spermatophyta Division Magnoliophyta Class Magnoliopsida Subclass Rosidae Order Fabales Family Fabaceae Genus Vigna Species Mungo


2

1.2 BOTANICAL DESCRIPTION

Black gram is an erect or sub-erect herb, 0.5-1.3m tall with stem lightly

ridged, covered with brown hairs and much branches from the base. The leaves

are large, trifoliate and are also hairy, generally with a purplish tinge. Flower is

pale yellow. The seed colour exhibits a wide range of variations from yellow,

greenish yellow, light green, shiny green, dark green, dull green, black, brown,

and green mottled with black. Pod colour is either black or brown or pale gray

when mature and 100 seeds weight is 3-7g.

1.3 GEOGRAPHICAL DISTRIBUTION

It is widely cultivated in Indian subcontinent and to lesser extent in

Thailand, Australia and other South Pacific countries. It is popular pulse crop

of India, Pakistan, Burma, Bangladesh, Ceylon and most of the African

countries. It is an important pulse crop grown throughout the country.

In India black gram is very popularly grown in Andhra Pradesh,

Orissa, Maharashtra Madhya Pradesh, Uttar Pradesh, West Bengal, Punjab,

Haryana, Karnataka, Tamil Nadu and Bihar.

1.4 CULTIVATION CONDITIONS

Black gram is a warm weather crop and grows in areas receiving an

annual rainfall ranging from 600 to 1000 mm. It is mainly cultivated in a

cereal-pulse cropping system primarily to conserve soil nutrients and utilize the

left over soil moisture, particularly, after rice cultivation. Hence, although it is

grown in all the seasons, majority of black gram cultivation falls in either Rabi

or late Rabi seasons, particularly in peninsular India. The optimum temperature

range for growth is 27-30ºC. A dry harvest period is desirable as this forces the

crop to mature and reduces the risk of weather damage, although black gram is

3

Plate-1 Botanical Description of black gram A. Black gram plant. B. Inflorescence of black gram C. Dissected flower D. Immature pod E. mature seeds of Black gram

4

more susceptible than green gram. Black gram grows on most soils, with a

preference to loamy soil condition with a pH of 5.5-7.5. It comes up well on water

retentive soils but cannot stand saline and alkaline conditions. Root growth can be

restricted on heavy clays, with a consequent limitation to growth. Black gram is

more tolerant to water logging as compared to green gram.

1.5 AGRICULTURAL IMPORTANCE

This crop is itself a mini-fertilizer factory, as it has a unique

characteristic of maintaining and restoring soil fertility through fixing

atmospheric nitrogen in symbiotic association with Rhizobium bacteria, present

in the root nodules. The crop is suitable for inter cropping with various crops

such as cotton, sorghum, pearl millet, green gram, maize, soybean, groundnut,

for increasing production and maintaining soil fertility.

1.6 FOOD AND NUTRITION VALUE OF BLACK GRAM

Among the grain legumes, black gram is the second most important food

grain in the world for his protein content (first is soybean). Grain legumes contain

2 to 3 times more protein than cereals, ranging approximately between 20 to 40

per cent. This protein is rich in essential amino acids such as arginine, leucine,

lysine, isoleucine, valine and phenylalanine etc. In addition to being an important

source of human food and animal feed. The presence of fats with low degree of

saturation has contributed significantly to the increasing popularity of blackgram.

In the South Asia, black gram is used to make �dal�, which is the most

common dish made from various kinds of split legumes with spices. In the

Southeast and East Asian countries, it is used to make various kinds of sweet,

bean jam, sweetened bean soup, vermicelli, and bean sprout. Due to various

health benefits of black gram, they are extensively used in the preparation of

5

dishes in China, Taiwan, Thailand, Pakistan, Korea, Southeast Asia and India.

They are eaten whole and as sprouts. The starch extracted from black gram is used

in making noodles. They are also used in making desserts and soups. Black gram

is a wonderful food that helps in reducing weight. Urad beans are rich in protein,

vitamin A, B, C, E and are a perfect source of minerals such as potassium, iron

and calcium. According to Chinese medicine, the sprouts are considered as a

cooling food with anti-cancerous properties. They are used to treat inflammations

that can arise as a result of infections, hypertension and heat strokes.

Black grams have high fiber content and complex carbohydrates that

are helpful in digestion. The complex carbohydrates balance the blood sugar

levels in the body and halt the rise of sugar levels just after meal consumption.

These properties of black gram are beneficial for people suffering from high

cholesterol or diabetes. The high nutritional value of Urad bean gave this pulse

a special importance in Ayurveda medicine.

Blackgram is one of the rich sources of vegetable protein and some

essential minerals and vitamins for the human body.

Table-2: Nutrition composition of black gram

Component Quantity (%) Protein 20-25% Fat 1. 3% Ash 3. 40% Crude fibers 4. 2% Starch 40 � 47% Vitamin A (IU) 300 Vitamin B1 (mg / 100g ) 0. 52- 0. 66 Vitamin B2 (mg / 100g ) 0. 29 - 0. 22 Niacin (mg / 100g ) 2. 0 Vitamin C (mg / 100 g ) 5 Iron (mg / 100g ) 7. 8 Calcium (mg / 100g ) 145

6

1.7 PRODUCTION AND PRODUCTIVITY CONSTRAINTS

India is producing 14.0lakh tons from an area of 31 lakh hectare, which

is one of the largest producing and consuming countries in the world. The

major producing states which includes Andhra Pradesh, Maharashtra, Madhya

Pradesh, Uttar Pradesh, Tamil Nadu, Karnataka and Odisha. Maharashtra is the

largest producing state contributing for about 24 per cent of total production

followed by Andhra Pradesh and Uttar Pradesh with 19 per cent and 12.29 per

cent, respectively. The total area under black gram in Odisha is about 1.50 lakh

hectares with total production 0.42 lakh tones. But the productivity of black gram is

280.0 kg ha-1 which is far below than the national average productivity (451.61 kg

ha-1) and overall production and productivity of black gram has not been improved

significantly in spite of consistent efforts of the plant breeders due to several biotic

and abiotic stresses. The traditional strategies of conventional breeding such as

selection, crossing and back cross, multiple cross have generated very few crop

varieties with improved stress tolerance. Much improvement could not be achieved

through these techniques because of narrow genetic base of agronomically

important gene responsible for abiotic stress tolerances and limited natural variation.

Contrary to the classical breeding and marker assisted selection approaches, direct

introduction of gene by genetic engineering offers a more promising and quick

solution for improving stress tolerance (Wang, 2005).Low temperature seriously

affects the crop causing loss in production and productivity in northern and eastern

parts of India. Genetic improvement of black gram to induce abiotic stress tolerance

could be achieved through genetic engineering so that to produce variety showing

regulation of higher expression of abiotic stress responsive gene.

Stresses induce various biochemical and physiological responses in

plants. Products of a number of genes are thought to function in stress tolerance

7

and response. The term tolerance is defined as the ability of cells and

organisms to endure an internal stress induced by an externally applied stressor.

Identification of the key genes underlying cold stress has thus become a major

priority in the search for improving the crop for winter hardiness. A deeper

understanding of the regulation of these genes, and of their response to low-

temperature stress, would allow clarification of the ways in which plants adjust

to the stress. Knowledge of this type is widely expected to provide

opportunities for the manipulation of gene expression in crop plants, with a

view to engineering higher levels of cold tolerance. Stress-inducible genes

were used to improve stress tolerance of plants by gene transfer (Shinozaki and

Yamaguchi-Shinozaki, 2000). Neither DNA norm RNA can identify how much

protein is produced inside a cell or what it does. Once created chemical

modifications such as phosphorylation play a key role in controlling protein

activity; these modifications cannot be detected by screening nucleotides.

Messenger RNA tells you what might happen, and the protein tells what is

happening. Various types of libraries are used to study genomics or proteomics.

Table 3. Area, Production and Productivity of Blackgram in Major States (2011-12)

S. No. Particulars

Area (lakh ha)

% Share

Production (lakh t)

% Share

Productivity (kg ha-1)

1 Andhra Pradesh 5.03 16.23 2.59 18.50 514.91

2 Karnataka 1.26 4.06 0.64 4.57 507.94

3 Madhya Pradesh 4.72 15.23 1.66 11.86 351.69

4 Maharashtra 5.75 18.55 3.27 23.36 568.70

5 Uttar Pradesh 3.91 12.61 1.72 12.29 439.90

6 Rajasthan 1.45 4.68 0.60 4.29 413.79

7 Tamil Nadu 3.41 11.00 1.21 8.64 354.84

8 Orissa 1.50 4.84 0.42 3.00 280.00

8

Being from Leguminosae family, the genetic transformation in black

gram have been difficult and challenging till now (Jaiwal,2001), but significant

progress has been made in recovery of transformed plant via Agrobacterium in

soybean, pea, chickpea, Vigna aconitifolia (Eapenet al.,1990). Black gram

transformation system require development of (a) Suitable gene construct for

desired trait (b) a source of totipotent cells or gametes that serve as recipients

of delivered DNA, (c) a means of delivering DNA into the target cells, and (d)

a system for selecting or identifying transformed cells.

1.8 TRANSCRIPTIONS FACTOR FOR ABIOTIC STRESS TOLERANCE

In plants, one transcription factor can control the expression of many

target genes through the specific binding of the transcription factor to the cis�

acing element in promoters of the target gene (shinozaki and Yamaguchi,

2000). Northern analysis of dehydration inducible gene revealed that there

appear to be at least four independent regulons in Arabidopsis i.e. 1)

Dehydration responsive element (DREB) /CBF regulon, 2) zinc finger home

domain (ZE-HD) regulon 3) ABA responsive element binding protein /ABA-

responsive element binding factor (AREB/ABF) regulon, and 4)

Myelocytomatosis oncogenes (MYC) and myelocytotomatosis oncogene

(MYB) regulon. Transgenic plant over expressing either CBF1, 2 or 3

constitutively express CBF targeted cold- induced gene, the CBF regulon,

exhibit an increase in freezing tolerance that is independent of a cold stimulus

(Liu and Zhu, 1998).

Since CBF transcripts begin accumulating within 15min of plants�

exposure to cold, Gilmour, et al., 2000 proposed that there is a transcription

factor already present in the cell at normal growth temperature that recognizes

9

the CBF promoters and induces CBF expression upon exposure to cold stress.

He named the unknown activator(s) �ICE� (inducer of CBF expression)

protein(s) and hypothesized that upon exposing a plant to cold, modification of

either ICE or an associated protein would allow ICE to bind to CBF promoters

and activate CBF transcription.

Over expression of ICE-1/CBF3 in transgenic Arabidopsis plant

showed increased tolerance to freezing, drought and high salt concentration,

suggesting that the ICE-1/CBF3 proteins function without modification of the

proteins in the development of stress tolerance.

The present work was carried out to address the constraints of

production and productivity problem in the black gram and was planned with

the following objectives;

Standardization of in vitro technique of regeneration of the black gram

cultivar.

Standardization of Transformation protocol.

Selection of transformed cells/ tissues/ plants.

Molecular characterization of transformed cell/ plant

10

REVIEW OF LITERATURE

Classical breeding have met with limited success due to the absence of

adequate and satisfactory level of genetic variability within the available

germplasm. There is intense pressure to produce further improvements in

crop quality and quantity. Rapid progress has been made in genetic

engineering techniques to transfer and achieve stable integration and

expression of useful genes in crop plants. Genes are introduced either with

the aid of Agrobacterium tumefaciens or through direct delivery of DNA

into cells and protoplasts that use cultures of meristematic cells as source of

totipotent cells. Though, genes conferring resistance to biotic and abiotic stress

have been available in many wild and relative species, these are sexually

incompatible with cultivated ones (Varalaxmi, et al., 2013). In the present

study, an attempt has been made to regenerate transgenic Blackgram

conferring resistance to cold. The success of the previous attempt

understanding different adaption, avoidance, escaping and tolerance

mechanism of plant to different stress condition and the regeneration and

genetic transformation of Vigna mungo L. has been reviewed in this chapter.

2.1 ABIOTIC STRESS AND THEIR CONSEQUENCES

Abiotic stresses include potentially adverse effects of salinity, drought,

flooding, metal toxicity, nutrient deficiency, UV exposure, photo-inhibition,

high temperature, low temperature and air pollution etc. Plants can experience

abiotic stress resulting from the shortage of an essential resource or from the

presence of high concentrations of toxic or antagonistic substance.The stresses


11

adversely affect growth, productivity and trigger a series of morphological,

physiological, biochemical and molecular changes in plants.

Cold stress is a major environmental factor that limits the agricultural

productivity of plants. Only one-third of the total land area on Earth is free of

ice and 42% of land experiences temperatures below −20°C. Cold stress can be

classified as chilling (0�15 °C) and freezing (<0 °C) stresses. Plants respond

and adapt to this stress to survive under stress conditions at the molecular and

cellular levels as well as at the physiological and biochemical levels. However,

expression of a variety of genes is induced by different stresses in diverse

plants. Generally, plants originating from temperate regions, like spinach and

Arabidopsis, exhibit a variable degree of chilling tolerance and can increase

their freezing tolerance during exposure to chilling and non-freezing

temperatures. This process is known as cold acclimation (Thomashow, 1999).

On the other hand, plants of tropical and subtropical origins are sensitive to

chilling stress and lack the cold acclimation mechanism.

In such areas, plants require specialized mechanisms to survive

exposure to low temperature. Low temperature often affects plant growth and

crop productivity, which causes significant crop losses (Xin and Browseb,

2001). Plants differ in their tolerance to chilling (0-15 ºC) and freezing (< 0ºC)

temperatures. The most obvious detriment concerning abiotic stress involves

farming. It has been claimed by one study that abiotic stress causes the most

crop loss of any other factor and that most major crops are reduced in their

yield by more than 50% from their potential yield (Wang, et al., 2006) it has

also been speculated that this yield reduction will only worsen with the

dramatic climate changes expected considered as a detrimental effect on yield

and the quality of production.

12

In general, plants from temperate climatic regions are considered to be

chilling tolerant with variable degree, and can increase their freezing tolerance

by being exposed to chilling, non-freezing temperatures, a process known as

cold acclimation (Levitt and Guch, 1980), which is associated with biochemical

and physiological changes (Gilmour, et al.., 2000) and ultimately showed

marked changes in gene expression, Bio-membrane lipid composition, and

small molecule accumulation (Yamaguchi and Shinozaki, 2006).

The tolerance of plants to stress has been widely shown to vary with

physiological growth stage, developmental phase, size of plants and genetic

variability. There is also growing evidence that all of these stresses are inter

connected, for instance during drought stress, however water shortages effect

transport of materials in different parts of the plants and imbalanced

localization of these products can cause toxification.

2.2 STRESS AVOIDANCE AND TOLERANCE

The two distinct strategies taken by plants to combat low-temperature

stress are avoidance and tolerance. Stress avoids acne entails preventing the

freezing of sensitive tissues. Some succulent species (with thick tissue mass

and abundant water content) are able to accumulate residual heat during the day

and dissipate it slowly during the cold night many annual herbs survive in the

form of dormant organs or seed; others protect the shoot meristem with leaves

(Kacperska, 1999). A more elaborate avoidance strategy involves supercoiling,

in which endogenous ice nucleation is prevented by inhibiting the formation of

ice nucleators, even where the temperature falls as low as -400C. Extremely

winter hardy species can generate within their cells so-called �liquid glass�, a

highly viscous solution that prevents ice nucleation even at -196 0C. Such cells

become osmotically, thermally and mechanically desensitized to the presence

13

of external ice. Where the severity of the stress is more progressive, tolerant

plants have evolved the ability to acclimatize, defined by Kacperska (1999) as

the non-heritable modification of structure and function in response to stress, in

a way that reduces harm and there by improves fitness.

The plant response to low-temperature stress can be divided into three

distinct phases. The first is cold acclimation (pre-hardening), which occurs at

low, but above zero temperatures. The second stage (hardening), during which

the full degree of tolerance is achieved, requires exposure to a period of sub-

zero temperatures. The final phase is plant recovery after winter (Li, et al.,

2008). Some plants (especially trees) need a combination of short photoperiod

and low temperature to fully develop their cold tolerance. In these cases,

tolerance can be lost if the temperature is raised above zero and the

photoperiod is lengthened (Kacperska, 1999). Plant organs differ in their level

of tolerance typically the roots are much more sensitive than the crown

(McKersie, 1994), which is understandable given that the crown is the site of

the major meristem responsible for production of new roots and shoots at the

end of the cold period.

2.2.1 Morphological bases of cold tolerance

The temperate and cool regions are those where altitudes ranged from

1600-2500 above mean sea level (amsl) regions, low temperature is the primary

abiotic stress which limits the crop productivity. The low temperature at

seedling and reproductive stages is the major problem, results in slow

establishment and low seed set which leads to poor yield of the crop. The low

temperature limits the crop productivity when temperatures remain above

freezing that is > 0 oC; it is called as chilling stress. Chilling sensitive cultivars

are typically tropical genotypes. There is wide range of cold stress in temperate

14

areas differing in both timing and intensity of low temperature. Yield losses are

more severe when cold stress occurs during reproductive stage/ anthesis in rice

which lead to high spikelet sterility. Ability of crop genotypes / lines to survive

/ perform better under low temperature than other genotypes is called as cold

tolerance. Ordinarily, it is the consequence of cold hardening that is an earlier

exposure to a low temperature for a specific period as a result of which chilling

tolerance of the concerned plants increases. Cold tolerance involves increased

chlorophyll accumulation, reduced sensitivity of photosynthesis, improved

germination, pollen fertility and seed set which are desirable as

2.2.2 Increased chlorophyll accumulation

Low temperature inhibits chlorophyll accumulations in actively growing

leaves. In rice, cold tolerant lines, for example, �japonica� accumulates more

chlorophyll under cold stress than do cold sensitive line, for example

of �indica rice� (Glaszmann, et al., 1990). Rasolofo,1986 evaluated 181

accessions to identify donor and outstanding cold tolerant lines using leaf

discoloration score and found 19 remained green (dark) after 10 days in the

120C cold water tank. (Sanghera, et al., 2001) Found 18 cold tolerance

�IRCTN� rice genotypes based on dark green colour and high spikelet fertility

(>90%) under temperate conditions.

2.2. 3 Reduced sensitivity of photosynthesis

Chloroplast and photosynthesis is major site of cold injury. Tolerance in

these aspects is expressed in native vegetation adapted to growing under cool

conditions. The reduced sensitivity of photosynthesis to cold have been

observed in maize inbreeds adapted to low temperature which is partly related

to specific enzymes of the process. (Singh, B.D., 2000).

15

2.2.4 Improved Pollen Fertility and Seed Set

Cold tolerance at reproductive stage is expressed as improved seed set

and pollen fertility. It is largely a function of floral structure and function under

stress. Lia, et al. (1998) reported plant cold tolerance in rice is associated with

anther size, number of pollen grain, diameter of fertile pollen grains at booting

stage. However, Sanghera, et al. (2001) reported that cold tolerance is

associated with high spikelet fertility (>90%) and well panicle exertion under

temperate conditions. Cold snaps cause a reaction in the plant that prevents

sugar getting to the pollen. Without sugar there is no starch build-up which

provides energy for pollen germination. And without pollen, pollination cannot

occur, thereby, no grain is produced. All the ingredients for starch are present

but they are not getting into the pollen grain where they are needed. A cell

layer surrounding the pollen, called the �tapetum�, is responsible for feeding the

pollen with sugar. The tapetum is only active for 1-2 days so if a cold snap

occurs at this time, then there is no further chance for pollen growth. But the

sugar cannot freely move into the tapetum and pass through it to the pollen.

Instead the sugar has to be broken down then transported in bits to the pollen

(Oliver, et al., 2005). �Invertase� is the catalyst that helps in breakdown of the

sugar molecule to transport it into the tapetum before it is transported to the

pollen. Quantities of invertase are decreased in conventional rice when it is

exposed to cold temperatures, but they remain at normal levels in a cold

tolerant variety when it experiences cold. By comparing a cold tolerant strain

of rice with conventional rice found that the gene responsible for invertase

looks exactly the same in the cold tolerant variety as it does in conventional

rice. So the invertase gene itself does not make the rice plant cold tolerant but

instead a mechanism that regulates the invertase gene is different. Early

research indicates that the invertase gene is regulated by the hormone abscisic

16

acid (Oliver, et al., 2007). He had experimented with injecting plants with

ABA the resulting rice plants are sterile, just like that if they experienced a cold

snap. Also, ABA levels increase when conventional rice is exposed to cold, but

they remain the same in the cold tolerant variety. Recent studies have indicated

that the difference between cold-sensitive and tolerant rice is due to a different

ability to control ABA levels. It has also been shown that this mechanism may

require interactions with other plant hormones like auxins further (Zhao et al.,

2008), also reported that low temperature turns off the genes responsible for sugar

transport into the pollen grains and therefore starch cannot be produced in the

pollen in cold conditions. Cold did not cause repression of sugar delivery in

cold tolerant Chinese rice and fertile pollen was still produced following cold

treatment. The sugar metabolism genes also continued to function normally

during cold treatment of cold tolerant rice. Ample genetic variation for cold

tolerance is available in well adapted breeding population. Germplasm

collected from high altitude and low temperature areas, cold tolerant mutant,

somaclonal variants and wild species can be exploited for breeding improved

cold tolerant genotypes in hilly areas.

2.3 COLD ADOPTION

Species adapted by natural selection to cold environments have

evolved a number of physiological and morphological means to improve

survival in the face of extended cold periods (Guy, 1999).

Morphologically these species are of short stature hade a low leaf

surface area and a high root / shoot ratio. Their growth habit takes full

advantage of any heat emitted from the ground during the day and minimizes

night chilling, since air temperature is maintained most effectively near the soil

surface. Cold-adapted plants tend to be slow growing, have the C3 mode of

17

photosynthesis and store sugars in underground tissues. Plants well adapted to

cool environments have evolved an efficient respiration system, which allows

them to rapidly mobilize stored reserves during the short growing season. The

timing of developmental and physiological responses to environmental stress is

under strict genetic control (Guy, 1999).

Plant species acclimatize during autumn, physiologically and

metabolically redirected towards synthesis of cryprotectant molecules such as

soluble sugars (saccharose, raffinose, stachyose, and trehalose), sugar alcohols

(sorbitol, ribitol, and inositol) and low-molecular weight nitrogenous

compounds (proline, glycine betaine). These, in conjunction with dehydrin

proteins (DHNs), cold-regulated proteins (CORs) and heat-shock proteins

(HSPs), act to stabilize both membrane phospholipids and proteins, and

cytoplasmic proteins, maintain hydrophobic interactions and ion homeostasis,

and scavenge reactive oxygen species (ROS); other solutes released from the

symplast serve to protect the plasma membrane from ice adhesion and

subsequent cell disruption. The process of solute release, especially of vacuolar

fructans, to the extracellular space is a vesicle-mediated, tonoplast derived

exocytosis (Valluru, et al., 2008). Fructans are transported to the apoplast by

post-synthesis mechanisms, probably in response to cold stress. The activity of

fructans exohydrolase, which generates increased sugar (glucose, fructose,

sucrose) content, is an important part of the hardening process. Symplastic and

apoplastic soluble sugar not only fructan precursors, but also trehalose,

raffinose, as well as fructo and gluco-oligosaccharides contributes directly to

membrane stabilization (Livingston, et al., 2006). Also important is the

increased activity of the antioxidative enzymes superoxide dismutase,

glutathione peroxidase, glutathione reductase, ascorbate peroxidase and

18

catalase, as well as the presence of a series of non-enzymatic antioxidants, such

as tripeptidthiol, glutathione, ascorbic acid (vitamin C) and a-tocopherol

(vitamin E) (Chen, et al., 2009).

In addition to the production of protective compounds that participate

in membrane stabilization, cold acclimation also affects cell lipid composition,

which is necessary for the maintenance of plasma membrane functionality. In

particular, the proportion of unsaturated fatty acids making up the

phospholipids is increased (Rajashekar, 2000). De Palma, et al., 2008

suggested that both the composition of the phospholipids and their ability to

interact with other protective proteins are important for generating a higher

level of freezing resistance. Phospholipase D, in particular, participates in the

degradation of phospholipids, and its suppression may therefore be relevant in

improving freezing tolerance (Rajashekar, 2000). Some plants respond to cold

stress by the synthesis of proteins that inhibit the activity of ice nucleators.

Some of these so called �antifreeze� proteins are highly similar in sequence to

plant pathogen-related (PR) proteins (particularly in winter rye), and

accumulate in response to cold, drought or the exogenous supply of ethylene

(Moffatt, et al., 2006). These proteins assemble as oligomers, which can bind

to the surface of a newly formed ice crystal, and thereby influence its

subsequent shape and growth. Their antifreeze activity is modulated by Ca+,

which is either released from pectin or bound to specific proteins. An altered

ratio of abscisic acid (ABA) to gibberellin content, in favor of ABA, results in

the retardation of growth required for pre-hardening (Junttila, et al., 2002).

Gibberellin content is regulated by a family of nuclear growth-repressing

proteins called DELLAs, and these are components of the C-repeat (CRT)

binding factor 1 (CBF1)-mediated cold stress response.

19

2.4 COLD SENSING AND SIGNALING

The identity of the plant sensors of low temperature remains as yet

unknown (Chinnusamy, 2006). Multiple primary sensors may be involved, with

each perceiving a specific aspect of the stress, and each involved in a distinct

branch of the cold signaling pathway (Xiong, et al., 2002). Potential sensors

include Ca2+ influx channels, two-component histidine kinase and receptors

associated with G-proteins. Certain cytoskeletal components (microtubules and

actin filaments) participate in cold sensing by modulating the activity of

Ca2+channels following membrane rigidification (Abdrakhamanova, et al., 2003).

Because of its basic role in separating the internal from the external

environment, the plasma membrane has been considered as a site for the

perception of temperature change (Wang, et al., 2006), with its rigidification

representing an early response (Vaultier, et al., 2006). The phosphorylation of

proteins, together with the suppression of protein phosphatase activity, may

also provide a means for the plant to sense low temperatures (Rajashekar

2000). Thus, a variety of signalling pathways is triggered, including secondary

messengers, ROS, Ca2+dependent protein kinases (CDPKs), mitogen-activated

protein kinase (MAPK) cascades and the activation of transcription factors

(TFs), all of which promote the production of cold-responsive proteins. These

products can be divided into two distinct groups: regulatory proteins

controlling the transduction of the cold stress signal, and proteins functionally

involved in the tolerance response. The latter include LEA (late embryogenesis

abundant) proteins, antifreeze proteins, mRNA-binding proteins, chaperones,

detoxification enzymes, proteinase inhibitors, transporters, lipid-transfer

proteins and enzymes required for Osmoprotectants biosynthesis (Yamaguchi-

Shinozaki & Shinozaki 2006). An outline of these processes is given in Fig. 1

20

Fig. 1 Scheme illustrating the molecular response of plants to low-temperature stress, realised as changes in transcriptome, proteome, metabolome and phenotype.

2.5 THE MOLECULAR BASIS OF COLD TOLERANCE (CBF / DREB RESPONSIVE PATHWAY)

The CBF / DREB responsive pathway provides one of the most

important routes for the production of cold responsive proteins. The major cis-

acting element involved in CBF / DREB is DRE (dehydration-responsive

element) / CRT. Two major groups of transcription factors bind to DRE/ CRT

sequences, namely CBF / DREB1 (CRT-binding factor / DRE-binding protein)

in low-temperature signalling, and DREB-2 during osmotic stress (Nakashima

& Yamaguchi-Shinozaki, 2006). CBF1, 2 and 3 are all responsive to low

temperature, and their encoding genes are present in tandem on Arabidopsis

21

thaliana chromosome 4. The genes carry the conserved AP2 / ERF domain

DNA-binding motif. CBF2 / DREB1C is a negative regulator of both CBF1 /

DREB1B and CBF3 / DREB1A. CBF3 is thought to regulate the expression

level of CBF2 (Chinnusamy, 2006). Thus, the functions of CBF1 and CBF3

differ from those of CBF2, and act additively to induce the set of CBF-

responsive genes required to complete the process of cold acclimation (Novillo,

et al., 2004). Upstream of CBF lie both ICE1 (inducer of CBF expression), a

positive regulator of CBF3, and HOS1 (high expression of osmotically

sensitive), a negative regulator of ICE1. The HOS1 product is a RING E3

ligase targeting ICE1 for degradation in the proteasome (Dong, et al., 2006).

Because of the rapid (within a few minutes) induction of CBF transcripts

following plant exposure to low temperature, ICE1 is unlikely to require de-

novo synthesis, but rather is already present in the absence of cold stress and is

only activated when the temperature decreases (Chinnusamy et al., 2003). The

LOS1 (low expression of osmotically responsive genes) product is a translation

elongation factor 2-like protein, which negatively regulates CBF expression.

The likely regulators of CBF1 and CBF2 are bHLH proteins other than ICE1.

To obtain transient expression of CBFs, the levels of CBF1 and CBF3

transcript, after their induction by ICE1, are subsequently lowered by CBF2.

Accordingly, the peak expression of CBF2 in response to low temperature has

been shown to occur about 1 h later than that of either CBF1 or CBF3 (Novillo,

et al., 2004). In addition to ICE1, a further positive regulator of CBF

expression is LOS4, an RNA helicase-like protein (Gong, et al., 2002) .

However, CAX1(cation exchanger), which plays a role in returning cytosolic

Ca2+ concentrations to basal levels following a transient increase in response to

low-temperature stress, is a negative regulator of CBF1, 2 and 3 (Catala, et al.,

2002). The ICE1-CBF pathway provides positive regulation of the expression

22

of certain Zn finger transcriptional repressors and the SFR6 (sensitivity to

freezing) protein, which is required for CBF function. SFR6 may be part of an

adaptor complex required for CBF action, or alternatively, may be involved in

the translation machinery of CBF transcripts and in CBF protein stability

(Chinnusamy, 2006). Further pathways, not under CBF control, are also

involved in the regulation of cold-responsive genes (Van Buskirk &

Thomashow, 2006). In particular, Chinnusamy,2006 have shown that both

HOS9 and HOS10 transcription factors play a role in the regulation of freezing

tolerance in a CBF-independent manner.

Fig. 2. The CBF (C-repeat-binding factor) pathway in plants. ICE1 (inducer of CBF expression) is activated by low temperature and is inhibited by HOS1 (high expression of osmotically sensitive). This triggers the expression of CBF3, which promotes the accumulation of COR (cold regulated)gene products. CBF3 expression also positively regulates the expression of CBF2, which, in turn, leads to the down-regulation of CBF3 and CBF1. LOS4 (low expression of osmotically responsive genes) is a positive regulator of CBF expression, and LOS1 a negative regulator

Knowledge gained from the study of the model plant A.thaliana has

proven to be largely, but not completely, transferable to crop plants.

Unfortunately, many key stress responses are not transferable, and Oh, et al.

(2007) experienced with over-expression of the barley low temperature induced

gene HvCBF4 in rice, which resulted in the up-regulation of a set of genes not

23

predicted from the heterologous expression of AtCBF3 in rice. For cereal

species, this disadvantage is to some extent balanced by the availability of the

rice genome sequence, and its increasing level of annotation, since the cereal

species genomes are all closely related to one another (Moore, et al., 1995). In

barley, the CBF genes HvCBF3, HvCBF4 and HvCBF8 are all components of

the frost resistance quantitative trait locus (QTL) located on chromosome 5H

(Francia, et al., 2004). A contrasting approach has targeted comparisons

between spring- and winter-sown cereal cultivars. Thus, for example, Monroy,

et al., (2007) observed that spring and winter wheats share the same initial

rapid expression of cold-inducible genes, but that their transcriptional profiles

diverge widely during cold acclimation. While in winter cultivars the

expression of cold acclimation genes continues over time, in spring cultivars,

their levels of expression decline and the cold acclimation process is

overridden by the transition from the vegetative to the reproductive stage.

Although the regulation of genes in the CBF-responsive pathway has been only

marginally explored to date in woody plants, there are some indications that

their regulation is more complex than in herbaceous species. For example four

Eucalyptus gunnii CBF1 genes displayed differential expression in response to

cold treatment (Kayal, et al., 2006; Navarro et al., 2009).

