supplementary material eraso et al. - journal of...
TRANSCRIPT
![Page 1: Supplementary material Eraso et al. - Journal of Bacteriologyjb.asm.org/content/suppl/2014/05/02/JB.01370-13.DCSupplemental/zjb... · Supplementary material Eraso et al. Figure S1](https://reader031.vdocument.in/reader031/viewer/2022020216/5be4a6d709d3f2f4628cfb8d/html5/thumbnails/1.jpg)
Supplementary material Eraso et al.
Figure S1. Filamentation phenotype associated with MraZ overproduction. DIC images
were obtained for WT MG1655 in LB containing either pDSW208 vector or pDSW208-
mraZ, ± IPTG, from log phase cultures.
![Page 2: Supplementary material Eraso et al. - Journal of Bacteriologyjb.asm.org/content/suppl/2014/05/02/JB.01370-13.DCSupplemental/zjb... · Supplementary material Eraso et al. Figure S1](https://reader031.vdocument.in/reader031/viewer/2022020216/5be4a6d709d3f2f4628cfb8d/html5/thumbnails/2.jpg)
Figure S2. Effect of growth medium on killing by overproduced MraZ. Spot dilutions of
WT MG1655 containing pDSW208 vector (V) or pDSW208-mraZ (Z) in LB,
minimal/glucose, or minimal/glycerol media, uninduced.
![Page 3: Supplementary material Eraso et al. - Journal of Bacteriologyjb.asm.org/content/suppl/2014/05/02/JB.01370-13.DCSupplemental/zjb... · Supplementary material Eraso et al. Figure S1](https://reader031.vdocument.in/reader031/viewer/2022020216/5be4a6d709d3f2f4628cfb8d/html5/thumbnails/3.jpg)
Figure S3. Cloning the mraZ regulatory region. Top: A ~2.7-kb fragment containing
most of the intergenic region between cra, located upstream from mraZ, and mraZ. This
fragment also contains mraZ, mraW, and ftsL. Bottom: complementation of the FtsL
depletion strain WM2909 (Table 1) at permissive (30˚C) and non-permissive (42˚C)
conditions by the fragment represented at the top. (V), vector only.
![Page 4: Supplementary material Eraso et al. - Journal of Bacteriologyjb.asm.org/content/suppl/2014/05/02/JB.01370-13.DCSupplemental/zjb... · Supplementary material Eraso et al. Figure S1](https://reader031.vdocument.in/reader031/viewer/2022020216/5be4a6d709d3f2f4628cfb8d/html5/thumbnails/4.jpg)
TABLE S1. Primers used in this study Primers DNA sequence 1650 GGGGAAGATATGTCCTAAAATGCCGC 1651 CCAAAAGTCCCATCAATGTAGATGCCATC 1658 CGCGTCTGTCGAGCATGAACCCGGTTG 1659 GGCGCTCGTGGCTTCCCATCGATCCTTTAAC 1661 GGCATGTTCTTCCTGACGTTTTGGTTTCTGCG 1776 GGCGCGTAGAGTACGGGACTGGACATCAATATGC 1816 GAGATTGACTAACGTTGCTCCCCG 1922 CGCTGATATTAGCCGTAAACATCGG 1923 CCATTTGACCGGCAGCGTTCTCAAG 2040 GATCCAAACAATTGATGAAATTCAGTCCAC 2041 CCAGGTGTTCTGCTACATATTCGGCACCGC
![Page 5: Supplementary material Eraso et al. - Journal of Bacteriologyjb.asm.org/content/suppl/2014/05/02/JB.01370-13.DCSupplemental/zjb... · Supplementary material Eraso et al. Figure S1](https://reader031.vdocument.in/reader031/viewer/2022020216/5be4a6d709d3f2f4628cfb8d/html5/thumbnails/5.jpg)
Table S2. MraZ orthologs
