supplemental information aurora a triggers lgl … information aurora a triggers lgl cortical...

Current Biology, Volume 25

Supplemental Information

Aurora A Triggers Lgl Cortical

Release during Symmetric Division

to Control Planar Spindle Orientation

Cátia A. Carvalho, Sofia Moreira, Guilherme Ventura, Cláudio E. Sunkel, and Eurico

Morais-de-Sá

Supplemental Figures

Figure S1, related to Figure 1. Lgl mitotic cortical release precedes apical

depolarization and occurs in aPKC mutants.

A. Follicle cells expressing Lgl-GFP (green) and stained for aPKC (red) and DAPI (Blue). Lgl

cortical release begins in prophase, when aPKC is apically polarized (left). aPKC depolarization

occurs during later stages of mitosis (right). Arrow depicts the nucleus. B. aPKCts/aPKC

k06403 egg

chamber expressing Lgl-GFP (green) at restrictive temperature (29ºC) shows extensive loss of

epithelial organization. Mutant follicle cells do not show apical exclusion of Lgl during interphase,

but display complete Lgl cortical release in mitotic cells (arrow).

Figure S2, related to Figure 2. Aurora A, but not Aurora B, is involved in Lgl

cortical exclusion during S2 cell mitosis.

A. Time-lapse images of S2 cells showing that knockdown of AurA by RNAi strongly delays Lgl-

GFP cytoplasmic accumulation. B. Lgl is completely released from the cortex before NEB in cells

treated with Binuclein 2, but not in cells treated with Binuclein 2 and the AurA inhibitor MLN8237,

which only show efficient release of Lgl after prolonged mitosis. Microtubules are labelled with

Cherry-Tubulin. (C, D) Western blots showing the depletion of AurA (C) and aPKC (D) by RNAi in

S2 cells. The same membranes were probed with anti-Lgl and anti-α-tubulin as controls.

Figure S3, related to Figure 4. Lgl is dispensable for proper chromosome

segregation.

A. Time lapse images of lgl4 mutants showing normal bipolar spindle formation in the follicular epithelium.

White arrow points to a mutant cell (absence of RFP, shown on the last frames), which is undergoing division

and is surrounded by other mutant mitotic cells, whereas the red arrow indicates a wild-type cell. B. lgl4 mutants

(marked by absence of GFP) do not show major chromosome segregation defects in the follicular epithelium.

Close ups show consecutive frames of two lgl mutant cells, and the frequency of lagging chromosomes (top)

relatively to a normal chromosome segregation (bottom). (C-E) Lgl does not affect mitosis in S2 cells. C. lgl

RNAi and control cells present a similar mitotic timing (NEB to anaphase onset; Student’s t test with two-tailed

distribution accessed significance). D. Western blot showing the efficiency of Lgl depletion. α-Tubulin was used

as control. E. Time-lapse images of cells expressing the centromere marker Cid-Cherry and GFP-tubulin to mark

the spindle. Note that despite the presence of supernumerary centrosomes in S2 cells, lgl RNAi allows clustering

of multiple centrosomes into bipolar spindle poles and proper chromosome alignment and segregation at

anaphase onset. Scale bars: 5 μm

Supplemental Experimental Procedures

Drosophila strains and genetics

w1118

was used as the wild-type control strain. The following mutant alleles and transgenic lines

were used: UAS::Lgl-GFP, UAS::Lgl-RFP and UAS::Lgl3A

-GFP [S1]; par-6D226

, par-6::Par-6-

GFP and par-6::par-6S34A

[S2]; and aur37

[S3] were all kindly provided by J.Knoblich.

UAS::Scrib-GFP [S4] (Gift of D. Bilder), aPKCK06403

[S5], aPKCts

[S6] (Gift of R.Martinho),

aPKCpsu141

[S7] (Gift of D. Bergstralh), lgl4

[S8], lgl27S3

[S9], His2av-RFP [S10], Jup-GFP

[S11], UAS-LglS656A,S660A

-GFP, UAS-LglS656A,S664A

-GFP and UAS-LglS660A,S664A

-GFP (this study).

