supplemental figure 1. multiple alignment of the n ... · 1 supplemental figure 1. multiple...

1

Supplemental Figure 1. Multiple

alignment of the N-terminal parts

of plant KNL2 orthologs.

Multiple sequence alignment was

performed by the MUSCLE method

and visualized by the JalView

program. Highly conserved amino

acids are highlighted in dark blue and

less conserved ones in light blue.

Supplemental Data. Lermontova et al. (2013). Plant Cell 10.1105/tpc.113.114736

2


Supplemental Figure 2. Evolutionary relationships of KNL2 protein of 25 taxa.

The evolutionary history was inferred using the Neighbor-Joining method (Saitou and Nei,

1987). The optimal tree with the sum of branch length = 8.35759732 is shown. The

percentage of replicate trees in which the associated taxa clustered together in the bootstrap

test (500 replicates) is shown next to the branches (Felsenstein, 1985). The evolutionary

distances were computed using the Poisson correction method (Zuckerkandl and Pauling,

1965) and are in the units of the number of amino acid substitutions per site. All positions

containing gaps and missing data were eliminated from the dataset (Complete deletion

option). There were a total of 47 positions in the final dataset. Phylogenetic analyses were

conducted in MEGA4 (Tamura et al., 2007). - SANTA domain containing proteins of

plants, - of Arabidopsis species; - SANTA+KIP domain containing proteins of plants,

- of Arabidopsis species.

3


4


Supplemental Figure 3. FLIP and FRAP on 10-day-old seedlings expressing EYFP-

KNL2-C.

Roots of 10-day-old seedlings expressing EYFP-KNL2-C were used for FLIP and FRAP

analysis.

(A) For measuring FLIP, individual nuclei were scanned three times with a 488 nm laserline

(2,5% laserpower, scanspeed 6 without averaging) followed by repeated bleaching of a square

region of interest within the nucleus measuring 1,4 µm2, using 100% laserpower and 4

iterations alternated by single recordings.

(B) For measuring FRAP, individual nuclei were scanned three times with a 488 nm laserline

(2.5% laserpower, scanspeed 6 without averaging). After this a square region of interest

measuring 1.4 µm2 was bleached using 100% laserpower and 4 iterations followed by 50

continuous recordings. Each experiment was run over the time scale of 40 sec, and 5–10

experiments were averaged to produce each curve. KNL2-C recovers to about 80%

fluorescence intensity at chromocenters within 10 sec.

For both FLIP and FRAP experiments fluorescence intensity was measured in the regions of

bleaching (1), and in regions adjacent to the ROI (2, 3). The x axis represents the time scale of

the experiment in second, the y axis corresponds to fluorescence intensity (arbitrary units).

5


Supplemental Figure 4. Schematic view of the KNL2 gene with the corresponding T-

DNA insertions and analysis of KNL2 transcript in SALK-039432 mutant.

(A) Positions of T-DNA insertions are shown by vertical arrows. The positions of primers

used for the RT-PCR analysis are marked by horizontal arrows.

(B) RT-PCR analysis (30 cycles) of KNL2 expression in heterozygous (5/6, 5/7) and

homozygous (8/1, 8/2) lines. Amplification of products of elongation factor (EF) mRNA was

used as loading control.

6


Supplemental Figure 5. Gene ontology enrichment analysis on A. thaliana genes selected

from regulatory network using AgriGO web application.

Hierarchical tree graph of overrepresented Gene Ontology (GO) terms in biological process

category generated by SEA (Singular enrichment analysis) for genes selected from the gene

regulatory network for cenH3 deposition. All genes are listed in Suppl. Table 3. Boxes in the graph

represent GO terms labeled by their GO ID, term definition and statistical information. The

significant terms (adjusted P ≤ 0.05) are marked with color, while non-significant terms are

shown as white boxes. The diagram, the degree of color saturation of a box is positively

correlated to the enrichment level of the term. Solid, dashed, and dotted lines represent two,

one and zero enriched terms at both ends connected by the line, respectively. The rank

direction of the graph is set to from top to bottom.

7


Supplemental Figure 6. Protein-Protein Interaction network of selected human proteins

in STRING.

Colored lines indicate different types of the supporting evidences including direct (physical)

and indirect (functional) associations from different sources: conserved co-expression,

experimental data and previous knowledge (publications and databases).

All underlying evidence can be inspected in dedicated viewers that are accessible from the

network.