Present Present Found in Bacteria (2184) Proteobacteria 1008 alphaproteobacteria 193 166 gammaproteobacteria 555 397 betaproteobacteria 191 156 deltaproteobacteria 68 62 zetaproteobacteria 1 1 Actinobacteria 328 Actinobacteria 328 275 Dictyoglomi 2 Dictyoglomia 2 2 Chloroflexi 18 Chloroflexi 10 7 Thermomicrobia 3 3 Dehalococcoidia 2 2 Caldilineae 1 1 Anaerolineae 1 1 Ktedonobacteria 1 1 Bacteroidetes 184 Flavobacteriia 62 59 Cytophagia 13 13 Sphingobacteriia 14 13 Bacteroidia 92 74 Bacteroidetes Order II 3 2 Planctomycetes 8 Planctomycetia 8 6 Spirochaetes 23 Spirochaetia 23 17 Nitrospirae 8 Nitrospira 8 8 Firmicutes 571 Bacilli 299 219 Clostridia 216 194 Negativicutes 35 34 Erysipelotrichi 21 21 Deinococcus-Thermus 18 Deinococci 18 18 Chlamydiae 1 Chlamydiia 1 1 Fusobacteria 3 Fusobacteriia 3 3 Fibrobacteres 1 Fibrobacteriia 1 1 Thermodesulfobacteria 2 Thermodesulfobacteria 2 2 Chlorobi 8 Chlorobia 8 7 Tenericutes 40 Mollicutes 40 25 Deferribacteres 4 Deferribacteres 4 4 Verrucomicrobia 9 Verrucomicrobiae 2 2 Opitutae 5 5 Methylacidiphilales 2 2 Synergistetes 11 Synergistia 11 11 Acidobacteria 6 Acidobacteriia 5 5 Holophagae 1 1 Nitrospinae 1 Nitrospinia 1 1 Lentisphaerae 1 Lentisphaeria 1 1
![Page 6: Supplementary material Eraso et al. - Journal of Bacteriologyjb.asm.org/content/suppl/2014/05/02/JB.01370-13.DCSupplemental/zjb... · Supplementary material Eraso et al. Figure S1](https://reader031.vdocument.in/reader031/viewer/2022020216/5be4a6d709d3f2f4628cfb8d/html5/thumbnails/6.jpg)
1
Table S3. MraW orthologs Present Present Found in Bacteria (4184) Proteobacteria 1857 alphaproteobacteria 386 308 gammaproteobacteria 877 500 betaproteobacteria 244 157 deltaproteobacteria 82 73 epsilonproteobacteria 267 45 zetaproteobacteria 1 1 Actinobacteria 442 Actinobacteria 442 328 Dictyoglomi 2 Dictyoglomia 2 2 Chloroflexi 15 Chloroflexi 7 7 Thermomicrobia 2 2 Dehalococcoidia 3 2 Caldilineae 1 1 Anaerolineae 1 1 Ktedonobacteria 1 1 Bacteroidetes 265 Flavobacteriia 81 64 Cytophagia 22 22 Sphingobacteriia 15 13 Bacteroidia 141 110 Bacteroidetes Order II 4 2 Planctomycetes 26 Planctomycetia 25 16 Phycisphaerae 1 1 Spirochaetes 125 Spirochaetia 125 56 Nitrospirae 8 Nitrospira 8 8 Firmicutes 1084 Bacilli 689 310 Clostridia 325 223 Negativicutes 43 35 Erysipelotrichi 27 22 Deinococcus-Thermus 20 Deinococci 20 17 Chlamydiae 20 Chlamydiia 20 10 Fusobacteria 40 Fusobacteriia 40 27 Fibrobacteres 1 Fibrobacteriia 1 1 Thermodesulfobacteria 2 Thermodesulfobacteria 2 2 Aquificae 16 Aquificae 16 15 Chlorobi 10 Chlorobia 10 9 Cyanobacteria 122 Chroococcales 65 49 Stigonematales 1 1 Oscillatoriales 22 20 Nostocales 16 15 Prochlorales 13 1 Gloeobacteria 1 1 Pleurocapsales 4 4 Tenericutes 65 Mollicutes 65 41 Thermotogae 18 Thermotogae 18 16 Deferribacteres 4 Deferribacteres 4 4 Verrucomicrobia 16 Verrucomicrobiae 6 4 Spartobacteria 2 1
![Page 7: Supplementary material Eraso et al. - Journal of Bacteriologyjb.asm.org/content/suppl/2014/05/02/JB.01370-13.DCSupplemental/zjb... · Supplementary material Eraso et al. Figure S1](https://reader031.vdocument.in/reader031/viewer/2022020216/5be4a6d709d3f2f4628cfb8d/html5/thumbnails/7.jpg)
2
Present Present Found in Opitutae 6 5 Methylacidiphilales 2 2 Synergistetes 12 Synergistia 12 11 Acidobacteria 7 Acidobacteriia 5 5 Holophagae 2 1 Nitrospinae 1 Nitrospinia 1 1 Caldiserica 1 Caldisericia 1 1 Lentisphaerae 1 Lentisphaeria 1 1 Elusimicrobia 1 Elusimicrobia 1 1 Gemmatimonadetes 1 Gemmatomonadetes 1 1 Chrysiogenetes 1 Chrysiogenetes 1 1 Haloplasmatales 1 Haloplasmataceae 1 1 Ignavibacteria 2 Ignavibacteria 2 2 Eukaryota (206) Viridiplantae 36 Streptophyta 25 17 Chlorophyta 11 8 Bangiophyceae 2 Cyanidiales 2 2 Bacillariophyta 4 Coscinodiscophyceae 3 2 Bacillariophyceae 1 1 Phaeophyceae 1 Ectocarpales 1 1 Cryptophyta 1 Pyronomonadales 1 1 Metazoa 