supplemental information egf receptor is required for … · supplemental information egf receptor...
TRANSCRIPT
1
Cancer Cell, Volume 22
Supplemental Information
EGF Receptor Is Required
for KRAS-Induced Pancreatic Tumorigenesis
Christine M. Ardito, Barbara M. Grüner, Kenneth K. Takeuchi, Clara Lubeseder-Martellato, Nicole
Teichmann, Pawel K. Mazur, Kathleen E. DelGiorno, Eileen S. Carpenter, Christopher J. Halbrook,
Jason C. Hall, Debjani Pal, Thomas Briel, Alexander Herner, Marija Trajkovic-Arsic, Bence Sipos,
Geou-Yarh Liou, Peter Storz, Nicole R. Murray, David W. Threadgill, Maria Sibilia, M. Kay
Washington, Carole L. Wilson, Roland M. Schmid, Elaine W. Raines, Howard C. Crawford, and Jens T.
Siveke
Inventory of Supplemental Information
Supplemental Data
Figure S1, related to Figure 1.
Figure S2, related to Figure 2.
Figure S3, related to Figure 3.
Figure S4, related to Figure 4.
Figure S5, related to Figure 5.
Supplemental Experimental Procedures
Supplemental References
2
SUPPLEMENTAL DATA
Figure S1, related to Figure 1: Upregulation of EGFR expression in human and mouse pancreatic disease. (A) IHC for
total EGFR shows elevated levels in tissue sections of human chronic pancreatitis and PDA in comparison to healthy
human pancreatic tissue. (B) Expression of EGFR in the mouse models used in this study, including KrasLSL-G12D/+;Ptf1aCre/+
(KrasG12D) and the KrasLSL-G12D/+;Ptf1aCre/+;p53Flox/Flox (KrasG12D;p53KO) models. Arrows indicate mPanIN areas highly EGFR
positive. Scale bars = 50 m.
3
Figure S2, related to Figure 2: Genetic ablation of EGFR signaling impairs KRAS-driven PDAC development. (A) IHC for
total EGFR in a KrasG12D;p53KO;EgfrKO pancreas. Arrowheads indicate EGFR-negative mPanIN lesions. Scale bar = 50 m.
(B) Western blot analysis of cell lines established from KrasG12D;p53KO compared to KrasG12D;p53KO;EgfrKO pancreata for
EGFR, E-Cadherin, N-Cadherin, active MET (MET pY1234, pY1235), total MET, full length Notch-1 (Notch1 fl) and
intracellular domain (Notch1 IC), full length Notch-2 (Notch2 fl) and intracellular domain (Notch2 IC). HSP90 was used as
a loading control.
4
5
Figure S3, related to Figure 3: Ablation of EGFR signaling blocks pancreatitis-dependent neoplasia and ADM in vivo. (A)
IHC and (B&C) quantitation of MUC5AC in KrasG12D, KrasG12D;EgfrKO and KrasG12D;Adam17KO mice (*** p < 0.001). Scale
bars = 50 µm. n=3 to 4 per group. (D)Total EGFR IHC analysis in KrasG12D control and KrasG12D;EgfrKO mice. Arrowheads
highlight EGFR positive mPanIN (n=7). Scale bars = 20 µm. (E) PCR analysis of DNA isolated from either pancreas (P) or
tail (T) of the indicated genotypes to examine pancreas specificity of recombination of the STOP cassettes in KrasG12D ,
KrasG12D;Adam17KO and KrasG12D;EgfrKO mice compared to floxed mice without Ptf1aCre/+. (F) Histology of 1-year old Tgfa
mice show induction of extensive ADM (asterisks) and fibrosis, neither of which is not found in Tgfa;EgfrKO or
Tgfa;Adam17KO mice of the same age. Scale bars = 100 µm. (G) Cerulein induction of a chronic pancreatitis-like
phenotype in wild-type (WT) EgfrKO and Adam17KO mice, as indicated. H&E and DBA-Lectin staining of ductal structures
are shown. Scale bars = 100 µm. n=5 (H&I) Quantitation of cerulein-treated pancreata shown in (G) stained by IHC for
infiltrating inflammatory cells positive for either Ly-6B.2 (neutrophils), F4/80 (macrophage) or CD3 (T-cells) in the
pancreata of EgfrKO (H) and Adam17KO mice (I) in comparison to controls. (n=5, *** p < 0.001. Error bars are +/-SEM). (J)
IHC analysis of the proinflammatory proteins COX1 and COX2 in pancreata from the cerulein-treated wild-type and EgfrKO
animals shown in (G). BV indicates blood vessels. Scale bar = 20 µm. (K-N) Wild-type, EgfrKO and Adam17KO mice were
treated with 7 hourly injections of 50 g/kg of cerulein and allowed to recover for 1 hour (K-M) or 4 hours (N). At
sacrifice, body and pancreatic masses were determined (K) and serum collected for assay of amylase activity (L). (M)
H&E revealed several areas of necrosis (arrows) n=5. Scale bar = 50 m (N) SOX9 IHC of saline treated wild type control
and cerulein-treated wild type, EgfrKO and Adam17KO mice with 4 hours of recovery, n=3. Scale bar = 50 m.