24

Table-4 ICE1-CBF/DREB1-dependent signaling components conferring plant cold tolerance

Gene Transgenic host Source plant Phenotype and effects References AtICE1 Arabidopsis thaliana

Arabidopsis thaliana

Freezing tolerance ;activation of CBF3/DREB1A

Chinnusamy, et al., 2003

AtICE2 Arabidopsis thaliana


Freezing tolerance; activation of CBF3/DREB1A Fursova,.et al.,2009

AtICE1 Cucumis sativus


Chilling tolerance; dwarf Liu, et al.,2010

SlICE1

Solanum lycopersicum Solanum lycopersicum

Chilling tolerance; accumulation of antioxidants

Miura, et al.,2012

TaICE141, TaICE187


Triticum aestivum Freezing tolerance Badawi, et al.,2008

AtCBF1, AtCBF2, AtCBF3

Arabidopsis thaliana Arabidopsis thaliana

Freezing, salt and drought tolerance; constitutive expression of COR

Gilmour, et al.,2005,, et al. Fursova, et al., 2009 and Hu, et al., 2011

OsDREB1A, OsDREB1B, OsDREB1C.

Oryza sativa Oryza sativa Chilling, salt and drought tolerance; dwarf Ito, et al.,2006

HvCBF4 Oryza sativa Hordeum vulgare Chilling, drought and salt tolerance Oh,. et al.,2007

TaDREB2, TaDREB3

Triticum aestivum Triticum aestivum Freezing and drought tolerance; dwarf Morran, et al.,2011

AtCBF1, AtCBF2.

Brassica napus Arabidopsis thaliana

Freezing tolerance; constitutive expression of COR Jaglo,et al.,2001

AtCBF1 Fragaria ananassa


Freezing tolerance Owens,et al.,2002

25

Gene Transgenic host Source plant Phenotype and effects References

AtCBF3 Solanum tuberosum Arabidopsis thaliana

Freezing tolerance Behnam, et al.,2007

AtCBF1 Populus tremula x


Freezing tolerance

Benedict, et al.,2006

AtCBF3 Triticum aestivum Arabidopsis thaliana Freezing tolerance Pellegrineschi, et al.,2004

AtCBF3 Nicotiana tabacum Arabidopsis thaliana Freezing tolerance Kasuga, et al.,2004

SlCBF1 Arabidopsis thaliana Solanum lycopersicum Freezing tolerance Zhang, et al.,2004

OsDREB1A Arabidopsis thaliana Oryza sativa Freezing, drought and salt Tolerance Dubouzet, et al.,2003

VrCBF1, VrCBF4

Arabidopsis thaliana Vitis riparia Freezing and drought tolerance; dwarf Qin, et al.,2004

HvCBF3 Arabidopsis thaliana Hordeum vulgare Freezing tolerance Siddiqua, et al.,2011

LpCBF3 Arabidopsis thaliana Lolium perenne Freezing tolerance; dwarf Skinner, et al.,2005

SlCBF1 Arabidopsis thaliana Solanum lycopersicum Chilling and oxidative tolerance Xiong, et al.,2006 Zhao, et al.,2008

MbDREB1 Arabidopsis thaliana Malus baccata Chilling, drought and salt tolerance

Hsieh, et al.,2002

GmDREB3 Arabidopsis thaliana Glycine max Freezing, drought and salt tolerance Yang, et al.,2011

BpCBF1 Arabidopsis thaliana Betula pendula Freezing tolerance; dwarf Chen, et al.,.2008

26

2.4.1 Sugars as signaling molecules

Sugars represent not just an energy source, but are also carbon

precursors, substrates for polymers, storage and transport compounds and

signalling molecules (Wormit, et al., 2006). In cold-induced barley cell

cultures, the extracellular sugar concentration regulates expression of the

stress-responsive genes BLT4.9 (non-specific lipid transfer protein) and DHN1

(Tabaei-Aghdaei, et al., 2003). Three different glucose signalling pathways are

known in plants: one is hexokinase-dependent, the second glycolysis

dependent, and the third hexokinase-independent (Xiao, et al., 2000).

Hexokinase functions as an intracellular glucose sensor, while some membrane

receptors probably act as extracellular sensors (Moore et al., 2003; Rolland, et

al., 2006). It is also believed that plants have a disaccharide sensing system,

involving sucrose and trehalose. Sucrose transport to the cell and its subsequent

cleavage by invertase or sucrose synthase is the source of the signal

(Iordachescu & Imai, 2008). Trehalose, a disaccharide confined mostly to

organisms adapted to situations of extreme desiccation, where its role is to

protect proteins and membranes, plays, together with its precursor trehalose-6-

phosphate, an important regulatory role in sugar metabolism and plant

development. In barley, trehalose induces the expression and activity of fructan

biosynthesis enzymes. However, for fructan accumulation, glucose or mannitol

is also required. From a microarray analysis following trehalose treatment, Bae,

et al.(2005) showed that the expression of a wide range of other genes was also

influenced by trehalose. A role for trehalose and trehalose-6-phosphate in

abiotic and biotic stress signalling has been confirmed by the observation that

coordinated changes occur in transcript levels of the enzymes involved in their

metabolism, especially after exposure to cold, osmotic and salinity stresses and

27

in response to Pseudomonas syringae infiltration. Fructose-based polymers

(fructans) also contribute to the cold and drought tolerance of several plant

families. These molecules are synthesized from sucrose by

fructosyltransferases, and help to stabilise membranes by binding to the

phosphate and choline groups of membrane lipids. This stabilisation results in

reduced water loss from the dry membranes (Valluru & Van den Ende, 2008).

In addition, fructans are suspected of stimulating the production of alternative

cryoprotectants (Valluru, et al., 2008). Both size- and species dependent

differences are thought to exist among cereal fructans (Hincha, et al., 2007).

Some Poaceae species can accumulate fructans (Triticum, Hordeum, Avena,

Poa, Lolium), but others cannot (Oryza). This difference was supposed by Ji, et

al., (2006) to reflect an evolutionary event that separated the Panicoideae (rice,

sorghum, maize, etc.) from the Pooidae (wheat, barley, rye, etc.). Although all

cereal species have invertases (from which fructan biosynthesis enzymes

evolved), the fructan non-accumulators lack fructan biosynthesis enzymes.

Some data have also been generated to suggest a role for ß-amylase during cold

and other abiotic stresses. The hypothesis put forward by Kaplan et al., (2006)

was that this enzyme provides some protection to photosystem II

photochemical efficiency by catalysing the synthesis of maltose.

2.4.2 Signalling cross-talk

The signalling pathway associated with cold stress is believed to be

rather less dependent on ABA than those involved in the response to either

moisture or salinity stress (Zhang, et al., 2004). However, it is clear that some

cross-talk does occur between the various abiotic stress signalling pathways, as

the transcription of members of identical gene families is induced, and rather

similar products are accumulated (Chinnusamy, et al., 2004). For instance, in

28

A. thaliana the hydrophilic proteins COR15a and COR78 are accumulated as a

response to both cold and moisture stress (Rajashekar, 2000). Because many

abiotic stresses including freezing, drought and salinity result in cellular

dehydration, it is hardly unexpected to find some overlap in the various

signaling pathways that all deliver protection against cellular dehydration. This

commonality presumably lies behind the involvement of the CBF regulon in

the abiotic stress response (Fowler, et al., 2005). A key link between the

various pathways is the ROS network, which balances scavenging with

production (Torres & Dangl, 2005). Plants are thought to have evolved a high

degree of control over ROS toxicity, to the extent that ROS are exploited as

signalling molecules (Timperio, et al., 2008). The plant cell senses ROS via

redox-sensitive transcription factors (e.g. nitrogen permease reactivator or heat-

shock factors), which activate functional proteins involved in the re-

establishment of cellular homeostasis (Mittler, et al., 2004). Freezing tolerance

has been identified as a multigene trait. Some interspecific variation has been

identified among relevant gene products (Rajashekar, 2000), but the regulation

of many of the genes induced during cold acclimation are conserved between

species Zhu, et al., (2008) have suggested that histone acetylation / deacetylation is

an important player in gene activation and repression during cold acclimation, and

in particular showed that the HOS15 gene product, a nuclear localised repressor

protein that functions as a histone deacetylator, specifically interacts with histone

H4. A recent research focus has centered on the role of microRNAs (miRNAs) as

regulators of stress responses. Several stress related elements are present in the

promoter regions of certain miRNAs, and some miRNAs are known to be inducible

by abiotic stress. miRNA expression profiling has also been used to demonstrate the

existence of cross-talk between the salinity, cold and drought stress signalling

pathways (Liu, et al., 2008).

29

2.5 Functional proteins involved in cold acclimation

The level of cold hardiness has been successfully correlated with the

level of expression of COR genes (Pearce, et al., 1996). During the cold

acclimation process, COR genes such as COR tmc-ap3 and COR14b are up-

regulated, as are BLT (barley low temperature) genes (BLT14, BLT63, BLT801,

BLT4) and ELIP (early light inducible protein) genes (Cattivelli, et al., 2002).

Other genes are down-regulated, most typically those associated with

photosynthesis, such LHC (light harvesting complex) and plastocyanin. Atienza,

et al, (2004) investigated the induction of the three genes, DHN5, DHN8 and

COR14b, in barley, and found them to be cold specific. Other up-regulated

genes included those encoding enzymes involved in amino acid metabolism

(chloroplast-dependent, except for proline, which was chloroplast-

independent).

2.5. 1 Late Embryogenic abundant (LEA) Proteins

The Dehydrins are a group of heat-stable, glycine-rich Late

Embryogenic abundant (LEA) proteins thought to be important for membrane

stabilization and the protection of proteins from denaturation when the

cytoplasm becomes dehydrated. Nakayama, et al., 2008 have suggested that

some of them, especially COR15am, function as a protectant by preventing

protein aggregation. The Dehydrins ERD10 (early response to dehydration) and

ERD14 function as chaperones and interact with phospholipid vesicles through

electrostatic forces (Kovacs, et al., 2008). Several dehydrins are significantly

accumulated during cold stress (Renaut, et al., 2004). Microarray experiments

have shown that the expression profile of specific combinations of dehydrin

genes can provide a reliable indication of low temperature and drought stress

(Tommasini, et al., 2008). COR413im was identified by Okawa, et al., (2008)

30

as an integral membrane protein targeted to the chloroplast inner envelope in

response to low temperatures, where it contributes to plant freezing tolerance.

However, the SFR2 protein, which is protective of the chloroplast during

freezing, is localised in the chloroplast outer envelope membrane (Fourrier, et

al., 2008).

2.5. 2 Heat shock proteins (HSP)

Osmotic, cold and salt stresses are the strongest inducers of HSP

expression in plants (Timperio, et al., 2008). Some HSPs (in particular HSP90,

HSP70, several small HSPs and chaperonins 60 and 20) increase in abundance

following exposure to low temperature, and unlike the HSPs produced in

response to high temperature stress, which function as molecular chaperones,

these have a strong cryoprotective effect, participating in membrane protection,

in the refolding of denatured proteins and in preventing their aggregation

(Timperio, et al., 2008). Small HSPs are not themselves able to refold non-

native proteins, but do facilitate refolding effected by HSP70 and HSP100

(Mogk, et al., 2003).

2.6 Stress avoidance and tolerance

The two distinct strategies taken by plants to combat low-temperature

stress are avoidance and tolerance. Stress avoids acne entails preventing the

freezing of sensitive tissues. Some succulent species (with thick tissue mass

and abundant water content) are able to accumulate residual heat during the day

and dissipate it slowly during the cold night many annual herbs survive in the

form of dormant organs or seed; others protect the shoot meristem with leaves

Kacperska, 1999. A more elaborate avoidance strategy involves supercoiling,

in which endogenous ice nucleation is prevented by inhibiting the formation of

ice nucleators, even where the temperature falls as low as -400C. Extremely

31

winter hardy species can generate within their cells so-called �liquid glass�, a

highly viscous solution that prevents ice nucleation even at -196 0C. Such cells

become osmotically, thermally and mechanically de-sensitised to the presence

of external ice (Wisniewski & Fuller, 1999). Where the severity of the stress is

more progressive, tolerant plants have evolved the ability to acclimatise,

defined by Kacperska, 1999) as the non-heritable modification of structure and

function in response to stress, in a way that reduces harm and thereby improves

fitness. The plant response to low-temperature stress can be divided into three

distinct phases. The first is cold acclimation (pre-hardening), which occurs at

low, but above zero temperatures. The second stage (hardening), during which

the full degree of tolerance is achieved, requires exposure to a period of sub-

zero temperatures. The final phase is plant recovery after winter (Li, et al.,

2008). Some plants (especially trees) need a combination of short photoperiod

and low temperature to fully develop their cold tolerance. In these cases,

tolerance can be lost if the temperature is raised above zero and the

photoperiod is lengthened. Plant organs differ in their level of tolerance

typically the roots are much more sensitive than the crown (McKersie, 1994),

which is understandable given that the crown is the site of the major meristem

responsible for production of new roots and shoots at the end of the cold

period.

2.7 ENZYMATIC AND METABOLIC RESPONSE

Many enzymes are involved in the cold response machinery. In

addition to those associated with osmolyte metabolism, detoxification cascades

and photosynthesis, lignin metabolism (caffeic acid 3-O-methyltransferase),

secondary metabolism, cell wall polysaccharide remodelling, starch

metabolism, sterol biosynthesis and raffinose family oligosaccharide (myo-

32

inositol-1-phosphate synthase and galactinol synthase) synthesis are all

participants in the global response to cold stress (Renaut, et al., 2006). Whereas

the transcription level of genes involved in photosynthesis, tetrapyrrole

synthesis, cell wall, lipid and nucleotide metabolism is negatively correlated

with freezing tolerance, the level of transcription of genes associated with

carbohydrate, amino acid and secondary metabolism (e.g. flavonoids) is

positively correlated with freezing tolerance (Hannah, et al., 2006). Much

attention has been paid to studying the response of saccharide metabolism to

low-temperature conditions. The transcriptional up-regulation of the raffinose

oligosaccharide pathway results in accumulation of monosaccharides and

disaccharides (including glucose, fructose, sucrose, galactinol, melibiose and

raffinose) (Usadel, et al., 2008). A key enzyme in the synthesis of raffinose

oligosaccharides is galactinol synthase, which catalyses the first committed step

in raffinose synthesis. Transcription of this enzyme, along with that of raffinose

synthase and to some extent that of a number of enzymes involved in the

synthesis of precursors for the raffinose pathway, such as members of the

Myoinositol phosphate synthase family, is induced by a fall in temperature .

Raffinose accumulation on its own, however, is neither sufficient nor necessary

for the induction of freezing tolerance or cold acclimation in A. thaliana.

Nishizawa, et al., 2008 have also suggested the possibility that both galactinol

and raffinose are ROS scavengers. The drought, salinity and cold tolerance of

rice transformed with an over-expressed Escherichia coli trehalose biosynthetic

gene were all significantly better than the wild type (Garg, et al., 2002). In

addition to those in the raffinose pathway, other sugar metabolism enzymes are

also involved in the cold response. In A. thaliana, sucrose synthesis genes,

among which are those encoding sucrose phosphate synthase (SPS), are known

to be induced by low temperature (Usadel, et al., 2008), while transcript levels

33

of several members of the invertase family (along with the overall level of

invertase activity in the plant) are suppressed. In other plant species, such as

wheat and tomato for example, invertase activity is up-regulated by a fall in

temperature, although this effect is weak in accessions that are chilling tolerant

(Vargas, et al.,2007). Recent research has underlined a key role for metabolite

transporters in carbohydrate metabolism under low temperature conditions, as

well as their partitioning between the chloroplast and the cytosol (Guy, et al.,

2008). The metabolism of nitrogenous compounds is also responsive to low-

temperature stress (Usadel, et al., 2008), in particular that of certain amino

acids and polyamine compounds (Davey, et al., 2009). Transcript signal levels

of A. thaliana enzymes involved in amino acid metabolism are notably affected

by cold stress, with some being increased (especially those associated with

proline biosynthesis, those within the glutamate and ornithine pathways, and

those encoding cysteine and polyamine synthesis), and others, such as the

genes responsible for branched-chain amino acid degradation, tending to be

repressed (Usadel, et al., 2008). The metabolic fingerprinting of several

ecotypes of A. lyrata ssp. petraea has suggested a significant influence of cold

stress on the expression level of genes within the glutamine-associated

pathways (e.g.an increase in glutamine synthetase and suppression of

asparagine synthetase), which are important for the metabolism of nitrogen

(Davey, et al., 2009). GABA (c-aminobutyric acid) is an important amine-

containing metabolite associated with cryoprotection in barley and wheat

(Mazzucotelli, et al., 2006). It is synthesised in the cytosol via the

decarboxylation of glutamine by glutamate decarboxylase (GAD). In A.

thaliana, GAD genes are rapidly up-regulated by the imposition of cold stress,

well before any observable increase in GABA content (Kaplan, et al., 2007).

These data support the notion that glutamate availability and GAD activity are

34

associated with freezing tolerance and GABA biosynthesis (Guy, et al.,

2008).Transcript levels associated with lipid metabolism genes are generally

suppressed by a decrease in temperature (Hannah, et al., 2006). However, some

evidence derived from

A. thaliana shows that a number of lipid catabolism enzymes (in

particular, phospholipase A and D) are activated by a fall in temperature, and

this is followed by a rise in the amount of free fatty acids present (Usadel, et

al., 2008). Another important group of hydrolases, the galactolipases, are less

markedly cold-induced than the phospholipases, although an increase in their

activity is thought to contribute significantly to chilling susceptibility in plants.

Their lipo-hydrolytic activity is more likely to be linked to freezing tolerance

than to cold acclimation (Wang, et al., 2006). The expression of secondary

metabolism genes is generally well correlated with freezing tolerance (Usadel,

et al., 2008). In A. thaliana, cold stress induces the biosynthesis of flavonoids

and anthocyanins, glucosinolates, terpenoids and phenylpropanoids

(Kaplan, et al., 2007). Anthocyanin content is also positively correlated with

cold tolerance in some ecotypes, and its level in the leaf has been observed to

rise significantly during cold acclimation (Marczak, et al., 2008). This response

is also widespread among other plant species (Chalker-Scott, 1999). Above

normal levels of anthocyanin and the blue light absorbing flavonols in the leaf

ensure that chlorophyll is not over-excited under conditions of extreme cold

(Korn, et al., 2008). The presence of salicylic acid, which plays an important

role in plant defence against pathogens, can also be heightened by cold stress,

together with that of a range of secondary metabolism precursors, such as

phenylpropanoids, free fatty acids and branched or aromatic amino acids. This

suggests, perhaps, a link between the plants� defence machinery and protection

35

from cold-induced damage. Nevertheless, the, biosynthesis of certain

secondary metabolites (e.g. terpenoid, indole alkaloids in Catharanthus roseus)

is suppressed by low temperature (Dutta, et al., 2007). Transcriptome profiling

studies have also demonstrated increases in the expression level of genes

associated with ABA signalling, as well as of ABA responsive genes

(Usadel, et al., 2008). Finally, genes regulating other metabolic pathways,

along with signalling genes associated with secondary metabolism products

(such as jasmonic acid and ethylene) are down-regulated by cold. Overall,

these observations underline that the regulation of secondary metabolism is

highly complex in plants.

2.8 IN VITRO REGENERATION

Grain legume crops like pigeon pea, chickpea, Uradean, mungbean,

groundnut and soybean are extensively grown in the rainfed and dryland areas

of India. Despite large acreage under these crops, total productivity remains

low and has been stagnating for the last few decades. A number of biotic and

abiotic stresses are severely affecting full realization of the yield potential of

these crops. There is need to increase productivity and enhance the nutritional

value of these pulse crops. Cultivars resistant to biotic and abiotic stresses and

which have better protein quality and quantity are needed. Grain legumes have

a narrow genetic base since they are essentially self-pollinated (although cross-

pollination does take place, it is at very low frequency).Thus, there is need to

widen the genetic base and incorporate desirable characters. There is an urgent

need to use transgenic technologies for improvement of leguminous crops.

Worldwide, soybean is the only transgenic grain legume being cultivated in

nearly 63% of the total area under transgenics. Routine transformation

protocols are limited in most grain legumes. The low success has been

36

attributed to poor regeneration ability (especially via callus) and lack of

compatible gene delivery methods, although some success has been achieved in

soybean. This review is an attempt to summarize the studies on regeneration

and genetic transformation in grain legume and to identify the hurdles being

faced in the efficient recovery of transgenic plants. The review presents a

comparative account of explants used, mode of regeneration, gene delivery

techniques and recovery of transgenics in crops considered here.

Plant tissues regenerate in vitro through two pathways, namely

�organogenesis (it may be direct or indirect via callus mediated organogenesis).

The regeneration of complete plants via tissue culture has made it possible to

introduce foreign genes into plant cells and recover transgenic plants.

Morphogenesis could occur directly from the explant or indirectly via the

formation of a dedifferentiated callus.

2.8.1 Callus mediated regeneration

Immature embryos were used induce the callus, regeneration of viable

plants was obtained in soybean (Glycine max (L.) Merr). Regeneration

occurred via embryogenesis or via organogenesis. Embryogenesis resulted

when embryos were plated on (MS) medium containing 43 µM á-

naphthaleneacetic acid. To get effective result the addition of 5.0µM thiamine-

HCl increased embryogenesis from 33% to 58% of the embryos plated. By

giving External addition of 30µM nicotinic acid to the MS medium enhanced

embryogenesis further to 76%. Organogenesis was obtained when medium

containing 13.3 µM 6-benzylaminopurine, 0.2µM and á-naphthaleneacetic acid

and four times the normal concentration of MS minor salts was used

(Barwale, et al.,1986).

37

Ignacimuthu and Franklin (1998) reported formation of from

cotyledons and embryonal axis explants cultured on BA (N6- benzyladenine)

and NAA (á-naphthalene acetic acid) supplemented medium. The percentage

of callus induction increased with an increase in the BAP concentration. This

also exhibited a concomitant decrease in shoot initiation.

(Muhammad et al., 2008) five-day-old in vitro grown seedlings of

cowpea was obtained in MS supplemented with 0.50 mg/l BAP - 0, 0.10, 0.30 and

0.50 mg/l NAA. Callusing was recorded on all cultures containing 0.5 mg/l BAP

with and without NAA. However, increased diameter of calli was recorded on MS

medium containing 0.5 mg/l BAP - 0.1, 0.3 and 0.5 mg/l NAA.

Harisaranraj, et al., 2008. In this study used half seed explants in Vigna

mungo (L) Hepper organogenesis. Half seed explants were inoculated onto B5

medium supplemented with kinetin (4.7ìM to 23.5ìM), 6-benzyladenine

(4.4ìM to 22.2ìM), á-naphthalene acetic acid (5.4ìM to 27.0ìM), indole

butyric acid (4.9ìM to 24.5ìM) and 2, 4- dichlorophenoxyacetic acid (4.5ìM

to 22.5ìM). Callus initiation was observed in all media evaluated and the

highest cell proliferation was obtained from explants cultivated in the presence

of 13. 3ìM BAP and 13.5ìM 2, 4-D.

Priya Srivastava et al., 2011 developed the regeneration protocol by

using leaf explant in Vigna mungo (L) silvestris organogenesis. Primary

immature leaf segment were inoculated on MS medium supplemented with 2,

4-dichlorophenoxyacetic acid (0.5ìM to 72.5ìM), Callus initiation was beastly

observed on media and having the highest cell proliferation was obtained from

explants cultivated in the presence of 2, 4-dichlorophenoxyacetic acid. Shoot

induction was obtained from callus induced on 6.0ìM 2, 4-D at 6 weeks after

transferring the callus and then regenerated media.

38

2.8.2 Direct organogenesis

Axillary shoot proliferation of Vigna mungo L. Hepper has been

reported from cotyledons (with intact cotyledonary nodes) cultured on

cytokinin-containing medium (Gill, et al., 1987).

The beneficial effect of BAP in increasing shoot regeneration

efficiency during seed germination (pre-conditioning) from cotyledonary node

explants has been observed previously in the legumes Glycine max (Thorne, et

al., 1995), Cajanus cajan (Shiv Prakash, et al., 1997) and Phaseolus species

(Santalla, et al., 1998).

The effect of adenine sulphate (AdS) was similar to that of the control.

The shoots developed on kinetin, 2-ip and zeatin were robust and longer than

those induced on BAP. BAP alone was found to be effective in multiple shoot

induction from similar explants of other grain legumes like Phaseolus vulgaris

(Aragao, et al., 1998) and Vigna unguiculata (Brar, et al., 1997).

Ignacimuthu and Franklin, (1998) reported formation of multiple

shoots in 15 days from cotyledons and embryonal axis explants cultured on BA

(N6- benzyladenine) and NAA (á-naphthaleneacetic acid) supplemented

medium. The percentage of callus induction increased with an increase in the

BAP concentration. This also exhibited a concomitant decrease in shoot

initiation. Similar results were found with shoot apical meristem cultures of

grain legumes, using combinations of an auxin and a cytokinin for callus

induction and differentiation (Gulati and Jaiwal, 1992).

Thidiazuron has been demonstrated as a better induction factor for

organogenesis and somatic embryogenesis in chickpea (Murthy et al., 1996;

Rizvi et al., 2000). N-phenyl-N�-(1-2- 3-thidiazol-5-yl) urea or thidiazuron

39

(TDZ) having a high cytokinin like activity have been found very useful for

rapid regeneration protocol by direct organogenesis (Malik and Saxena, 1992;

Murthy et al., 1996).

Das, (1998) reported that regeneration has been achieved in Vigna

mungo L. through organogenesis using explants from axillary shoots

originating from the nodes of seedlings germinated in cytokine containing

medium. He germinated Seeds in thidiazuron (TDZ) at 0. 5 mg /L

supplemented MS medium produced: 11 axillary shoot: cotyledonary node.

Stem and petiole explants derived from these axillary-shoots produced callus

along with shoot-buds after 2 weeks of culture on half strength MS

supplemented with 0.1 mg/L á-napthalene acetic acid. Shoot-buds were also

produced from various sites of injury caused by incisions on the stem explants.

Full strength MS salts inhibited bud formation. The pH of the regeneration

medium had a significant effect on regeneration efficiency. The shoot-buds

elongated and rooted on one third strength MS medium. The plantlets were

transferred to soil after 3 weeks and 90�95% of the plantlets thus obtained

could survive transfer to soil.

Das, (2002) reported more efficient regeneration system in black gram

by using liquid culture method. Young multiple shoots obtained by germinating

the seeds in 2mg/L BAP (8.9mM), N6- benzyladenine-supplemented

Murashige and Skoog (MS) medium were used as a source of tissue to initiate

the liquid culture. The liquid medium consisted of half-strength B5 or MS salts

supplemented with MS organics, a naphthalene acetic acid (0.1 mg/L, 0. 4mM)

and N6-benzyladenine (0.5 mg/L, 2.2mM). Transferring the growing tissues to

fresh medium every third day resulted in 142% increase in the number of shoot

buds produced after 24 days.

40

Muruganantham, et al., 2004 used eighteen day old immature

cotyledonary nod explants of black gram produced multiple shoot in MS salt

+B5vitamins containing medium in presence of (1.0 mg/L), TDZ(0.1 mg/L)

and Ads (15mg/L) maximum shoot proliferation (28 shoot/explants) occurred

at the end of second subculture after 45d. The combination of TDZ and Ads

with significantly increased shoot proliferation. Elongation were performed in

GA3 (0.6mg/l) containing media.

Varalaxmi, et al, (2007) soaked black gram seed in sterilled water for

18h in dark from the imbibed seed were separated the cotyledon along with

embryonal axis was placed in such a way that the embryonal axis was in

contact with the medium MS containing b5 vitamins, and combinations of

different plant growth regulators, BAP, NAA and IAA. The plant regulator

combination tested were BAP (1, 2, 3, mg/lit) alone and in combination with

0.5mg/l NAA or with 1mg/lit IAA. One subculture done after 1wk. they were

subsequently transferred to regeneration media containing 3mg/l BAP and

maintained in light for 20days. after 20 days transfer on media containing

575mg/lit proline, 760mg/lit glutamine, 3. 0mg/l BAP, or 0.5 mg/l IBA was

tested in MS1/2 strength MS+B5 regeneration medium for assessing their

effect on shoot development. Cotyledonary node of Vigna mungo by culturing

them on low concentration of (1, 2, 3 mg/L BAP ) followed by transfer to

hormone free MS medium. After 10 days transfer on medium containing 1.0

mg/L BAP gave higher number of shoots (9.33/explant) compared to culture of

the explants on hormone free medium for 15 days followed by transfer to

medium containing 1.0 mg/L BAP (8.33/explants). (Mony et al., 2010).

Muhammad, et al., (2008) Five-day-old in vitro grown seedlings of

cowpea was obtained in MS supplemented with 0.50 mg/l BAP - 0, 0.10, 0.30

41

and 0.50 mg/l NAA. The highest frequency (%) of shoot regeneration and

mean number of shoots per explant was recorded on MS medium containing

0.5 mg/l BAP without NAA. Addition of any concentration of NAA resulted in

significant decrease in the frequency shoot regeneration and mean number of

shoots per explant. Maximum mean number of 2.60 shoots per explant was

obtained on MS without NAA

Andres and Gatica, (2010) achieved regeneration done in common bean

(Phaseolus vulgaris) by using N6-benzylaminopurine(BAP) and adenine

sulphate (AS) was established. Embryogenic axes of the common bean were

cultured on MS Medium supplemented with BAP (0, 5 and 10 mg/L), AS (0,

20 and 40 100, mg/L). Regardless of the concentration of BAP and AS in the

induction medium, the higher average of shoots was obtained. , the induction

medium supplemented with 5 mg/L BAP and 20 or 40 mg/L AS resulted in the

higher average of shoots formation.

Yadavetal et al. (2010) reported yielding up to 27 shoot using double

cotyledonary node explants of cultivar ML 267 of green gram. The explants

were derived from 3 days �old seedling germinated on MS and B5 media

containing (2.0 mg/L- BAP). They were initially culture on MS B5 media

augmented with different concentration of BAP and very low concentration of

different auxins (NAA, IAA, &IBA) and cytokinin for shoot bud induction. the

explants showing multiple shoot bud initial were transferred to MS, B5 media

containing reduced concentrations of BAP for shoot proliferation. Among the

different auxins and cytokinins tested, best regeneration response.

Firoz Anwar et al. (2011) reported regeneration system for Vicia faba

(L), using single cotyledon explants with half embryonal axis. MS medium

42

supplemented with 6 µM TDZ (thidiazuron), 10 µM 2-iP and 4 µM kinetin

induced 30 to 50 adventitious buds /shoots after two weeks of culture, which

were elongated on MS medium supplemented with 6 µM 2-iP and 2 µM

kinetin. With healthy and strong roots established on MS medium

supplemented with 5 µM IBA within 10 to 14 days.. TDZ promoted

adventitious bud formation while 5 µM IBA was most suitable for rooting,

higher concentrations were toxic to plantlets.

Sumita Acharjee et al. (2012) regenerated blackgram (Vigna mungo)

using Thidiazuron (TDZ) in the culture medium. The explanted cotyledon with

wounded embryonic axes produced the highest number (9.75-10.45) of healthy,

elongated shoots when cultured on shoot bud regeneration medium (SRI)

composed of 2 µM BAP, 2 µM KIN, 2 µM TDZ, and 0.5 µM NAA followed

by multiple shoot regeneration (SRII) medium containing 2 µM BAP, 2 µM

KIN, and multiple shoot elongation (SE) medium (0.5 µM of BAP + 0.5M of

KIN). The presence of TDZ in combination with BAP and NAA in the SRI

medium for one sub-culture cycle (10 - 14 days) significantly increases

formation of multiple shoot buds per explant. Independent, healthy shoots

obtained were selected for both in vitro rooting and grafting. Establishment of

plantlets in the soil was highest (80 - 100%) in the case of in vitro rooted

compared to grafted shoots (40%).

2.8.3 Somatic embryogenesis

Somatic embryogenesis, the production of bipolar embryo structures

from somatic cells, other than zygote, is of considerable theoretical and

practical importance. The information regarding direct or indirect plant

regeneration via somatic embryogenesis may be useful for production of

43

somaclonal variants, clonal multiplication and genetic transformation studies

(Hartweek, et al., 1988)

The role of ABA in somatic embryo development has been well

documented ABA was found to be essential for the maturation process because

it increased fatty acid content (Feirer, et al., 1989) or because it induced

specific protein synthesis (Hatzopoulos, et al.,, 1990) favoring somatic embryo

maturation. ABA has been shown to significantly increase the frequency of the

induction of torpedo-shaped embryos and their maturation

Produced a large number of globular, heart-shaped, and torpedo shaped

embryos in the medium containing 0.25mg/L 2, 4- D and 20mg/l L-glutamine.

Increased concentrations of 2, 4-D resulted in a decline in the frequency of

embryogenesis. The presence of 2, 4-D in the initial callus forming medium has

been shown to be essential for the induction of somatic embryogenesis in V.

acontifolia, V. mungo, and V. radiata as well as other legumes (Anbazhagan

and Ganapathi, 1999). Subsequently, V. mungo callus developed somatic

embryos in suspension culture with a reduced level of 2, 4- D to permit further

development (Sankara Rao. 1996)

Eapen and George (1990) reported the induction of somatic embryos

from immature cotyledon-derived call us of V. mungo on L6 liquid medium

with picloram, GA3, casein hydrolysate, and sorbitol with a cytokinin.