113 Porifera 1 1 Cnidaria 2 1 Platyhelminthes 2 2 Annelida 2 1 Mollusca 1 1 Arthropoda 31 29 Equinodermata 2 1 Chordata 70 51 Hemichordata 1 1 Placozoa 1 1 Fungi 2 Chytridiomycota 1 1 Mucorales 1 1 Peronosporales 2 Phytophthora 2 2 Icthiosporea 1 Capsaspora 1 1 Kinetoplastida 13 Trypanosomatidae 13 9 Heterolobosea 1 Schizopyrenida 1 1 Dictyosteliida 4 Dictyostelium 3 3 Polysphondylium 1 1 Apicomplexa 18 Coccidia 4 2 Aconoidasida 14 13 Oligohymenophorea 2 Hymenostomatida 1 1 Peniculida 1 1 Spirotrichea 1 Sporadotrichida 1 1 Pelagophyceae 3 Aureococcus 3 1 Euglyfida 1 Paulinellidae 1 1 Albuginales 1 Albuginaceae 1 1
![Page 8: Supplementary material Eraso et al. - Journal of Bacteriologyjb.asm.org/content/suppl/2014/05/02/JB.01370-13.DCSupplemental/zjb... · Supplementary material Eraso et al. Figure S1](https://reader031.vdocument.in/reader031/viewer/2022020216/5be4a6d709d3f2f4628cfb8d/html5/thumbnails/8.jpg)
1
TABLE S4. Differential gene expression comparing WT to mraZ-
Gene
Description logFC (1) P-value FDR(2)
flu Antigen 43, phase-variable bipartite outer membrane protein -3.561810633 8.85E-31 3.47E-27
hyi Hydroxypyruvate isomerase, glyoxylate-inducible -3.421677637 0.000503552 0.024705503 glxR Tartronate semialdehyde reductase, glyoxylate-inducible -2.809710388 0.000736019 0.031063153 emrD Multidrug resistance pump -2.203280196 4.21E-09 2.36E-06 rsxB Reducer of the transcriptional activator SoxR -2.136495647 0.000493231 0.024705503 ybfE Function unknown -2.071181902 0.000324994 0.01860387 suhB Inositol-1-monophosphatase -1.951099212 8.79E-10 5.75E-07 yfhL Function unknown -1.936988432 3.28E-05 0.004291395 gpt Xanthine phosphoribosyltransferase -1.868438304 3.77E-08 1.85E-05 dusC tRNA-dihydrouridine synthase -1.862015441 0.001003426 0.037869692 yicG Function unknown -1.853006611 7.21E-06 0.001318339 rsxA Reducer of the transcriptional activator SoxR -1.845642755 7.81E-05 0.006661087 holD DNA polymerase, psi subunit -1.845642755 0.000257098 0.016017615 ygjN mRNA interferase, toxin-antitoxin pair HigBA -1.812521274 0.000668322 0.029837046 cnu oriC-binding Nucleoid-associated protein -1.785306745 4.21E-07 0.000175622 ycgX Function unknown -1.769786133 0.000789119 0.03190292 yhjV Function unknown -1.757040922 0.000327049 0.01860387 flhD Transcriptional activator of flagellar class II operons -1.695406053 3.93E-05 0.00468003 ydiY Function unknown -1.692804839 0.000401104 0.021865741 gltF Function unknown -1.661435275 0.000767557 0.03190292 ydhI Efflux pump associated protein -1.636230888 6.54E-05 0.005967112 ynfM Putative arabinose efflux transporter -1.632298379 4.47E-07 0.000175622 secG secA-interacting subunit -1.628567246 1.14E-06 0.000337469 yfiC tRNA m(6)A37 methyltransferase, SAM-dependent -1.618046877 0.000439542 0.023002713 ydgK Function unknown -1.582923967 1.73E-06 0.00042539 spr Murein DD-endopeptidase, space-maker hydrolase -1.554511912 8.18E-07 0.000274468 yeaJ Predicted membrane-anchored diguanylate cyclase -1.546364758 4.24E-05 0.004755532
uhpA Response regulator required for uhpT transcription; hexose-P utilization -1.544853067 0.001457439 0.046507697
opgC Protein involved in succinylation of osmoregulated periplasmic glucans (OPGs) -1.542382053 0.000676156 0.029837046
yliE Predicted membrane-anchored cyclic-di-GMP phosphodiesterase -1.535589853 0.000523148 0.025350065