6
7
Figure S4, related to Figure 4: EGFR signaling is required for ADM. (A) Staining for the intermediate progenitor marker
Nestin (white arrowheads) in acinar epithelial explants of KrasG12D and KrasG12D;EgfrKO mice at days 2 , 3 and 4 of
explant culture (upper panel, white arrow). Scale bar = 20 µm. (B) Quantitation of Nestin positive acinar clusters at days
2 and 3 in KrasG12D and KrasG12D;EgfrKO explant cultures. (C) IF staining for actin (red) and EGFR pY1068 IF (green) in WT
and EgfrKO explant cultures treated with cerulein for 3 days. Scale bar = 20 µm. (D) IF staining for TGFA (green,
arrowheads) in wild type, EgfrKO and Adam17KO acinar cell explants at 0, 3 and 5 days of culture. Scale bars = 20 µm. (E)
Co-IF staining for amylase (green) and CK19 (red) in wild-type and Adam17KO acinar cell explants, treated with cerulein
at 0, 3 and 5 days of culture. Scale bars = 20 µm. (F) IHC for the EGFR ligand TGFA, active pY1068 EGFR, ADAM17 and
AREG in normal human pancreas and chronic pancreatitis samples. Scale bars = 50 µm for main micrographs, 25 m for
insets.
8
Figure S5, related to Figure 5: EGFR is important for maximal MAPK activity, which is critical for metaplasia and
neoplasia. (A) Active phospho-STAT3 IHC in 3 month old KrasG12D and KrasG12D;EgfrKO pancreata. (B) KRAS and EGFR co-
immunoprecipitation from KrasG12D derived tumor cells isolated as described previously ( Mazur et al., 2010). IgG was
used as negative control for immunoprecipitation. Whole cell lysate was used as a positive control for expression of the
blotted proteins. Numbers designates indicate two separate cell lines. (C) Confocal IF analysis of EGFR and KRAS
localization in pancreata of 3 month old KrasG12D mice. Arrowhead highlights an area of colocalization. Scale bar = 10 m.
(D) S2013 (mutant KRAS) and BXPC-3 cells (wild-type KRAS) were treated with vehicle, erlotinib or recombinant TGFA.
Lysates were assessed for RAS activity by RAF-RBD pulldown. ERK and EGFR activities were measured by western blotting
for pERK1/2 pT202,pY204 and EGFR pY1068, respectively. Numbers represent quantitation from 3 independent
experiments. Similar results were obtained with other mutant Kras PDA cell lines, including L3.2, CAPAN-2 and ASPC-1.
MiaPaCa2 and Panc1 cell lines did not respond to erlotinib treatment. (E) IHC for for pERK1/2 pT202,pY204 in normal
human pancreas and chronic pancreatitis. Scale bar = 50 m.