However, Eapen and George (1990) were not able to induce the development

of embryos past the torpedo stage (Patel, et al., 1991) reported that

benzyladenine was essential for the induction of somatic embryos from leaf-

derived callus of V. mungo cultured on MS medium.

44

In vitro somatic embryogenesis from cell suspension cultures of

cowpea (Vigna unguiculata (L) Walp). Torpedo-shaped embryos began to

mature to cotyledonary stage within 7 d of transfer into MS liquid medium

containing 0.5mg/L (ABA). Mature cotyledonary stage embryos are capable of

converting into complete plantlets. At the end of the maturation treatment, most

embryos changed colour from deep yellow to dull white and are

physiologically mature with the initiation of root and shoot primordia. Similar

results were observed in cowpea by (Ramakrishnan, et al., 2005).

The somatic embryogenesis by using liquid shake culture of

embryogenic calluses was achieved in black gram by Muruganantham et al.

(2010).The production of embryogenic callus was induced by seeding primary

leaf explants of V. mungo onto (MS) medium supplemented (optimally) with

1.5mg/l 2, 4-dichlorophenoxyacetic acid. The embryogenic callus was then

transferred to liquid MS medium supplemented (optimally) with 0.25mg/l 2, 4-

dichloro phenoxyacetic acid. Globular, heart-shaped, and torpedo-shaped

embryos developed in liquid culture. The optimal carbohydrate source for

production of somatic embryos was 3% sucrose (compared to glucose, fructose,

and maltose). L-Glutamine (20 mg/l) stimulated the production of all somatic

embryo stages significantly. Torpedo-shaped embryos were transferred to MS

liquid medium containing 0.5mg/l abscisic acid to induce the maturation of

cotyledonary-stage embryos. Cotyledonary-stage embryos were transferred to

1/2-MS semi-solid basal medium for embryo conversion. Approximately 1�

1.5% of the embryos developed into plants.

Sivakumar, (2010) optimized somatic embryogenesis was processes in

Urad beans [Vigna radiata (L.) Wilczek cv.Vamban]. Primary leaf explants

were used for embryogenic callus induction in MS medium with B5 vitamins)

45

containing 2.0 mg/L 2, 4-dichlorophenoxyacetic acid (2, 4-D), 150 mg/L

glutamine and 3 % sucrose. Fast growing, highly embryogenic cell suspensions

were established from 21-d-old callus in MS medium supplemented with 0. 5

mg/L 2, 4-D and 50 mg/L proline (Pro), and maximum recovery of globular

(39.0 %), heart-shaped (26. 3 %) and torpedo-stage (21.0 %) somatic embryos

were observed in this medium. Mature cotyledonary-stage somatic embryos

were cultured for 5 d in half strength B5 liquid medium containing 0.05mg/L 2,

4-D, 20mg/L Pro, 5ìM abscisic acid, 1000mg/L KNO3, 50mg/L polyethylene

glycol (PEG 6000) and 30 g/L D- mannitol. Mature somatic embryos were

germinated after dessication for 3 d and complete development of plantlets

accomplished in MS medium containing 30 g dm-3 maltose, 0.5 mg dm-3

benzyladenine and 500 mg dm-3 KNO3.

2.8.4 Rhizogenesis

Along with percentage response of shoots for rooting, quality and

number of roots produced per shoot is also important, which is determined by

the type and concentration of auxins, Bassiri, et al., (1985) reported that only

IBA 1. 0 mg/L produced 10 roots per explants sometimes auxin- auxin

combination.

Altaf and Ahmad, 1986 (0. 5 ìMBA + 1-10ìM NAA) Mallikarjuna, et

al., 1993 (1/10 B5 medium + 2 mg L-1 IAA + 0.5 mg/l NAA) Vani and Reddy,

1996 (B5+IAA (4mg/l) + KIN (0.5mg/l); Chakrabarty, et al., 2000 (MS salts +

B5 vitamins + 3 sucrose + 5.0mg/l IAA + 0.5mg/l KIN; Reddy, et al., 2001 (B5

medium 2 mg/l IAA + 2mg/l BAP).) used Auxins (IAA, IBA, NAA) and

cytokinins (kinetin and BAP) for rooting inducers in chickpea. For root

induction, IBA has been most frequently used by many workers at various

concentrations.

46

Barna and Wakhlu, 1994 (1ìM/L), Sharma and Amla, 1998 (2ìM/l),

Arachiasamy, 2000 (2.46ìM and 4.92ìM/l, and Jayanand et al, 2003 (5ìM/L)

and Rizvi, et al., 2000 (2.5ìM/l). IBA proved the above combination of auxins

and cytokinins to be the best rooting factor which induced high percentage of

rooting (71.5%) in chickpea.

The best medium was WH supplemented with 2.5ìM IBA. A novel

rooting system was developed by Jayanand, et al. (2003) by placing the

elongated shoots on a filter bridge immersed in MS liquid medium

supplemented with 5ìM IBA which resulted in rooting frequency of up to 90

per cent.

Next to IBA, NAA is the frequently used auxin. Better rooting

response was reported when the media was supplemented with 2.5ìM NAA

(Malik and Saxena, 1992). It was found that excised shoots were difficult to

root if exposed to TDZ for a period longer than 2-3 weeks. So also is the case

when TDZ was used at 5ìM or higher concentration where it suppressed the

primary roots and as well as secondary roots. Similar trend was observed by

Polisetty et al.(1997) when BA was used at higher concentrations (Briggs et

al., 1988). To induce rooting different concentrations of NAA was tested by

Surya-Parkash et al.(1992). Frequency of root differentiation declined when

NAA was deleted from the medium. They also highlighted the importance of

quality of shoots cultured on RIM (root induction medium) to get normal

rooting. Increased concentration of agar-agar (1.2%) and inclusion of activated

charcoal (0.2%) improved the degree and percentage of root differentiation.

Similarly other workers Adkins, et al.,1995 (half MS salts and B5

vitamins + 2 mg/l NAA + 0.5 g activated charcoal), Murthy, et al., 1996, (MS

47

+ 2. 5 f M NAA), Rao et al., 1997 (½ MS + 1 mg/L NAA), Altinkut, et al.,

1997 (1 mg/l NAA), Ramana and Sadanandam, 1997 (1 mg/l NAA),

Senthil, et al., 2004 (2. 5mM/L NAA) used NAA at different levels to induce

rooting. Few workers reported that the rooting response is also dependent on

the genetic background of explant. Brandt and Hess (1994) observed

differential response for rooting in desi and kabuli cultivars. The highest rate of

rooting shoots (71. 5%) in case of A-1 and 68. 3 per cent in ICCV-2 with

simultaneous good shoot growth was obtained on WH medium supplemented

with 2.5ìM IBA.

Similarly IAA was used by Subhadra et al. (1998) and Batra et al.

(2002) at the concentration of 1 mg/L. The rooting response is also dependent

on the nature of media. Significant differences were noticed between liquid and

solid rooting medium supplemented with NAA, with average rooting of 16.5

per cent and 84.7 per cent in solid and liquid medium respectively Chaturvedi

and Chand, (2001) obtained 50 per cent rooting with 0.8 mg/l NAA in solid

medium and 70 per cent with 1.2 mg/l NAA and 0.04 mg/l IBA. The induced

roots were thicker and longer in liquid medium than in solid medium.

Proliferation of roots was observed only when transferred to liquid plain ½ MS

after the root induction (Kar, et al., 1996). Similarly, Polisetty, et al., (1997)

subcultured plant lets on ¼ th strength MS medium without agar to get good

root growth. Quality of roots can be improved by increasing the agar-agar

concentration in the medium and also helps the normal growth of the plantlets

by reducing the degree of vitrification.

Shoots were rooted in half strength MS under partial dark conditions

(Batra, et al., 2002). Some workers used ¼th strength of MS medium (Singh, et

al., 2002), ½ strength MS medium (Sharma and Amla, 1998) and ½ strength

48

B5 medium (Ramana and Sadanandam, 1997) for root induction. Whereas,

Malik and Saxena, (1992) did not find any difference between media that

contained half or full strength of MS salts for rooting. Singh B. D. (2007) also

highlighted that exogenous carbon source was not needed.

Rooting and transplantation of chickpea is now no more a hurdle for

chickpea transformation. Healthy and strong rooting was achieved by exposing

cut ends of the in vitro raised shoots (3-5 cm) to 5-10 sec pulse treatment with

100 ì moles/ml IBA followed by their transfer to liquid MS basal medium.

Potting-mixture with good aeration and les ser capacity to retain water was

most suitable for successful establishment of plantlets. Garden soil mixed with

sand and bio-manure in equal proportion was most suitable for achieving cent

percent transplantation success. Cent percent of plantlets acclimatized in pots

and showed normal growth, development, flowering, pods and seeds setting. In

this communication, we have shown that shoot length, pulse treatment of cut

ends of shoots with 100 moles /ml IBA (1st report) and aeration of potting

mixture are key factors for rapid micro-propagation and successful

establishment of in vitro raised chickpea plantlets.

Muhammad, et al., 2008 five-day-old in vitro grown seedlings of

cowpea was obtained in MS supplemented with 0.50 mg/l BAP - 0, 0.10, 0.30

and 0.50 mg/l NAA. Regenerated shoots were rooted on MS containing 0.50

mg/l IBA where up to seven adventitous secondary shoots arose from the base

of mother shoot were also recorded. These shoots could also be rooted easily

on the same rooting medium. Rooted plants were adapted at room temperature

in soil mix in pots. All plants flowered and set seeds in the growth room after

three months.

49

In black gram shoot buds elongated on one-third-strength MS (MS1/3)

semisolid medium and plantlets were obtained by transferring the shoots onto

ms1/3 semisolid medium supplemented with indolebutyric acid (1 mg/L, 4.

9mM) for rooting Das( 2002). The rooting development in black gram

observed in half MS medium with NAA, IAA, IBA (-mg/L). (Muruganantham,

2004), The high frequency (100. 0%) of rooting was observed with MS

medium supplemented with 0. 5 mg l-1 IBA. Mony, et al., (2010)

2.8.5 Hardening and Establishment of regenerated plants

Ultimately regenerated plants were establishment in soil. It is

recommended that removal of sugar from the support medium, pre-

conditioning to low relative humidity, high light intensity and high temperature

can ensure higher survival during transfer of plantlets to natural conditions. The

gradual removal of sugar is known to stimulate photosynthetic ability. Neelam,

et al., (1986) used autoclaved soil: sand: compost (1:1:1) mixture, as potting

mixture. Obtained only 30-40 per cent survivability. The mortality was due to

soft, weak stems and roots without good differentiation of vessels and due to

inability to pick the nutrients from soil when transferred from agar medium.

Among the different potting mixtures used, pure vermiculite was the best and

supported the survival of 85.4 per cent plants. Only 20.4 per cent plants

survived when transferred to the vermiculite and perlite (1:1) mixture whereas

the plants transferred to the sand, soil and sawdust mixture (1:1:1) did not

survive (Barna and Wakhlu, 1994).

Surya- Parkash et al., 1992 made attempts to transfer rooted plantlets

to sterilized pots containing soil, sand and vermiculite in 1:1:1 ratio. However,

no success was achieved. Soil rite was used as inert supporting powder. Kumar,

et al., (1994) obtained matured plantlets by adding soil rite to liquid ¼ strength

50

MS medium without sucrose. Polisetty, et al., (1997) irrigated potted plants

with ¼ strength Hoagland�s nutrient medium. Rooted plantlets of black gram

(ca. 5 cm) were transferred to autoclaved vermiculite in 6-cm plastic pots and

covered with a plastic cover to maintain humidity. Two weeks after transfer to

pots, the covers were gradually removed over a period of 7 days, before the

plantlets were finally transferred to soil Das, et al. (2002). Jayanand, et al.,

(2003) derived a comprehensive method for the hardening and transplantation

to glasshouse.

Among the various potting media tried such as black soil, red soil,

smooth sand, coarse sand and vermiculite individually and in combination with

each other, coarse sand showed the best results with about 80 per cent survival.

As the regenerate plantlets have to be adopted not only to soil but to higher

light intensities and lower atmospheric humidity as well, they standardized the

requirement of temperature, humidity, light intensity and photoperiod during

different stages of plant growth (Singh, 2007).

2.9 TRANSFORMATION STUDIES

2.9.1 Efficient techniques for transformation

The development of efficient transformation method is frequently not

straight forward and can take many years of painstaking research with a range of

different methods (Potrykus, 1991). Although several approaches have been tried

successfully for integrative transformation (Potrykus, 1991)only three are widely

used to introduce genes into a wide range of crop plants (Dale et al.,, 1993). These

include (i) Agrobacterium mediated gene transfer, (ii) microprojectile

bombardment with DNA or biolistics and (iii) direct DNA transfer into

isolated protoplasts. Of these techniques the first two approaches have been

more successfully used in many of crops and chickpea in specific.

51

2.9.2 Indirect method of Gene transformation (Agrobacterium mediated)

A. tumefaciens plasmid transfers only T-DNA. In principle, desired

DNA sequence can be intentionally introduced into plant genomes (Zambryski,

et al., 1983; Trieu, et al., 2000). The oncogenic T-DNA region is deleted from

Agrobacterium strain in order to prevent over production of phytohormones,

which interfere regeneration from tissue and with normal plant development.

The strain with disarmed T-DNA has only the �vir� region and is a suitable

system for plant transformation. The T-DNA transfer is mediated by products

encoded by the �vir� (virulence) region of the Ti-plasmid, which is composed

of at least six inducible operons that are activated by signal molecules, mainly

small phenolics, certain class of monosaccharides and acidic pH acts

synergistically with phenolic compounds (Riva, et al., 1998).

Induction of �vir� operons by inclusion of phenolics like

acetosyringone in the co-cultivation medium could therefore enhance T-DNA

transfer to plant cells. Addition of 50ìM acetosyringone to the bacterial re-

suspension medium as well as co-cultivation medium resulted in non-

significant increase in transformation frequency from 88 % in cultures without

acetosyringoneto 95 % with large GUS positive sector(s). Acetosyringone

enhances vir functions during transformation (Stach, et al., 1996) and has been

shown to increase transformation potential of Agrobacterium strain with

moderately virulent vir region in several plant species (Atkinson and Gardner

1991, Janssen and Gardner, 1993:Kaneyoshi, et al., 1994).

Injuries implicated with the help of hypodermic needle, enhanced the

frequency of transient GUS expression, at the regeneration and cotyledons

detachment sites of the cotyledonary nodes up to 98 %. Wounding the plant

material before co-cultivation allows better bacterial penetration into the tissue

52

facilitating the accessibility of plant cells for Agrobacterium or possibly stimulated

the production of potent �vir� gene inducers like phenolic substances such as

acetosyringone and hydroxyl acetosyringone (Stach et al.1996) and enhanced the

plant cell competence for transformation (Binns and Thomashow, 1988).

Wounding the plant material before co-cultivation has also been shown

to increase transformation frequency. Mechanical injury of the meristematic

region probably induces meristem reorganizations promoting formation of

large transgenic sectors and enhanced recovery of transformants. Pre-culture of

explants on regeneration medium prior to inoculation and co-cultivation with

Agrobacterium has been reported to enhance efficiency of transformation in

some grain legumes, e. g. Vigna unguiculata (Muthukumar, et al., 1996) and

Cajanus cajan (Geetha, et al., 1999).

These signal molecules are recognized especially by Agrobacterium to

induce �vir� gene expression and thereby activate T-DNA transfer (Zambryski,

1992). When preculture was combined with mechanical injury the results were

reversed that leads to increase in transient GUS expression up to 100 % and

specifically at the regeneration site of the cotyledonary node explants. This

may be attributed to visually more clear regeneration site on the pre-cultured

explants for mechanical injury as compared to non-pre-cultured and freshly

release of phenolics as a result of mechanical injury. High vigor of pre-cultured

explants was also found to increases the regenerability of mechanically injured

explants. It is concluded that inoculation of pre-cultured and mechanically

injured cotyledonary node explants of V. mungo for 30 min with A. tumefaciens

at a density of 108 cells cm-3 followed by co-culture on SR medium for 3 d has

been found more beneficial and resulted in the production of significant

number of transgenic plants to efficiency of 4.31 %. (Saini, et al., 2007).

53

In Agrobacteria mediated transformation many co-cultivation, culture

and micro environmental condition affected the transformation efficiency. The

length of co-cultivation period required for achieving maximum gene transfer

was found to be 2 - 3 d with no significant difference between them for

cotyledonary node explants of Vigna mungo. Further extension in co-culture

time decreased the transformation frequency resulting in bacterial overgrowth

and had detrimental effect on regeneration potential of explants. A short co-

culture period of 2 or 3 d has also been found to be optimum in other plant

species such as Antirrhinum majus (Holford, et al., 1992), Vigna unguiculata

(Muthukumar, et al., 1996), Vigna radiate (Jaiwal, et al., 2001), Cajanus cajan

(Mohan and Krishnamurthy, 2003), Glycine max (Li ,et al., 2004) and

Nicotiana tabacum (Uranbey, et al., 2005).

The modification in the co-cultivation media for avoiding necrosis

which occurring during incubation for 72 h, due to the Agrobacterium over

infection to plant and hypersensitivity reaction given by the plant against to

Agrobacterium for this modifying LPGM medium with acetosyringone, sodium

thiosulphate, L-cysteine and di-thiothreitol and incubated at 25°C±20C in the

dark given in chickpea genetic transformation with Agrobacterium mediated

protocol. (S. Ignacimuthu and Prakas, 2006)

The improvement in black gram for salt stress tolerance through

Agrobacterium mediated genetic transformation was done by the over-

expression of the Glyoxalase 1 (Gly 1) gene. (Muruganantham, et al., 2007)

reported the herbicide tolerant (Vigna mungo L. Hepper) plants were produced

using cotyledonary-node and shoot-tip explants from seedlings. In vitro

selection was performed with phosphinothricin as the selection agent. Explants

were inoculated with Agrobacterium tumefaciens strain LBA4404 (harboring

54

the binary vector pME 524 carrying the nptII, bar, and uidA genes) in the

presence of acetosyringone. Shoot regeneration occurred for 6 wk on

regeneration medium (MS medium with 4.44ìM benzyl adenine, 0.91ìM

thidiazuron, and 81.43ìM adenine sulfate). Transgenic black gram plants were

produced at a 1% transformation. Frequency using kanamycin (75 mg/l) from

cotyledonary-node explants (Saini and Jaiwal, 2003), where chimeras (79%)

were observed as a result of a high level of antibiotic tolerance in the explants.

More than 50% of the putatively transformed mungbean shoots growing in

kanamycin-containing media were escapees after co-cultivation of

cotyledonary-node explants (Jaiwal, et al., 2001). PPT (10 mg/l) proved to be

more efficient than kanamycin for rapid selection, production, and

identification of putative pea transformants.

The potential of genetic engineering to incorporate insect resistance

cholesterol oxidase gene (choM) into mung bean plants through Plasmid

pCAMBIA 1301-choA was transformed into Agrobacterium rhizogenes strain

K599 and A. tumefaciens strain EHA 105 for mungbean transformation. The

two-day-old cotyledons that were co-cultured with hairy root bacteria showed

higher ability to produce branched roots than the others. An average of 10

branched roots was formed on both the wounded axial site and the hypocotyl

cut end. Ten of 75 individual lines (13.25%) showed GUS positive. In addition,

cotyledons that were cut and cultured on MB medium supplemented with

2mg/L BAP for 4 days before co-culture with A. tumefaciens using hairy root

method revealed high transformation ability (31.25%) discovered by(Potjamarn

suraninpong, et al., 2004).

Sita Mahalakshmi, et al.(2006) was reported Transgenic mungbean

plants were developed via primary leaf explants with disarmed Agrobacterium

55

tumefaciens strain C-58 harbouring a binary plasmid, pCAMBIA� 1301

(containing genes for b-glucuronidase (GUS) and hygromycin

phosphotransferase (hpt)]. By using of primary leaf explants (cut at the node)

from four-day old and ten-day-old seedlings.

Jaiwal.,2007 first time reported the normal and fertile transgenic plants

of mungbean with two transgenes, bar and á-amylase inhibitor, Cotyledonary

node explants were transformed by co-cultivation with Agrobacterium

tumefaciens strain EHA105 harboring a binary vector pKSB that carried

bialaphos resistance (bar) gene and Phaseolus vulgaris á-amylase inhibitor-1

(áAI-1) gene. Green transformed shoots were regenerated and rooted on

medium containing phosphinothricin (PPT).

Islam and Islam (2010) used two different types of explants, namely

cotyledonary leaf and cotyledon attached with embryonic axis (CAEA) were

used in different experiments. CAEA and cotyledonary leaf explants were

infected with A.tumefaciens strain LBA4404 harboring the binary plasmid

pBI121 containing gusA and Neomycin phosphotransferase (nptII) marker

genes to determine theirtransformation ability. Between two explants, CAEA

showed better response towards transformation than the cotyledonary leaf.

Maximum transformation of CAEA explants was obtained following 45 min of

infection with Agrobacterium suspension having an OD of 1.3 at 600 nm and

72 hours of co-cultivation as judged by transient GUS assays.

Sushil Kumar Yadav et al. (2012) reported highly efficient protocol for

genetic transformation mediated by Agrobacterium has been established for

green gram (Vigna radiata L. Wilczek). Double cotyledonary node (DCN)

explants were inoculated with Agrobacterium tumefaciens strain LBA 4404

56

harbouring a binary vector pCAMBIA 2301 containing neomycin

phosphotransferase (npt II) gene as selectable marker, ß-glucuronidase (GUS)

as a reporter (uidA) gene and annexin 1bj gene. Important parameters like

optical density of Agrobacterium culture, culture quantity, infection medium,

Infection and co-cultivation time and acetosyringone concentration were

standardized to optimize the transformation frequency. Kanamycin at a

concentration of 100 mg/l was used to select transformed cells. Transient and

stable GUS expressions were studied in transformed explants and regenerated

putative plants, respectively. Transformed shoot were produced on regeneration

medium containing 100 mg/l kanamycin and 250 mg/l cefotaxime and rooted

on ½ MS medium. Transient and constitutive GUS expression was observed in

DCN explants and different tissues of T0and T1 plants.

Yellisetty Varalaxmi et al.(2013) used Agrobacterium tumefaciens

strain LBA4404 harbouring binary vector pCAMBIA 2301, which contains a

neomycin phosphotransferase gene (nptII) and a -glucuronidase (GUS) gene

(uid A) for transformation of Vigna mungo cotyledon derived calli. Wounding

of explants before infection, osmotic effects of infection and co-cultivation

media had an effect on the competence of the tissue as well as transforming

ability of Agrobacterium cells. Transient GUS expression studies revealed

that a cell.

Density of 108cells/ml, 100 µM acetosyringone and 330 µM cysteine

were effective in increasing the transformation frequency and obtaining stable

transformants with a3.8% transformation efficiency. IBA pulse treatment was

effective in root induction of kanamycin selected putative transformants.

Molecular analysis using polymerase chain reaction (PCR) of nptII gene

confirmed the transgenic nature of T0 transformants.

57

2.9.3 Direct DNA transfer

Physical as well as chemical methods have been developed to facilitate

DNA delivery across the plasma membrane, which lead to both stable and

transient gene expression. The first report on direct delivery of DNA molecules

into plant protoplasts was documented by Davey, et al. (2009). However, in

Blackgram there are no reports on direct DNA transformation.

Microinjection, sonication, electroporation and biolistic mediated transfer are the

main procedures to let desired DNA molecules enter any living cell; plant, animal,

or microbial. Microinjection involves immobilization of protoplasts and micro

injecting DNA directly into the nucleus. Miki, et al. (1987) reported

transformation efficiencies of 12-66 per cent in tobacco. In the sonication process,

ultra sound waves are used to facilitate uptake of nucleic acids into plant cells and

protoplasts. Joersbo and Brunstedt (1992) used mild sonication (20 KHz) to

facilitate uptake of chloramphenicol transferase (cat gene) in tobacco and achieved

a maximum of 81per cent transient expression with no significant loss of viability.

The electroporation method was originally developed to introduce

DNA in prokaryotic cell (Fromm et al., 1985). This has been successfully

used for transformation of wide range of crop species including pigeonpea

(Christou et al., 1987)

2.9.4 Microprojectile bombardment with DNA or biolistic

Acceleration of heavy microprojectile (0.5-5.0 µ m diameter

tungsten or gold particles) coated with DNA has been developed into a

technique that carries genes into virtually every type of cell and tissue

(Klein, et al., 1988; Sanford, et al.,1990; Taylor and Vasil, 1991). This

method allows the transport of genes into many cells at nearly any desired

58

position in a plant. The technology basically involves loading tiny

tungsten or gold particles with vector DNA and then spreading the

particles on the surface of a mobile plate.

Then, under a partial vacuum, the microprojectile is fired

against a retaining plate or mesh by a shock wave caused by helium

under pressure achieving speeds of one to several hundred meters per

second. The particles are capable of penetrating several layers of cells and

allow the transformation of cells within tissue explants (Register, et al.,

1994). This technique, although not as efficient as the Agrobacterium-

mediated gene transfer, has a distinct advantage in that virtually any type

of meristematic totipotent cells, tissues, organs and monocots that are not readily

amenable to agro-infection can be used with a reasonable success rate. Another

major advantage lies in its application in transient gene expression studies in

differentiated tissues (Fitch et al., 1990).

2.9.5 Selectable markers

The genetic transformation of plants requires �marker� genes

that allow the recognition of the transformed cells in the background of

untransformed ones. These genes are dominant, usually of microbial origin

and placed under the control of strong, constitutive, eukaryotic promoters,

often of viral origin (Birch, 1997). The most popular selectable marker

genes used in plant transformation vectors include constructs providing

resistance to antibiotics such as kanamycin and hygromycin and genes that

allow growth in the presence of herbicides such as phosphinothricin,

glyphosate, bialaphos and several other chemicals. For successful

selection, the target plant cells must be susceptible to relatively low

concentrations of the antibiotic or herbicide. The utility of any particular

59

gene construct as a transformation marker varies depending on the plant

species and explant involved (Li, et al., 2002).

Kanamycin has proven to be the most widely applicable selective agent but

the concentration is species specific. Species like Vigna mungo L., Cicer arietinum

(Fontana, et al.,1993; Sanyal, et al., 2003; Sarmah, et al.,2004), Kanamycin has

been used for selection in most of the chickpea transformation studies

reported (Fontana et al.,1993; Kar et al.,1996, ; Krishamurthy, et al.,2000) are

selected at low concentration of kanamycin (15-100 mg/l). However, recently

Tewari-Singh, et al., (2004) used a desensitized aspartate kinase (AK) gene as a

non-antibiotic selection marker for production of transgenic chickpea, which was

found to be a better selection marker than kanamycin as transgenic plants could be

identified more easily and rapidly using the marker.

2.14.6 Molecular and genetic characterization of transgenic plants

The integration of the target gene is confirmed by technique

�polymerase chain reaction� (PCR) routinely, which screens putative transgenic

and classify either as positive or negative (Edwards et al.,1991). Another

technique could be used to detect the presence of a given sequence of DNA or

RNA in the non-fractionated (not subjected to electrophoresis) DNA is �Dot

blot�, where sample DNA�s from several individuals can be tested in a single

test run. Dot blots are useful in detecting presence of the sequence being

transferred in a number of suspected transgenic individuals and a presence of

specific mRNA in several such individuals or in different tissues of a single

individual. Southern blotting or southern hybridization (Southern, 1975) is used

to demonstrate the presence of the gene in question in transgenics, where

detection of DNA fragments which are complementary to given DNA is critical

(Sambrook and Russell, 2001). This is the common method to confirm the

60

stable integration of DNA in the genome and also to know the number of

copies integrated. Few examples of use of the Southern blotting to know the

presence of transgene are available in chickpea (Krishnamurthy, et al.,, 2000;

Kar, et al.,, 1996; Tewari-Singh, et al.,, 2004 and Sarmah, et al.,, 2004),

pigeonpea (Geetha, et al.,, 1999; Lawrence and Koundal, 2001). The number of

copies of a transgene construct inserted is variable for all transformation

methods. Data from several different transgenic dicotyledonous species showed

an average of three T-DNA inserts, with occasionally upto 20-50 copies in

some plants. Kar, et al., (1996) noted multiple gene inserts in all transgenic

chickpea plants while, Krishnamurth, et al. (2000) and Tewari-Singh, et al.

(2004) found 50 per cent single insert and 50 per cent multiple (4-6) gene

inserts. However, single copy insertion of the target gene based on strong

signal generated by hybridization of GUS and npt II specific homologous

probes was reported by (Sarmah, et al., 2004; Sanyal, et al., 2003).

The expression of transgenes can vary considerably between different

independently transformed plants (Hobbs, et al.,1990; Jefferson, et al., 1990;

Blundy, et al., 1991). In some instances there is a positive association between

transgene expression and copy number, but other studies have shown no

association or even a negative one (Hobbs, et al.,, 1990).

Transgene expression many a times be unstable or may decline over

generations. Several techniques have been used for detection of expression of inserted

gene such as northern hybridization, immunoblotting and western blotting

(Sambrook, et al.,1989; Saghai-Mahroof, et al.1984). Unlike Southern hybridization,

northern hybridization detects transcription of DNA sequence that is used as a probe.

This technique has been used to know the expression of cowpea protease inhibitor at

mRNA level in transgenic pigeon pea (Lawrence and Koundal, 2001).

61

Bhattacharya et al., (2002), used Southern confirmed plants for northern

blotting of Bt (cry IA(b)) transformants in cabbage and reported differences in the

level of transgene expression. Western blotting is used to detect proteins of a

particular specificity. When a transferred gene expresses in transformed cells, the

translated product in from of protein can be identified by this technique. Sarmah, et

al., (2004) analyzed PCR positive transgenic lines through western blotting and

compared with bean seed protein. The chickpea a-AII polypeptides detected by

western blotting had similar size to those found in bean seeds. This indicated that

the primary translation product, which is proteolytically processed in bean seeds,

was similarly processed in chickpea seeds. They also used this assay to estimate the

level of a-A II in the T1 seeds of transgenic lines.

The immunoblotting technique is based on antigen-antibody reaction. In

this method total protein from plants is fractioned on SDS-PAGE (10% polyacryl

amide) and transferred to PVDF and detected by antiserum of specific antigen.

Bhattacharya et al., (2002) detected Bt cry1Ab proteins using the rabbit anti cry

IA(b) serum and a goat antirabbit IgG coupled to alkaline phosphtase as secondary

antibody. They could detect 81.3 kDa cry protein through this method which was

further tested to know viability of second instar larvae of Plutella xylostella. They

observed high reduction in growth rate and mortality. Sarmah, et al., (2004) used

this technique to confirm the expression of the bean a- amylase inhibitor gene

against Callesobruchus maculatus in putative transgenic chickpea.

Sanyal et al., (2005) reported the expression of Cry1Ac in chickpea by

elisa method and he observed that there was variation in protein content in all

transgenic plants and it is because of site of its integration and number of

copies integrated into plants. There could be several reasons for non-expression

62

or low expression of the transgene in transgenic plants (Finnegan and

Mc Elroy, 1994; Matzke and Matzke, 1995).

These include pleiotropic effects from transgenes, somaclonal

variations in the regenerated transgenic plants or environmental effects on the

promoters driving the transgenes (Senthil et al., 2004)reported partial

suppression of Uid gene due to presence of two inserts in a tandem array which

tend to become inactivated as result of gene silencing. Although the CaMV35S

promoter is considered constitutive, its level of expression is found to change

with respect of cell cycle or the various tissues (Nagata et al., 1987).

Molecular characterization on the expression of Cry1Ac gene in chickpea

plants was carried out by Indurkar, et al. (2007) and reported the level of protein

expression in transgenic plants showing variation found 6-20 ng/ mg. The practical

way of avoiding problems associated with variation in transgene expression and

stability and somaclonal variation is to produce a large number of independently

transformed plants (often>100) and to select those with a desirable phenotype

(Birch, 1997). Except for vegetatively propagated crop plants, it is usually desirable

to identify genotypes 1with single inserts of the transgene construct which will have

simpler inheritance patterns and are likely to have more predictable transgene

expression levels in subsequent segregating populations. Following initial analysis,

the transgenic plants need to be moved into a containment glasshouse for further

phenotypic and genotypic analysis using the original non-transgenic genotype as a

control. Further evaluation of transgenic plants is done under agronomic conditions

by carrying out field assessment studies.