GR1-GAL4 or e22c-GAL4 were used to induce expression of UAS transgenes in the follicular

epithelium. The GR1-GAL4 driver shows mild expression during the proliferative stages of

oogenesis and very high expression during later stages of oogenesis, and flies with transgenes

driven by GAL4 were kept at 29 ºC or 25ºC to modulate higher or milder expression levels prior

to dissection. The FLP/FRT-mediated mitotic recombination system was used for clonal

analyses in the follicle epithelium [S12]. lgl4 germline clones were produced with the dominant

female sterile technique [S13] to remove the maternal contribution of Lgl during

embryogenesis.

Genotypes

Figure 1 (time-lapse movies on Movie S1)

ATop

w ;; UAS::Scrib-GFP/ GR1::GAL4

ABottom

,D,ETop

w ;; UAS::Lgl-GFP/GR1::GAL4

B w

C w ;; UAS::Lgl3A

-GFP/GR1::GAL4

D,EBottom

par6::Par-6-GFP

FTop

,G par-6D226

FRT19A; par-6::par-6S34A

/+; UAS::Lgl-GFP GR1::GAL4/+

FBottom

,G w ; FRT42B aPKCK06403

/FRT42B aPKCts; UAS::Lgl-GFP/GR1::GAL4

H w,y, hs::FLP/+ ; FRT42B aPKCK06430

/FRT42B nls-GFP

I w,y, hs::FLP/+ ; FRT42B aPKCpsu141

/FRT42B nls-GFP

Figure 2 (and Movie S2)

A w; e22c::GAl4 UAS::FLP/ UAS::Lgl-RFP; FRT82B aur37

/ FRT82B nls-GFP

Figure 4

ATop

hs::FLP/+;nls-RFP FRT40A/lgl27S3

FRT40A; +/+

Amiddle


FRT40A;UAS::Lgl-GFP GR1::GAL4/+

Abottom


FRT40A; UAS::Lgl3A

-GFP GR1::GAL4/+

BTop


FRT40A UAS::LglS656A,S660A

; GR1::GAL4/+

Bmiddle



; GR1::GAL4/+

BBottom



; GR1::GAL4/+

C,D,EAAS

,F.G.H w; UAS::LglS656A,S660A

/+; GR1::GAL4/+

C,D,EASA

,F,G w; UAS::LglS656A,S664A

/+; GR1::GAL4/+

C,D,ESAA

,G

w; UAS:: LglS660A,S664A

/+; GR1::GAL4/+

Econtrol

w

EWT

,G w ;; UAS::Lgl-GFP/GR1::GAL4

E3A

,G w;; UAS::Lgl3A

-GFP/GR1::GAL4

EASA,lgl

,G hs::FLP/+;nls-RFP FRT40A/lgl27S3


; GR1::GAL4/+

Figure S1

A w ; UAS::Lgl-GFP/GR1::GAL4

B w ; FRT42B aPKCK06403

/ FRT42B aPKCts; UAS::Lgl-GFP/GR1::GAL4

Figure S3

A hs::FLP/+; lgl4 FRT40A/ nls-RFP FRT40A; Jup-GFP/+

B hs::FLP/+; lgl4 FRT40A/ nls-GFP FRT40A; His2av-mRFP /+

Movie S4 (maternal phenotype)

hs::FLP/+; lgl4 FRT40A/ ovo

D1 FRT40A; His2av-mRFP /+

Movie S5

w;; UAS::LglS656A,S660A

/+; GR1::GAL4/+

w;; UAS::LglS656A,S664A

/+; GR1::GAL4/+

w;;UAS::Lgl3A

-GFP/GR1::GAL4

Ovary immunofluorescence

Drosophila ovaries were fixed in 4% paraformaldeyde for 20 minutes, followed by washing

steps in PBS-T (PBS with 0.05-0.2 % Tween), blocking with PBS-T complemented with 10%

BSA and primary antibody incubation overnight. After washing steps in PBS-T supplemented

with 1% BSA, ovaries were incubated for 2 hours with secondary antibodies and then washed

with PBS-T before mounting in vectashield with DAPI (Vector Laboratories).