rplU 50S ribosomal subunit protein L21 -1.491586262 4.35E-06 0.00089881 cspF Cold shock protein; not cold-inducible -1.470980445 4.79E-05 0.005085294 yhdU Function unknown -1.413458375 0.001271763 0.043946707 pyrD Dihydroorotate dehydrogenase, UMP biosynthesis -1.408272759 0.000301707 0.017942452
pgaA Biofilm adhesin polysaccharide PGA secretin; OM porin -1.395457349 3.91E-05 0.00468003
appY Global transcription regulator, AraC family -1.378234657 6.94E-05 0.006192713 rpsF 30S ribosomal subunit protein S6 -1.334552885 3.46E-06 0.000798698 greA Transcript cleavage factor; growth regulator -1.327538658 0.000731116 0.031063153 yidD Membrane protein insertion efficiency factor -1.327294168 0.000436902 0.023002713 mglA Methyl-galactoside transporter -1.321501584 0.000719351 0.031026955 gtrA Bactoprenol-linked glucose translocase -1.29479156 1.56E-05 0.002362197 atpI ATP synthase; accessory factor -1.289662825 7.39E-06 0.001318339
![Page 9: Supplementary material Eraso et al. - Journal of Bacteriologyjb.asm.org/content/suppl/2014/05/02/JB.01370-13.DCSupplemental/zjb... · Supplementary material Eraso et al. Figure S1](https://reader031.vdocument.in/reader031/viewer/2022020216/5be4a6d709d3f2f4628cfb8d/html5/thumbnails/9.jpg)
2
rnpA RNase P, C5 protein component; involved in tRNA and 4.5S RNA-processing -1.289427539 0.000196951 0.01356587
ycaD Function unknown -1.272195561 2.81E-05 0.003938153 rpsT 30S ribosomal subunit protein S20 -1.259588424 3.77E-05 0.00468003
fimB Site-specific recombinase; mediates fimbriae phase switching -1.251966108 0.000832619 0.03268031
ibpA Chaperone, heat-inducible protein of HSP20 family -1.244428293 0.000501548 0.024705503 rpsU 30S ribosomal subunit protein S21 -1.217090126 2.93E-05 0.003971468 yfiP Function unknown -1.213137107 0.001452494 0.046507697 dusB tRNA-dihydrouridine synthase B -1.209293071 5.90E-05 0.005938436 prfC Peptide chain release factor 3, RF-3 -1.186943459 0.000437386 0.023002713 ygiM Function unknown -1.179723763 0.00067656 0.029837046 maa Maltose O-acetyltransferase -1.174712966 8.20E-05 0.00684814 dusA tRNA-dihydrouridine synthase A -1.16521842 0.000465742 0.023740738
mioC
Required for biotin synthase activity in vitro; transcription of mioC through oriC may have physiological significance in suboptimal conditions -1.161018607 0.000231785 0.014781392
intS Integrase -1.150599342 0.001236758 0.043946707 yhbU Function unknown -1.146381326 0.001173804 0.042267701 amiC N-acetylmuramyl-L-alanine amidase -1.13771701 6.40E-05 0.005967112 rpsJ 30S ribosomal subunit protein S10 -1.11577945 2.48E-05 0.003601479 xseA Exonuclease VII, large subunit -1.09942772 0.000148406 0.010590782 cld Regulator of lipopolysaccharide O-chain length -1.094766224 6.39E-05 0.005967112 yedE Function unknown -1.08334363 0.000976472 0.037210216 yacC Function unknown -1.08312961 0.000315486 0.018481835 yafK L,D-transpeptidase-related protein -1.05588482 6.30E-05 0.005967112 mltD Lytic transglycosylase D, murein hydrolase -1.054385865 0.000125866 0.009500448 yibB Function unknown -1.042352958 0.000298301 0.017942452 mnmA tRNA(Gln,Lys,Glu) U34 2-thiouridylase -1.033234906 0.000219216 0.014781392 lamB Maltoporin, maltose high-affinity uptake system -1.022047204 0.00023052 0.014781392 rplY 50S ribosomal subunit protein L25; 5S rRNA-binding -1.00894027 0.000116655 0.008977852