63

MATERIALS AND METHODS

The present work was carried out on �Studies on genetic

transformation of black gram (Vigna mungo L.) with cold induced

transcriptome gene (ICE- 1) for abiotic stress tolerance� during 2011-2013 at

the Department of Agricultural Biotechnology, College of Agriculture, Orissa

University of Agriculture and Technology, Bhubaneswar-751003 (Odisha).

The details of materials used and the experimental techniques adopted during

the entire course of investigation are presented in this chapter.

3.1 MATERIALS

3.1.1 Genotypes

The cultivar used in the present investigation is Type-9�(T-9) which is

released from Agriculture University, Kanpur. It is popular, high yielding

(8q/ha) and suitable for different agro- climatic situations of entire Orissa as

well as throughout India. The seeds of these varieties were collected from State

Seed Corporation, Odisha.

3.1.2 Explant source

Different types of explants from four days old sterile seedlings of cultivars

�T-9� were used for in vitro regeneration and transformation studies. The explants

used were Cotyledonary node and Cotyledonary node with Shoot tip.

3.1.3 Plant nutrient medium

For in vitro culture experiments Murashige and Skoog (1962) basal

salts were used (Appendix-I).


64

3.1.4 Plant growth regulators

The following different plant growth regulators at different

concentrations in different experiments (Appendix-III) were used.

Auxins

Indole Butyric Acid (IBA)

Naphthalene Acetic Acid (NAA)

Cytokinins

Benzylamino purine (BAP)

Thidiazuron (TDZ)

Kinetin (Kn)

Gibberellin

Gibberllic acid (GA3)

3.1.5 Agrobacterium strain and plasmid vector

The disarmed Agrobacterium strain EHA105 harboring binary vector

pCAMBIA2301 was used for in vitro transformation. pCAMBIA2301 contains

ICE1 gene, nptII marker and GUS reporter gene linked to CaMV35S promoter

and nos terminator.

3.2 METHODOLOGY

3.2.1 Sterilization of Glassware and Media

Sterilization refers to any process that effectively kills or eliminates

transmissible agents (such as fungi, bacteria, viruses, spore forms, etc.) from a

working surface, equipment, article of food or medication, or biological culture

medium. Sterilization can be achieved through application of heat, chemicals,

irradiation, high pressure or filtration.

65

Plate . 2 Explant source of regeneration and transformation A. Seeds of black gram cultivar �T-9� B. sterile explants culture of 4 days C. Shoot tip with Cotyledonary node D. shoot tip

66

Fig -3 Schematic map of vector pCAMBIA2301

Fig- 4 Linear map of T-DNA region of vector pCAMBIA2301

67

3.2.2 Steam sterilization

A widely-used method for heat sterilization is the autoclave.

Autoclaves commonly use steam heated to 121°C or 134°C. To achieve

sterility, a holding time of at least 15 minutes at 121°C or 3 minutes at 134 °C

is required. Additional sterilizing time is usually required for liquids and

instruments packed in layers of cloth, as they may take longer to reach the

required temperature. After sterilization, autoclaved liquids must be cooled

slowly to avoid boiling over when the pressure is released.

3.2.3 Sterilization by filters

Hormones that would be damaged by heat, irradiation or chemical

sterilization can be sterilized by mechanical filtration. This method is

commonly used for sensitive pharmaceuticals and protein solutions in

biological research.

A filter with pore size 0.2 µm will effectively remove bacteria. If

viruses must also be removed, a much smaller pore size around 20 nm is

needed. Solutions filter slowly through membranes with smaller pore

diameters. Prions are not removed by filtration. The filtration equipment and

the filters themselves may be purchased as presterilized disposable units in

sealed packaging, or must be sterilized by the user, generally by autoclaving at

a temperature that does not damage the fragile filter membranes.

3.2.4 Glasswares and chemicals:

Glasswares like culture tubes, conical flasks, petriplates, beakers etc.,

are of Borosil make. All the chemicals and plant growth regulators are of

analytical grade and are procured from standard chemical manufacturing

companies.

68

3.2.5 Cleaning of glasswares

Glasswares were rinsed in water and then soaked in 0.15% chromic

acid overnight. The chromic acid were drained out and the glasswares were

washed with clean soap solution. The thoroughly washed glasswares are rinsed

in distilled water and dried in a hot air oven. The instruments like forceps,

scalpels etc., were also cleaned and dried.

3.2.6 Sterilization of glasswares:

Clean glasswares were rinsed in double distilled water and dried in

oven at 80C and sealed with aluminum foil, petriplates placed in autoclavable

covers, instruments like scalpel, forceps, and blade holders wrapped in

aluminum foil were autoclaved at 121 C and at 15 lbs. pressure for 15

minutes. The glasswares were then transferred to sterile inoculation chambers.

3.2.7 Sterilization of laminar- flow chamber:

All steps in this experiment like the sterilization, preparation,

inoculation of the explants, sub culturing were conducted under aseptic

condition in the laminar- flow cabinet. Before the laminar flow cabinet was

used, the working surface of the chamber is sterilized by swabbing with 70%

alcohol. The chamber was then exposed to UV light for 15 minutes. The walls

of the chamber were also swabbed with 70% alcohol to ensure total sterility.

Before taking the materials into cabinet, they were swabbed with 70% alcohol.

In case of glasswares, the mouth of the bottles, flasks etc. are flamed before

and after use. Also, before starting the experiment, the hands are swabbed well

with alcohol.

69

3.3 PREPARATION OF EXPLANTS

Seed were surface sterilized with 70% ethanol (v/v) for 1 minute

followed by washing twice with sterilized distilled water for 2-3 times. Seeds were

treated with 0.2% HgCl2 (w/v) solution for 3 minutes followed by thorough

washing for 4 to 5 times with sterile distilled water to remove all the traces of

HgCl2 and blot dried on sterilized filter paper. Sterilized seeds were germinated

under aseptic conditions on MS medium with 2 mg/l BAP for 4 days.

The following explants were taken from 4 day old seedlings under

sterile conditions using scalpel and blade.

Cotyledonary node

Cotyledonary node with Shoot tip

3.4. PREPARATION OF MEDIA

MS basal salts supplemented with different concentrations of different

growth regulators were used depending on the purpose of the individual

experiment. Separate stock solutions of macronutrients, micronutrients, iron

source and organic supplements (except Myoinositol) were prepared (Appendix

I). The medium was prepared by adding appropriate quantities of the stock

solutions and correct volume was made up with distilled water. Sucrose 30 g/l

and Myoinositol 100 mg/l were added freshly to the medium. The pH of the

medium was adjusted to 5.6 to 5.8 using 0.1N HCL or 0.1N NaOH. Then agar

7.5 g/l was added and dissolved by warming the medium. Then appropriate

quantities of medium were poured in test tube (150x25 mm diameter) or bottles

(300 ml capacity) before it solidify. The test tubes were then plugged with non-

absorbent cotton plugs or glass bottles with suitable caps. The media was

autoclaved at 1210C for 15 minutes and kept for solidification. Medium, where

70

thermolabile compounds had to be added, filter sterilized solutions were added

to warm (40-500c) autoclaved medium and then dispensed in pre-autoclaved

containers.

Table-5 Amount of stock solutions added to the media

Sl. no. Stock solution Strength Amount to be

added (ml)

1 Macronutrients 20X 50

2 Micronutrients 1000X 1

3 Iron source 200X 5

4 Organic supplements 1000X 1

Agar (8g/l) and Myoinositol(100mg/l) were added separately

3.5 PHYSICAL FACTORS FOR IN VITRO CULTURE

All the in vitro culture work was carried out aseptically in a laminar

airflow chamber and the plant tissue culture experiments were conducted under

defined conditions of the culture room maintained at 25±20C, uniform light

(1000 lux) was provided by fluorescent tubes over a photoperiod of 16/8 hours.

3.6 PREPARATION OF ANTIBIOTIC STOCKS

Kanamycin, cefotaxime and carbenicillin stocks of 100 mg/l were

prepared in sterile double distilled water and rifampicin stock of 100 mg/l was

prepared in DMSO. All the stocks were filter sterilized and stored at 40C for

future work (Appendix- IV).

71

3.7 STANDARDIZATION OF REGENERATION PROTOCOL

3.7.1 Callus induction

The different explants were cultured on MS medium supplemented

with different growth regulators and coconut water and incubated in culture

room for callus induction. Observations were recorded on days to callus

initiation, number of explants responding, type of callus, and color of callus,

visual callus quality and percentage of callus induction. MS medium with

different combinations of growth regulators were used for callus induction.

Response of explants to callus initiation was assessed by calculating

number of explants responded for callus initiation and expressed in percentage.

Percent callus induction ∶= No. of explants with callus initiation Total no. of explants cultured × 100

3.7.2 Multiple shoots induction

Different explants like cotyledonary node and cotyledonary node with

shoot tip were cultured on MS medium supplemented with different levels of

BAP, TDZ, IBA, and kinetin for induction of multiple shoots. Observations

were recorded on number of days for shoot induction. Shoot percentage and

number of shoots. Shoots were subcultured on different medium for elongation.

Shoot induction at the end of culture period was assessed by

calculating number of explants responded for multiple shoot induction and

expressed in percentage.

Percent shoot induction = No. of explants with multiple shoots Total no. of explants cultured X 100

72

3.7.3 Rooting and hardening

Elongated shoots were transferred to MS medium supplemented with

different concentrations of IBA and NAA for rooting. Number of shoots

producing roots and types of roots produced and rooting percentage were

recorded. Rooted shoots were transferred to pots containing soil: sand: FYM

(1:1:1) mixture for hardening. Response of regenerated shoots to rooting was

assessed by calculating number of shoots responded for rooting and expressed

in percentage.

Percent rooting induction = No. of shoots with rooting Total no. of shoots cultured X 100

3.8 TRANSFORMATION

In this study Agrobacterium mediated genetic transformation method

was tried for gene transfer in Blackgram.

3.8.1 Maintenance and growing of Agrobacterium

The Agrobacterium strain EHA105 carrying plasmid vector

pCAMBIA2301 containing ICE1 gene construct was maintained on solid LB

(Appendix-VIII) medium containing 50 mg/l kanamycin and 10mg/l

rifampicin. Sub culturing was done every fortnight in fresh medium. Single

Agrobacterium colony was taken from the plate with the help of sterilized loop

and inoculated into 100ml LB broth containing 25 mg/l kanamycin and was

incubated on shaker for 16 hrs. At room temperature and fresh culture was used

for transformation. The culture having O.D. 0.6 to 0.8 at 620 nm wavelength

was used for bacterial infection.

73

3.8.2 Co-cultivation

Cotyledonary node with shoot tip explants were taken from different

days old seedlings and co-cultivated with Agrobacterium. The overnight grown

culture of Agrobacterium was centrifuged at 6000 rpm for 5 minutes, the

supernatant was discarded and the bacterial pellet was suspended in liquid plant

growth medium (LPGM). Explants were suspended in Agrobacterium

suspension containing 100 µM acetosyringone and kept for different interval of

time on shaker at 100 rpm. Excess bacteria were blot dried and explants were

placed in petriplates lined with blotting paper soaked in LPGM (Appendix II).

Petriplates was wrapped with aluminum foil and kept for different days

intervals in culture room for co-cultivation. Then the explants were washed

with sterile distilled water and cefotaxime 500 mg/l, blot dried and inoculated

on the MS medium containing 2.0 mg/l BAP +0.05mg/l IBA+ 500mg/l

cefotaxime + 80 mg/l kanamycin medium and transformation efficiency

recorded based on observation kanamycin positive selection and GUS positive

selection.

3.8.2 GUS histochemical assay

To conform the presence of transgene, histochemical staining of the

co-cultivated explants, after washing with antibiotics, the explants were

blot dried on sterile blotting paper and analyzed. The best substrate for

localization â-glucuronidase activity in tissue and cell is 5-Bromo 4-Chloro-3

indolylglucronide (x-Gluc) that gives a blue precipitate at the site of enzymatic

activity. The product of â-glucuronidase action is not colored. The derivative

produced must undergo an oxidative dimerization to from the insoluble and

highly coloured blue dye. GUS test was carried out to analyses transient

expression of GUS reporter.

74

Protocol for GUS Histochemical Staining

The explants were washed in phosphate buffer and incubated in

phosphate buffer with 1%Triton X-100 (Appendix VII) at 37˚C for 1

hr.

Then the explants were transferred to X-Glu staining solution (1mM)

and incubated at 37˚C in incubator for 16 to 24 hr.

After incubation explants were washed with alcohol and analyzed for

GUS expression.

The GUS expression cell are detected microscopically by distinct blue

coloration, which is a result of enzymatic cleavage of 5-Bromo 4-chloro

3-indolylglucronide.

3.8.3 Cefotaxime sensitivity test

To know the minimal level of cefotaxime which would completely

eliminate the excess bacteria after co-cultivation and to find out the suitable

concentration of cefotaxime/ carbenicillin to avoid bacterial contamination, this

test was conducted at 0, 100, 200,300, 400 and 500 mg/l cefotaxime..

3.8.4 Kanamycin sensitivity test

Kanamycin sensitivity test was carried out to find out the minimum

concentration of kanamycin required to inhibit the growth of untransformed explants

in order to design the selection medium. The test was carried out by culturing the

explants on regeneration medium along with different levels of kanamycin (0, 20, 40,

60, and 80 mg/l). Putative transformants and percent of putative transformants were

calculated on the basis of kanamycin selection as fallows.

Percent putative transformants = ୭୲ୟ୪ ୬୭.୭ ୣ୶୮୪ୟ୬୲ୱ ୱ୳୰୴୧୴ୣୢ ୭୬଼ ୫/୪ ୩ୟ୬ୟ୫୷ୡ୧୬୭୲ୟ୪ ୬୭.୭ ୱ୦୭୭୲ୱ ୭ୠ୲ୟ୧୬ୣୢ ୰୭୫େ୭ିୡ୳୪୲୧୴ୟ୲ୣୢ ୣ୶୮୪ୟ୬୲ୱ X 100

75

3.9 ISOLATION OF PLASMID DNA FROM AGROBACTERIUM (ALKALILYSIS METHOD-SAMBROOK AND RUSSEL, 2001)

A single Agrobacterium colony was picked up aseptically using a

inoculation loop and was grown overnight in 50 ml LB broth containing (25

mg/l kanamycin) in sterile conical flask.

Culture of 1.5 ml was taken and centrifuged at 10,000 rpm for 10

minutes at 40C

The supernatant was discarded and cell pellet was dried.

The 200 µl ice cold suspension buffer (Appendix-IX) was added and

pellet was dissolved by vortexing.

Freshly prepared lysis buffer (Appendix- IX ) of about 200 µl was added

and kept on ice for 5 minutes.

The 200 µl of 1.5 M Potassium acetate (Appendix-IX) was added,

mixed well without vortexing and kept on ice for 10 minutes.

Then lysate was centrifuged for 15 minutes at 12,000 rpm. Supernatant

was transferred to a fresh tube.

Equal volume of phenol-chloroform was added, vortexed and

centrifuged for 10 minutes at 10,000 rpm. Aqueous upper layer was

transferred to a fresh tube.

DNA was precipitated by adding 600 µl of isopropanol and kept at -

200C for overnight.

Suspension was centrifuged at 12,000 rpm for 15 minutes and DNA

pellet was dried.

76

Pellet was washed with 1 ml of 70% ethanol and dried completely.

The pellet was dissolved in 30 µl of T10E1 buffer (Appendix- V).

RNAse (2 µl) of was added and incubated at 370C for 1 hr.

Purified sample was stored at -200C for further use.

3.10 EXTRACTION OF PLANT GENOMIC DNA (CTAB METHOD- EDWARDS ET AL., 1991)

Collected plant tissue (2g) was macerated in pestle and mortar at room

temperature without buffer for 15 sec.

Extraction buffer (0.4 ml) (Appendix-V) was added and sample was

vortexed for 5 sec. (can be kept at room temperature for more than 1 hr.).

The solution was centrifuged at 13000 rpm for 2 minutes and 300 µl of

supernatant was transferred to fresh eppendorf tube.

Supernatant was mixed with 300µl isopropanol and incubated at room

temperature for 5 minutes and centrifuged at 13,000 rpm for 2 min.

Pellet was dried and suspended in 100µl 1x T10E1 buffer.

RNAse (1 mg/ml) was added to the DNA and incubated at 37°C in water

bath for half an hour.

DNA was precipitated using 1/10th volume of 3M Sodium acetate and

ethanol and incubated overnight at 4°C

The solution was centrifuged at 13000 rpm for 2 minutes and pellet was dried.

Pellet was suspended in 50µl 1x T10E1 buffer.

3.11 POLYMERASE CHAIN REACTION

The genomic DNA of plants obtained from co-cultivated explants,

control plants and plasmid DNA (positive control) were used as template for

77

PCR confirmation of the targeted transgene with primers nptII gene.

Nucleotide sequence of specific primer nptII is as follows

Forward: 5�GAGGCTATTCGGCTATGACTG3�

Reverse: 5�ATCGGGAGCGGCATACCGTA3�

Table -6 PCR reaction mixture

Components Stock 25µl

reaction 10 reactions (µl)

Taq assay buffer 1X 2.5 25

Taq polymerase 3U 0.5 µl 5

Primer

Forward 2.5 µM 1.0µl 10

Reverse 2.5 µM 1.0µl 10

dNTPs 200µM 1.0µl 10

Template DNA 2 2.0µl 20

PCR water - 15.0 150

Table � 7 PCR conditions were as follows

Stage Temperature (00C) Duration (min) Cycles

Initial Denaturation 94 5 1

Cycle/Loop

Denaturation 94 30 sec

Annealing 52 30 sec 35

Primer extension 72 30 sec

Final extension 72 10 1

Soak 4 1

After the completion of required number of cycles of amplification the

samples were stored at 4°C in a refrigerator and the contents were loaded on

agarose gel for electrophoresis.

78

3.11.1 Separation of PCR amplified products by agarose gel electrophoresis

The PCR amplified products from each reaction (25µl) along with 5 µl

of loading dye (Bromophenol blue) (AppendixVI) were loaded on 1.2 %

agarose gel. The electrophoresis was carried out using 1X TBE buffer

(Appendix VI ) at 60 V for I hr. Molecular weight marker was run in a

separate lane. The DNA bands on the gels were visualized under UV trans-

illuminator and documented.

3.11.2 Transformation efficiency

After the PCR analysis of putative transformants the transformation

efficiency was calculated by using following formula.

= ܡ܋ܖ܍ܑ܋ܑ܍ ܖܗܑܜ܉ܕܚܗܛܖ܉ܚ܂ + ܀۱۾ ܗ.ܗܖ ܔ܉ܜܗ܂ ܗ܋ ܕܗܚ ܌܍ܖܑ܉ܜ܊ܗ ܛܜܗܗܐܛ ܗ.ܗܖ ܔ܉ܜܗ܂ ܛܜܖ܉ܔܘ ܍ܞ − ܆ ܜܖ܉ܔܘܠ܍ ܌܍ܜ܉ܞܑܜܔܝ܋

3.12 STATISTICAL METHODS

As all the studies were done in laboratory under well-defined

conditions of medium of growth, temperature and light, completely

randomized design (CBD) was employed for the experiment. The �f� test

was carried out after ANOVA and CD (p=0.5) and CV% values were

calculated. Data from different explants and different Medium

combinations obtained from similar experiments were pooled. The pooled

data were analyzed as factorial experiment.

79

Table-8 cDNA sequence (5�-3�) of ICE1 gene (2559 b)

AGAGAGATAAGCTTAAGCCAAAATTAAGCAGAAAAATGGAGAAATAGTGACGGTGAGAGAGAGAGAGATACGGTAAACGAAGCAAAGCAAAGAGAGTCACGAGAAATCTGGGGTATGTGTTCAATGATAAAGCAATTTCATGGTGGCCGAAATTGAATCCATCAAAAAAAAAGTTTCAATTTTTAAGCTCTGAGAAATGAATCTATCATTCTCTCTCTCTATCTCTATCTTCCTTTTCAGATTTCGCTTCTTCAATTCATGAAATCCTCGTGATTCTACTTTAATGCTTCTCTTTTTTTACTTTTCCAAGTCTCTGAATATTCAAAGTATATATCTTTTGTTTTCAAACTTTTGCAGAATTGTCTTCAAGCTTCCAAATTTCAGTTAAAGGTCTCAACTTTGCAGAATTTTCCTCTAAAGGTTCAGACTTTGGGGTAAAGGTGTCAACTTTGGCGATGGGTCTTGACGGAAACAATGGTGGAGGGGTTTGGTTAAACGGTGGTGGTGGAGAAAGGGAAGAGAACGAGGAAGGTTCATGGGGAAGGAATCAAGAAGATGGTTCTTCTCAGTTTAAGCCTATGCTTGAAGGTGATTGGTTTAGTAGTAACCAACCACATCCACAAGATCTTCAGATGTTACAGAATCAGCCAGATTTCAGATACTTTGGTGGTTTTCCTTTTAACCCTAATGATAATCTTCTTCTTCAACACTCTATTGATTCTTCTTCTTCTTGTTCTCCTTCTCAAGCTTTTAGTCTTGACCCTTCTCAGCAAAATCAGTTCTTGTCAACTAACAACAACAAGGGTTGTCTTCTCAATGTTCCTTCTTCTGCAAACCCTTTTGATAATGCTTTTGAGTTTGGCTCTGAATCTGGTTTTCTTAACCAAATCCATGCTCCTATTTCGATGGGGTTTGGTTCTTTGACACAATTGGGGAACAGGGATTTGAGTTCTGTTCCTGATTTCTTGTCTGCTCGGTCACTTCTTGCGCCGGAAAGCAACAACAACAACACAATGTTGTGTGGTGGTTTCACAGCTCCGTTGGAGTTGGAAGGTTTTGGTAGTCCTGCTAATGGTGGTTTTGTTGGGAACAGAGCGAAAGTTCTGAAGCCTTTAGAGGTGTTAGCATCGTCTGGTGCACAGCCTACTCTGTTCCAGAAACGTGCAGCTATGCGTCAGAGCTCTGGAAGCAAAATGGGAAATTCGGAGAGTTCGGGAATGAGGAGGTTTAGTGATGATGGAGATATGGATGAGACTGGGATTGAGGTTTCTGGGTTGAACTATGAGTCTGATGAGATAAATGAGAGCGGTAAAGCGGCTGAGAGTGTTCAGATTGGAGGAGGAGGAAAGGGTAAGAAGAAAGGTATGCCTGCTAAGAATCTGATGGCTGAGAGGAGAAGGAGGAAGAAGCTTAATGATAGGCTTTATATGCTTAGATCAGTTGTCCCCAAGATCAGCAAAGTAAACACTTACTTTGTCTCTTTTATCTCCTTAAGAGCTTGTTTACTTGTTGCTGTTATAGAGAATTGTTGTGTTGTAGCTTTGTAGGGCCTTTGTTGTTGTCAAACTTTGCATGTAGTTGCTTACTCTTTTGAGGAAGAGGCTCGTGATAGTGTTTTATGGATTTTCGATGAATTTGCAATGGATAGAGCATCAATACTTGGAGATGCAATTGATTATCTGAAGGAACTTCTACAAAGGATCAATGATCTTCACAATGAACTTGAGTCAACTCCTCCTGGATCTTTGCCTCCACTTCATCAAGCTTCCATCCGTTGACACCTACACCGCAAACTCTTTCTTGTCGGTCAAGGAAGAGTTGTGTCCCTCTTCTTTACCAAGTCCTAAAGGCCAGCAAGCTAGAGTAAGGACTATATTCTGTATAACTTTTGCTTAGACTGGAAAGAAGAAAACAAAGATTCATGTTTGAGAGTTACTCTGCTTCTTTTTCACAGGTTGAGGTTAGATTAAGGGAAGGAAGAGCAGTGAACATTCATATGTTCTGTGGTCGTAGACCGGGTCTGTTGCTCGCTACCATGAAAGCTTTGGATAATCTTGGATTGGATGTTCAGCAAGCTGTGATCAGCTGTTTTAATGGGTTGCCTTGGATGTTTTCCGCGCTGAGGTGATCTTCTACTCTCAGTTGAAAGGTTAAGGATTTGTAGAACAGTTTTAGTAGTAACATGTTTTCTTTTGTCTATCAGCAATGCCAAGAAGGACAAGAGATACTGCCTGATCAAATCAAAGCAGTGCTTTTCGATACAGCAGGGATGCTGGTATGATCTGATCTGATCCTGACTTCGAGTCCATTAAGCATCTGTTGAAGCAGAGCTAGAAGAACTAAGTCCCTTTAAATCTGCAATTTTCTTCTCAACTTTTTTTCTTATGTCATAACTTCAATCTAAGCATGTAATGCAATTGCAAATGAGAGTTGTTTTTAAATTAAGCTTTTGAGAACTTGAGGTTGTTGTTGTTGGATACATAACTTCAACCTTTTATTAGCAATGTTAACTTCCATTTATGTTTCATCTTAAAGCTATGCTCAAGAATT

80

EXPERMINTAL RESULTS

The present investigation was carried out to develop cold tolerant black

gram variety in order to meet the demand of the farmers for cultivation under

cold stress condition. Transformation of Blackgram variety �T-9� was carried

out with ICE-1 gene which is a positive regulator CBF-3. The results of present

investigations form different experiments were presented in this chapter.

4.1 IN-VITRO REGENERATION

A successful application of in vitro techniques for crop improvement

was rested upon a reproducible plant regeneration protocol. Two methods viz. a

direct and indirect regeneration method with intervening callus mediation, were

commonly employed for genetic transformation. In the present investigation,

direct regeneration method was employed for obtaining an efficient and

reproducible in vitro regeneration protocol in Black gram cv. �T-9� for genetic

transformation.

4.1.1 Effect of surface sterilants

Surface sterilants are commonly used to obtain contamination free

culture in tissue culture experiments. Concentration and duration of

treatment greatly affect the germination and survival percentage of the

seeds of black gram. In this study 0.2 % HgCl2 was used as surface

sterilants for sterilization of black gram seeds. Among the various

treatments, the best result was observed in treatment of seeds with of 0.2%

HgCl2 for a period four minutes. In this treatment 91.25 % aseptic culture

and 88.75 % survivability of explants were recorded. Increasing the exposure

time of HgCl2 treatment (more than 4 minutes) resulted into better aseptic


81

culture percentage and poor germination percentage. Increase in time of treatment

increases the percentage of ascetic culture but reduces the germination or

survival percentage of seeds. The effect of time on aseptic culture and germination

or survival percentage of seeds is presented in Table 9.

Table-9 Effect of surface sterilants on the aseptic culture and survival of explants

Treatments 0.2% HgCl2 treatment in

minutes

Aseptic culture

percentage

Death percentage

Survival / Germination percentage

T1 0 0.00 0.00 0.00

T2 1 14.00 6.75 93.00

T3 2 53.50 6.50 92.25

T4 4 91.75 10.00 88.75

T5 5 78.50 12.25 86.50

T6 8 89.75 36.50 75.50

T7 10 89.25 37.25 56.25

T8 12 83.50 36.00 20.00

C.D(p=0.05) 6.25 4.03 7.52

C.V% 6.52 14.39 7.67

4.1.2 Indirect regeneration

Callus refers to the actively unorganized mass of cell induced in culture.

Generally, a higher auxins concentration in growth medium induces callus

formation. Establishment of callus, which retains high morphogenetic potential, is a

preliminary step in tissue culture of any species. The quantity and quality of callus

produced depends on a wide variety of conditions like explants genotype, growth

regulators and light/dark incubation etc. For induction of callus from leaf and shoot

tip cotyledonary node explants were cultured on MS medium supplemented with

different concentration of 2.4.D (0.5, 1.0, 1.5, 2.0 &3.0 mg/l) in combination with

Kinetin (1mg/l), IAA (1mg/l), NAA (1mg/l) and coconut water. The influence of

different treatments presented Table-10, Fig-5 and Plate 3.

82

Table -10 Effect of Plant growth regulators (PGR) on callus induction of black gram cv. �T-9�

Treatments Media used No. of days to induce

Callus induction

(%)

Morphological observation

T1 MS 0 0 No callus proliferation

T2 MS+ 0.5 mg/l 2.4. D 14.25 31.25 Light green, loses

T3 MS+1.0 mg/l 2.4. D 15.00 50.00 Watery, light green

T4 MS+ 1.5 mg/l 2.4. D 16.25 53.75 Light green, soft

T5 MS+ 2.0 mg/l 2.4. D 16.75 57.5 Greenish white, watery

T6 MS+ 3.0 mg/l 2.4. D 12.5 63.75 compact whitish calli

T7 MS+3.0 mg/l 2.4. D +1mg/l Kn 12.00 87.25

Whitish green , friable

T8 MS+ 2.0 mg/l BAP+ 0.5mg/l NAA 15.25 78.75

Brownish ,slight friable

T9 MS+ 3.0 mg/l 2.4. D+1mg/l Kn+ 0.1% Cocoanut water 14.00 61.25 Greyish ,compact

T10 MS+ 3.0 mg/l 2.4. D+1mg/l IAA+ 0.1% Cocoanut water 13.25 73.75 Brownish , hard

T11 MS+ 3.0 mg/l 2.4. D+1mg/l Kn+ 0.2% Cocoanut water 11.00 87.5

Whitish green, friable

T12 MS+ 3.0 mg/l 2.4. D+1mg/l IAA+ 0.1% Cocoanut water 16.25 28.75

Light greenish, compact

C.D(p=0.05) 2.10 3.10 C.V% 10.17 14.76

*Each treatment replicated four times. Twenty observations per replication

Out of the twelve different treatments, the medium supplemented with 3

mg/l 2.4.D along with 1mg/l Kinetin resulted highest callus induction from

87.25% explants within 12 days of incubation (Plate-3D). Callus obtained from

leaf and cotyledonary node explant cultured on MS medium supplemented with

2.4.D (3 mg/l) and kinetin (1 mg/l) were found to be loose friable whitish green

callus colour. The time taken for the callus induction is comparatively reduced

in MS medium supplemented with same concentration of Phytohormones along

with organic supplement (Cocoanut water) and callus induction were found to

83

be 87.5% response with average of 11 days to induce callus. Where in plane

MS medium callus proliferation was not observed in leaf as well as shoot tip

explant (Plate-3A). As compared to the former, the callus obtained from inter

cotyledonary node was not better in quality than leaf. Callus induction from

cotyledonary node had taken more time as compared to leaf. But Callus

obtained from the above experiments when cultured on the MS medium

supplemented with various combination of growth regulator for regeneration of

callus failed to regenerate the complete plant.

4.1.3 Induction of Multiple shoot

Both the explants (cotyledonary node and shoot tip) harvested from

four days old in-vitro raised seedlings were tested on MS medium. The

multiple shoot induction response varied with the type of phytohormone and

their combination. In the present study, MS medium supplemented with

different concentrations of BAP, Kinetin, and TDZ and in combination of IBA

was used for multiple shoot induction. Among the various treatments tested

(Table 11, Fig 6 and Plate 5) for multiple shoots induction, the medium SIM-4

(Shoot Induction Medium) supplemented with 3mg/l BAP, 0.05mg/l IBA

(including adenine sulphate (100mg/l) exhibited the best induction of multiple

shoots (Plate 5E) among thirteen treatments. This treatment resulted

development of shoots from cotyledon node in reasonable time frame of 13

days with more than 84.33% of the explants responding with average of 7.17

shoots per explant.

84

PLATE - 3 Effect of plant growth hormone on callus induction from leaf

explant A. MS (control) B. MS+ 1.5 mg/l 2.4. D C. MS+ 2.0 mg/l 2.4. D D. MS+3.0 mg/l 2.4. D +1mg/l Kn E. MS+ 3.0 mg/l 2.4. D+1mg/l Kn+ 0.2% Cocoanut water F. MS+ 3.0 mg/l 2.4. D+1mg/l IAA+ 0.1% Cocoanut water

PLATE NO. 4 Effect of plant growth hormone on callus induction from shoot tip explant

A. MS+ 1.5 mg/l 2.4. D B. MS+ 2.0 mg/l 2.4. D C. MS+3.0 mg/l 2.4. D +1mg/l Kn D. MS+ 3.0 mg/l 2.4. D+1mg/l Kn+ 0.2% Cocoanut water E. MS+ 3.0 mg/l 2.4. D+1mg/l IAA+ 0.1% Cocoanut water

85

Table-11 Effect of Plant growth regulators on shoot multiplication from of shoot tip and cotyledon node

Treatments

No.