9
SUPPLEMENTAL EXPERIMENTAL PROCEDURES
RNA isolation for pancreas and qRT-PCR
Mice were anesthetized with avertin and the tail of the pancreas was removed and immediately homogenized in
RLT buffer (Qiagen, Valencia, CA) using a Pro 250 Homogenizer (Pro Scientific, Oxford, CT). Total RNA was extracted
from mouse pancreatic tissue using the RNeasy Mini kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol.
5 µg of RNA was treated with TURBO DNA-free DNase (Ambion, Austin, TX) according to the manufacturer’s directions.
Reverse transcription was performed on 2 µg of DNase-digested RNA using the iScript cDNA Synthesis Kit (Bio-Rad,
Hercules, CA).
All real-time PCR reactions were performed in triplicate using Power SYBR Green PCR Master Mix (Applied
Biosystems, Foster City, CA) on a StepOnePlus Real-time PCR System (Applied Biosystems) and analyzed using the
StepOne version 2.2 software (Applied Biosystems, Foster City, CA). Aliquots equivalent to 12.5 ng of total RNA were
taken from the reverse transcription reactions and added to 25 L PCR reactions containing 300 nM of forward and
reverse primers. To ensure only one PCR product was being produced, melt curve analysis was performed after the
amplification cycles by denaturing each reaction over a 35°C temperature gradient from 60°C to 95°C. The cycle
threshold (Ct) of the amplification plot was adjusted to a point within the geometric phase of amplification to obtain Ct
values for each PCR reaction. The relative amount of each gene of interest was normalized to the reference genes
HPRT1, RPL13A, 18s RNA and TBP by a modified delta Ct method. The fold change was then calculated by comparing the
delta Ct of each experimental condition to the control treatment and expressed as arbitrary mRNA units and expressed
relative to signal from results from wild type pancreata.
qRT-PCR oligonucleotides
Neuregulin F/R AACAGCAGGCACAGCAGCCC/ AGGGGAGCTTGGCGTGTGGA
EGFR (fresh pancreas) F/R TGCCACCTATGCCACGCCAAC / TGAGACCTCTGGCTGGCCCA
EGF F/R CAGCGGACCCAACAGCAGCA / GCACTGACCCGAGCTGCAGG
TGFA F/R TGTGGCCCTGGCTGTCCTCA / GGCACTGCCAGGGGTGTTGT
10
HBEGF F/R TTGTCCGCGTTGGTGACCGG / CTTGGGGTGGCCAGGCCTTG
AREG F/R GGAGCCGCTGTCGTGTTGCT / GTCCACCGGCACTGTGGTCC
BTC F/R ATGCCGCTTCGTGGTGGACG / GCAGGTGCAGACGCCGATGA
EREG F/R CACTCCGCAAGCTGCACCGA / TGCACTTGAGCCACACGGGG
18s RNA F/R CGAAGGATTGACAGATTG / CAAATCGCTCCACCAACTAA
TBP F/R CCCCACAACTCTTCCATTCT / GCAGGAGTGATAGGGGTCAT
HPRT1 F/R TCAGTCAACGGGGGACATAAA / GGGGCTGTACTGCTTAACCAG
RPL13a F/R TCTGGGCCGGAAGGTGGTGG / GGCAGCATGCCTCGCACAGT
Cyclophillin-F/-R ATGGTCAACCCCACCGTGT / TTCTGCTGTCTTTGGAACTTTGTC
ErbB1-F/-R (for explants) GTCTGCCAAGGCACAAGTAAC / CACCTCCTGGATGGTCTTTAA
ADAM 17 F/R CCCCCACCCGGAGATGCTGA/ CGGCACACACGGGCCAGAAA
Antibodies:
CK19 (TROMA III, Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, Iowa), Amylase (Sigma-
Aldrich), total EGFR and EGFR pY1068 from both Millipore (Billerica, MA) and Epitomics (Burlingame, CA). Antibodies
recognizing Erk1/2, Akt 1/2,Kras, Cox1, Cox2 were from Santa Cruz Biotechnology (Santa Cruz, CA) Those for Erk pT202
pY204, Akt pT308, c-Met, Stat3 Y705, E-cadherin and Cleaved Caspase-3 were from Cell Signaling Technology (Danvers,
MA); for Notch-1, N-cadherin and Sox9 were from BD Biosciences (San Diego, CA), for total Ras and CyclinD1 were from
Epitomics, for Muc5 AC (Thermo Fisher Scientific, Kalamazoo, MI), CD3 and BrdU (Abcam, Cambridge, MA),
ADAM17/TACE (Millipore), for Ly-6B.2 and F4/80 were from AbD Serotec, (Oxford, UK), pY1234/pY1235 c-Met (R&D),
TGFA (Novus Biologicals) and AREG (LifeSpan BioSciences Inc., Seattle, WA).