patA YgjG; putrescine aminotransferase. Putrescine degradation 1.030694455 0.000788399 0.03190292
yqjE Function unknown 1.050538935 0.001035185 0.038696202 ydcI Predicted transcriptional regulator, function unknown 1.052935264 4.32E-05 0.004755532 betI Repressor for the betIBA betT divergon; osmoprotection 1.072514802 8.94E-05 0.007314252
lhgO L-2-hydroxyglutarate oxidase; recovery of a-keto-glutarate 1.084998452 0.000197008 0.01356587
aldA Aldehyde dehydrogenase; putrescine degradation 1.09966751 5.55E-05 0.005732507
puuR Transcriptional repressor for the puu divergon; induced by putrescine; putrescine degradation 1.100916533 0.000553482 0.026402688
fadD Acyl-CoA synthase; fatty acid degradation 1.119226855 8.86E-06 0.00151244
fadE Medium-long-chain fatty acyl-CoA dehydrogenase; fatty acid degradation 1.131297488 0.000641175 0.029262951
ybiI Function unknown 1.148804426 0.000334449 0.01875301 trpT Tryptophan tRNA(CCA) 1.174062063 0.000148355 0.010590782 fadA 3-ketoacyl-CoA thiolase; fatty acid degradation 1.175843711 0.000810172 0.032120452
fadB fatty acid oxidation complex subunit alpha; fatty acid degradation 1.17813692 1.31E-05 0.002070512
yidG Function unknown 1.186250415 0.000558324 0.026402688 fucP Fucose permease 1.220661044 0.000233489 0.014781392
![Page 10: Supplementary material Eraso et al. - Journal of Bacteriologyjb.asm.org/content/suppl/2014/05/02/JB.01370-13.DCSupplemental/zjb... · Supplementary material Eraso et al. Figure S1](https://reader031.vdocument.in/reader031/viewer/2022020216/5be4a6d709d3f2f4628cfb8d/html5/thumbnails/10.jpg)
3
yjfO Function unknown 1.229423858 9.20E-05 0.007370652 argT Lys-, Arg-, and Orn-binding protein 1.24485951 1.20E-06 0.000337469 csiD Carbon starvation induced gene, function unknown 1.249035009 0.000135104 0.010005348
paaJ 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase; phenylacetic acid degradation 1.344448803 1.32E-05 0.002070512
acs Acetyl CoA synthase, acetate-scavenging enzyme, improves carbon starvation survival 1.436390429 1.69E-06 0.00042539
sucD Succinyl CoA synthase alpha-subunit 1.444572527 0.001310004 0.043946707 potF Putrescine-ornithine transporter 1.519786649 8.39E-07 0.000274468 astB Arginine succinyltransferase; arginine catabolism 1.528409912 0.000914535 0.035540105 puuP Putrescine importer 1.562049883 7.14E-05 0.006226933
puuD Gamma-glutamyl-GABA hydrolase; putrescine degradation 1.764918677 8.33E-10 5.75E-07
phoH Function unknown 1.93668688 2.54E-10 2.49E-07 astD Arginine succinyltransferase; arginine catabolism 2.024375032 4.36E-05 0.004755532 astA Arginine succinyltransferase; arginine catabolism 2.153768048 4.25E-06 0.00089881
puuA Gamma-glutamylputrescine synthase, ATP-dependent; putrescine degradation 2.275011812 2.14E-12 2.80E-09
astC Succinylornithine transaminase, arginine catabolism 2.426168746 7.07E-13 1.39E-09
puuB Gamma-glutamylputrescine oxidase; putrescine degradation 3.036431807 6.61E-06 0.00129687
Highlighted genes are sorted into different overall functional groups. Blue: polyamine
metabolism; magenta: arginine catabolism; green: fatty acid catabolism; yellow: translation.
(1) Log2 of the fold change calculated from expression values. (Negative signs): genes activated by MraZ; (positive signs): genes repressed by MraZ.
(2) The maximum false discovery rate (FDR) chosen was 0.05.