Treatment

MS+ growth regulators(mg/l)

Shoot tip with cotyledon node Shoot tip explant No. of days to

induce No. of explants

response No. of

shoots/explant No. of days to

induce No. of explants

response No. of shoots/explant

SIM 0 MS 0.00 0.00 0.00 0.00 0.00 0.00

SIM 1 MS+1.0 BAP + 0.05 IBA 15.17 31.33 2.33 17.67 21.33 2.00

SIM 2 MS+2.0 BAP + 0.05 IBA 14.50 44.67 3.00 17.83 39.67 2.33

SIM 3 MS+3 BAP + 0.05 IBA 13.00 84.33 7.17 15.67 77.67 5.50

SIM 4 MS+6 BAP + 0.05 IBA 14.33 52.33 3.67 14.50 49.00 2.33

SIM5 MS+0.1 TDZ 13.83 59.67 4.00 14.17 46.00 2.17

SIM 6 MS+0.5 TDZ 13.33 45.00 4.00 16.83 45.00 2.67

SIM7 MS+0.1 TDZ + 0.05 IBA 15.33 80.00 5.17 14.00 74.33 3.67

SIM 8 MS+0.5 L TDZ+ 0.05 IBA 14.33 59.67 3.67 13.67 56.33 3.33

SIM 9 MS+0.5 Kinetin 12.17 48.67 3.17 15.83 45.67 3.67

SIM 10 MS+1.0 Kinetin 12.00 33.67 3.17 16.67 41.33 2.67

SIM 11 MS+0.5 Kinetin +0.05 IBA 14.17 34.00 3.33 13.33 30.33 2.83

SIM 12 MS+1.0 Kinetin +0.05 IBA 12.67 60.33 4.33 14.17 56.33 2.67

SIM 13 MS+2.0 Kinetin+0.05 IBA 14.67 56.67 2.67 15.67 48.67 3.00

C.D(p=0.05) 2.21 3.72 0.83 1.78 2.42 0.63

C.V% 12.53 13.08 12.03 10.80 6.22 18.24

*Each treatment replicated four times. Twenty observations per replications

86

Similarly, better shooting percentage was also observed in the medium SIM-7

(fortified with TDZ 0.1 mg/l and 0.05 mg/l IBA) with average shoot induction

of 80.00% with 5.17 shoots per explant (Plate 5D). In case of shoot tip explant

multiple shoots were observed after 15.67 days of incubation with 77.67%

response and 5.50 shoots per explant (Plate 5E). The treatment (with the TDZ

0.1mg/l +IBA 0.05mg/l) showed about 74.33% percentage of shoot induction

with 3.67 shoots per explant. Lowest response (15-18%) and shooting (2-3

shoots per explant) was recorded in the treatment of 1mg/l BAP and 0.05mg/l

IBA. The explant shoot tip with cotyledonary node showed better response

(84.33% response with average multiple shoots 7.17 per explant) than that of

shoot tip explant (77.67% with 5.5 shoots per explant).

4.1.4 Elongation of Multiple shoots

The number of shoots produced per explant was invariably less until

the optimum concentration 3mg/l BAP + 0.05mg/l IBA. Even though 7.17

Shoots per explant were obtained, but shoots were stunted and did respond well

while cultured on fresh media. For elongation of multiples shoots, these were

cultured on the MS medium supplemented with various combination of GA3

and adenine sulphate (100mg/l). Among different medium combination, the

better elongation of shoots was observed with MS medium fortified with

1.0 mg/l GA3 and this medium promoted the maximum elongation of shoots

(11.23 cm) within a week incubation period (Table 12, Fig 7 and Plate 6). The

MS medium supplemented with the 1.2 mg/l GA3 showed elongation about

10.42 cm (Plat 6E) and the lowest elongation (5.6 cm) was observed in MS

medium supplemented with 0.2mg/l GA3.

87

Plate - 5 Effect of the Plant growth regulators on Direct organogenesis : initiation of multiple shoots from cotyledonary node (above) and shoot tip (below) A. MS+1.0 BAP + 0.05 IBA B. MS+0.5 Kinetin +0.05 IBA C. MS+0.5 TDZ D. MS+0.1 TDZ + 0.05 IBA E. MS+3 BAP + 0.05 IBA

88

Fig. 5. Effect of Plant growth regulators (PGR) on callus induction of black gram cv.�T-9�

Fig. 6 Effect of Plant growth regulators on shoot multiplication from

of shoot tip and cotyledon node

0

20

40

60

80

100

0

5

10

15

20

T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12

Callu

s in

duct

ion

(%)

No.

of d

ays

to in

duce

Treatment

No. of days to induce Callus induction(%)

0

10

20

30

40

50

60

70

80

SIM 0 SIM 1 SIM 2 SIM 3 SIM 4 SIM5 SIM 6 SIM7 SIM 8 SIM 9 SIM 10 SIM 11 SIM 12 SIM 13

Surv

ival

(%)

Treatment

No. days to induce No. of explants response No. Of shoots/explant

0

10

20

30

40

50

60

70

80

90

SIM 0 SIM 1 SIM 2 SIM 3 SIM 4 SIM5 SIM 6 SIM7 SIM 8 SIM 9 SIM 10 SIM 11 SIM 12 SIM 13

Surv

ival

(%

)

Treatment

No. days to induce No. of explants response No. of shoots/explant

89

Table -12 Effect of Plant growth regulators on shoot elongation of multiple shoots

Treatments No.

Treatment MS+ growth

regulators(mg/l)

No. of Days to induction

No. of explants response

Length of shoots in cm

EIM 0 MS 0.00 0.00 0.00

EIM 1 MS+GA3 0.2 11.00 36.00 5.60

EIM 2 MS+GA3 0.4 12.33 55.00 9.88

EIM 3 MS+GA30.6 16.00 48.33 5.46

EIM 4 MS+GA3 0.8 12.83 55.33 8.26

EIM 5 MS+GA3 1.0 6.67 77.33 11.28

EIM 6 MS+GA3 1.2 13.33 58.00 10.42

EIM 7 MS+GA3 1.4 13.83 59.33 8.44

C.D(p=0.05) 3.41 0.89 0.75

C.V% 13.21 14.08 13.13


4.1.5 Rhizogenes of Multiple shoots

The rooting of shoots was significantly affected by auxins

concentration. The healthy in vitro raised shoots (6-11cm long) obtained from

direct regeneration method was transferred to different media such as MS

medium supplemented with various concentrations of IBA and same media

composition with NAA and agar- agar 0.5% for rhizogenes. Within 10-15

days, roots growth was observed. After 15 days, formations of healthy

secondary roots were observed. As indicated from (Table-13, Fig 8 and Plate-7),

72.5% of shoots responded for rooting in MS medium supplemented with NAA

(0.5 mg/l) with 6.2 roots per shoots (Plate 7D). About 68.9% (Plat-7E) explant

90

3ODWH�-��(IIHFW�RI�SODQW�JURZWK�UHJXODWRU�RQ�VKRRW�HORQJDWLRQ� $��06�*$3 ��PJ�O %��06�*$��PJ�O &��06�*$��PJ�O '��06�*$3 ��PJ�O (��06�*$��PJ�O )��06�*$��PJ�O

3ODWH-��(IIHFW�RI�3ODQW�JURZWK�UHJXODWRUV�RQ�URRWLQJ�RI�PXOWLSOH�VKRRWV�

A. MS+IBA 0.25 mg/l

B.MS+ IBA 0.5 mg/l

C.MS+ IBA 5 mg/l

D.MS+NAA 0.5

E.MS +NAA 0.25 mg/l

91

responded for rooting in medium NAA (0.25mg/l) which was comparatively

lower percentage response than the 0.5mg/l NAA but number of roots per

shoots are quite higher(8.40).

Table -13 Effect of Plant growth regulators on rooting of multiple shoots

Treatments No.

Treatments MS + growth regulators(mg/l)

No. of Days to

induction

No. of explants

response(%)

No. of roots/shoots

RIM 0 MS 0 0 0.00

RIM 1 MS+IBA 0.25 10 21.2 2.45

RIM 2 MS+ IBA 0.5 12 32.4 3.60

RIM 3 MS+ IBA 1 14 55.5 2.80

RIM 4 MS+ IBA 2 15 59.2 3.60

RIM 5 MS+ IBA 3 10 53.33 4.00

RIM 6 MS+ IBA 4 15 63.4 4.20

RIM 7 MS+ IBA 5 16 61.5 3.80

RIM 8 MS +NAA 0.25 12 68.9 8.40

RIM 9 MS+NAA 0.5 10 72.5 6.20

RIM 10 MS+NAA 1 13 59.2 3.80

C.D(p=0.05) 2.68 0.93 2.12

C.V% 9.63 13.56 12.25


4.1.6 Hardening of rooted plantlets

The pre- hardening was done for the rooted plantlets (about 13-15cm

height) and these plantlets were transferred in to liquid plant growth medium

(LPGM) for 48 hours so as to acclimatize them. Then, the plants were

transferred to pots containing soil: sand: FYM (1:1:1) and kept in green house

at 90% humidity. Seventy percentage of plantlets were survived and

completely established in Green house (Plate-8A &B).

92

Fig. 7 Effect of Plant growth regulators on shoot elongation of multiple shoots

Fig. 8 Effect of Plant growth regulators on rooting of multiple shoots

0

2

4

6

8

10

12

0

10

20

30

40

50

60

70

80

90

EIM 0 EIM 1 EIM 2 EIM 3 EIM 4 EIM 5 EIM 6 EIM 7

Leng

th o

f sho

ots

(cm

)

No.

of d

ays

to in

duct

ion/

No.

of e

xpla

nts

res

pons

e

Treatment

No. of Days to induction No. Of explants response Length Of shoots in cm

0

10

20

30

40

50

60

70

80

RIM 0 RIM 1 RIM 2 RIM 3 RIM 4 RIM 5 RIM 6 RIM 7 RIM 8 RIM 9 RIM 10

Surv

ival

(%

)

Treatment

No. of Days to induction No. of explants response.(%) No. Of roots/shoots

93

Plate - 8 Hardening of plantlets A. Pre-hardening of rooted plantlets B. Hardening of rooted plantlets in soil: sand: vermicompost (1:1:1)

94

4.2 Transformation studies

4.2.1 Kanamycin sensitivity test

To standardize lethal dose of kanamycin, putative transgenics explants

were cultured on MS medium containing the different concentration of

Kanamycin (20.40.60 and 80mg/l). At the 20 and 40 mg/l kanamycin explant

were not inhibited by the antibiotic and were able to grow healthy. The

treatment with 60mg/l kanamycin appear to have a slightly toxic effect over the

explant causing loss of chlorophyll, but the explants were able to overcome this

toxicity in later stages. Kanamycin at 80mg/l had a deleterious effect. (Plate-9E).

The plant become albino at the higher concentration of the kanamycin and caused

immediate death of the explant as shown in the Table- 14

Therefore in the present transformation studies, 80 mg/l kanamycin

was used as a selection agent. The co-cultivated explants that grew uninhibited

on this concentration of kanamycin considered a putative transformants.

Table -14 Detection of lethal concentration of Kanamycin for selection medium

Treatments Kanamycin (mg/l)

No. of explants

inoculated

Explant survival after 20

day

Percentage of survival

Appearance of explant

T1 0 20 19.66 98.00 Dark green

T2 20 20 12.00 60.00 Dark green

T3 40 20 7.33 36.65 Pale green

T4 60 20 2.66 13.33 Yellowish

green

T5 80 20 0 0 White

C.D(p=0.05) 1.29

C.V % 10.43

95

4.5 Optimization of Agrobacterium mediated transformation protocol.

4.3.1 Effect of pre-culture period of explant in the co-cultivation protocol

Pre-culture is one of the important steps for co-cultivation experiment.

Variations in the pre-culture period in co-cultivation were taken at 0 - 96 hours.

The effect of pre-culture on survivability of explants after co-

cultivation is presented in Table 15 and Fig 9. Significant difference was

found in explants pre-cultured for 48 (68.30%) and 72 hours (76.65%) and

GUS expression (about 60, 78.30%) was observed respectively. The significant

survivability (85.00%) with 88.33% GUS expression was recorded in pre-

culture for 96 hours. Compared with all treatment, it showed highest

survivability and GUS expression percentage after co-cultivation. Therefore

it was concluded that 96 hours is the best pre-culture period in order to

obtain maximum survivability and also found to be suitable for co-

cultivation found based on the percentage Gus expression.

Table -15 Effect of pre-culture period on co-cultivation

Treatment Duration of

pre-culture in hours

Average no. explant alive after co-

cultivation

Percent survival

GUS expressio

n %

T1 0 9.00 45.00 36.65

T2 24 12.33 61.45 40

T3 48 13.67 68.30 60

T4 72 15.33 76.65 78.3

T5 96 17.00 85.00 88.3

C.D(p=0.05) 1.29 2.77

C.V% 5.42 12.85


96

4.3.2 Co-cultivation period

Explants were immersed with Agrobacterium suspension under

shaking condition for 20 to 30 minutes. Then the explants were taken out,

blot dried and co-cultivated on liquid MS medium (without sucrose)

supplemented with BAP (2mg/l) for different periods (24 to 96 hours) in order

to determine the optimum co-cultivation period to get maximum survivability.

The effect of different co-cultivation period on survivability of explants is

presented in Table 16 and Fig 10. Significant survivability and GUS expression

were found from the explants co-cultivated for 72 hours (78.35 and 75%

respectively). GUS expression (88.33%) was recorded in co-cultivation period

of 96 hours but survivability percentage was reduced to 51.65%. Hence 72

hours found to be suitable for co-cultivation.

Table-16 Effect of Duration of co-cultivation

Treatment Duration of co-culture in

hours

Average no.explant alive after co-cultivation

GUS expression %

Bacterium growth

T1 24 14.33 35 +

T2 48 14.67 55 +

T3 72 15.67 75 +

T4 96 10.33 88.3 +++

C.D(p=0.05) 1.54 1.43

C.V% 6.15 5.9

+ Slight growth , +++ Prominent growth of Agrobacterium, *20 explants used for the experiment with 4 replication was done.

97

Fig. 9 Effect of pre-culture period on co-cultivation

Fig. 10 Effect of duration of co-cultivation

0

10

20

30

40

50

60

70

80

90

100

0

20

40

60

80

100

120

T1 T2 T3 T4 T5

Perc

enta

ge o

f sur

viva

l

Dur

atio

nof p

re-c

ultu

re in

hou

rs/A

vera

ge n

o. o

f ex

plan

t al

ive

afte

r co

-cul

ture

Treatment

Duration of pre-culture in hours

Average no. explant alive after co-cultivation

Percent survival

GUS expression %

0

10

20

30

40

50

60

70

80

90

100

0

20

40

60

80

100

120

T1 T2 T3 T4

Perc

enta

ge o

f su

rviv

al

Dur

atio

nof p

re-c

ultu

re in

hou

rs/A

vera

ge n

o. o

f exp

lant

al

ive

afte

r co

-cul

tiva

tion

Treatment

Duration of co-culture in hours

Average no.explant alive after co-cultivation

GUS expression %

98

4.3.3 Optimization of antibiotic concentration for inhibition of Agrobacterium tumefaciens growth

Sensitivity of Agrobacterium tumefaciens to various levels of

antibiotics was determined by culturing the co-cultivated explants on MS

medium containing 2.0 mg/l BAP and different concentrations of

cefotaxime (0 to 500 mg/l). The effect of different concentrations of

antibiotics on growth of Agrobacterium is presented in Table 17.

The percentage of reappearance of Agrobacterium was t h e

maximum (100 %) on growth medium without antibiotic and it was found

to be gradually decreased with increase in concentration of antibiotics from

100 to 500 mg/l. The growth of Agrobacterium was totally inhibited at 500

mg/l concentration of both cefotaxime. So 500 mg/l cefotaxime was

added in the selection medium for getting contamination free

transformants.

Table-17 Determine the sensitivity of Agrobacterium to various level of cefotaxime

Treatment Concentration of cefotaxime

mg/L

Bacterium growth

Reappearance

Bacterium growth

reappearance percentage

Bacterium growth

T1 0 20 100 ++++

T2 100 15.75 78.75 +++

T3 200 13.5 67.5 +++

T4 300 9.75 48.5 ++

T5 400 3.5 17.5 +

T6 500 0 0 -

C.D(p=0.05) 1.46

C.V% 7.62

- No growth,+ little growth , ++ moderate ,+++ Prominent growth , ++++ over growth of Agrobacterium, *20 explants used for the experiment with 4 replication was done.

99

4.3.4 Transformation efficiency of Agrobacterium on selection of putative transformants on Kanamycin medium.

The cotyledonary nodes and shoot tips were co-cultivated with strain

EHA-105 containing the gene construct ICE -I. Four days pre-cultured shoot

tips were dipped in the bacterial suspension and then resuspended in LPGM

medium containing Acetosyringone (100µM) for 20 min, Then cotyledonary

nodes and shoot tips were incubated for 72 hours and subsequently cultured in

the shooting medium without selection pressure and grown for the next 3 days

followed by sub culturing on selection medium. Inclusion of the selective

agent, Kanamycin (80 mg/l) in the selection medium allowed transformed cells

to proliferate (Plate-10H) however, with a few albino shoots. These explants

were then sub-cultured after every 2 weeks on selection medium. A total of 130

explants of cv. �T-9� were obtained after co-cultivation. Out of these 12

explants of �T-9� were survived on selection medium containing 80 mg/l

Kanamycin. A transformation frequency of 9.23%.was achieved (Table-19).

The growth of the resistance shoots was rapid. Kanamycin- resistant shoots

were subjected to further high selection pressure and were maintained for

evaluation of transgenic black gram.

100

Plate - 9 Determination of Kanamycin sensitivity A. control (0mg/l) B. 20mg/l C. 40mg/l D. 60mg/l E. 80mg/l

�Plate - 10 Kanamycin based selection of transformants

F. control G. a week culture on selection medium H. two week old culture on selection medium

101

4.3.5 Gus assay of transformants

The different tissue of transformants was stained in X-gal. High GUS

expression was detected in the leaf (Plate-11 A & B) and cotyledonary node. The

relative expression of GUS was analyzed as blue colour development (Plate-11).

About 95% percentage of transient GUS expression was recorded (Table-18). The

explant which were not inoculated with Agrobacterium, showed no GUS activity.

The cross section of GUS positive (Plate-11 E&F) as well as negative explants

were made (Plate-11C&D) and observed in microscope at 10X and 20X

magnification.

Table-18 Transient GUS expression percentage

Total no of explant assayed

No. putative GUS +ve

Transformation efficiency in %

20 19 95


4.3.6 Molecular analysis of putative transformants

Putative transformants were screened by the PCR for presence of nptII

genes. For this purpose total genomic DNA was isolated from the explants

survived on the selection medium (Kanamycin 80 mg/l) and control. Then the

PCR reaction was carried out using primers specific for nptII gene and plasmid

DNA used as a positive control. The PCR amplified product was electrophoresed

on 1.2% agarose gel (Plate-12). Expected band of about 700 bp was obtained

only in two samples (out 10 samples). The transformation efficiency found to be

about 1.53% (Table-19).

Table 19 Transformation efficiency based on kanamycin selection and PCR analysis

Total no of explant assayed

No. of shoots obtained after co-

cultivation

No. shoots selected based on Kanamycin

selection

Transformation efficiency (%)

based on Kanamycin

selection

No. plants selected based on

PCR analysis

Transformation

efficiency (%) based on PCR

165 130 12 9.23 02 1.53

102

Plate� 11 GUS histochemical assay A. Control B. Transformants (+ve for GUS) C. T.S of Untransformed cells (10X) D. L.S of Untransformed cells (10X) E. T.S of transformed cells (GUS +ve )(20X) F. callus showing GUS +ve

103

Plate - 12 PCR analysis of putative transformants using nptII as primer M. 20 bp ladder

1. Positive control 2. negative control 3. untransformed 4-11. putative transformants

104

DISCUSSION

Transformation of crop plants with desired genes is the focus of many

plant genetic engineering programs. The stable introduction of foreign genes

into plants is one of the significant advances in crop improvement programme,

which would help in transforming desirable genes into local adopted varieties,

thus supplement conventional breeding programme. Among the several

methods used for transformation of plants, Agrobacterium tumefaciens

mediated transformation is preferred in many cases because of several distinct

advantages over other methods. These include single copy integration, greater

precision with excellent stability. The rate of transformation is influenced by

various factors like plant genotype, Agrobacterium strains, plasmid vectors,

temperature etc. Along with these factors, like Agro-inoculum treatment

duration and co-cultivation period also influences transformation rate.

5.1 IN- VITRO REGENERATION

A highly in-vitro plant regeneration system is very essential for carrying

out genetic transformation work. In case of legume crops, direct organogenesis

of shoots from cotyledonary nodes, shoot apices, leaflets and embryo axes is

the most common regeneration pathway.

5.1.1 Effect of surface sterilants

In present study 0.2 % HgCl2 was used as surface sterilants for

sterilization of black gram seeds. Among the various treatments, the best

result was observed in treatment of seeds with of 0.2% HgCl2 for a period four

minutes. In this treatment 91.25 % aseptic culture and 88.75 %

survivability of explants were recorded. The present result is in congruent with


105

the result reported by Saini, et al., 2007, Yadav, et al., 2010 and Varalaxmi, et

al., 2007 where 0.1% of HgCl2 treatment for 5 � 8 minute duration also

resulted higher aseptic culture with greater survival percentage.

5.1.2 Indirect regeneration

A very rapid and efficient regeneration method of Vigna mungo L. has

been established using liquid culture (Das, et al., 2002) by using a leaf explant

in liquid culture medium. The callus induction and plant regeneration of Indian

soybean (Glycine max L.) via half seed explant culture was also carried out

(Radhakrishnan and Ranjithakumari, 2007). Protocol for callus induction and

plant regeneration was established by using half seed explant on B 5 media of

Vigna mungo (L.) Hepper. The callus was induced in almost all media

combinations supplemented with varying levels of phytohormones. In the

present investigation among all the media and phytohormone combination

tested, the MS medium supplemented with 2.4.D (3.0 mg/l) and kinetin

(0.1mg/l) along with coconut water had induced profuse callusing in both types

of explants like leaf and inter cotyledonary node. The calli so developed were

loose, friable, whitish green coloured and of good quality as compared to calli

produced on other media combinations. Harisaranraj (2008) reported the best

callus development in MS medium supplemented with 2.0 mg/l BAP and 0.5

mg/l NAA. Further attempt to convert callus into plants was not successful.

Successful regeneration of calli of black gram to whole plant had not been

reported yet by any researchers.

5.1.3 Multiple shoot induction

The efficiency of in vitro multiple shoot formation and regeneration

was found to be dependent on various parameters, viz. explant size, age of

explant donor seedling, explant type, genotype, media composition, and growth

106

regulators (Gulati and Jaiwal,1992). For in vitro regeneration of black gram

various explants viz. stem, epicotyl, cotyledonary node explants (Gill et

al.,1987), excised cotyledonary and hypocotyl segments (Sen and Guha, 1998),

cotyledons and embryo axes (Ignacimuthu and Franklin,1997) were utilized

for in vitro multiple shoot induction. In the present investigation shoot tips and

cotyledonary nodes were used for efficient regeneration. Multiple shoots (7.17

shoots/ explant) were achieved from the inoculated explant excised from 4 days

old germinating seedling when cultured on half-strength MS medium

supplemented with 3mg/l BAP, 0.05mg/l IBA. Yadav et al., 2010 used MS B5

media for induction of multiple shoots. Cotyledonary node with embryonic

axis were used by Sumita et al., 2012 for induction of the of multiple shoot.

They reported that MS medium fortified with BAP (2mg/l),Kinetin (2mg/l)

was found to be only 3.24 shoots per explant in the �T-9� cultivar which is

comparatively lower percentage of multiple shoot induction as compared to our

present result. In present investigation similarly, better shooting percentage

was also observed in the medium SIM-7 (fortified with Thidiazuron (TDZ )0.1

mg/l and 0.05 mg/l IBA) with average shoot induction of 80.00% with 5.17

shoots per explant obtained. The TDZ has been reported to induce the

adventitious shoots. Mean multiple shoots per explant decrease with the

increase (up to 3mg/l) of TDZ and also causes shunted shoots with abnormal

morphology. Similar results were reported when TDZ used longer time in the

media (Jayanaand, et al., 2003).

5.1.4 Elongation of Multiple shoots

The explants with multiple shoots from various experiments were

sequentially sub-cultured on to shoot elongation media containing low

concentrations of BAP and Kinetin for production of healthy elongated shoots.

107

In the Blackgram cv. Co-5, the highest (10.45) mean numbers of healthy

elongated shoots per explant was obtained in medium supplemented with 0.5

µM of BAP and 0.5 µM of Kinetin which significantly differed from the mean

number of elongated Shoots per explant in all the other media tested. The mean

number of healthy elongated multiple shoots per explant in the cultivar T-9 and

local market collection was found 10.10 and 9.75, respectively (Sumita, et

al.,2012). A positive effect of a low concentration of the cytokinins group of

growth hormones (BAP, Kinetin, etc.) on multiple shoot elongation was also

observed in other legumes such as V. raditata (Chandra and Pal 1995; Gulati

and Jaiwal 1994), cowpea (V. unguiculata) (Muthukumar, et al. 1996), and

chickpea (Cicer aritenum) (Chakraborti, et al., 2006; Das, et al., 2004; Sarmah,

et al., 2004). In the present work medium supplemented with various

combination of GA3 and adenine sulphate (100mg/l) were used for elongation

of multiple shoots. Among different medium combination, the better elongation

of shoots was observed with MS medium fortified with 1.0 mg/l GA3 and this

medium promoted the maximum elongation of shoots (11.23 cm) within a

week incubation period. The MS medium supplemented with the 1.2 mg/l GA3

showed elongation about 10.42 cm. The phytohormone GA3 showed greater

elongation as compared to the result reported by Sumita, et al., 2012.

5.1.5 Rhizogenes of Multiple shoots

The rooting of shoots was significantly affected by the auxins

concentration. MS medium supplemented with 0.25 mg/l IBA and 0.2 mg/l

NAA performed better rooting within least number of days (8.33) for rooting.

Khawar and Özcan (2002) reported that MS medium containing 0.25 mg/l. IBA

performed best and required four weeks for rooting. Geetha, et al. (1999)

reported that roots emerged within 15 days. A higher percentage of rooting

108

(100%) was found with 0.5 mg/l IBA in the study. Raman, et al. (2004)

reported that efficient rooting (100%) of the shoots on medium containing half

MS salts, full MS vitamins and IBA (2.5 ìM). Khawar and Özcan (2002)

reported that medium containing 0.25 mg/l IBA obtained only 25% roots and

Geetha, et al. (1999) reported that medium containing 3 mg/l IBA showed

78.3% of rooting. The maximum number of roots (14.33) per shoot was

recorded in medium containing 0.5 mg/l NAA. Geetha, et al. (1999) reported

that medium containing 3.0 mg/l IBA produced 14.5 roots/plants. It was clear

from the above discussion that 0.5 mg/l IBA was better for root formation than

any other treatments. Das, et al. (2002) and Geetha, et al. (1999) reported that

IBA was effective for rooting of black gram, while Roy et al. (2007) reported

that NAA was effective for rooting.

In our study we found higher percentage of rooting in MS medium

supplemented with NAA (0.5 mg/l) and in this treatment about 72.5% of shoots

responded well for rooting with an average of 6.2 roots per shoots. Similarly,

68.9% explant responded for rooting in medium containing NAA (0.25mg/l)

which was comparatively lower percentage response than the 0.5mg/l NAA but

number of roots per shoots are quite higher (8.40). in vitro raised healthy

plantlets of 13-15 cm in height were planted in a mixture of soil: sand: FYM

present in the ratio of 1:1:1. Survival rate of the transplanted plantlets was

recorded to be 70%.

5.2 Transformation studies

Agrobacterium-mediated transformation involves interaction between

two biological systems and is affected by various physiological conditions.

Therefore optimization of some of the aspects that enhance the virulence of

Agrobacterium for T-DNA transfer and factors that improve survival and

109

regeneration of transformed cells is crucial for a recalcitrant crop like

black gram. Transient GUS expression provides an easy and clear indication of

the expression of transferred genes and can be used to assess the frequency of

transformation. In the present study, sub-culturing of explants prior to agro

infection facilitated entry of Agrobacterium cells and production of �vir� gene

inducers. Compromise between the efficiency of infection and survival rate

after transfer.

Inclusion of synthetic phenolic compound acetosyringone in co-

cultivation medium enhanced transient expression of GUS when used at a final

concentration of 100 µM. Acetsyringone enhances �vir� functions during

transformation (Stachel, et al., 1985) and has been shown to increase

transformation potential of Agrobacterium strain with moderately virulent �vir�

region in several plant species (Atkinson and Gardner, 1991; Janssen and

Gardner, 1993; Kaneyoshi et al., 1994). Also the acidic pH (5.2) used in the

infection medium acts synergistically with acetosyringone for increasing the

transformation efficiency.

The blue coloration in the infected cotyledon explants upon histochemical

assay suggested the introduction and expression of GUS gene. Based on molecular

characterization using PCR, the integration of nptII gene was confirmed in

transgenics. The untransformed control did not show any amplification with these

primers. Two transgenic lines expressing the nptII. The transformation frequency

increased with increase in concentration of Agrobacterium cells up to 108 and,

thereafter, decreased with further increase in number of Agrobacterium cells.

Similar results were mobtained in Nicotiana tabacum and Arabidopsis thaliana

and in most of the grain legumes (Bean, et al. 1997).

110

The length of co-cultivation period required for achieving maximum

gene transfer was found to be 3 days. Further extension in co-culture time

decreased the transformation frequency resulting in bacterial overgrowth and

had detrimental effect on regeneration potential of explants. A short co-culture

period of 2 or 3days has also been found to be optimum in other plant species

such as Antirrhinum majus (Holford, et al.,1992), Vigna unguiculata

(Muthukumar, et al., 1996), Vigna radiate (Jaiwal, et al., 2001), Cajanus cajan

(Mohan and Krishnamurthy, 2003), and Glycine max (Li, et al. 2004)

Wounding the plant material before co-cultivation allows better bacterial

penetration into the tissue facilitating the accessibility of plant cells for

Agrobacterium or possibly stimulated the production of potent �vir� gene

inducers like phenolic substances such as acetosyringone and

hydroxyacetosyringone (Stachel, et al.,1985) and enhanced the plant cell

competence for transformation (Binns and Thomashow,1988). Wounding the

plant material before co-cultivation has also been shown to increase

transformation frequency. Mechanical injury of the meristematic region

probably induces meristem reorganizations promoting formation of large

transgenic sectors and enhanced recovery of transformants.

Pre-culture of explants on regeneration medium prior to inoculation and co-

cultivation with Agrobacterium has been reported to enhance efficiency of

transformation in some grain legumes, e.g. Vigna unguiculata (Muthukumar, et al.

1996) and Cajanus cajan (Geetha, et al. 1999). However, in present study, no

such results were obtained. This may be due to the specificity of species to pre-

culture. In contrast, pre-culture (0 - 3 days) of cotyledonary node explants prior

to co-culture with bacteria reduced the frequency of transient GUS expression

high. This may be due to the healing of the wounding site, because wounding is

111

a prerequisite for Agrobacterium-mediated transformation. The reduction may

be attributed to the secretion of compounds that inhibit �vir� gene induction or

dilution of the �vir� gene inducing signal molecules released as result of

wounding. Wounding induced division and production of phenolic compounds

such as acetosyringone and hydroxyacetosyringone. These signal molecules are

recognized especially by Agrobacterium to induce �vir� gene expression and

thereby activate T-DNA transfer (Zambryski, 1983). Pre-culture was found to

reduce transformation efficiency in other plant species also such as kiwifruit

(Janssen and Gardner, 1993) had no effect in peanut transformation (Sharma

and Anjaiah, 2000). When preculture was combined with mechanical injury the

results were reversed that leads to increase in transient GUS expression and

was found to be up to 95 %. This may be attributed to visually more clear

regeneration site on the pre-cultured explants for mechanical injury as

compared to non-pre-cultured and freshly release of phenolics as a result of

mechanical injury. High vigour of pre-cultured explants was also found to

increases the regenerability of mechanically injured explants. These optimized

transformation factors were used for the stable genetic transformation of Vigna

mungo. One hundred sixty five cotyledonary node explants co-cultured with

Agrobacterium produced a total of 12 shoots on kanamycin selection medium.

The green shoots (2 to 3 cm) were subjected to a second round of selection at

the rooting stage. These plantlets were subsequently transferred to soil. The

plant genomic DNA was isolated for PCR analyses. PCR results showed

amplification of a 700 kb band corresponding to the coding region of nptII

gene, indicating the presence of transgene in 2 out of 10 putatively transformed

plants established in soil, with an overall transformation frequency of 1.53%.

