supplementary material for - science · 2012. 7. 9. · black and white) bag (kindly provided by...
TRANSCRIPT
Correction: 12 July 2012
www.sciencemag.org/cgi/content/full/336/6089/1711/DC1
Supplementary Material for
Uniform ripening Encodes a Golden 2-like Transcription Factor Regulating Tomato Fruit Chloroplast Development
Ann L.T. Powell,* Cuong V. Nguyen, Theresa Hill, KaLai Lam Cheng, Rosa Figueroa-Balderas, Hakan Aktas, Hamid Ashrafi, Clara Pons, Rafael Fernández-Muñoz, Ariel Vicente, Javier Lopez-Baltazar, Cornelius S. Barry, Yongsheng Liu, Roger Chetelat,
Antonio Granell, Allen Van Deynze, James J. Giovannoni,* Alan B. Bennett
*To whom correspondence should be sent. E-mail: [email protected] (A.L.T.P.); [email protected]
(J.J.G.)
Published 29 June 2012, Science 336, 1711 (2012) DOI: 10.1126/science.1222218
This PDF file includes:
Materials and Methods
Figs. S1 to S8
Tables S1 to S3, S7, and S8
References (32–58) Other Supplementary Material for this manuscript includes the following: (available at www.sciencemag.org/cgi/content/full/336/6089/1711/DC1)
Tables S4 to S6 as a separate Excel file Correction: On page 2, the accession number of Ailsa craig was corrected to “LA2838A” on the third line of Materials and Methods.
2
Materials and Methods MATERIALS AND METHODS Plant materials, fruit staging and harvesting. Tomato plants (Solanum sps.) were
grown in fields and greenhouses in Davis, CA and Ithaca, NY, USA and Malaga, Spain.
The S. lycopersicum varieties ‘Ailsa Craig’ (LA2838A), the monogenic u mutant of
‘Ailsa Craig’ called ‘Craigella’ (LA3247) (36), ‘Castlemart’, ‘Fireball’, ‘E6203’ and
‘M82’ (LA3475) were germinated from stock seed collections (Tomato Genetics
Resource Center, UC Davis), transplanted and grown in two gallon pots in greenhouses
or in furrow irrigated fields. Seed for S. lycopersicum var. cerasiforme (PI114490) was
provided by A. Van Deynze and SolCAP and grown in greenhouses in Davis, CA, USA.
Seed for lines, N93 (u/u) and 73X (U/U), T91 (U/U) were provided by Hanoi University
of Agriculture, Viet Nam and grown in Ithaca, NY, USA. S. pennellii (LA0716), IL10-1
(LA4087), IL10-1-1 (LA4088) and IL10-2 (LA4089) lines from the S. lycopersicum
(‘M82’) x S. pennellii IL population were grown in greenhouses in Davis and Ithaca. The
BC2S1 and RIL S. lycopersicum (‘Moneymaker’) x S. pimpinellifolium (‘TO-937’)
population and additional IL10-1, IL10-1-1, IL10-2, and LA0716 plants were grown in
plastic greenhouses in Malaga, Spain. The ‘Cuatomate’ landrace was provided by J.