Antibodies for whole-mount immunofluorescence included cytokeratin-19 (DAKO, Carpinteria, CA), amylase and
actin (Sigma-Aldrich), Nestin (BD Biosciences) and EGFR pY1068 (Epitomics). Secondary antibodies were Alexa Fluor488-
labeled anti-rabbit and Alexa Fluor594 anti-mouse (Invitrogen, Grand Island, NY).
11
BrdU incorporation
Wild type, KrasG12D, EGFRKO and KrasG12D;EGFRKO mice were treated i.p. with either 250 µg/kg cerulein or saline
once daily for three days followed by three days of recovery. Beginning on the third day of cerulein administration and
continuing until euthanasia, 50 mg/kg BrdU was injected i.p. once daily. Tissue harvest was performed 8 hours after the
injection on a particular day, as indicated. Mice were anesthetized and perfused with 4% paraformaldehyde. Tissue was
analyzed by IHC.
Histological quantitation
Quantitation of amylase positive area was performed on independent, singly DAB stained sections using
Olympus cellSens Dimension imaging software. Final quantitation represents the average of 15-20 20X fields of view
from 2 mice of each genotype, treatment regimen or time point, as indicated.
For MUC5AC quantitation, representative slides per mouse were chosen and at least 5 10X pictures were taken
from each slide and calculated manually or using the AxioVision 4.8 software (n = 3-4 mice per group).
Cleaved Caspase 3 and Cyclin D1 and were quantified using Aperio ImageScope v11.1.2.752 software.
Quantitation represents the average of 10-15 20x fields of view from a representative slide from each mouse. Caspase
quantitation used an algorithm counting positive pixels, whereas CyclinD1 quantitation counted positive nuclei (n = 3).
For CK19 quantitation of the In vivo treatment of KrasG12D;p53KO mice with erlotinib or cetuximab, three slides
per mouse from different regions were randomly chosen and at least 5 10X pictures were taken from each slide and
calculated manually or using the AxioVision 4.8 software (n = 3 mice per group).
Percentage of healthy acinar tissue in KrasG12D;p53KO and KrasG12D;p53KO;EgfrKO mice was calculated using the
Zeiss Mirax optical slide scanner and the Panoramic Viewer 1.15 software. Two slides per mouse from 2 mice of each
genotype were measured.
12
Primary cell isolation for RAS Activity Assay
Pancreata were removed from 3 to 5 week old wild-type, KrasG12D, KrasG12D;Adam17KO or KrasG12D;EGFRKO mice.
Pancreata were rinsed twice in HBSS, minced and incubated with 0.2 mg/mL Collagenase-P (Roche, Indianapolis, IN) at
37°C for 15 minutes. Collagenase digested tissue was rinsed 3x in HBSS containing 5% FBS and filtered through 500 µm
and 105 µm polypropelene mesh (Spectrum Laboratories, Rancho Dominguez, CA) in succession. Filtrate was
centrifuged through HBSS supplemented with 30% FBS and resuspended in 1x Waymouth MB 752/1 medium (Sigma-
Aldrich, St. Loius, MO) supplemented with 50 µg/mLg gentamycin (Life Technologies, Grand Island, NY), 0.4 mg/mL
soybean trypsin inhibitor (Life Technologies), and 1 µg/mL dexamethasone (Sigma-Aldrich). The cellular suspension was
plated in non-adherent plates overnight at 37°C and 5% CO2. The following day, cells were either left untreated or
treated with 1 µM Erlotinib (Cayman Chemical, Ann Arbor, MI) for 6 hours, rinsed once in HBSS and lysed in an
appropriate volume of MLB (25 mM HEPES pH 7.4, 150 mM NaCl, 1% Igepal CA-630, 10% glycerol, 25 mM NaF, 10 mM
MgCl2 and 1 mM EDTA) containing protease and phosphatase inhibitors (Roche).