8


Supplemental Table 1A: List of selected A. thaliana genes involved in regulation of cenH3 assembly and their homologues of H. sapiens. Last column shows sequence similarity of corresponding proteins. Arabidopsis thaliana Homo sapiens

Protein sequence similarity (%)

Gene name Gene Nr Gene name Accession Nr CenH3 At1G01370 CENPA AAH02703 52% KNL2 At5G02520 Mis18BP1 NP_060823 56% E2F1 At5G22220 E2F1 AAH50369 46% E2F2 At1G47870 E2F2 AAM54044 45% E2F3 At2G36010 E2F3 CAI21471 56% RBR At3G12280 retinoblastoma-like 1 AAH32247 33% SuvH4 At5G13960 SUV39H2 NP_001180356 41% Met1 At5G49160 DNMT1 NP_001370 37%

9


Supplemental Table 1B: H. sapiens proteins involved in cenH3 assembly and their interacting partners. Score above 0,400 is defined as medium confidence and above 0,700 - as high. Protein Inter. Partner Exp./Bioch. Data (Score) Source

CENPA HJURP 0,798 Dunleavy et al. 2009; Foltz et al. 2009

RBBP4 0,522 Dunleavy et al. 2009

HJURP CENPA 0,798 Dunleavy et al. 2009; Foltz et al. 2009

RBBP4 CENPA 0,522 Dunleavy et al. 2009 RB1 0,981 Qian and Lee 1995 RBBP4 SUV39H1 0,538 Vaute et al. 2002 E2F1 0,543 Nicolas et al. 2000 RB1 E2F1 0,999 Helin et al 1992 E2F2 0,987 Wu et al. 1995 DNMT1 0,845 Robertson et al. 2000

SUV39H1 0,845 Nielsen et al. 2001; Vandel et al. 2001

E2F3 0,998 Lees et al. 1993 RBBP4 0,981 Qian and Lee 1995 E2F1 RB1 0,999 Helin et al 1992 RBBP4 0,543 Nicolas et al. 2000 DNMT1 0,620 Robertson et al. 2000 E2F2 RB1 0,987 Wu et al. 1995 E2F3 RB1 0,998 Lees et al. 1993 SUV39H1 RBBP4 0,538 Vaute et al. 2002

RB1 0,845 Nielsen et al. 2001; Vandel et al. 2001

DNMT1 0,812 Fuks et al. 2003 DNMT3B 0,620 Geiman et al. 2004 DNMT1 RB1 0,845 Robertson et al. 2000 SUV39H1 0,812 Fuks et al. 2003 DNMT3B 0,814 Kim et al. 2002 E2F1 0,620 Robertson et al. 2000 DNMT3B DNMT1 0,814 Kim et al. 2002 SUV39H1 0,620 Geiman et al. 2004

10


Supplemental Table 2: Primers used in this study.