112

SUMMARY AND CONCLUSION

Black gram (Vigna mungo L. Hepper) is popularly known as Urad in

Hindi, Biri in Odia and Uddu in Kannada. It belongs to the family Fabaceae. It

is diploid in nature with 2n=2x=22. It has a small genome size containing 574

million base pairs. It is the third most important pulse crop in India after

chickpea and pigeon pea and grown mostly as a fallow crop in rotation with

cereals. In India total area under cultivation is about 31.0 lakh hectares with the

average production and productivity of 14.0 lakh tones and 451.61 kg/ha

respectively. The total area under black gram in Odisha is about 1.50 lakh

hectares with total production 0.42 lakh tones. But the productivity of black

gram is 280.0 kg/ha which is far below than the national average productivity

(451.61 kg/ha). Its yield is highly affected by a number of abiotic stresses

particularly cold and moisture stress. Abiotic stress causes the crop loss more

than 50% from their potential yield (Wang et al., 2006). Varietal improvement

against abiotic stress tolerance is the major remedy for increasing productivity

and production of black gram. Varietal improvement of black gram through

genetic engineering of plant for tolerance to abiotic stress could be achieved by

the regulated expression of a large number of stress responsive genes. Among

available genes, ICE-1 gene has been identified as one of the potential genes

conferring resistance to abiotic stress. This gene had been isolated from the

model plant Arabidopsis thaliana and well characterised. It is an upstream

transcription factor and is a positive regulator of CBF-3 and plays a critical role

in cold tolerance. The present research aimed at developing an efficient

regeneration and transformation system for genetic improvement of black

gram cv. �T-9�.

For development of an efficient in vitro regeneration protocol, different

explant like leaf, shoot tips, shoot tips with cotyledon nodes were tested for

callus initiation. The leaf was found to be more responsive for callus initiation


113

than other explants. The MS medium supplemented with 2.4.D (3 mg/l) and

kinetin at (1mg/l) was found to be the most responsive in the callus formation.

Callus induction was achieved in 87.25% explants cultured in this medium

after 12 days of incubation. Further conversion of callus to whole plants could

not be achieved in spite of different media, phytohormone combination and

organic supplements The direct multiple shoots induction from different

explants was observed in medium SIM-4 (Shoot Induction Medium)

supplemented with 3mg/l BAP, 0.05mg/l IBA (including adenine sulphate

(100mg/l). This treatment resulted development of shoots from cotyledon node

in reasonable time frame of 13 days with more than 84.33% of the explants

responding with average of 7.17 shoots per explant. The explants shoot tip with

cotyledonary node showed better response than that of shoot tip. About 84.33%

response of direct regeneration were recorded with average multiple shoots of

7.17 per explant. During sub-culturing MS medium fortified with 1.0 mg/l GA3

promoted the maximum elongation of shoots (11.23 cm) within a week

incubation period. About 68.9% explant responded for rooting in medium

NAA (0.25mg/l) which was comparatively lower percentage response than the

0.5mg/l NAA but number of roots per shoots are quite higher (8.40).

Transformation of regenerated shoots was achieved by employing

Agrobacterium mediated indirect transformation protocol. EHA-105

Agrobacterium strain harbouring a binary vector pCAMBIA2301 containing

Neomycin phosphotransferase (nptII) gene as selectable marker, ß-

glucuronidase (GUS) as a reporter gene and ICE-1gene was used for co-

cultivation with regenerated multiple shoots for genetic transformation.

Kanamycin based selection system performing Agrobacterium mediated

transformation of black gram Kanamycin at 80mg/l used for screening of

putative transformants. Explants were co-cultivated and regenerated multiple

shoots were subjected to Kanamycin (80 mg/l) selection for screening of

transformants. Transformation efficiency on the basis of Kanamycin selection

was found to be 9.23%. Transient GUS expression percentage was observed

about 95% in transformed shoots after screening on selection medium

114

containing antibiotics. Based on PCR analysis with nptII primer transformation

efficiency was found to be about 1.53%. The genetically modified plants were

hardened in the greenhouse and then transferred to the field for further agro-

morphological and biochemical characterization.

Transgenics technology supplements the breeding programme for

genetic improvement of crop plants where conventional genetic transfer cannot

achieved due to sexual barrier and limited availability of genes within the

germplasm. The Agrobacterium mediated transformation which has been

successful in other dicot crops has not been as efficient in grain legumes like

black gram. The present investigation is a foot step for transgenic development

in legume crop by increasing the efficiency of gene delivery and expression

system. Further enhancement in transgenic technology in legume crop can be

achieved by development new vector and its delivery system and efficient

regeneration protocol.

i

REFERENCES

Abdrakhamanova, A., Wang, Q.Y., Khokhlova, L. and Nick, P., 2003. Is

microtubule for cold disassembly a trigger acclimation?. Plant & Cell

Physiology, 44: 676�686.

Adkins, A.L., Godwin, J.D. and Adkins, S.W., 1995. An efficient in vitro

regeneration system for Australian grown chickpea (Cicer arietinum)

cultivars. Australian Journal of Botany, 43: 491-497

Allagulova, C.R., Gimalov, F.R., Shakirova, F.M. and Vakhitov, V.A.2003.

The plant dehydrins: structure and putative functions. Biochemistry

(Moscow), 68:945�951.

Allen, M. D., Yamasaki, K., Ohme-Takagi, M., Tateno, M., and Suzuki, M.,

1998, a novel mode of DNA recognition by a -sheet revealed by the

solution structure of the GCC-box binding domain in complex with

DNA. European Molecular Biology Organization Journal,

17:5484�5496

Altaf, N. and Ahmad, M.S., 1986. Plant regeneration and propagation of

chickpea through tissue culture techniques. International Atomic

Energy Authority, WienIAEA.407-417

Altimkut, A., Bajororic using callus derived plantlets and seedlings

.International chickpea Newsletter,4:30-31

Ammirato, P. V., 1983. The regulation of somatic embryo development in plant

cell cultures: suspension culture techniques and hormone requirements.

Biotechnology. 1. 68�74


ii

Amutha, M., M. S. and Ganapathi, A. 2010. Somatic embryo productions by

liquid shake culture of embryogenic calluses in Vigna mungo (L.)

Hepper, In Vitro Cell. Dev. Biol. - Plant 46:34�40

Anbazhagan, V. R. and Ganapathi, A. 1999. Somatic embryogenesis in

suspension cultures of pigeon pea (Cajanus cajan). Plant Cell Tissue

Organ Cul. 56: 179�184.

Anderson, M. D. and Brar., 1997. Differential gene expression in chilling

acclimated maize seedlings and evidence for the involvement of

abscisic acid in chilling tolerance. Plant Physiol. 105: 331�339

Andres, M. and Gatica Arias., 2010. In vitro plant regeneration system for

common bean (Phaseolus vulgaris): effect of N6-benzylaminopurine

and adenine sulphate. Electronic journal biotechnology.140-146

Anthony, T.T., Stephen, H.B., Igor, V.K., Ignacio, E.M.M., Wayne, K.V.,

Laura, A.B., Heungsop, S., TZYY, J.C., Hiroaki, K., Gary, R.D.,

Detlef, W. and Maria, J.H., 2000. Transformation of Medicago

truncatula via infiltration of seedlings of flowering plants with

Agrobacterium. The Plant Journal. 22 (6): 531-541.

Arachiasamy, S., Varghese, G. and Ignarcimuthu, S., 2000. High frequency

regeneration of chickpea (Cicer arietinum L.) plantlets from leaf callus.

Phyto-morphology, 50 (3-4): 297-302.

Aragao F. J. L., Ribeiro, S. G., Barros, L. M. G., Brasileiro, A. C. M., Maxwell,

D. P,.. Rech, E. L. and Faria. J. C.1998. Transgenic beans (Phaseolus

vulgaris L.) engineered to express viral antisense RNAs show delayed

and attenuated symptoms of bean golden mosaic Gemini virus. Mol

Breed. 4:491�499.

Arora, P.P., 1988, Line x tester analysis for combining ability in bengalgram.

Himachal Journal of Agriculture Research,14: 6-12.

iii

Atienza, S.G., Faccioli, P., Perrotta, G., Dalfino, G., Zschiesche, W.,Humbeck,

K., Stanca, and Cattivelli L A.M. 2004. Large-scale analysis of

transcript abundance in barley subjected to several single and combined

abiotic stress conditions. Plant Science, 167:1359�1365.

Atkinson, R.G. and Gardner. R. 1991. Agrobacterium-mediated transformation

of pepino and regeneration of transgenic plants. Plant Cell Rep. 10:

208-212.

Badawi, M., Reddy, Y.V., Agharbaoui, Z., Tominaga, Y., Danyluk, J., Sarhan,

F. and Houde, M. 2008.Structure and functional analysis of wheat ICE

(inducer of CBF expression) genes. Plant Cell Physiol. 49:1237�1249

Bae, H.H., Herman, E., Bailey, B., Bae, H.J. and Sicher R. 2005 Exogenous

trehalose alters Arabidopsis transcripts involved in cell wall

modification, abiotic stress, nitrogen metabolism, and plant defense,

Physiologia Plantarum, 125:114�126.

Barna, K.S. And Wakhlu, A.K., 1994. Whole plant regeneration of Cicer

arietinum from plantlets from leaf callus, Phytomorphology, 50 (3-4):

297-302.

Barwale, U. B., Kerns H. R. and Widholm. J. M.1986. Plant regeneration from

callus cultures of several soybean genotypes via embryogenesis and

organogenesis. Plant biotechnology. 167(4): 473-481.

Bassiri, A., Slinkard, A.E. and F. Ahmad., 1985.Rooting of stem cutting in

Cicer. International Chickpea Newsletter. 13: 10-11.

Bean, S. J., Gooding. P. S., Mullineaux. P. M. and D.R. Davies., 1997. A

simple system for pea transformation, Plant Cell Rep. 16:513-519.

Behman , 2007. The Arabidopsis DREB1A gene driven by the stress-inducible

rd29A promoter increases salt tolerance in proportion to its number in

tetrasomic tetraploid potato, Plant Biotechnology. 23.169-177.

iv

Benedict, C., Skinner, J.S., Meng, R., Chang, Y., Bhalerao, R., Huner, N.P.,

Finn, C.E.; Chen, T.H. and Hurry, V. 2006 The CBF1-dependent low

temperature signalling pathway, regulons and increase in freeze

tolerance are conserved in Populous spp. Plant Cell Environ, 29:1259�

1272.

Bhatnagar Mathur, P., Vadez, V. and Sharma, K.K. 2008. Transgenic

approaches for abiotic stress tolerance in plants: retrospect and

prospects. Plant Cell Rep. 27:411-419.

Bhattacharya, R. C., Viswakarma, N., Bhat, S. R.,. Kirti, P. B. and. Chopra, V.

L. 2002. Development of insect resistant transgenic cabbage plants

expressing a synthetic cry1A(b) gene from Bacillus thuringensis.

Current Science. 83:146-150.

Binns, A. N. and Thomashow M. F.1998.Cell biology of Agrobactrium

infection and transformation of plant. Annual Review of

Microbiology.42:575-606.

Birch, R. G., 1997. Plant transformation: problem and strategies for practical

application . Annual Review of Microbiology .42: 297-326.

Blumwald, E., Aharon, G.S. and Lam, B.C.H.1998. Early signal transduction

pathways in plant�pathogen interactions. Trends in Plant Sci. 3:342�

346

Blundy, K. S., Blundym, M. A. C.and Carter, D. 1991. The expression of

class-1 patatin gene fusions in transgenic potato varies with both gene

and cultivar. Plant Molecular Biology. 16: 153-160.

Brandt, E.B. and Hess, D., 1994. In vitro regeneration and propagation of

chickpea (Cicer arietinum) from meristem tips and cotyledonary nodes.

In vitro Cell Development Biology. 30(1): 75-80.

v

Brar, M.S., Al-Khayri, J.M., Shamblin, C.E., McNew, R.W., Morelock T.E.

and Anderson E.J. 1997. In vitro shoot tip multiplication of cowpea

Vigna unguiculata L . Walp. In Vitro Cell. Dev. Biol. 33: 111-118

Briggs, B.A., Mc CULLOUDS, S.M. and Edick, L.A., 1988.

Micropropagation of azaleas using thidiazuron. Acta Horticulturae.

226: 205-208.

Budar, F., Thia-Toong, L., Montagu, V.M. And Hernalsterns, J.P., 1986.

Agrobacterium � mediated gene transfer results mainly in transgenic

plant transmitting T-DNA as a single Mendalian factors. Genetics.44:

303-313.

Catala, R., Santos, E., Alonso, J.M., Ecker, J.R., Martinez-Zapater., Cattivelli,

L., Baldi, P., Crosatti C., Di-Fonzo, N., Faccioli, P., Grossi, M.,

Mastrangelo, A.M., Pecchioni, N. and Stanca, A.M. 2002.

Chromosome regions and stress-related sequences involved in

resistance to abiotic stress in Triticeae. Plant Molecular Biology.

48:649�665.

Cattivelli, L., Baldi, P., Crosatti, C., Di Fonzo, N., Faccioli P., Grossi M.,

Mastrangelo A.M., Pecchioni N. and Stanca A.M. 2002. Chromosome

regions and stress-related sequences involved in resistance to abiotic

stress in Triticeae. Plant Molecular Biology. 48:649�665.

Chakrabarty, R., Viswakarma, N., Bhat, S.R., Kirti, P.B., Singh, B.D. and

Chopra, V.L. 2002. Agrobacterium mediated transformation of

cauliflower: Optimization of protocol and development of transgenic

cauliflower. Journal of Biosciences. 27(5): 495-502.

Chalker-Scott, L. 1999.Environmental significance of anthocyanins in plant

stress responses. Photochemistry and Photobiology, 70:1�9.

vi

Chaturvedi, C.P. and L. Chand. 2001. Efficient plantlet regeneration in

chickpea. International Chickpea Newsletter. 8: 20-21.

Chandra, M. and Pal, A.1995. Differential response of the two cotyledon of

Vigna mungo in vitro. Plant cell repo.15:248-253

Chauhan, Richa, Tiwari, A. and Singh, N.P., 2003.Differential requirement of

mature and immature embryo of chickpea (Cicer arietinum L.) for in

vitro regeneration. Indian Journal of Plant Physiolog.8 (1): 28-33.

Chen W.P. and Li, P.H. 2002.Attenuation of reactive oxygen production during

chilling in ABA-treated maize cultured cells. Palva E.T. (Eds), Plant

cold hardiness. Kluwer Academic Publishers, Dordrecht, The

Netherlands, 223�233.

Chen, M., Xu, Z., Xia, L., Li, L., Cheng, X., Dong, J., Wang, Q. and Ma, Y.

2009.Cold-Induced modulation and functional analyses of the DRE-

binding transcription factor gene, GmDREB3, in soybean (Glycine max

L.). J. Exp. Bot. 60: 121�135

Chen, T.H. and Murata, N. 2008.Glycinbetaine: an effective protectant against

abiotic stress in plants. Trends in Plant Science.13: 499�505

Chen, W.J. and Zhu, T. 2004.Networks of transcription factors with roles in

environmental stress response. Trends in Plant Science.9:591�596

Chilton, M.D., 1993. Agrobacterium gene transfer: progress on a �poor man�s

vector� for maize. Proc. Natl. Acad. Sci. USA. 90:3119-3120.

Chinnusamy, V., 2006. Gene regulation during cold acclimation in plants.

Physiol Plant. 126: 52�61.

Chinnusamy, V., Ohta, M., Kanrar, S., Lee, B.H., Hong, X.,Agarwal, M., Zhu,

J.K.2003,. ICE1: A regulator of cold-induced transcriptome and

freezing tolerance in Arabidopsis. Genes Dev. 17:1043�1054

vii

Chinnusamy,V., Schumaker, K. and Zhu J.K. 2004. Molecular genetic

perspectives on cross-talk and specificity in abiotic stress signalling in

plants. Journal of Experimental Botany. 55:225�236.

Choi, D. W., Rodriguez, E. M., Close, T. J., 2002. Barley Cbf3 gene

identification, expression pattern, and map location. Plant Physiol. 129:

1781�1787.

Chowdhury, Surya-Prakash, J.B., Jain, R.K. and Chowdhury, V.K., 1992.

Factors affecting plant regeneration in chickpea. Indian Journal of

Experimental Biology. 30: 1149-1153.

Christou, P., Murphy, J. E. and Swain, W. F. 1987. Stable transformation of

soybean by electroporation and root formation from transformed callus.

In: Proceedings of National Academy of Science. 84: 3962-3966.

Dale, P.J., Irwin, J.A and Scheffler, J.A.1993. The Experimental and

Commercial release of transgenic plants, Plant Breeding.111:1-22

Das Dilip K., Prasanna Bhomkar, N. Shiva Prakash and Neera Bhalla-

sarin.2002.Improved method of regeneration of black gram (Vigna

mungo l.) through liquid culture, in vitro cell. dev. biol.plant. 38:456�

459

Das Dilip, K., N. Shiva Prakash, Neera Bhalla-Sarin., 1998. An efficient

regeneration system of black gram (Vigna mungo L.) through

organogenesis Plant Science .134:199�206.

Davey M.T., Rech, E.L. and Mulligan, B.J.1989.Direct DNA transfer to plant

cell. Plant Molecular Biology, 13: 273-285

Davey, M.P., Woodward, F.I. and Quick W.P.2009.Intraspecific variationin

cold-temperature metabolic phenotypes of Arabidopsis lrata ssp.

petraea. Metabolomics, 5:138�149.

viii

De, Palma, M., Grillo, S., Massarelli, I., Costa, A., Balogh, G., Vigh, L. and

Leone, A.2008. Regulation of desaturase gene expression, changes in

membrane lipid composition and freezing tolerance in potato plants.

Molecular Breeding, 21:15�26.

Deng W, Pu, X-A, Goodman, R.N., Gordon, M.P., Nester, E.W.1995. T- DNA

genes responsible for inducing a necrotic response on grape vines. Mol.

Plant-Microbe Interact. 8: 538-548.

Ditt, R., Nester, E.W. and Comai L., 2001. The plant gene expression response to

Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA.98: 10954-10954.

Donaldson, P.A. And Simmonds, D.H., 2000. Susceptibility to Agrobacterium

tumefaciens and cotyledonary node transformation in short season

soybean. Plant Cell Reports. 36: 1276-1279

Dong, C.H., Agarwal, M., Zhang, Y., Xie, Q. and Zhu, J.K.2006.The negative

regulator of plant cold responses, HOS1, is a RING E3 ligase that

mediates the ubiquitination and degradation of ICE1.Proceedings of the

National Academy of Sciences USA, 103:8281�8286

Dubouzet, J. G., Sakuma, Y., Ito, Y., Kasuga, M., Dubouzet, E. G., Miura, S.,

Seki, M., Shinozaki, K., Yamaguchi-Shinozaki, K. 2003. OsDREB

genes in rice, Oryza sativa L., encode transcription activators that

function in drought, high-salt and cold-responsive gene expression.

Plant. J .33: 751-763.

Durham, R. E., and Parrott, W. A.1992. Repetitive somatic embryogenesis

from peanut cultures in liquid medium. Plant Cell Rep. 11: 122

Dutta, A., Sen, J. and Deswal, R .2007.Downregulation of terpenoidindole

alkaloid biosynthetic pathway by low temperature and cloning of a AP2

type C-repeat binding factor (CBF) from Catharanthus roseus (L). G.

Don. Plant Cell Reports, 26:1869�1878.

ix

Eapen S., and George, L. 1990. Ontogeny of somatic embryos of Vigna

aconitifolia, Vigna mungo and Vigan radiate. Ann. Bot. 66: 219� 226

Eapen, S. 2008. Advances in development of transgenic pulse crops. Biotech.

Ad. 26:162-168.

Edwards, K., Johnstone, C. and Thompson. C. 1991. A simple and rapid

method for the preparation of plant genomic DNA for PCR analysis.

Nucleic Acids Research. 19(6): 1349.

Estruch, J.J.1997. Transgenic plants: an emerging approach to pest control.

Nat. Biotechnol.66:141-151.

Feirer, P. R., Conkey, H. J, and Verhagen, A. S.1989. Triglycerides in conifer

calli: A comparison with zygotic embryos. Plant Cell Rep. 8: 207�209.

Finnegan, J. and McElroy D. 1994. Transgene inactivation: plants fight back.

Biotechnology. 12: 883-888.

Firoz Anwar, Salem, S., Alghamdi, Megahed, H., Ammar and Siddique, K. H.

M.2011. An efficient in vitro regeneration protocol for faba bean (Vicia

faba L.) Journal of Medicinal Plants Research. 5(28): 6460-6467

Fitch, M. M. M., Hanshardt, R. M., Gonsalves, D., Slightom, J. L. and Sanford,

J. C.1990. Stable transformation of papaya via microprojectile

bombardment. Plant Cell Reports. 9: 189-294.

Fontana, G.S., Santini, L., Caretto, S., Frugis, G. and Hariotti, D., 1993.

Genetic transformation in the grain legume Cicer ariteinum L.

(Chickpea). Plant Cell Reports, 12: 194-198

Fourrier, N., Bedard, J., Lopez-Juez, E., Barbrook, A., Bowyer, J., Jarvis, P.,

Warren, G. and Thorlby, G .2008.A role for SENSITIVETO

FREEZING2 in protecting chloroplasts against freeze induced damage

in Arabidopsis. The Plant Journal, 55:734�745

x

Fowler, D. B., 1996. Relationship between low-temperature tolerance and

vernalization response in wheat and rye. Can. J. Plant Sci. 76: 37�42

Fowler, S. and Thomashow, M. F.2002. Arabidopsis transcriptome profiling

indicates that multiple regulatory pathways are activated during cold

acclimation in addition to the CBF cold response pathway. The Plant

Cell, 14: 1675�1690.

Fowler, S.G., Cook, D. and Thomashow, M.F.2005.Low temperature induction

of Arabidopsis CBF1, 2, and 3 is gated by the circadian clock. Plant

Physiology, 137:961�968.

Franciaan, E., Rizza, F., Cattivelli, L., Stanca, A.M., Galiba, G., Toth, B.,

Hayes, P.M., Skinner, J.S. and Pecchioni, N.2004.Two loci on

chromosome-5H determine low-temperature tolerance in a

��Nure��(winter) � ��Tremois�� (spring) barley map. Theoretical and

Applied Genetics, 108:670�680.

Fromm, M., Taylor, L. P. and Walbot, U.1985. Expression of genes transferred

into monocot and dicot plant cells by electroporation. In: Proceedings

of National Academy of Science, 82: 5824-5828

Fursova, O.V., Pogorelko, G.V. and Tarasov, V.A., 2009.Identification of

ICE2, a gene involved in cold acclimation which determines freezing

tolerance in Arabidopsis thaliana. Gene, 429:98�103.

Garg, A.K., Kim, J.K., Owens, T.G., Ranwala, A.P., Choi, Y.D., Kochian, L.V.

and Wu, R.J. 2002. Trehalose accumulation in rice plants confers high

tolerance levels to different abiotic stresses. Proceedings of the

National Academy,of Sciences USA, 99:15898�15903.

Geetha, N., Venkatachalam, P. and Lakshmisita, G.1999. Agrobacterium

mediated genetic transformation of pigeonpea (Cajanus cajan L.) and

development of transgenic plants via direct organogenesis. Plant


xi

Gheysen, G.,G. Angenon, M. and Van Montagu., 1998. Agrobacterium

mediated plant transformation: A scientifically intriguing story with

significant application. In Transgenic Plant Research. Plant

cell.104:57-56

Gill, R., Eeapen, S. and Rao, P. S. 1987. Morphogenetic studies of cultured

cotyledons of Urdbean (Vigna mungo L. Hepper). J. Plant Physiol.

1330:1�5.

Gilmour, S. J., Sebolt, A. M., Salazar, M. P., Everard, J. D. and Thomashow,

M. F. 2000. Overexpression of the Arabidopsis CBF3 transcriptional

activator mimics multiple biochemical changes associated with cold

acclimation. Plant Physiol.124: 1854�1865.

Glaszmann, J.C., Kaw, R.N. and Khush G.S.1990.Genetic divergence among

cold tolerant rices (Oryza satva L.) Euphytica. 45:95�104.

Gong, Z., Lee, H., Xiong, L., Jagendorf, A., Stevenson, B. and Zhu,

J.K.2002.RNA helicase-like protein as an early regulator of

transcription factors for plant chilling and freezing tolerance.

Proceedings the National Academy of Sciences USA.99: 11507�11512.

Goodman, R.N. and Novacky, AJ.1994. The hypersensitive reaction in plants

to pathogens. A resistant phenomenon. APS PRESS, St. Paul,

Minnesota.244.

Grennan, A.K. 2006. Abiotic stress in rice. An ��omic�� approach. Plant

Physiology,14:1139�1141

Griffith, M. and Yaish, M.W.F.2004.Antifreeze proteins in over wintering

plants: a tale of two activities. Trends in Plant Science, 9:399�405.

Gulati, A. and P. K. Jaiwal., 1992. In vitro induction of multiple shoots and

plant regeneration from shoot tips of mungbean (Vigna radiata L.

Wilczek). Plant Cell Tissue Org. Cult 23: 1-7.

xii

Gusta, L.V., Wisniewski, M., Nesbitt, N.T. and Gusta, M.L.2004.The effect of

water, sugars, and proteins on the pattern of ice nucleation and

propagation in acclimated and non-acclimated canola eaves. Plant

Physiology,135:1642�1653.

Gustavo A. R, Gonzalez-Cabrera, J., Vazquez-Padron, R. and Ayra-Pardo, C.,

1998. Agrobacterium tumefaciens: A natural tool for plant

transformation. Electronic J. Biotechnol.1 http://www/ ejb.org/ content/

vol1/ issue3/full/1.

Gutha, L. and Reddy. 2008. A. Rice DREB1B promoter shows distinct stress-

specific responses, and the overexpression of cDNA in tobacco confers

improved abiotic and biotic stress tolerance. Plant Mol. Biol. 68:533�

555

Guy, C. 1999. The influence of temperature extremes on gene expression,

genomic structure, and the evolution of induced tolerance in plants. In:

Lerner H.R. (Ed.), Plants responses to environmental stresses. from

Phytohormone to genome reorganization. Marcel Dekker, Inc., New

York, Basel, 497�548.

Guy, C., Kaplan, F., Kopka, J., Selbig, J. and Hincha, D.K. 2008. Metabolomics of

temperature stress. Physiologia Plantarum, 132:220�235.

Hammond �Kosack, K.E.and Jones, J. D.G.1996. Resistance gene�dependent

plant defence responses. Plant Cell. 8:1773�1791.

Hannah, M.A., Wiese, D., Freund, S., Fiehn, O., Heyer, A.G. and Hincha,

D.K.2006.Natural genetic variation of freezing tolerance in

Arabidopsis. Plant Physiology, 142: 98�112.

Hare, P.D., Cress, W.A. and Van Staden, J.1998.Dissecting the roles of

osmolyte accumulation during stress. Plant, Cell and

Environment.21:535�553.

http://www/

xiii

Harisaranraj, R., Saravana Babu, S. and Suresh, K. 2008 . Callus Induction and

Plant Regeneration of Vigna mungo (L.)Hepper via Half Seed Explant.

Ethno-botanical Leaflets. 12: 577-85.

Hartweek, L. M., Lazzeri, P. A., Cui, D., Collins, G. B. and.Williams, E.

G.1988. Explant orientation effects on somatic embryogenesis from

immature soybean cotyledons. In vitro Cell Division and Biology. 24:

821-828.

Hatzopoulos, P., Fong, F., and Sung, R. Z.1990. Abscisic acid regulation of

DC8, a carrot embryogenic gene. Plant Physiol. 94: 690�695.

Higashi, Y., Hirai, M.Y., Fujiwara, T., Naito, S., Noji, M. and Saito, K., 2006.

Proteomic and transcriptomic analysis of Arabidopsis seeds: molecular

evidence for successive processing of seed proteins and its implication

in the stress response to sulfur nutrition. Plant J. 48: 557-571.

Hincha, D.K., Livingston, D.P., Premakumar, R., Zuther, E., Obel, N., Cacela,

C. and Heyer, A.G. 2007. Fructans from oat and rye: composition and

effects on membrane stability during drying. Biochimical. Biophysica.

Acta.1768:1611�1619.

Hirschi, K.D.1999.Expression of Arabidopsis CAX1 in tobacco: altered calcium

homeostasis and increased stress sensitivity. The Plant Cell.11:2113�

2122

Hobbs, S. L. A., Kpodar, P. and C.M.O. Delong.1990. The effect of T-DNA

copy number, position and methylation on reporter gene expression in

tobacco transformants. Plant Molecular Biology.15: 851-864.

Holford P, Hernandez, N, and Newburg, H. T., 1992. Factors influencing the

efficiency of T-DNA transfer during co-cultivation of Antirrhinum

majus with Agrobacterium tumefaciens. Plant Cell Rep. 11: 196-199.

xiv

Hooykas, P.J. And Schilperoort.1992. Agrobacterium and plant genetic

engineering. Plant Molecular Biology. 14: 5-8.

Horsch, R.B., Fry, J., Hoffmann, M., Wallroth, M., Eichholtz, D., Rogers, S.

and Fraley, R.T., 1985. A simple and general method for transferring

genes into plants. Science, 227: 1229-1231.

Hsieh, T.H., Lee, J.T., Yang, P.T., Chiu, L.H., Charng, Y.Y., Wang, Y.C. and

Chan, M.T. 2002.Heterology expression of the Arabidopsis C-

repeat/dehydration response element binding factor1 gene confers

elevated tolerance to chilling and oxidative stresses in transgenic

tomato. Plant Physiol. 129:1086�1094.

Hu, Y., Zhang, L., Zhao, L., Li, J., He, S., Zhou, K., Yang, F., Huang, M., Jiang,

L. and Li, L.2011. Tricho statin A selectively suppresses the cold-induced

transcription of the ZmDREB1 gene in maize. PLoS One. 6: e22132

Iba, K. 2002.Acclimative response to temperature stress in higher plants:

approaches of gene engineering for temperature tolerance. Annual

Review of Plant Biology. 53:225�245.

Ignacimuthu and Prakash. 2006. Agrobacterium � mediated transformation of

chickpea with alpha- amylase inhibitor gene for insect resistance.

J.Biosci.31:331-345

Ignaeimuthu, S., Franklin, G. And Melchias, G.1997. Multiple shoot formation

and in vitro fruiting of Vigna-mungo L. Hepper. Curr. Sci.73:733-735.

Indurkar, S., H. S. Mistra, and E. Susan., 2007. Genetic trasnfermation of

chickpea (Cicer arietinum L.) with insecticidal crystal proteins using

particle gun Bombardment. Plant Cell Rep. 26: 755-763.

Iordachescu, M. and Imai, R.2008.Trehalose biosynthesis in responseto abiotic

stresses. Journal of Integrative Plant Biology.50:1223�1229

xv

Islam .R, Malik .T., Husnain .T and Riazuddin S., 1994. Strain and cultivar

specificity in the Agrobacterium chickpea interaction. Plant Cell

Reports. 13: 561-563.

Islam,M.N. and Islam,K.T. 2010. Agrobacterium � mediated genetic

transformation of Vigno mungo L.Hepper. Cuur.sci.73:733-735

Ito Y., Katsura K., Maruyama K., Taji T, Kobayashi M., Seki M., Shinozaki

K., Yamaguchi-Shinozaki K., 2006. Functional analysis of rice

DREB1/CBF-type transcription factors involved in cold-responsive

gene expression in transgenic rice. Plant Cell Physiol. 47: 141�153.

J.M. and Salinas, J.2003.Mutations in the C2+/ H+ transporter CAX1 increase

CBF / DREB1 expression and the cold-acclimation response in

Arabidopsis. The Plant Cell. 15:2940�2951.

Jaglo, K. R., Kleff, S., Amundsen, K. L., Zhang, X., Haake, V., Zhang, J. Z.,

Deits, T. and Thomashow, M. F. 2001. Components of the Arabidopsis

C-repeat/dehydration-responsive element binding factor cold-response

pathway are conserved in Brassica napus and other plant species. Plant

Physiol.127: 910�917

Jaglo-Ottosen, K. R., Gilmour, S. J., Zarka, D. G., Schabenberger, O. and

Thomashow M. F. 1998. Arabidopsis CBF1 overexpression induces cor

genes and enhances freezing tolerance. Science .280: 104-106

Jaiwal, P.K., 2001. Agrobacterium tumefaciens mediated genetic

transformation of mungbean A recalcitrant grain legume. Plant Science.

161: 239-247.

Jaiwal, P.K., Kumari, R., Ignacimuthu, S., Potrykus, I., Sautter, C. 2007.

Agrobacterium tumefaciens mediated genetic transformation of

mungbean (Vigna radiata L. Wilczek)-a recalcitrant grain legume.