Lopez-Baltazar, Oaxaca, Mexico, and grown in greenhouses in Davis. Transgenic tomato
(S. lycopersicum cv. ‘T63’) lines expressing the transcription factors AtGLK1
(At2g20570) or AtGLK2 (At5g44190) regulated by the CaMV35S (p35S), the
Arabidopsis lipid transfer protein (pLTP) (37), the tomato rubisco small subunit 3b
(pRbcS) (38, 39) or the tomato phytoene desaturase (pPDS) (38, 40) promoters were
provided by Mendel Biotech. Inc., Hayward, CA, USA and Seminis Vegetable Seeds-
3
Monsanto, Woodland, CA, USA. The AtGLK expressing lines were obtained by crossing
two types of parental transgenic tomato lines. In the cross, one parent line was
transformed using Agrobacterium tumefaciens with a TDNA construct containing either
the AtGLK1 or the AtGLK2 coding sequence fused to the E. coli LexA operator binding
site (LexA:AtGLK1, LexA:AtGLK2) and the CaMV35S regulated sulfonamide selectable
marker (dihydropteroate synthase, SULII). The second parental lines used in the crosses
were transformed with the LexA-Gal4 activation domain coding sequence linked to the
CaMV35S, LTP, RbcS or PDS promoters (p35S:LexA-Gal4, pLTP:LexA-Gal4,
pRbcS:LexA-Gal4, pPDS:LexA-Gal4) and the CaMV35S regulated GFP and the
CaMV35S regulated kanamycin (NPTII) as a selectable marker (41). The LexA:GLK1 and
LexA:GLK2 parental lines were each crossed with each of the four promoter containing
parental lines, p35S:LexA-Gal4, pLTP:LexA-Gal4, pRbcS:LexA-Gal4, pPDS:LexA-Gal4
and progeny contained a promoter, the LexA-Gal4, an AtGLK, a CaMV35::GFP and both
selectable markers. Therefore, AtGLK1 and AtGLK2 were each expressed with four
different promoters in four lines. In the progeny, the two transgenic constructs in each
line were selected by their resistance to kanamycin and sulfonamide. The identity of the
transgenic constructs in each line was confirmed by PCR amplification of genomic DNA
using primers for the selectable markers and primers for each promoter with a LexA
reverse primer and gene specific primers for each transcription factor and the selectable
marker genes (Table S7). The transgenic lines were screened for plant and fruit
phenotypes by comparisons to ‘T63’ lines expressing only the CaMV35S promoter
construct (TControl) with no AtGLK sequences and non-transformed ‘T63’. The
genotype of the ‘T63’ cultivar is u/u and no plant or fruit phenotype differences were
4
observed between the TControl and the nontransformed ‘T63’ plants. The initial
observations of the green fruit phenotype were made in the heterozygous progeny of the
cross; the phenotypes were consistent in the homozygous progeny through five
generations in greenhouse and field trials in Davis, CA (2004-2012). The full-length
sequence of SlGLK2 (Genbank accession numbers JX163897/JQ316459, Table S8)
cDNA was cloned downstream of the CaMV35S promoter into a pBI121 derived vector
pBTEX (42) digested with SmaI/SalI. The fidelity of the construct was confirmed by
DNA sequencing and transgenic ‘Ailsa Craig’ (U/U) and ‘M82’ (u/u) tomato plants were
generated by Agrobacterium tumefaciens (strain LBA4404) mediated transformation
using previously described methods (43). Ten transgenic plants were selected by
kanamycin resistance, crossed with themselves and homozygous progeny identified. Five
transformed U/U lines and more than 5 transformed u/u lines showed the overexpression
fruit phenotype. Four other transformed U/U lines showed the co-suppression phenotype.
Tomato fruit were tagged 3-4 days post anthesis (dpa) when they were 0.5 cm
diameter. Mature green and red ripe fruit were harvested 32 and 46 dpa, respectively,
using the tags for reference. Immature green fruit was collected at 10-25 dpa. To examine
the effects of light, 3 dpa fruit attached to the plants were enclosed in a three layer (red,
black and white) paper bag (kindly provided by Yasutaka Kubo, Okayama University,
Okayama, Japan, through Fujii-Seitai Co., Okayama, Japan) that was crimped closed with
a twist-tie. The fruit remained enclosed in the light-blocking bags (>99% of the incident
light was blocked) on the plants until they were harvested for analysis. Fruit which
developed in the absence of light were harvested and compared to fruit of the same age
that developed in typical greenhouse or field light conditions.
5
Genomic DNA was prepared from leaf tissue from for PCR amplification using
Phire Plant Direct PCR Kit (Finnzymes, Thermo Fisher Scientific, Inc.) reagents. To
amplify the GLK and promoter sequences for genotyping, the primers shown in Table S7
were used.
Sequence alignments were generated using Geneious Pro v 5.3 (44).