Primary antibodies

Primary antibodies concentrations were used as follows: rabbit anti-Lgl (1/100 for

immunofluorescence (IF) and 1/500 for Western Blot (WB), d-300, Santa Cruz Biotech), rabbit

anti-aPKC (1/500 for IF and 1/2000 for WB, c-20, Santa Cruz Biotech), mouse anti-Dlg (1/200,

Developmental Studies Hybridoma Bank (DSHB)), rabbit anti-LGLS656-P

(1/1000), mouse anti-

γ-tubulin (1/200, Glu88, Sigma), mouse anti-α-tubulin (1/10000, DM1A, Sigma), rabbit anti-

AurA (1/1000 for WB, gift of D.Glover [S14]) and anti-MBP-HRP conjugated (1/10000, NEB).

The phosphorylated peptide RRKpSFKKSLRESFC was injected into rabbits to produce an

antibody against phosphoserine 656 of Lgl, which was purified by immunodepletion with the

unmodified peptide and affinity purified with the phosphorylated version (GenScript).

S2 culture, transfection and drug treatment

Drosophila S2 cells were cultured at 25 ºC in Schneider’s Drosophila media supplemented with

10 % FBS (fetal bovine serum). Stable S2 cell lines expressing the different Lgl-GFP variants

and Cherry-Tubulin were generated using Cellfectin® II reagent (Life technology (Invitrogen))

according to the manufactures’ instructions. Gene expression was induced at 37 ºC for 1 hour.

Cells were treated with 400 nM MLN8237, a specific inhibitor of AurA [S15] and/or 40 μM of

the specific Drosophila inhibitor of AurB, Binucleine 2 [S16]. We used a S2 cell line expressing

Cid-Cherry and GFP-Tubulin [S17] to analyse mitosis in S2 cells.

RNA interference in S2 cells

For double-strand (ds)RNA production, individual gene sequences were amplified from

genomic DNA using primers containing a 5’ T7 RNA polymerase-binding site flanked by gene-

specific sequences (see primers in table below) to amplify 311 base pairs (bp) of lgl (2020 to

2331 of coding sequence), 311 bp of aPKC (2020 to 2331 of coding sequence) and 361 bp of

aurA (1244 to 1605 of coding sequence). PCR-amplified sequences were reverse transcribed

using the Megascript® T7 kit (Ambion, Austin, TX, USA). For RNAi treatment, S2 cells in

exponential growth phase were seeded at 1 x 106 cells per 1 ml of serum-free Schneider media

and incubated with 30 μg of dsRNAi. After 1 hour, 2 ml of Schneider’s growth media

supplemented with 10 % of FBS was added and cells incubated for 120 h (aPKC RNAi). To

achieve efficient depletion of AurA and Lgl, the RNAi treatment was repeated after 96h and

cells were incubated for further 72h. Control cultures were prepared in the same way but

without addition of dsRNA.

Cloning of Lgl variants for S2 transfection and Drosophila transgenesis

Tagged constructs were made using the Gateway Cloning System (Life Technologies). lgl and

lgl3A

coding sequences were amplified from Drosophila Lgl cDNA clone LD06034, and pKS-

Lgl3A

(Gift of J.Knoblich ) respectively, using Lgl flanking primers designed accordingly to the

manufacturer´s protocol (see Table below), and cloned into pENTR. Primers listed below were

used to generate one or two serine-to-alanine mutations in pENTR-Lgl, following the

QuickChange II Site-Directed Mutagenesis Kit protocol (Agilent Technologies). The GFP-

tagged constructs were obtained using LR clonase II to mediate the recombination into pHWG

to transfect Drosophila S2 cells, and pUASt.attb.WG ([S18], gift from Saverio Brogna) to

generate transgenic flies. All lgl double mutant transgenes were inserted into the piggyback-y+-

attP-VK00018 landing site on chromosome II via PhiC31 site-specific transgenesis (BestGene

Inc).