Plant Sci .16:239-47

xvi

James, D.J., Passey, A.J., Barbaro, D.J. and Bevan, M., 1989. Genetic

transformation of apple (Malus pumila M.) using a disarmed Ti-binary

vector. Plant Cell Reports.7: 658-661.

Janssen, B. J., Gardner R. C.,1993. The use of transient GUS expression to

develop an Agrobacterium-mediated gene transfer system for

kiwifruit. Plant Cell Rep. 13: 28-31.

Jayanand, B., G. Sudarsanam, and K. K. Sharma., 2003. An efficient protocol

for the regeneration of whole plant of chickpea (Cicer arietinum) by

using axillary meristem explants derived from in vitro germinated

seedlings. In vitro Cell Division and Biology. 39: 171-179.

Jefferson, R., Goldsbrough, A. and Beven, M. 1990. Transcriptional regulation

of patatin-1 gene in potato. Plant Molecular Biology. 14: 995-1006.

Ji, X., Vanden Ende, W., Schroeven, L., Clerens, S., Geuten, K.,Cheng, S., and

Bennett, J. 2006. The rice genome encodes two vacuolar invertases

with fructan exohydrolase activity but lacks there lated fructan

biosynthesis genes of the Pooideae. New Phytologist.173:50�62.

Joersbo, M. and Brunstedt, J.1992. Direct gene transfer to plant protoplast by

mild sonication. Plant Cell Reports.9: 207-210.

Juntilla, O. and Robberecht, R. 1999. Ecological aspects of cold-adapted plants

with special emphasis on environmental control of cold hardening and

dehardening. In: Margesin R., Schinner F. (Eds),Cold-adapted

organisms ecology, physiology, enzymology and molecular biology.

Springer-Verlag, Berlin, Germany. 57�77.

Junttila, O., Welling, A., Li, C., Berhany, A.T., Palva, E.T.2002. Physiological

aspects of cold hardiness in northern deciduous tree species. Academic

Publishers, Dordrecht, The Netherlands.65�76.

xvii

Kacperska, A. 1999.Plant response to low temperature: signalling pathways

involved in plant acclimation. Springer-Verlag, Berlin,Germany,79�103

Kaneyoshi, J., S. Kobayashi, Y. Nakamura, N. Shigemoto and Y. Doi., 1994. A

simple and efficient gene transfer system of trifoliate orange. Plant Cell

Rep. 13: 541-545.

Kannaiyan, S., 1999. Bioresources Technology for sustainable Agriculture.

Associated publishing Company.New Delhi. 422.

Kaplan, F., Sung, D.Y. and Guy C.L. 2006. Roles of ß-amylase and starch

breakdown during temperature stress. Physiologia Plantarum.126:120�128.

Kar, S., Johnson, T. M., Nayak, P. and Sen, S. K.1996. Efficient transgenic

plant regeneration through Agrobacterium mediated transformation of

chickpea (Cicer arietinum L.). Plant Cell Reports. 16 (1-2): 32-37.

Kasuga, Yamaguchi-Shinozaki, K. and Shinozaki, K.,1994. A novel cis-acting

element in an Arabidopsis gene is involved in responsiveness to

drought, low-temperature, or high-salt stress. Plant Cel. 6: 251�264.

Kasuga, M., Setsuko Miura, Kazuo Shinozaki and Kazuko Yamaguchi-

Shinozaki.2004. A Combination of the Arabidopsis DREB1A Gene and

Stress-Inducible rd29A Promoter Improved Drought and Low-

Temperature Stress Tolerance in Tobacco by Gene Transfer. Plant Cell

Physiol. 45(3): 346�350.

Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K. and Shinozaki, K., 1999.

Improving plant drought, salt and freezing tolerance by gene transfer of a

single stress-inducible transcription factor. Nat. Biotechnol. 17: 287�291.

Kayal, W.E., Navarro, M., Marque, G., Keller, G., Marque, C. and Teulieres.

C.2006. Expression profile of CBF-like transcriptional factor genes

from Eucalyptus in response to cold. Journal of Experimental

Botany.57: 2455�2469.

xviii

Kenji, Miura and Tsuyoshi, Furumot. 2013. Cold Signalling and Cold

Response in Plants. Int. J. Mol. Sci., 14:5312-5337

Khawer, M. K., Sancak, G., Uranbey, S. and Ozan, S. 2004. Effect of

Thidiazuron on shoot regeneration from different explants of Lentil

(Lens cutlinaris Medik) via organogenesis. Turk. J. Bot.2: 45-47.

Khawar, K. M. and Ozcan, S. 2002.Effect of Indole-3-Butryic acid on in vitro

root development in lentil.J.Bot.26:109-111

Khlifi, S. and Tremblay, F. M., 1995 . Maturation of black spruce somatic

embryos. I. Effect of L-glutamine on the number and germinability of

somatic embryos. Plant Cell Tissue Organ Cult. 41: 23� 32.

Klein, T. M., Fromm, M. E. and Gradziel, T.1988. Factors influencing gene,

delivery into Zea mays cells by high velocity microprojectiles.

Biotechnology.6: 559-564.

Komari ,T., Hiei, Y., Saito, Y., Murai N and Kumashiro T., 1996. Vectors

carrying two different T-DNAs for co-transformation of higher plants

mediated by Agrobacterium tumefaciens and segregation of

transformants free from selection markers. Plant J. 10: 165-174.

Komatsu, S., 2007. Over-expression of calcium-dependent protein kinase 13

and calreticulin interacting protein 1 confers cold tolerance on rice

plants. Mol. Genet. Genomics 227: 713�723

Korn, M., Peterek, S., Mock, H.P., Heyer, A.G. and Hincha, D.K.

2008.Heterosis in the freezing tolerance, and sugar and flavonoid

contents of crosses between Arabidopsis thaliana accessions of widely

varying freezing tolerance. Plant, Cell and Environment.31:813�827.

Kovacs, D., Kalmar, E., Torok, Z. and Tompa, P. 2008.Chaperone activity of

ERD10 and ERD14, two disordered stress-related plant proteins. Plant

Physiology.147:381�390.

xix

Krishnamurthy, K. V., K. Suhasini, A. P. Sagare, M. Meixner, A. De-Kathen,

T. Pickardt and Schieder., 2000. Agrobacterium mediated

transformation of chickpea (Cicer arietinum L.) embryo axes. Plant

Cell Reports. 19 (3): 235-240.

Kumar, V. D., P. B. Kirti, J. K. S. Sachan, and V. L. Chopra., 1994. Plant

regeneration via somatic embryogenesis in chickpea. Plant Cell

Reports. 13: 468-472.

Lane, A. and A. Jarvis. 2007. Changes in Climate will modify the Geography

of Crop Suitability: Agricultural Biodiversity can help with Adaptation.

eJournal. 4(1): 1-12, 2007.

Lawrence, P. K. and Koundal, K. R. 2001. Agrobacterium tumefaciens mediated

transformation of pigeonpea (Cajanus cajan L. Millsp) and molecular

analysis of regenerated plants. Current Science. 80: 1428-1432.

Lee, B., Henderson, D.A. and Zhu J.K.2005. The Arabidopsis cold responsive

transcriptome and its regulation by ICE1. The Plant Cell. 17:3155�3175.

Lee, B.H., Henderson, D.A. and Zhu, J.K. 2005.The Arabidopsis cold-

responsive transcriptome and its regulation by ICE1. Plant Cell

17:3155�3175

Lee, J. T., Prasad, V., Yang, P. T., Wu, J. F., Ho, T. H, D., Charng, Y. Y. and

Chan, M. T. 2003.Expression of Arabidopsis CBF1 regulated by an

ABA/stress promoter in transgenic tomato confers stress tolerance

without affecting yield. Plant Cell Environ 26: 1181�1190

Levitt guch, J. 1980. In: Chilling, Freezing, and High Temperature Stress.

Plant Physiology.123:265�274.

Li W., Wang, R., Li, M., Li, L., Wang, C., Welti ,R. and Wang, X.

2008.Differential degradation of extra plastidic and plastic lipids during

freezing and post-freezing recovery in Arabidopsis thaliana. The

Journal of Biological Chemistry, 283:461�468.

xx

Li, H.Y., Zhu, Y.M., Chen, Q., Conner, R, L. and Ding, X.D. 2004.Production

of transgenic sorghum plants with two anti-fungal protein genes via

Agrobacterium and particle bombardment. Biol Plant. 48:367�374

Li, W., Wang, R., Li, M., Li, L., Wang, C., Welti, R. and Wang X.

2008.Differential degradation of extraplastidic and plastidic

lipidsduring freezing and post-freezing recovery in Arabidopsis

thaliana. The Journal of Biological Chemistry.283:461�468.

Lia, X.H., Dai, L.Y. and Zhang J.H.1998. Factors related to cold tolerance at

booting stage in Oryza sativa L. Chinese J. Rice Sci.12:6�10.

Litz, R. E., 1986. Effect of osmotic stress on somatic embryogenesis in Carica

suspension culture. J. Am. Soc. Hortic. Sci. 111: 969�972.

Liu Y., Burch-Smith T., Schiff M., Feng, S. and Dinesh-Kumar S, P., 2004.

Molecular chaperone Hsp90 associates with resistance protein N and

its signaling proteins SGT1 and Rar1 to modulate an innate immune

response in plants; J. Biol. Chem. 279 2101�2108.

Liu, J. and Zhu, J. K. 1998. A calcium sensor homolog requireed for plant salt

tolerance. Science. 280: 1943-1945

Liu, L., Duan, L., Zhang, J.,Zhang, Z., Mi, G. and Ren, H.2010 Cucumber

(Cucumis sativus L.) over-expressing cold-induced transcriptome

regulator ICE1 exhibits changed morphological characters and

enhances chilling tolerance. Sci. Hortic.124, 29�33

Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki,

K. and. Shinozaki, K. 1998. Two transcription factors, DREB1 and

DREB2, with an EREBP/AP2 DNA binding domain separate two

cellular signal transduction pathways in drought- and low-temperature-

responsive gene expression, respectively, in Arabidopsis. Plant

cell.10:1391�1406.

xxi

Liu, Q., Kasuga, M., Miura, S., Yamaguchi-Shinozaki, K. and Shinozaki,

K.1999. Improving plant drought, salt, and freezing tolerance by gene

transfer of a single stress-inducible transcription factor. Nat.

Biotechnol. 17: 287�291.

Liu, W., Parrot, W. A., Hilderbrand, D. F., Collins, G. B. and Williams, E. G.,

1990. Agrobacterium induced gall formation in bell pepper (Capsicum

annuum L.) and formation of shoot like structures expressing

introduced genes. Plant Cell Reports. 9: 360-364.

Livingston, D.P., Premakumar, R. and Tallury, S.P. 2006. Carbohydrate

partitioning between upper and lower regions of the crown in oat and

rye during cold acclimation and freezing. Cryobiology,52:200�208.

Llorente, F., 2000. A freezing-sensitive mutant of Arabidopsis, frs1, is a new

aba3 allele. Planta. 211: 648�655

Loiseau, J., Marche, C., and Deunff, Y. L. 1995. Effects of auxins, cytokinins,

carbohydrates and amino acids on somatic embryogenesis induction

from shoot apices of pea. Plant Cell Tissue Organ Cult. 41: 267�275.

Kasuga, M., Miura1, S., Shinozaki, K. and Yamaguchi-Shinozakil. K. 2004. A

Combination of the Arabidopsis DREB1A Gene and Stress-

Inducible rd29A Promoter Improved Drought-and Low- Temperature

Stress Tolerance in Tobacco by Gene Transfer. Plant Cell Physiol. 45

(3):346-350.

Malik, K.A. and Saxena, P.K., 1992.Thidiazuron induces high-frequency shoot

Regeneration from elite chickpea genotypes. International Chickpea

Newsletter. 29: 4-6.

Mallikarjun, N., Moss, J.P. and Mallikarjun, N., 1993. Regeneration from elite

chickpea genotypes. International Chickpea Newsletter, 29: 4-6.

xxii

Marczak, L., Kachlicki, P., Kozniewski, P., Skirycz, A., Krajewski ,P. and

Stobiecki, M. 2008.Matrix-assisted laser desorption »� LRQL]DWLRQ� WLPH-

of-flight mass spectrometry monitoring of anthocyanins in extracts

from Arabidopsis thaliana leaves. Rapid Communications in Mass

Spectrometry.22:3949�3956.

Maruyama, K., Sakuma, Y., Kasuga, M., Ito, Y., Seki, M., Goda, H., Shimada,

Y., Yoshida, S., Shinozaki, K. and Yamaguchi-Shinozaki, K.2004.

Identification of cold-inducible downstream genes of the Arabidopsis

DREB1A/CBF3 transcriptional factor using two microarray systems.

Plant J. 38:982�993

Matzke, M. A. and Matzke, A. J. M., 1995 . How and why do plants

inactivate homologous (trans) genes. Plant Physiology. 107: 679-685.

Mazzucotelli, E., Tartari, A., Cattivelli, L. and Forlani, G. 2006.Metabolism of

gamma-amino-butyric acid during cold acclimation and freezing and its

relationship to frost tolerance in barley and wheat. Journal of

Experimental Botany.57:3755�3766.

Mckently, A.M., Moore, G.A., Doostdar, N. and Niedz, R.P., 1995,

Agrobacterium mediated transformation of peanut embryoaxes and the

development of transgenic plants. Plant Cell Reports.14: 699-703.

McKersie,B.D.,1994.Oxidativestress.http://www.agronomy.psu.edu/Courses/A

GRO518/Oxygen.htm.

Mehdy, M.C.1994. Active oxygen species in plant defence against pathogens.

Plant Physiol. 105:467�472.

Mehra, K., 1993. Scope of plant biotechnology in developing countries. An

Indian case study in plant tissue culture. J. Sci. Indian Indian Res.

52:795-802.

xxiii

Merkle, S. A., Parrott, P. A., and Flinn, B. S. 1995. Morphogenic aspects of

somatic embryogenesis. In: Thorpe TA (ed) In vitro embryogenesis in

plants. Kluwer, Dordrecht. 155�203.

Meyer, P., 1995. Variation of transgene expression in plants. Euphytica, 85:

359-366.

Miki, B. L.A., Reich, T.J and Iyer, V.N. 1987. Microinjection an experimental

tool for studying and modifying plant cells. In: plant DNA infectious

agent.Ed. Hohn, T. and Schell, J. Springer Verlag, New York, 349-365

Mittler, R., Vanderauwera, S., Gollery, M. and Van Breusegem, F.

2004.Reactive oxygen gene network of plants. Trends in Plant

Science.9:490�498.

Miura, K., Sato, A., Shiba, H. Kang, S.W., Kamada, H. and Ezura, H.

2012.Accumulation of antioxidants and antioxidant activity in tomato,

Solanum lycopersicum, are enhanced by the transcription factor

SlICE1. Plant. Biotechnol.29:261�269.

Miura, K., Shiba, H., Ohta, M., Kang, S.W., Sato, A., Yuasa, T., Iwaya-Inoue,

M. Kamada, H. and Ezura, H. 2012. SlICE1 encoding a MYC-type

transcription factor controls cold tolerance in tomato, Solanum

lycopersicum. Plant Biotechnol.29:253�260.

Moffatt, B., Ewart, V. and Eastman, A. 2006. Cold comfort: plant antifreeze

proteins. Physiologia Plantarum. 126:5�16.

Mogk, A., Schlieker. C., Friedrich, K.L., Schonfeld, H.J., Vierling, E., Bukau,

B.2003.Refolding of substrates bound to small Hspsrelies on a

disaggregation reaction mediated most ef¿FLHQWO\� E\� &OS%� »� 'QD.��

Journal of Biological Chemistry.278:31033�31042.

xxiv

Mohan, K.L. and Krishnamurthy, K,V. 2003.Plant regeneration from

decapitated mature embryo axis and Agrobacterium mediated genetic

transformation of pigeon pea. Biol Plant.46:519�527

Monroy, A.F., Dryanova, A., Malette, B., Oren, D.H., Farajalla, M.R.,Liu, W.,

Danyluk, J., Ubayasena, L.W.C., Kane. K., Scoles, G.J., Sarhan F.and

Gulick P.J.2007. Regulatory gene candidates and gene expression

analysis of cold acclimation in winter andspring wheat. Plant

Molecular Biology. 64:409�423.

Mony Shariful Alam, M.D. Shahidul Haque, Mahabub Alam, Mirza Hasanuzzaman.

2010. Regeneration of Blackgram (Vigna mungo L.) on Changes of

Hormonal Condition.), Not. Bot. Hort. Agrobot. Cluj 38:140-145.

Moore, B., Zhou, L., Rolland, F., Hall, Q., Cheng, W.H., Liu, Y.X., Hwang, I.,

Jones, T., Sheen, J.2003. Role of the Arabidopsis glucosesensor HXK1

in nutrient, light, and hormonal signaling. Science. 300:332�336.

Moore, G., Devos, K.M., Wang, Z., and Gale, M.D.1995,Grasses, line up and

form a circle. Current Biology.5:737�739.

Morran, S., Eini, O., Pyvovarenko, T.,Parent, B.,Singh, R., Ismagul, A., Eliby,

S., Shirley, N.; Langridge, P. and Lopato, S.2011.Improvement of

stress tolerance of wheat and barley by modulation of expression of

DREB/CBF factors. Plant Biotechnol. J. 9: 230�249.

Muhammad, Aasim.,Khalid, mahhmood., Khawar and Sebahattin,ozca. 2008.

In-vitro Micropropagation from shoot Meristems of Turkish cowpea

(Vigna Unguiculata L.) Cv. Akkiz. Bangladesh J. Bot. 37(2): 149-154

Muller, J., Aeschbacher, R.A., Sprenger, N., Boller, T. and Wiemken A. 2000

Disaccharide-mediated regulation of sucrose: fructan-

6fructosyltransferase, a key enzyme of fructan synthesis in barley

leaves. Plant Physiology, 123:265�274

xxv

Murthy, B.N.S., Victor, J., Singh, R.P., Fletcher, R.A. and Saxena, P.K., 1996.

In-vitro regeneration of chickpea (Cicer arietinum L.) stimulation of

direct organogenesis and somatic embryogenesis by thidiazuron. Plant

Growth Regulation. 19: 233-240

Muruganantham, M., Amutha, S., Ganapathi,A. 2010. Somatic embryo productions

by liquid shake culture of embryogenic calluses in Vigna mungo (L.) Hepper

In Vitro Cellular & Developmental Biology. 46(1): 34-40

Muruganantham, M., Ganapathi, A., Samutha, G., Vengadesan and Selvaraj,

N.2005.Shoot regeneration from immature cotyledonary nodes in black

gram. India journal of biotechnology. 4:551-555

Muthukumar, B., Mariamma, M., Veluthambi, K., Gnanam, A. 1996. Genetic

transformation of cotyledon explants of cowpea (Vigna unguiculata L.

Walp.) using Agrobacterium tumefaciens. Plant Cell Rep. 15: 980-985

Nagata, T., K. Okada, T. Kavazu and I. Takale., 1987. Cauliflower mosaic

virus 35S promoter directs S-phase specific expression in plant cells.

Molecular Genera.36: 1276-1279

Nakashima, K. and Yamaguchi-Shinozaki K.2006.Regulons involved in

osmotic stress-responsive and cold stress-responsive gene expression in

plants. Physiologia Plantarum.126:62�71.

Nakayama, K., Okawa, K., Kakizaki, T. and Inaba, T.2008.Evaluationof the

protective activities of a late embryogenesis abundant (LEA) related

protein, Cor15am, during various stresses in vitro. Bioscience,

Biotechnology and Biochemistry. 72:1642�1645.

Navarro, M., Marque, G., Ayax, C., Keller, G., Borges, J.P., MarqueC. And

Teulieres, C.2009. Complementary regulation of four Eucalyptus CBF

genes under various cold conditions. Journal of Experimental Botany,

60:2713�2724.

xxvi

Neelam, A., Reddy, C. S., and Reddy, G. M.1986. Plantlet regeneration from

callus cultures of Cicer arietinum. International Chickpea Newsletter.

14: 12-13.

Nick, P., 2000.Control of the response to low temperatures. Springer, Berlin.

Germany, 121�135

Nishida,I. And Murata, N., 1996. Chilling sensitivity in plant and cyan

bacteria: The cucial contribution of membrane lipids .Annu. Rev. Plant

Physiology. Plant Mol.Biol.47.541-568.

Nishizawa, A., Yabuta, Y. and Shigeoka, S.2008.Galactinol and raffinose

constitute a novel function to protect plants from oxidative damage.

Plant Physiology. 147:1251�1263.

Novillo, F., Alonso, J.M., Ecker, J.R. and Salinas, J. 2004.CBF2 »�'5(%�& is a

negative regulator of CBF1 »�'5(%�% and CBF3 »�'5(%�$ expression

and plays a central role in stress tolerance in Arabidopsis. Proceedings

of the National Academy of Sciences USA.101:3985�3990.

Odutayo, O. I., Akinirinusi, F. B., Odunbososye, I. and Oso, R. T. 2005.

Multiple shoot induction from embryo derived callus cultures of

cowpea (Vigna ungimculata L.). Walp. African J. of Biotechnology. 4:

1214-1216.

Oh, S.J., Kwon, C.W., Choi, D.W., Song, S.I. and Kim, J.K.2007. Expression

of barley HvCBF4 enhances tolerance to abiotic stress in transgenic

rice. Plant Biotechnology Journal. 5:646�656.

Oh, S.J., Song, S.I., Kim, Y.S., Jang, H.J., Kim, S.Y., Kim, M., Kim, Y.K.,

Nahm, B.H. and Kim, J.K. 2005. Arabidopsis CBF3/DREB1A and

ABF3 in transgenic rice increased tolerance to abiotic stress without

stunting growth. Plant Physiol.138: 341�351.

xxvii

Okawa, K., Nakayama, K., Kakizaki, T., Yamashita, and T., Inaba T.2008

Identification and characterization of Cor-413im proteins as novel

components of the chloroplast inner envelope. Plant, Cell and

Environment. 3:1470�1483.

Oliver, S.N, Dennis, E.S. and Dolferus, R. 2007. ABA regulates apoplastic

sugar transport and is a potential signal for cold induced pollen sterility

in rice. Plant Cell Physiol.48:1319�1330.

Oliver, S.N, Van Dongen, J.T., Alfred, S.C., Mamun, E.A., Zhao, X.C., Saini,

H.S., Fernandes, S.F., Blanchard, C.L., Sutton, B.G., Geigenberger, P.,

Dennis, E.S. and Dolferus, R. 2005.Cold induced repression of the rice

anther-specific cell wall invertase gene OSINV4 is correlated with sucrose

accumulation and pollen sterility. Plant Cell Environ.28:1534�1551.

Oono, Y., Sekim, M., Nanjo,T., Narusaka, M., Fujita, M., Satoh, R., Satou, M.,

Sakurai, T., Ishida, J., Akiyama, K., Iida, K., Maruyama, K., Satoh, S.,

Yamaguchi-Shinozaki,K., and Shinozaki, K., 2003. Monitoring

expression profiles of Arabidopsis gene expression during rehydration

process after dehydration using ca.7000 full-length cDNA microarray.

Plant J. 34: 868�887.

Orvar, B. L., 2000. Early steps in cold sensing by plant cells: the role of actin

cytoskeleton and membrane fluidity. Plant J. 23: 785�794

Owens,C. L ., Thomashow, M. F., Hancock, J. F. and Iezzoni, A. F. 2002. CBF1

orthologs in sour cherry and strawberry and the heterologous expression

of CBF1 in strawberry. J.Am. Soc. Hortic. Sci. 127: 489�494.

Patel M. B., Bhardwa, R., and Johi, A.1991. Organogenesis in Vigna radiata

(L.)Wilczek. Indian J. Exp. Biol. 29: 619�622.

Pearce, R.S., Dunn, M.A., Rixon, J.E., Harrison, P. and Hughes M.A.1996.

Expression of cold-induced genes and frost hardiness inthe crown

meristem of young barley (Hordeum vulgare L. cv.Igri) plants grown in

different environments. Plant, Cell and Environment.12:275�290.

xxviii

Pellegrineschi, A., Reynolds, M., Pacheco, M., Brito, R.M., Almeraya, R.,

Yamaguchi-Shinozaki, K. and Hoisington, D.2004.Stress-Induced

expression in wheat of the Arabidopsis thaliana DREB1A gene delays water

stress symptoms under greenhouse conditions. Genome 47:493�500.

Perl A., Lotan O., Abu-Abied M., Holland D., 1996. Establishment of an

Agrobacterium-mediated transformation system for grape (Vitis

vinifera L.): The role of antioxidants during grape-Agrobacterium

interactions. Natur Biotechnol. 14: 624-628.

Philips, G. C. and Gamborg, O. L. 2005. Plant cell tissue and organ culture.

Published by N. K. Mehra. Narosa publishi ng house 6, community

centre. New Delhi, India.91-93.

Polisetty, R., Paul, V., Devashwar, J.J., Khetarpal, S., Suresh, K. And

Chandra, P., 1997. Multiple shoot induction by benzyladenine and

complete plant regeneration from seed explants of chickpea (Cicer

arietinum L.). Plant Cell Report. 16 (8): 565-571.

Potjamarn Suraninpong.,Sontichai Chanprame, Hyeon-JE CHO., Jack M.

Widholm and Areewaranyuwat., 2004. Agrobacterium-mediated

Transformation of Mungbean [Vigna radiata(L.) Wilczek]. Walailak. J

Sci & Tech . 1(2):38-48.

Potrykus, I. 1991. Gene transfer to plants: Assessment of published approaches

and results. Annu.Rev.Plant Physiol.Plant Mol.Biol, 42:205-225

Priya Srivastava., Anjana Pandey., 2011.Standardization of Callus Induction

and Plant Regeneration from Leaf Explants of Black Gram (Vigna

mungo var. silvestris). International Journal of Innovations in

Biological and Chemical Sciences .1: 1-6.

Pu, X-A. and Goodman R.N. 1992. Induction of necrosis by Agrobacterium

tumefaciens on grape explants. Physiol. Mol. Plant Pathol. 41: 245--254.

xxix

Qin, F., Sakuma, Y., Li, J., Liu, Q., Li, Y.Q., Shinozaki, K. and Yamaguchi-

Shinozaki, K. 2004.Cloning and functional analysis of a novel

DREB1/CBF transcription factor involved in cold-responsive gene

expression in Zea mays L. Plant Cell Physiol., 45, 1042�1052.

Rajashekar C.B. 2000. Cold response and freezing tolerance in plants. In:

Wilkinson R.E.(Ed.), Plant�environment interactions, 2nd edition.

Marcel Dekker, Inc., New York, USA. 321�341

Ramakrishnan, K., Gnanam, R., Sivakumar, P. and Manickam, A. 2005. In

vitro somatic embryogenesis from cell suspension cultures of cowpea

[Vigna unguiculata (L.) Walp]. Plant Cell Rep 24: 449�461.

Radhakrishna and Ranjithakumari, 2007. Morphological and agronomic

evaluation of tissue culture derived Indian soybean plants[J]. Acta

Agriculturae Scandinavica. 91:391-396

Ramana, R.V. and Sadanandam, D.A., 1997. Differential morphogenic

response of chickpea and Agrobacterium mediated genetic

transformation. In vitro, 33(3): 2,56A.

Raman,S., Sonia, M.,Seema, B., Anila, B. and Jaiwal, P.K.2004.An improved

protocol of plant regeneration via somatic embryogenesis in cell

suspension culture of black gram.Physiol.Mol.plants.24:121-125

Rasolofo, P.R.1986.Screening rice cultivars at seedling stage and anthesis for

low temperature tolerance in Madagascar. IRRN. 11:12�13.

Raveendar.S. and. Ignacimuthu. 2010. Improved Agrobacterium Mediated

Transformation in Cowpea Vigna unguiculata L. Walp. Asian Journal

of Plant Sciences.9: 256-263.

Reddy, K.J., Vanidevi, K., Redy, S.M., Rao, D. and Vidyavati. 2001.

Perspectives in biotechnology. Proceedings of a National Symposium,

Warangal, India. 131-132.

xxx

Reddy, K.J., Vanidevi, K., Redy, S.M., Rao, D. and Vidyavati., 2001.

Perspectives in biotechnology. Proceedings of a National Symposium,

Warangal, India, 26-27February.131-132.

Register, J. C., Peterson, D. J., Bell, B. J., Bullock, W. P., Evans, I. J. and Jiao,

S.1994. Structure and function of selectable and non-selectable

transgenes in maize after introduction by particle bombardment. Plant

Molecular Biology.25(6): 951-961.

Renaut, J., Lutts, S., Hoffmann, L. and Hausman J.F.2004. Responses of poplar

to chilling temperatures: proteomic and physiological aspects. Plant

Biology, 6:81�90

Richter T.E, Ronald P.C.2000. The evolution of disease resistance genes. Plant

Mol. Biol. 42: 195�204.

Riva, de laz., 1998. Agrobacterium tumefaciens: a natural tool for plant

transformation EJB Electronic Journal of Biotechnology .3

Rizvi, S.M.H., Jaiwal, P.K. and Singh, R.P., 2002. A possible involvement of

cellular polyamine level in thidiazuron induced somatic embryogenesis

in chickpea. Role(Cicer arietinum L.). Indian Journal of Experimental

Biology, 36 (6): 605-609.

Rolland, F., Baena-Gonzales E. and Sheen, J.2006. Sugar sensing and

signalling in plants: conserved and novel mechanisms. Annual Review

of Plant Biology, 57:675�709

Roy, S. K., Haque, M.S. and Siddiqua, M.K.2007.Plant regeneration through

direct regeneration through multiple shoot formation in black gram.

Progress.Agric. 18(2):11-16

Saghai-Maroof, M. A., K. M. Salimar, R. A. Jorgenson, and R. S. Allard.,

1984. Ribosomal DNA-spacer length polymorphism in barley,

Mendalian inheritance, Chromosomal location and population

dynamics. Proc. Natl. Acad. Sci. USA. 81: 8014-8018.

xxxi

Sahoo, L., Sugla, T., Jaiwal, P.K., 2003. In vitro regeneration and

transformation of cowpea, mungbean, urdbean, and azukibean. In:

Biotechnology for the improvement of legumes. Part-B. Kluwer Acad.

Publishers. Netherlands.89-120.

Saini J.P., Tandon J.P., 1985. Evaluating rices for cold

tolerance. IRRN.10:9�10.

Saini, R. and Jaiwal, P.K.2007.Agrobacterium tumifacines mediated

transformation of Blackgram: an assessment of factors influcing the

efficiency of UidA gene transfer. Biologia Plantarum.51(1):69-74

Sambrook, J. and D. W. Russel., 2001. Molecular Cloning - A Laboratory

Manual, Cold Spring Harbour Laboratory, Cole Spring Harbour, New

York.108-112

Sambrook, J., E. F. Fritsch and T. Maniatis., 1989. Molecular Cloning. A

laboratory manual, second edition, cold spring, Harbour Laboratory

Pres .103-107.

Sanford, J. C., Wolf, E. D. and Allen, N. K.1990. Method for

transporting substances into living cells and tissues and apparatus

therefore. US Pat No,4: 954-1050.

Sanghera G.S., Wani S.H., 2008. Innovative approaches to enhance genetic

potential of rice for higher productivity under temperate conditions of

Kashmir. J. Plant Sci. Res.24:99�113.

Sanghera G.S., Zarger M.A., Anwar A., Singh S.P., Ahmad N., Rather M.A.,

2001.Studies on spikelet fertility and incidence of leaf blast on certain

IRCTN rice genotypes under temperate conditions. Paper presented at

National Symposium on plant Protection Strategies for sustainable

Agri-Horticulture, SKAUST-Jammu. Oct 12-13, p. 125.

xxxii

Sangwan. R.S, Bourgeois, Y., Brown, S., Yasseur, G. and Sangwan-Norreel,

B., 1992.Characterization of competent cells and early events of

Agrobacterium-mediated genetic transformation in Arabidopsis

thaliana. Planta 188: 439-456.

Sangwan, V.,2001. Cold-activation of Brassica napus BN115 promoter is

mediated by structural changes in membranes and cytoskeleton, and

requires Ca2+ influx. Plant J. 27: 1�12.

SankaraRao, K.1996. Embryogenesis in flowering plants: Recent approaches

and prospects. J. Biosci.21: 827�841.

Santalla. M., Power J. B and. Davey, M. R 1998. Efficient in vitro shoot

regeneration responses of Phaseolus vulgaris and P. coccineus.

Euphytica 102:195�202.

Sanyal, I., Singh, A. K. and Amla, D. V. 2003. Agrobacterium tumefaciens

mediated transformation of chickpea (Cicer arietinum L.) using mature

embryonic axes and cotyledonary nodes. Indian Journal of


Sarmah, B. K., Moore, A., Tate, W., Molvig, L., Morton, R. L., Rus, D. P.,

Chiaiese, P., Maarten, J. C.,. Tabe, L. M. and Higgins, T. J. V. 2004.