Mapping SlGLK2 on tomato chromosome 10. The S. lycopersicum cv. ‘M82’ x S.
pennellii acc. ‘LA0716’ introgression line (IL) population (45) and an F2 population of
1100 individuals derived from a backcross of S. pennellii IL 10-1 (U/U) to its recurrent
parent ‘M82’ (u/u) were used for low and higher resolution mapping, respectively. Initial
analysis positioned U between markers TG303 (SL2.40ch10:1773625) and CT234
(SL2.40ch10:2641027); additional CAPS markers more precisely mapped U to between
markers B (SL2.40ch10:2275056) and C (Sl2.40ch10:2358687) (Figure 2A). A BC2S1
population of 40 individuals and a recombinant inbred line (RIL) population of 110
individuals from S. lycopersicum cv. ‘Moneymaker’ x S. pimpinellifolium acc. ‘TO-937’
were also phenotyped for fruit with dark shoulders (Figure 2A) and they were genotyped
with markers saturating the end of chromosome 10. Linkage analysis revealed that U was
located between solcap_snp_sl_29163 (SL2.40ch10:2113226) and solcap_snp_sl_17859
(SL2.40ch10:2335463) markers. Linkage analysis using the overlapping minimal regions
flanking the U locus from the three populations narrowed U to the region of chromosome
10 between markers B (SL2.40ch10:2275056) and solcap_snp_sl_17859
(SL2.40ch10:2335463) (Figure 2A). In this 60,507 bp segment, eight gene models,
including SlGLK2, are predicted (Table S1).
6
Identification of GLK-like sequences in pepper and potato. The pepper (C.
annuum) transcriptome was assembled using mRNA prepared from vegetative and fruit
tissues of three pepper varieties, ‘CM334,’ ‘Maor’ and ‘Early Jalapeño’. The assemblies
from the three varieties were combined using CAP3 to generate a common assembly for
pepper. The total pepper assembly and the individual variety assemblies were used to
perform basic local alignments (BLAST) searches with the Arabidopsis and tomato GLK
sequences to identify CaGLK1 (JF807944) and CaGLK2 (JF807945). To identify potato
GLK sequences, homology of the Arabidopsis, tomato and pepper sequences to the
diploid potato, S. phurjea, genome and transcript sequences
(http://potatogenomics.plantbiology.msu.edu/index.html) identified CaGLK1 (JF807946) and CaGLK2
(JF807948).
RNA extraction. Total RNA was prepared using Qiagen RNeasy Plant kits (Qiagen)
from cotyledons, sepals, petals, young leaves and fully developed leaves and using
standard protocols (46) from immature green fruit (12-15 dpa), mature green fruit (32
dpa) and ripe fruit (46 dpa). At least three biologically replicated samples of RNA were
prepared from each genotype, tissue and ripening stage from more than four plants.
Extraction of RNA from fruit was done using a modified version of a CTAB based RNA
extraction protocol (47). Outer pericarp and epidermis were excised with a sterile scalpel
and frozen and ground with liquid nitrogen to a fine powder. Two grams of this tissue
were transferred in a 50 mL tube to which 10 mL of the RNA extraction buffer (CTAB
2% v/v, PVP 2% v/v, 100mM Tris pH 8, 2M NaCl, 25mM EDTA, 0.5 g/L spermidine
10mM β-mercaptoethanol, DEPC water) was added. The sample was incubated 5 min at
65 °C and extracted twice with 1 volume of chloroform-isoamyl alchohol 24:1 (CIA)
7
mixed by vortexing. The tubes were centrifuged at 3,500 rpm for 45 min at 4 °C. The
supernatant was placed in a new 15 mL tube. 1/10 volume of 1M KOAc was and the
samples were vortexed and centrifuged at 3,500 rpm for 30 min. The supernatant was
recovered, 25% volume of 10 M LiCl was added followed by mixing gently by inversion.
The tubes were kept overnight at -20 °C. The samples were centrifuged at 4,000 rpm for
45 min, the supernatant was discarded and an RNA clean up protocol was done with the
RNA Plant Mini Kit (Qiagen). The RNA pellet was resuspended in 35 µL of nuclease-
free H2O. The RNA concentration and purity were measured using NanoDrop 2000c
Spectrophotometer (Thermo Scientific, Inc.). The RNA integrity was checked by agarose
gel electrophoresis.