Table of primers used in this study

Purpose Sense/Antisense (5’ < > 3’)

dsRNA

synthesis

lgl

TAATACGACTCACTATAGGGTATTAGCTGGCCTATCACTGGC

TAATACGACTCACTATAGGGGTCAAAGAGAACTAAGCCGTGC

aPKC

TAATACGACTCACTATAGGGACCCGTTCCTGGTCGGATTG

TAATACGACTCACTATAGGGACCGCAGAATGTGGAGGTGGT

aurA

TAATACGACTCACTATAGGGACTACTTGCCACCCGAAATG

TAATACGACTCACTATAGGG AATTAAATTACGCGGGGAGC

Cloning of

Lgl variants

Flanking

CACCATGTTAAAGTTTATCAGAGG

AAATTGGCTTTCTTCAGGCG

LglS656A

GAGCAGCTGTCTCGTCGAAAGGCTTTTAAGAAATCATTGAGGGAG


3’


3’


3’

CTCCCTCAATGATTTCTTAAAAGCCTTTCGACGAGACAGCTGC

LglS660A

GTCGAAAGTCTTTTAAGAAAGCATTGAGGGAGTCATTTCGAAAGC

GCTTTCGAAATGACTCCCTCAATGCTTTCTTAAAAGACTTTCGAC

LglS664A

GAAATCATTGAGGGAGGCATTTAGAAAGCTTCGCAAGGGTCG

CGACCTTGCGAAGCTTTCTAAATGCCTCCCTCAATGATTTC

LglS656A,S660A

GGCTTTTAAGAAAGCATTGAGGGAGTCATTTCGAAAGC

GCTTTCGAAATGACTCCCTCAATGCTTTCTTAAAAGCC

LglS656A,S664A

GGCTTTTAAGAAATCATTGAGGGAGGCATTTCG

CGAAATGCCTCCCTCAATGATTTCTTAAAAGCC

LglS660A,S664A

GTCTTTTAAGAAAGCATTGAGGGAGGCATTTCG

CGAAATGCCTCCCTCAATGCTTTCTTAAAAGAC

In vitro kinase assays

pMal-Lgl402-802

was provided by J. Knoblich. MBP-Lgl402-802

protein was expressed in BL21

Star E.Coli, and purified using amylose magnetic beads following manufacturers instructions

(New England Biolabs). 0.5 μg of MBP-Lgl were incubated at 30ºC for 30 min with the

indicated amount of recombinant Aurora A (Millipore) in ice-cold kinase assay buffer (25 mM

MOPS, pH 7.2, 12.5 mM β-glycerol-phosphate, 25 mM MgCl2, 2 mM EDTA, 0.25 mM DTT,

and 0.2 mM ATP), with or without addition of MLN8237 and lambda phosphatase at the

indicated concentrations. Reactions were stopped by addition of SDS Laemmli buffer and

samples were resolved by SDS-PAGE and followed by western blot with p-Lgl656 antibody.

Equivalent gels were used for western blot with anti-MBP to control for the amount of MBP-

Lgl used in each reaction.