RAS Activity Assay
GST-Raf-1-RBD fusion protein was prepared by modifying procedures published elsewhere (Castro A.F et al Methods,
2005). Briefly, a 250 mL culture of BL21(DE3)LysE bacteria containg the GST-Raf-1-RBD expression construct was induced
with IPTG for 4 hours. The bacteria was pelleted by centrifugation and resuspened in bacterial lysis buffer (50 mM Tris
pH 8.0, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, 100 µM PMSF) containing protease inhibitors (Roche). Bacteria were
lysed by ten 10 second pulses using a Branson Sonifier 150 (Branson Ultrasonics Corp., Danbury CT) at power setting 7.
Debris was pelleted by centrifugation and Lysate was removed and incubated with 500 µL of glutathione beads (Thermo
Scientific, Rockford, IL) for 2 hours at 4°C with agitation. Beads were pelleted and washed 3x with wash buffer (20 mM
Tris pH 8, 50 mM NaCl, 20% glycerol, 1 mM EDTA and 1 mM DTT) containing protease inhibitors (Roche). The active RAS
pulldown assays were performed by incubating 750 µg of either cell line or acinar cell lysate with 75 µg of GST-Raf-1-RBD
fusion protein bound beads in a total volume of 1.5 mL of MLB at 4°C for 1 hour with agitation. Beads were washed 3x
13
with MLB then incubated with Laemmli buffer at 95°C for 5min. Protein was separated by denaturing SDS-PAGE,
transferred to Immobilon PSQ (Millipore, Billerica, MA) and visualized by standard western blotting techniques.
Immunoprecipitation of murine PDA lysates
Primary murine PDA cell lines of KrasG12D mice were lysed in a non-denaturating lysis buffer and incubated with primary
antibody (Egfr and Ras, both Millipore). Pull-down of immunoprecipitates was achieved using A/G agarose (Thermo
Scientific) and visualization was performed using standard western blot.
Cytokine Expression Analysis
Two Egfr floxed and EgfrKO mice were treated to induce chronic pancreatitis, as described. Two saline-treated mice of
each genotype were used as baseline normalization controls. The pancreata were harvested 24 hrs after the final
cerulein injection and divided in half. The pancreatic head was preserved and embedded in paraffin for further analysis,
while the tail was homogenized to make protein lysates. Protein was quantitated by BCA assay (ThermoFisher Scientific,
Rockford, IL) and equal protein from the duplicate genotypes and treatment regimens were combined. Lysates were
used to probe the Mouse Cytokine Array, Panel A (R&D Systems, Minneapolis, MN) and quantitated with Imagequant5
software (GE Healthcare, Piscataway, NJ). When the ratio between the saline and cerulein-treated mice differed by
more than 5-fold between genotypes, the cytokine was scored as being differentially expressed.
Amylase Activity Assay
Blood was collected from mice by cardiac puncture upon euthanization, allowed to coagulate and centrifuged to
obtain serum. Serum amylase activity was determined using Liquid Amylase Reagent (Pointe Scientific, Canton, MI)
according to the manufacturer’s instructions.
SUPPLEMENTAL REFERENCE Mazur, P. K., Einwachter, H., Lee, M., Sipos, B., Nakhai, H., Rad, R., Zimber-Strobl, U., Strobl, L. J., Radtke, F., Kloppel, G.,
et al. (2010). Notch2 is required for progression of pancreatic intraepithelial neoplasia and development of pancreatic
ductal adenocarcinoma. Proc Natl Acad Sci U S A 107, 13438-13443.