RNA gel-blot analysis. Total RNA was extracted from frozen tissues and gel blot
analyses were done as described (48) using 25 µg total RNA per lane. An SlGLK2-
specific probe was generated by PCR using primers GLK2E1F and GLK2E2R (Table
S7) to amplify a 402 bp fragment from a pGEM-T Easy vector that contained the SlGLK2
full length cDNA.
Semi-quantitative and quantitative real time reverse transcription-PCR (RT-PCR).
cDNA was synthesized using M-MLV Reverse Transcriptase (Promega) from total RNA
extracted as described above using 1 µL of 100 mM Oligo dT (Applied BioSystems), 3
µg of RNA and nuclease-free H2O up to 12 µL. This mixture was heated at 70°C for 10
min and cooled on ice. To this, 5 µL of 5X first strand buffer, 1 µL of 10 mM dNTP´s
and 1 µL of RNA inhibitor (all from Applied BioSystems); to reverse transcribe the RNA
to cDNA, 1 µL of 200 u/ µL M-MLV Reverse transcriptase (Promega) was added. The
tube was heated 2 min at 42 °C, 50 min at 37 °C and kept at 4 °C until use. Semi-
8
quantitative RT-PCR was done simultaneously with the cDNA product and gene specific
and actin control primers (see Table S7). Three separate biologically replicated samples
were amplified and analyzed by agarose gel electrophoresis and ethidium bromide
staining; gel images are an example of the results.
Quantitative RT-PCR (qRT-PCR) was done to quantitate the amount of AtGLK and
SlGLK expression in 4-5 biological replicated preparations of RNA of each genotype or
tissue from green (10-25 dpa) fruit. qRT-PCR was performed on the StepOnePlus
(Applied Biosystems) using SYBR GREEN. The reaction volume contained 2 µL of
template, 0.3 µL of forward primer (10 mM), 0.3 µL of reverse primer (10 mM), 7.5 µL
of Fast SYBER GREEN Master Mix (Applied Biosystems) and 4.9 µL of sterile
molecular biology-grade water (total 15 µL). All qRT-PCR reactions were performed
with the following cycling conditions: 95°C for 10 min, followed by 40 cycles of 95 °C
for 3 s and 60 °C for 30 s. A melting curve for every target analyzed was included using
the following conditions: 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. Tomato
actin primers (LeACT, The Institute for Genomic Research no. TC116117) were used as
an internal control and processed in parallel with reactions with gene specific primers
(Table S7).
The 2-ΔΔCT method (49) was used to determine the relative mRNA abundance and
compared to tomato actin and the sample with the least expression. Comparisons of gene
expression between different genes were justified because all primers had similar
efficiencies and were > 93%. All templates and primer concentrations were optimized for
the reactions initially using conventional RT-PCR.
9
Microarray analysis. RNA was extracted as three biological replicates of immature
green (15 dpa) pericarp tissue taken from three or more fruit as described above. Samples
of total RNA were checked for integrity and quality using an Agilent Bioanalyser
(Agilent Technologies). The three biologically replicated RNA samples were labeled and
hybridized to the 34,000 gene EUTOM3 exon array (http://www.eu-
sol.net/science/bioinformatics/data-and-databases/all-databases) according the
manufacturer's instructions (Affymetrix) at Unitat Central d’Investigació (Universitat de
Valencia, Spain). Briefly, 300 ng of total RNA from each sample were labeled using the
Ambion WT expression array kit (Ambion Inc.). The end labeling and hybridization were
performed according to the GeneChip whole transcript (WT) sense target labeling assay
manual (Ambion Inc.). Hybridization was performed using an Affymetrix Hybridization
Oven 640 (Affymetrix) for 17 hr. at 45oC. Following hybridization, the chips were
washed and stained with a phycoerythrin-strepavidin conjugate using the GeneChip®
Fluidics Station (Affymetrix) with the FS450-0001 protocol. The chips were scanned
using the Affymetrix® GeneChip® Scanner 30007G and the Affymetrix® GeneChip®
Command Console software (Affymetrix) was used to generate non-scaled RNA signal
intensity files (.cel). Raw data are MIAME compliant and are deposited at the
Arrayexpress site (http://www.ebi.ac.uk/arrayexpress/ with experiment accession number
E-MEXP-3652)
Data was pre-processed and analyzed using Partek Genomic Suite software v6.6 (Partek
Inc.) with the probes matching only once with the iTAG annotation v2.3. The
configuration consisted of a pre-background adjustment for GC content, Robust Multi-
array Analysis (50) for background correction, quantile normalization and probe set
10
summarization using median polishing. All signals were log2 transformed. Library files
were eutom3gene_v2_ucprobes.cdf and the annotation file version was eutom3-
annotation-per-scaffold-modif.txt which represents 30,000 genes of tomato genome.