Imaging

Imaging of fixed samples was performed using Leica TCS SP5 II (Leica Microsystems)

confocal microscope with HC PL APO CS 40x/NA 1.10 objective and a LAS 2.6 software. For

live imaging of Drosophila egg chambers, ovarioles were dissected in Schneider’s media

supplemented with 10% FBS and 200 µg/ml insulin (Sigma-Aldrich) as previously described in

[S19]. Muscle sheet was removed manually and individual ovarioles placed in a small drop of

the same medium on a culture dishes for live imaging (MatTek). S2 cells were plated on poly-L-

lysine-coated culture dishes for live imaging (MatTek). Either cells or ovarioles were filmed at

25 ºC, with the exception of the aPKC temperature sensitive mutants, which were filmed at 29

ºC, using a spinning disc confocal system (Andor Revolution XD) equipped with an electron

multiplying charge-coupled device camera (iXonEM+; Andor) and a CSU-22 unit (Yokogawa)

based on an inverted microscope (IX81; Olympus) with a PLAPON 60x/NA 1.42 objective

using iQ software (Andor). Z-stacks were collected of 8-12 serial optical sections separated by

0.5-1 µm.

Data analysis and quantification

To quantify Lgl and Par-6 fluorescence intensity throughout mitosis (Figure 1D, 1F and Figure

2A and 2D), the mean pixel intensity was measured within manually limited homogeneous

region of the cytoplasm (Lgl) or at the apical side (Par-6) using sum projections generated from

3 sections. The minimum value (before mitosis for Lgl or at anaphase onset for Par-6) was

subtracted to the intensity of each time point, and the intensity was normalized to the maximum

value of Lgl cytoplasmic accumulation or to the apical intensity of Par-6 before mitosis. Due to

lower signal-to-noise of the Par-6-GFP and Lgl-RFP signals, we considered each time point as

the average of 3 consecutive time points.

To measure the normalized cytoplasmic to cortical ratio of Lgl at NEB (Figures 3C), NEB was

manually identified by the accumulation of Lgl-GFP or Cherry-Tubulin in the region that

confined the nucleus. A macro on FIJI was generated to automate the measurement of the cortex

and cytoplasm intensities. The image was segmented to identify the cell contour (CC), and the

cortex mean intensity was calculated for the area between CC - 1 px and CC - 5 px, whereas the

cytoplasm mean intensity was calculated for the area within Cc - 6 px). The ratio was obtained

after subtracting the background intensity for each value. To generate the normalized plot of

figure 3B, cytoplasm/cortex ratio was corrected to the mean ratio obtained for Lgl3A

, and was

normalized to the mean of S2 cells expressing Lgl-GFP. The plot presents the average of data

collected from movies for at least five different cells.

Spindle angles were quantified on metaphase cells in the most longitudinal region of the egg

chamber and dividing nearly parallel to the XY plane of imaging. The angle was measured

between a vector of the spindle axis defined by the position of the two centrosomes and vector

planar to the epithelial monolayer identified by the position of the apical domain of the

neighbouring cells. To minimize the inclusion of spindle orientation defects that could be

attributed to dominant polarity defects of LglS656A,S660A

-GFP expression, any dividing cell within

regions of the tissue that did not present an intact monolayer was excluded from the

quantification. All image processing and measurements were performed using Fiji and the

statistical analysis and graphs were performed with GraphPad.

Supplemental References

S1. Betschinger, J., Mechtler, K., and Knoblich, J.A. (2003). The Par complex directs

asymmetric cell division by phosphorylating the cytoskeletal protein Lgl. Nature 422,

326-330.

S2. Wirtz-Peitz, F., Nishimura, T., and Knoblich, J.A. (2008). Linking cell cycle to

asymmetric division: Aurora-A phosphorylates the Par complex to regulate Numb

localization. Cell 135, 161-173.

S3. Berdnik, D., and Knoblich, J.A. (2002). Drosophila Aurora-A is required for

centrosome maturation and actin-dependent asymmetric protein localization during

mitosis. Curr Biol 12, 640-647.

S4. Zeitler, J., Hsu, C.P., Dionne, H., and Bilder, D. (2004). Domains controlling cell

polarity and proliferation in the Drosophila tumor suppressor Scribble. J Cell Biol 167,

1137-1146.

S5. Wodarz, A., Ramrath, A., Grimm, A., and Knust, E. (2000). Drosophila atypical protein

kinase C associates with Bazooka and controls polarity of epithelia and neuroblasts. J

Cell Biol 150, 1361-1374.