Transgenic chickpea seeds expressing high levels of a bean á-amylase

inhibitor. Molecular Breeding. 14: 73-82.

Satoh, R., Nakashima, K., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki,

K. 2002. ACTCAT, a novel cis-acting element for proline and hypo

osmolality responsive expression of the ProDH gene encoding proline

dehydrogenase in Arabidopsis. Plant Physiol. 130: 709�719.

Senthil, G., Williamson, B.,. Dinkins, R. D. and G. Ramsay., 2004. An efficient

transformation system for chickpea (Cicer arietinum). Plant Cell

Report. 23: 297- 303.

xxxiii

Shalini, Shikha., BATRA, P., Sindhu, A. and Chowdhury, U.K., 2001. Multiple

shoot induction and complete plant regeneration of chickpea (Cicer

arietinum L.). Crop Research Hisar, 21 (3): 308-311.

Sharma, K.K. and Anjaiah, V. 2000. An efficient method for the production of

transgenic plants of peanut (Arachis hypogaea L.) through Agrobacterium

tumefaciens-mediated genetic transformation. Plant Sci. 159: 7�19.

Sharma, L. and Amla, D.V., 1998. Direct shoot regeneration in chickpea (Cicer

arietinum L.). Indian Journal of Experimental Biology, 36 (6): 605-609.

Shen, Y. G., Zhang, W. K., He, S. J., Zhang, J. S., Liu, Q. and Chen, S. Y.

2003. An EREBP/AP2-type protein in Triticum aestivum was a DRE-

binding transcription factor induced by cold, dehydration and ABA

stress. Theor Appl Genet. 106: 923�930

Shinozaki, K. and Yamaguchi-Shinozaki K.1996.Molecular response to

drought and cold stress. Curr. Opin. Plant Biol.7:161�167.

Shinozaki, K. and Yamaguchi-Shinozaki K.2000.Molecular response to

dehydration and low temperature: differences and cross-talk between

two stress signalling pathways. Current Opinion in Plant

Biology.3:217�223.

Shinozaki, K. and Yamaguchi-Shinozaki, K., 1997. Gene expression and signal

transduction in water stress response. Plant Physiol. 115: 327�334.

Shinozaki, K., Yamaguchi-Shinozaki, K. and Seki, M., 2003. Regulatory

network of gene expression in the drought and cold stress

responses. Curr. Opin. Plant Biol. 6:410�417.

Shiv Prakash, N., Pental, D. and Bhalla-Sarin, N.1994. Regeneration of

pigeonpea (Cajanus cajan) from cotyledonary node via multiple shoot

formation. Plant Cell Rep. 13:623�627

xxxiv

Shivakumar, P., Gnanam1, R., Ramakrishnan K. and Manickam, A. 2010.

Regeneration of Vigna radiate. Biologia. plantaru. 54 (2): 245-251,

Siddiqua, M. and Nassuth, A. 2011. Vitis CBF1 and Vitis CBF4 differ in their

effect on Arabidopsis abiotic stress tolerance, development and gene

expression. Plant Cell Environ. 34:1345�1359.

Sing, B. D.2007. Biotechnology Expanding Horizon. Kalyani publishers,

Ludhiana, India. 343.

Singh B.D.2000. Plant Breeding. Kalyani Publishers, Ludhiana, India. 443�

460.

Singh, Rajendrer., Jat, R. S., Sahoo, P.D., Srinivasan and Singh, R. 2002.

Thidiazuron induced multiple shoot formation in chickpea (Cicer

arietinum L.). Journal of Plant Biochemistry and Biotechnolog. 11 (2):

129-131.

Sita Mahalakshmi, L., Leela, T, Kiran, B., Naresh, B. and Devi, P.2006. In

vitro plant regeneration from the petioles of primary leaves of

Mungbean Vigna radiata L. Plant Biotech. 23: 409-411.

Sita Mahalakshmi, L., Leela, T., Manoj Kumar, S., Kiran Kumar, B., Naresh,

B. and Prathibha, D. 2006. Enhanced genetic transformation efficiency

of mungbean by use of primary leaf explants, Current science, 91:1.

Skinner, J.S., von Zitzewitz, J., Szucs, P., Marquez-Cedillo, L., Filichkin, T.,

Amundsen, K., Stockinger, E.J., Thomashow, M.F., Chen, T.H. and Hayes,

P.M. 2005.Structural, functional, and phylogenetic characterization of a

large CBF gene family in barley. Plant Mol. Biol. 59:533�551.

Skokut, T. A., Manchester, J. and Schaefer, J.1985. Regeneration in Alfalfa

tissue culture: Stimulation of somatic embryo production by amino

acids and N-15 NMR determination of nitrogen utilization. Plant

Physiol. 79: 579�583.

xxxv

Skoog and Miller. 1957. Chemical regulation of growth and organ formulation

in plant tissue culture in-vitro . Symposium of soxen Experiment

Biology.11:118-131.

Smith. V. H. and Jimmerson, J. 2005.Chick pea (Garbanzo Beans) Briefing No.

55:25-30.

Sonia, saini R. and jaiwal, P. K., 2007. Agrobacterium tumefaciens mediated

transfer of Phaseolus Vugaris á �amylase inhibitor-1 gene into Vigna

radiate (L) Wilczek using bar as selectable marker. Plant Cell Rep.

26:187-198.

Southern, E. M.1975. Detection of specific sequences among the DNA

fragments separated by gel electohorosis. J. Nol. Biol. 98: 503-517.

Srivastava, P. And Pandey, A. 2011. Standardization of callus induction and

plant regeneration from leaf explants of black gram (vigna mungo var.

Silvestris). International Journal of Innovations in Biological and

Chemical Sciences I: 1-6.

Stachel, S.E., Nester, E. W. And Zambryski, P., 1996.A plant cell factor

induces Agrobacterium tumefaciens vir gene expression. Proc. Nat.

Acad. Sci.USA. 83:379-383.

Stachel, S.E., Messens, E., Van,M. And Zambryski, P.,1985.Identification of

signal molecules produced by wounded plant cell that activates T-DNA

transfer in Agrobacterium tumefaciens. Nature.318:624-629.

Strickland, S. G., Nichol, J. W., and Stuart, D. A. 1987. Effect of carbohydrate

source on alfalfa somatic embryogenesis. Plant Sci. 48: 113�121.

Stuart, S., and Strickland, S.1984. Somatic embryogenesis from cell cultures of

Medicago sativa L. II. The interaction of amino acids with ammonium.

Plant Sci. Lett. 34: 174�181.

xxxvi

Subhadra, R.K., Vashishat, J.B., Chowdhury, M., Singh and Sareen, P.K.,

1998. Multiple shoots from cotyledonary node explants of non-

nodulating genotype (ICC 435 M) of chickpea (Cicer arietinum L.).

Indian Journal of Experimental Biology.36:1276-1279

Sukapinda, K., Kozuch, M. E., Wilson, B. R., Aniley, W. M. and Merlo, D. J,

1993.Transformation of maize protoplast and regeneration of haploid

transgenic plants. Plant Cell Reports. 13: 63-68.

Sumitha, A., Pratap, J.H. and Bidyut, K.S.2012. Effect of TDZ on in vitro

Regeneration of black gram embryonic Axes.j. crop sci.

Biotech.15(4):311-318

Sun, W., Van Montagu, M. and Verbruggen, N.2002.Small heat shock proteins

and stress tolerance in plants. Biochimica Biophysica Acta, 1577:1�9.

Surya-Prakash., Chowdhury, J.B., Jain, R.K. And Chowdhury, V.K., 1992.

Factors affecting plant regeneration in chickpea. Indian Journal of

Experimental Biology. 30: 1149-1153.

Sushil, K.Y., Sweety, K., Varalaxmi, Y., Annapuma, K., Jyothi, L.N.,Vanaja,

M., Maheswari M.,Aurn,K.S.,Venkateswralu, B. and Pulugurtha, B.

2012.optimization of Agrobacterium mediated genetic transformation

of cotyledonary node explant of Vigna radiata. Springer plus.1:59

Tabaei-Aghdaei, S.R., Pearce, R.S. and Harrison, P.2003.Sugars regulate cold-

induced gene expression and freezing-tolerance in barley cell cultures.

Journal of Experimental Botany. 54:1565�1575.

Tantau, H., Balko C., Brettschneider, B., Melz, G. and Dorffling, K.2004.

Improved frost tolerance and winter survival in winterbarley (Hordeum

vulgare L.) by in vitro selection of proline over accumulating lines.

Euphytica, 139:19�32

xxxvii

Tateishi, Y.1996. Systematics of the species of Vigna subgenus Ceratotropis.

In "Mungbean Germplasm: Collection, Evaluation and Utilization for

Breeding Program" JIRCAS Working Report .2:9- 24.

Taylor, M. G. and Vasil, I. K. 1991. History of the physical factors affecting

transient GUS expression in pearl millet embryos following

microprojectile bombardment. Plant Cell Reports, 10: 120-125.

Tewari-Singh, N., Sen, J., Kiesecker, M., Reddy, V. S., Jawbsen, H. J. and

Guhamukherjee, S. 2004. Use of a herbicide or lysine plus threonine for

no antibiotic selection of transgenic chickpea. Plant Cell Reports. 22:

576-583

Thomashow, M. F., 1998. Role of cold-responsive genes in plant freezing

tolerance. Plant Physiol. 118: 1-7

Thomashow, M.F. 1999.Plant cold acclimation: Freezing tolerance genes and

regulatory mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol.

50:571�599.

Thomson, A. M., Brown, R. A., Rosenberg, M. J., Izaurralde, R. C. and

Benson, V.2005. Climate change impacts for the conterminous USA:

An integrated assessment. Part 3. Dry land production of grain and

forage crops. Climent Change. 69: 43-65.

Thorne, G. C. H., Santarem, E. R. and Ferreira, A. G.1995. Adventitious bud

induction and plant regeneration from soybean cotyledonary nodes. Int

J Expt Bot. 57:127�35.

Timperio, A.M., Egidi, M.G., and Zolla, L.2008.Proteomics applied onplant

abiotic stresses: role of heat shock proteins (HSP). Journal of

Proteomics. 71 :391�411.

xxxviii

Tommasini, L., Svensson, J.T., Rodriguez, E.M., Wahid, A., Malatrasi, M.,

Kato, K., Wanamaker, S., Resnik, J. and Close, T.J.2008. Dehydrin

gene expression provides an indicator of low temperature and drought

stress: transcriptome-based analysis of barley (Hordeum vulgare L.).

Functional and Integrative Genomics.8:387�405.

Torres, M.A. and Dangl, J.L.2005.Functions of the respiratory burstoxidase in

biotic interactions, abiotic stress and development. Current Opinion in

Plant Biology, 8:397�403.

Trieu, A.T., Burleigh, S.H., Kardailsky, I.V., Maldonado-Mendoza, I.E.,

Versaw, W.K., Blerplock, L.A., Shin, M., Chiou, T.J., Katageri, H.,

Derobre, G.R., Weigel, D. and Harrison, M.J., 2000. Transformation of

Medicago truncatula via infilteration of seedlings or flowering plants

with Agrobacterium. Plant Journal.22: 531-541.

Uemura, M., Tominaga, Y., Nakagawara, C., Shigematsu, S., Minami, A. and

Kawamura, Y.2006. Responses of the plasma membrane to low

temperatures. Physiologia Plantarum, 126:81�89.

Uranbey S, Sevimay, .S., Kaya, M., Ipek , Sancak , Basalma , Ozcan, .S., 2005

. Influence of different co-cultivation temperatures, periods and media

on Agrobacterium tumefaciens-mediated gene transfer. Biol. Plant. 49:

53-57.

Usadel, B., Blasing, O.E., Gibon, Y., Retzlaff, K., Hoehne, M.,Valluru R., Van

den Ende W.2008. Plant fructans in stress environments: emerging

concepts and future prospects. Journal of Experimental

Botany.59:2905�2916.

Vagujfalvi, A., Galiba, G., Cattivelli, L. and Dubcovsky, J.2003. The cold

regulated transcriptional activator Cbf3 is linked to the frost-tolerance

locus Fr-A2 on wheat chromosome 5A. Mol Genet Genomics. 269: 60�67.

xxxix

Valluru, R., Lammens, W., Claupein, W., Van den Ende, W. 2008. Freezing

tolerance by vesicle-mediated fructan transport. Trends in Plant

Science, 13: 409�414.

Van Buskirk, H.A. and Thomashow, M.F.2006. Arabidopsis

transcriptionfactors regulating cold acclimation. Physiologia

Plantarum.126:72�80.

Vani, A.K.S, Reddy, V.D. 1996. Morphogenesis from callus cultures of

chickpea Cicer arietinum L. Indian Journal of Experimental Biology.

34: 285-287.

Vargas, W.A., Pontis, H.G. and Salerno G.L. 2007.Differential expression of

alkaline and neutral invertases in response to environmental stresses:

characterization of an alkaline isoform as a stress-response enzyme in

wheat leaves. Planta.226:1535�1545.

Varisai Mohamed, S., Wang, C. S., Tiruvengadam, M., and Jayabalan, N. 2004.

In vitro plant regeneration via somatic embryogenesis through cell

suspension cultures of Horsegram [Macrotyloma uniflorum (Lam.)

Verdc.]. In Vitro Cell Dev. Biol. Plant 40: 284�289.

Vaultier, M.N., Cantrel, C., Vergnolle, C., Justin, A.M., Demandre,C.,

Benhassaine-Kesri, G., Cicek, D., Zachowski, A., and Ruelland E.

2006. Desaturase mutants reveal that membrane rigidification acts as a

cold perception mechanism upstream of the diacylglycerol kinase

pathway in Arabidopsis cells. FEBS Letters.580:4218�4223.

Verdcourt,B. 1970. Studies in the Leguminosae - Papilionoideae for the "Flora

of Tropical East Africa". Kew Bulletin. IV:24.

Vergnolle, C.2005. The cold-induced early activation of phospholipase C and

D pathways determines the response of two distinct clusters of genes in

Arabidopsis cell suspensions. Plant Physiol. 139: 1217�1233.

xl

Viswanathan, C. and Zhu, J. K.2002. Molecular genetic analysis of cold-

regulated gene transcription. Philos. Trans. R. Soc. Lond. B. 357: 877�

886.

Wang, W., Vinocur, B. and Altman, A. 2007. Plant responses to drought,

salinity and extreme temperatures towards genetic engineering for

stress tolerance. Planta. 218: 1-14.

Wang, X., Li, W., Li, M. and Welti, R. 2006. Profiling lipid changes in plant

response to low temperatures. Physiologia Plantarum.126:90�96

Wang, Y.2005. Molecular tailoring of farnesylation for plant drought tolerance

and yield protection.Plant J.43:413-449.

Wang,W., Vinocur, B. and Altman, A. 2003. Plant responses to drought,

salinity and extreme temperatures: towards genetic engineering for

stress tolerance. Planta, 218:1�14.

Welling, A. and Palva, E.T. 2008.Involvement of CBF transcription factors in

winter hardiness in birch. Plant Physio.l147: 1199�1211.

Wetherell, D. F.1984. Enhanced adventive embryogenesis resulting

fromplasmolysis of cultured wild carrot cell. Plant Cell Tissue Organ

Cult. 3: 221�227.

Williams, M. E., 2005. Mutations in the Arabidopsis phosphoinositide

phosphatase gene SAC9 lead to overaccumulation of PtdIns (4, 5) P2

and constitutive expression of the stress-response pathway. Plant

Physiol. 138: 686�700.

Wisniewski, M. and Fuller, M.1999. Ice nucleation and deep super cooling in

plants: new insights using infrared thermography. In :Margesin R.,

Schinner F. (Eds),Cold-adapted organisms ecology,physiology,

enzymology and molecular biology. SpringerVerlag, Berlin,

Germany:105�118.

xli

Wojtaszek, P., 1997. Oxidative burst: an early plant response to pathogen

infection. Biochem. J. 322: 681 - 691.

Wormit, A., Trentmann, O., Feifer, I., Lohr, C., Tjaden, J., Meyer, S., Schmidt,

U., Martinoia, E. and Neuhaus, H.E.2006. Molecular identification and

physiological characterization of a novel monosaccharide transporter

from Arabidopsis involved in vacuolar sugar transport. The Plant

Cell.18:3476�3490

Xiao, W., Sheen, J. and Jang, J.C. 2000 The role of hexokinase in plant sugar

signal transduction and growth and development. Plant Molecular

Biology, 44:451�461.

Xin, Z. and Browse, J. 2001. Cold comfort farm: the acclimation of plants to

freezing temperatures. Plant Cell Environ. 23:893�902.

Xiong, L. 2001. The Arabidopsis LOS5/ABA3 locus encodes a molybdenum

cofactor sulfurase and modulates cold stress- and osmotic stress�

responsive gene expression. Plant Cell. 13: 2063�2083.

Xiong, L. and Zhu J.K. 2001.Abiotic stress signal transduction in plants.

Molecular and genetic perspectives. Physiologia Plantarum. 112:152�

166

Xiong, L., Schumaker, K.S. and Zhu, J.K.2002.Cell signaling during cold,

drought, and salt stress. The Plant Cell. 14:S165�183.

Xiong, Y. and Fei, S.Z.2006. Functional and phylogenetic analysis of a

DREB/CBF-like gene in perennial ryegrass (Lolium perenne L.).

Planta, 224: 878�888

Varalaxmi, Y., Prasanna, A., Yadav, S.K., Venkateswarlu, B. and Maheswri.

M.2013. optimization of parameters for Agrobacterium mediated

transformation of black gram using cotyledon explant.12(11):1209-

1216

xlii

Varalaxmi,Y., Vijaylakshmi, A., Yadav, S.K., Venkateswarlu, B.and

Maheswri, M.2007. Efficient plant regeneration from cotyledons of

Black gram. India Journal of biotechnology. 6:414-417.

Yadav, S.K., Sreenu, P., Maheswari, M., Vanaja, M. and Venkateswarlu,

B.2010.Efficient shoot regeneration from double cotyledonary node

explants of green gram (vigna radiate (L) Wilczek) India journal of

biotechnology .9:403-407.

Yamaguchi-Shinozaki K. and Shinozaki K., 1996.A novel cis-acting element in

an Arabidopsis gene is involved in responsiveness to drought, low-

temperature, or high-salt stress. Plant Cell.6 (2):251�264.

Yamaguchi-Shinozaki, K, and Shinozaki K.2006.Transcriptional regulatory

networks in cellular responses and tolerance to dehydration and cold

stresses. Annu. Rev. PlantBiol.57:781�803

Yamaguchi-Shinozaki, K. and Shinozaki, K., 2005.Organization of cis-acting

regulatory elements in osmotic- and cold-stress-responsive promoters.

Trends Plant Sci. 10: 88�94.

Yamaguchi-Shinozaki., K. and Shinozaki,K., 1994. A novel cis-acting element

in an Arabidopsis gene is involved in responsiveness to drought, low-

temperature, or high-salt stress. Plant Cell. 6: 251�264.

Yang, W., Liu, X.D., Chi, X.J., Wu, C.A., Li, Y.Z., Song, L.L., Liu, X.M.,

Wang, Y.F., Wang, F.W., Zhang, C., and Liu, Y.2011.Dwarf apple

MbDREB1 enhances plant tolerance to low temperature, drought, and

salt stress via both ABA-dependent and ABA-independent pathways.

Planta, 233: 219�229

Zambryski, P., Joos, H., Genetello, C., Leemans, J., Vanmontagu, M.

Andschell, J.1983. Ti plasmid vector for the introduction of DNA into

plant cells without alteration of their normal regeneration capacity.

European Molecular Biology Organization Journal. 2: 2143-2150.

xliii

Zarka, D.G., Vogel, J.T., Cook, D. and Thomashow, M.F.2003. Cold induction

of Arabidopsis CBF genes involves multiple ICE (inducer of CBF

expression) promoter elements and a cold-regulatory circuit that is

desensitized by low temperature. Plant Physiology, 133:910�918.

Zhang, X., Fowler, S.G., Cheng, H., Lou, Y., Rhee, S.Y., Stockinger, E.J. and

Thomashow, M.F. 2004.Freezing-sensitive tomato has a functional

CBF cold response pathway, but a CBF regulon that differs from that

of freezing-tolerant Arabidopsis. Plant J.39:905�919

Zhao X., Dolferuf R., Darvey N., 2008. Precision breeding of cold tolerant

rice. IREC Farmers Newsletter. 177:12�13.

Zhu, J. K., J. Liu, and L. Xiong .1998. Genetic analysis of salt tolerance in

Arabidopsis: evidence for the critical role of potassium nutrition. Plant

Cell 10: 1181-1191.

Zhu, J., Jeong, J.C., Zhu, Y., Sokolchik, I., Miyazaki, S., Zhu, J.K., Hasegawa,

P.M., Bohnert, H.J., Shi, H., Yun, D.J. and Bressan, R.A.2008.

Involvement of Arabidopsis HOS15 in histone deacetylation and cold

tolerance. Proceedings of the National Academy of Sciences USA,

105:4945�4950.

xliv

APPENDICES

Appendix I. Tissue culture Media composition

MS media composition:

The basal media used for all the experiments is MS medium (Murashige

and Skoog, 1962).

Stock solutions:

Stock solutions are prepared by dissolving the chemicals of analytical

grade in double distilled water and storing them in brown bottles.

A.20X MS macro nutrients stock (per litre);

All the chemicals are mixed well on a magnetic stirrer and the volume is

made up to one litre using double distilled water and refrigerated at 40C.

B. 1000X MS micro nutrients stock (per litre);

Chemical Required amount

(in g/L)

H3BO3 6.22 g

MnSO4.H2O 22.40 g

ZnSO4 8.60 g

KI 0.83 g

Na2MoO4.2H2O 0.25 g

CuSO4.5H2O 25 mg

CoCl2.6H2O 25 mg

Chemical Required amount (in g/L)

KNO3 38.0 g

NH4 NO3 33.0 g

CaCl2.H2O 8.8g

MgSO4.7H2O 7.4g

KH2PO4 3.43g


xlv

All the chemicals are mixed on a magnetic stirrer and the volume is

made up to one litre using double distilled water and refrigerated at 40C.

C. 200X MS Iron stock (per litre):

FeSO4.7H2O 2785 mg in 250 mL H2O

Na2- EDTA 3725 mg in 250 mL H2O

Both the dissolved solutions are combined and boiled for a few minutes

until it turned clear and is then stored in a brown bottle at 40C.

D. 1000x MS Vitamin stock:

Glycine 200 mg

Nicotinic acid 50 mg

Thiamine HCl 10 mg

Pyridoxine 10 mg

All the vitamins are dissolved and refrigerated at 40C.

Preparation of culture medium:

Composition of MS basal medium (per liter)

Stock solution Volume to be taken ml/l

10X MS Macro nutrient stock 50

1000X MS Micro nutrient stock 1 mL

200X MS Iron stock 5 mL

Myoinositol 100 mg

Sucrose 30 g

Agar 8 g

H2O 800 mL

xlvi

All the ingredients are dissolved and then volume is made up to 1000

ml. The required concentrations of hormones are added and the pH is adjusted

to 5.8 with 1N NaOH and 1N HCl. Agar is added and autoclaved.

The medium is then distributed into conical flasks making sure that each

flask is filled with not more than half of its capacity to ensure proper

autoclaving. The flasks are plugged with cotton and autoclaved at 1210C and 15

lbs pressure for 15 min.

Appendix II. Preparation of LPGM (Liquid Plant Growth Medium)

LPGM was prepared same as MS medium except sucrose and agar

Appendix III Preparation of Phytohormones stocks

a. IAA (1mg/ml) stock solution 10 ml

Ten milligram of IAA was dissolved in 1N NaOH (1-2 ml) and

sterile double distilled water was added slowly with constant stirring to

make up of volume up to 10ml and stored in refrigerator at 40C.

b. IBA (1mg/ml) stock solution 10 ml

Ten milligram of IAA was dissolved in ethanol (1-2 ml) and sterile

double distilled water was added to make up of volume up to 10 ml and

stored in refrigerator at 40C.

c. NAA (1 mg/ml) stock solution 10 ml

Ten milligram of IAA was dissolved in DMSO (1-2 ml) and sterile



d. 2.4. D (1mg/l) stock solution 10ml

Ten milligram of 2.4.D was dissolved in 1N NaOH (1-2 ml) and

sterile double distilled water was added to make up of volume up to 10 ml

and stored in refrigerator at 40C.

xlvii

e. BAP (1mg/ml) stock solution 10 ml

Ten milligram of BAP was dissolved in 1N NaOH (0.3-0.5 ml) and


stored in refrigerator at40 C.

f. TDZ (1mg/ml) stock solution 10ml

Ten milligram of TDZ was dissolved in 1N NaOH (0.3-0.5 ml) and

double distilled water was added to make up of volume up to 10 ml and stored

in refrigerator at 40C.

g. Kinetin (Kn) 1mg/l stock in 10ml

Ten milligram of TDZ was dissolved in 1N NaOH (0.3-0.5 ml) and



h. GA3 1mg/l stock in 10ml

Ten milligram of TDZ was dissolve well with some alcohol drops and



Appendix IV. Preparation of antibiotic stock solution

a. Kanamycin (100mg/ml)

One gram of kanamycin was dissolved in 10 ml of sterile double

distilled water. After dissolving completely, filter sterilized into sterile

eppendorf tubes aseptically and stored in refrigerator at 40C.

b. Rifampicin (100mg/l)

One gram of rifampicin was dissolved in 5 ml of DMSO and volume

was made to 10ml with sterile double distilled water. After dissolving

completely, filter sterilized into sterile eppendorf tubes aseptically and


xlviii

c. Cefotaxime (100mg/ml)

One gram of cefotaxime was dissolved in 10 ml of sterile double

distilled water. After dissolving completely, filter sterilized into

sterile eppendorf tubes aseptically and stored in refrigerator at 40C.

Appendix V. Reagents for DNA Isolation

a. Tris-HCl 1.0 M (pH 8.0)

12.114 g of Tris-HCl was dissolved in sterile de-ionized water, pH

adjusted to 8.0 and volume was made to 100 ml with de-ionized water

and autoclaved at 15 psi for 20 min.

b. EDTA 0.25 M (pH 8.0) (dissolved salt; Mw - 372.3)

18.61g of EDTA was dissolved in sterile de-ionized water, pH

adjusted to 8.0, volume made to 100 ml with de-ionized water and

autoclaved at 15 psi for 20 min.

c. NaCl 0.5 M

29.2g of NaCl was dissolved in 100 ml de-ionized water.

d. 10% working CTAB

10% CTAB - 10 g

5 M NaCl - 14 ml

Dissolved and volume made up to 100 ml with de-ionized water


e. CTAB buffer (100 ml)

2.0 g CTAB Powder (2%)

10.0 ml 1M Tris-HCl pH8 (100 mM)

4.0 ml 0.5 M EDTA (20 mM)

28.0 ml 5 M NaCl (1.4 M)

Make the solution up to 100ml with sterile distilled water (SDW)

xlix

f. Sodium Acetate 3M (pH 6.8)

Sodium Acetate 40.83gm of Sodium acetate was dissolved in 80ml

de-ionized water and pH was adjusted to 6.8. Volume was made to 100ml

with de-ionized water and autoclaved at 15 psi for 20 min.

g. Choloroform: Iso-amyl alcohol mixture (24:1)

Chloroform - 96 ml

Iso-amyl alcohol - 4 ml

h. Ethanol 70%

Absolute alcohol - 70 ml

Double distilled water - 30 ml

i. RNase stock

1 M Tris- HCl (pH 8.0) - 100 µl

5 M NaCl - 300 µl

RNase - 10 mg

Volume adjusted to 1 ml with de-ionized water, boiled for 15 minutes

and allowed to cool slowly and stored at -20ºC.

j. TE (10:1)

1 M Tris-HCl (pH 8.0) - 1 ml

0.25 M EDTA (pH 8.0) - 0.4 ml

Dissolved and volume made up to 100 ml with de-ionized water


l

Appendix VI. Preparation of Reagents for Gel Electrophoresis

a. Loading dye Bromophenol Blue)

- 0.25% Bromophenol Blue

- 40% (w/v) sucrose in water

Stored at 40C

b. Ethidium bromide stock

Ethidium bromide stock was prepared by dissolving 25mg of ethidium

bromide in 25ml of distilled water. The final concentration was 1mg/l.

c. 10xTBE

Tris Base 121 g

Boric Acid 51.3 g

EDTA 3.7 g

Distilled Water to 1 L

Dissolve components, sterilize. Store at room temperature

Appendix VII. Preparation of GUS assay reagents

Potassium fericyanide 50mM

Potassium ferrocyanide 50mM

Sodium EDTA (10mM) 1.46gm of EDTA was dissolved in 10ml of double

distilled water and pH was adjusted to 7.0.

0.1% Triton-X

Sodium phosphate (Na2HPO4.2H20) Buffer, 0.5M, pH7.0

NaH2PO4.2H2O - 36 ml

KH2PO4 - 64 ml

pH was adjusted to 7.0 and the buffer was autoclaved or 0.5 KH2PO4(PH

7.0, Autoclaved)

X-gal

Dimethyl formide

li

a. Substrate �A preparation

Reagent Volume taken for 25µl in ml

0.1M Na2HPO4.2H20 or 0.5 KH2PO4 5

Sodium EDTA 2.5

Potassium fericyanide 50mM 2.5

Potassium ferrocyanide 50mM 2.5

0.1% Triton-X 2.5

Distilled water 10

Above substrate prepared by mixing the chemical in the sterile condition

kept in the -200C (freshly prepared)

b. X-gal preparation

Weighed and dissolved 25mg of X-gal (Himedia) substrate in the 250µl

of Dimethyl formide mixed till it become clear, wrapped aluminum foil and

added this to substrate-A mixed. Syringe filter sterilization (25mm Axiva) was

done and stored at -200C.

Appendix VIII. Preparation of LB agar and Broth Media

LB agar medium (100ml)

Chemical Quantity

Tryptone 1.0gm

Nacl 1.0gm

Yeast extract 0.5gm

Agar 1.5gm

Dissolve each component in about 80 ml of double distilled water and

make up the volume to 100ml .Adjust the pH to 7.2-7.4 .Autoclave the above

medium and store at 40C.

LB broth Medium (100ml)

Dissolve each component except agar in about 80 ml of double distilled

water and make up the volume to 100ml .Adjust the pH to 7.2-7.4 .Autoclave

the medium and store at 40C.

lii

Appendix IX. Plasmid isolation (Alkali lysis method)

a. Solution �I (Re-suspension solution)

0.9% Sucrose 2.25g

10nM EDTA, PH8 5ml (0.5M stock)

25nM Tris-HCl 6.25ml (1ml stock)

Made the volume to 250 ml by using sterile distilled water (stored at 4oC)

b. Solution II (cell lysis solution) 250ml.

0.2N NaOH 50ml (1stock)

1% SDS 2.5gm

Make volume with sterile distilled water to250 ml.

c. Solution III (Neutralizing solution) 100ml

1.32M Sodium acetate 100ml.

26.4ml (5 M stock).

Make the volume to 100ml with sterile distilled water.

d. Solution IV

TE buffer (250ml)

Tris- HCl 2.5m (0.1M stock)

EDAT 0.125 ml (0.5M stock)

The pH was adjust to 8.0with 1N HCl and final volume was made up

250ml.The solution was autoclaved before use.

e. EDTA 0.5M, pH-8.0

Weighed 186.1g of Na2EDAT.2H2O and the final volume was made up

to 800ml with and pH was then adjusted to 8.0 using NaOH pellets .Then the

volume was adjusted to 100ml with distilled water.

liii

Appendix X: Equipment�s u s e d

Autoclave (Arch Tech)

B.O.D. incubator (Remi)

Deep freeze -20 0C (Blue star)

Electronic balances (Sartorios)

Hot air oven (Wiswo)

Laminar flower (Clear)

Microwave ovens (Samsung)

Magnetic stirrer (Remi)

Microscope (Zeiss)

PH meter (EU-Tech)

Refrigerated Centrifuges (Remi)

Refrigerator (Whirlpool)

UV transilluminator (UVI Tech)

Vortex mixer (Geni)

Gel Documentation Unit (UVI Tech)

Horizontal Gel electrophoresis unit (Geni)

Ice maker (orumsem)

Incubator shaker (Pelican)

Mini centrifuge (Biofuge)

PCR (Peq Star)

Spectrophotometer (BL-190)

Water bath (GFL)

Water purification system (Borosil)

Lyophilizer (Christ)

Rotary shaker (Remi)

studies on genetic transformation of black gram (vigna mungo l.)

Documents