Primer name Primer sequence Reference Gateway cloning

KNL2-attB1l

KNL2-attB1sh

KNL2-attB2

KNL2- attB1gensh

KNL2prexin-attB2

GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGACGGAACCAAATCTCGAC

GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGAATTACTCTGGGACGAAAG

GGGGACCACTTTGTACAAGAAAGCTGGGTCTTTGATTTTCAAGTTTCTTCG

GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAACTATATGATTGTTTACTAC

GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATTAAGGCAAAATTCGAAG

RT-PCR qKNL2_2081f

qKNL2_2297r

qKNL2_27f

qKNL2_198r

qKNL2_607f

qKNL2_799r

actin2-rev

qcenH-3´-r

actin2-for

qcenH3-3´-f

ATTGGGACAGAAACGGTCAA

TCTGTTCCCATGGTTGGTCT

TGGTTCCAAGTCGTCTTTCC

TTTCCCTTCGAATTCCTTTG

CCTTGTTGGGAACGAGTTTG

GGGAGGACAAGCTGCTAAGA

CAAGAGGCGGCAGAAGATTAC

AACGATTCCTGGACCTGCCTC

TCCCTCAGCACATTCCAGCAG

GCATCACCAAGAGACAAGGAG

Analysis of T-DNA insertion mutants

SALK_039432-LP

LBb1.3

SALK_039432-RP

TAATACCACTTCCAACCGCTG

ATTTTGCCGATTTCGGAAC

TTTGTTCATCTGGGTTTTTCG

Bisulfite sequencing

MEA-ISR-5F

MEA-ISR-3R

AtSN1-3R

AtSN1-5F

AAAGTGGTTGTAGTTTATGAAAGGTTTTAT

CTTAAAAAATTTTCAACTCATTTTTTTTAAAAAA

CAATATACRATCCAAAAAACARTTATTAAAATAATATCTTAA

GTTGTATAAGTTTAGTTTTAATTTTAYGGATYAGTATTAATTT

Zheng et al., 2007

Zheng et al., 2007

Zheng et al., 2007

Zheng et al., 2007

11


Supplemental References

Dunleavy, E.M., Roche, D., Tagami, H., Lacoste, N., Ray-Gallet, D., Nakamura, Y., Daigo, Y., Nakatani, Y., and Almouzni-Pettinotti, G. (2009). HJURP is a cell-cycle-dependent maintenance and deposition factor of CENP-A at centromeres. Cell 137, 485-497.

Foltz, D.R., Jansen, L.E., Bailey, A.O., Yates, J.R., 3rd, Bassett, E.A., Wood, S., Black, B.E., and Cleveland, D.W. (2009). Centromere-specific assembly of CENP-a nucleosomes is mediated by HJURP. Cell 137, 472-484.

Fuks, F., Hurd, P.J., Deplus, R., and Kouzarides, T. (2003). The DNA methyltransferases associate with HP1 and the SUV39H1 histone methyltransferase. Nucleic Acids Res 31, 2305-2312.

Geiman, T.M., Sankpal, U.T., Robertson, A.K., Zhao, Y., and Robertson, K.D. (2004). DNMT3B interacts with hSNF2H chromatin remodeling enzyme, HDACs 1 and 2, and components of the histone methylation system. Biochem Biophys Res Commun 318, 544-555.

Helin, K., Lees, J.A., Vidal, M., Dyson, N., Harlow, E., and Fattaey, A. (1992). A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F. Cell 70, 337-350.

Kim, G.D., Ni, J., Kelesoglu, N., Roberts, R.J., and Pradhan, S. (2002). Co-operation and communication between the human maintenance and de novo DNA (cytosine-5) methyltransferases. EMBO J 21, 4183-4195.

Lees, J.A., Saito, M., Vidal, M., Valentine, M., Look, T., Harlow, E., Dyson, N., and Helin, K. (1993). The retinoblastoma protein binds to a family of E2F transcription factors. Mol Cell Biol 13, 7813-7825.

Nicolas, E., Morales, V., Magnaghi-Jaulin, L., Harel-Bellan, A., Richard-Foy, H., and Trouche, D. (2000). RbAp48 belongs to the histone deacetylase complex that associates with the retinoblastoma protein. J Biol Chem 275, 9797-9804.

Nielsen, S.J., Schneider, R., Bauer, U.M., Bannister, A.J., Morrison, A., O'Carroll, D., Firestein, R., Cleary, M., Jenuwein, T., Herrera, R.E., and Kouzarides, T. (2001). Rb targets histone H3 methylation and HP1 to promoters. Nature 412, 561-565.

Qian, Y.W., and Lee, E.Y. (1995). Dual retinoblastoma-binding proteins with properties related to a negative regulator of ras in yeast. J Biol Chem 270, 25507-25513.

Robertson, K.D., Ait-Si-Ali, S., Yokochi, T., Wade, P.A., Jones, P.L., and Wolffe, A.P. (2000). DNMT1 forms a complex with Rb, E2F1 and HDAC1 and represses transcription from E2F-responsive promoters. Nat Genet 25, 338-342.

Vandel, L., Nicolas, E., Vaute, O., Ferreira, R., Ait-Si-Ali, S., and Trouche, D. (2001). Transcriptional repression by the retinoblastoma protein through the recruitment of a histone methyltransferase. Mol Cell Biol 21, 6484-6494.

Vaute, O., Nicolas, E., Vandel, L., and Trouche, D. (2002). Functional and physical interaction between the histone methyl transferase Suv39H1 and histone deacetylases. Nucleic Acids Res 30, 475-481.

Wu, C.L., Zukerberg, L.R., Ngwu, C., Harlow, E., and Lees, J.A. (1995). In vivo association of E2F and DP family proteins. Mol Cell Biol 15, 2536-2546.

Zheng, X., Zhu, J., Kapoor, A., and Zhu, J.K. (2007). Role of Arabidopsis AGO6 in siRNA accumulation, DNA methylation and transcriptional gene silencing. EMBO J 26, 1691-1701.

supplemental figure 1. multiple alignment of the n ... · 1 supplemental figure 1. multiple...

Documents