S6. Guilgur, L.G., Prudencio, P., Ferreira, T., Pimenta-Marques, A.R., and Martinho, R.G.

(2012). Drosophila aPKC is required for mitotic spindle orientation during symmetric

division of epithelial cells. Development 139, 503-513.

S7. Kim, S., Gailite, I., Moussian, B., Luschnig, S., Goette, M., Fricke, K., Honemann-

Capito, M., Grubmuller, H., and Wodarz, A. (2009). Kinase-activity-independent

functions of atypical protein kinase C in Drosophila. J Cell Sci 122, 3759-3771.

S8. Ohshiro, T., Yagami, T., Zhang, C., and Matsuzaki, F. (2000). Role of cortical tumour-

suppressor proteins in asymmetric division of Drosophila neuroblast. Nature 408, 593-

596.

S9. Brumby, A., Secombe, J., Horsfield, J., Coombe, M., Amin, N., Coates, D., Saint, R.,

and Richardson, H. (2004). A genetic screen for dominant modifiers of a cyclin E

hypomorphic mutation identifies novel regulators of S-phase entry in Drosophila.

Genetics 168, 227-251.

S10. Pandey, R., Heidmann, S., and Lehner, C.F. (2005). Epithelial re-organization and

dynamics of progression through mitosis in Drosophila separase complex mutants. J

Cell Sci 118, 733-742.

S11. Karpova, N., Bobinnec, Y., Fouix, S., Huitorel, P., and Debec, A. (2006). Jupiter, a new

Drosophila protein associated with microtubules. Cell Motil Cytoskeleton 63, 301-312.

S12. Xu, T., and Rubin, G.M. (1993). Analysis of genetic mosaics in developing and adult

Drosophila tissues. Development 117, 1223-1237.

S13. Chou, T.B., and Perrimon, N. (1996). The autosomal FLP-DFS technique for generating

germline mosaics in Drosophila melanogaster. Genetics 144, 1673-1679.

S14. Giet, R., McLean, D., Descamps, S., Lee, M.J., Raff, J.W., Prigent, C., and Glover,

D.M. (2002). Drosophila Aurora A kinase is required to localize D-TACC to

centrosomes and to regulate astral microtubules. J Cell Biol 156, 437-451.

S15. Manfredi, M.G., Ecsedy, J.A., Chakravarty, A., Silverman, L., Zhang, M., Hoar, K.M.,

Stroud, S.G., Chen, W., Shinde, V., Huck, J.J., et al. (2011). Characterization of

Alisertib (MLN8237), an investigational small-molecule inhibitor of aurora A kinase

using novel in vivo pharmacodynamic assays. Clin Cancer Res 17, 7614-7624.

S16. Smurnyy, Y., Toms, A.V., Hickson, G.R., Eck, M.J., and Eggert, U.S. (2010).

Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides

insights into the mechanism of cytokinesis. ACS Chem Biol 5, 1015-1020.

S17. Moutinho-Pereira, S., Matos, I., and Maiato, H. (2010). Drosophila S2 cells as a model

system to investigate mitotic spindle dynamics, architecture, and function. Methods Cell

Biol 97, 243-257.

S18. Rugjee, K.N., Roy Chaudhury, S., Al-Jubran, K., Ramanathan, P., Matina, T., Wen, J.,

and Brogna, S. (2013). Fluorescent protein tagging confirms the presence of ribosomal

proteins at Drosophila polytene chromosomes. PeerJ 1, e15.

S19. Prasad, M., Jang, A.C., Starz-Gaiano, M., Melani, M., and Montell, D.J. (2007). A

protocol for culturing Drosophila melanogaster stage 9 egg chambers for live imaging.

Nat Protoc 2, 2467-2473.

supplemental information aurora a triggers lgl … information aurora a triggers lgl cortical...

Documents