To identify statistically significant differentially expressed genes between WT (Tcontrol)
and AtGLK expressing lines, probe set information is summarized into information for
the genes. A 3-way ANOVA mixed model (51) was used to analyze the effects of type
(transgenic or WT), sample genotype (WT, AtGLK1- and AtGLK2-expressor) and
replicate and the interaction between type and sample genotype. The ANOVA model
was:
Yijkl = μ + typei+replicatej+sample genotype(type)ik+ εijkl
Where Yijkl represents the lth observation on the ith type jth replicate kth sample genotype
μ is the common effect for the whole experiment. εijkl represents the random error present
in the lth observation on the ith type jth replicate kth sample genotype .The errors εijkl are
assumed to be normally and independently distributed with mean 0 and standard
deviation δ for all measurements.
To determine specific group differences in case of significant main effects (or
interaction), the ANOVA analysis was followed by Fisher’s LSD post hoc contrast to
generate p-values and fold changes for comparisons between type and sample type. Gene
lists of pair-wise contrasts were divided into up- and down-regulated genes (compared
with wildtype (WT) TControl). Genes whose expression changed as a consequence of
AtGLK expression were defined independently for each AtGLK expressing line using a
11
mean fold change ≥2 (relative to WT TControl samples) and a P value of ≤0.05. A total
of 3216 genes (≈ 10% of the EUTOM3 probes on the microarrays) were significantly up
or down regulated in AtGLK1 and/or AtGLK2 overexpressing tomato lines (Table S4).
Venn diagrams (Figure S6A) were used to identify sets of common and specifically
regulated genes. Genes differentially expressed (either up or down-regulated) in both
transgenic lines were defined as regulated by GLKs and genes up or down regulated only
in the material expressing either AtGLK1 or AtGLK2 were defined as specifically
regulated by GLK1 or GLK2, respectively. These classes of genes were used for
subsequent analyses. Two dimensional hierarchical agglomerative clustering using
Euclidean distance and average linkage were performed. The differentially expressed
genes identified genes were grouped into clusters to calculate Gene Ontology (GO)
enrichment scores for molecular function categories by applying Fisher Exact tests using
a local, customized version of the 'catscore.pl' Perl script (52) was used. Only GO terms
with a p<0.05, and three or more regulated genes for the GO-term were defined as over-
represented. Complete functional enrichment results are provided in Tables S5 and S6.
The EUTOM3 microarrays were designed and annotated by Stephane Romabauts (VIB
Department of Plant Systems Biology, Ghent University Technologiepark 927, 9052
Ghent, Belgium). The MIAME–compliant microarray data are available at
http://ted.bti.cornell.edu and at http://www.ebi.ac.uk/arrayexpress/ with the accession
number E-MEXP-3652.
Chlorophyll. Chlorophyll was measured in the youngest fully expanded apical leaves
in a truss and in immature green (15 dpa) fruit. Tissues from the outer fruit pericarp and
epidermis (~50 mg each) and leaf (~7 mg) from well irrigated plants were extracted into
12
1 ml N,N dimethylformamide (DMF) overnight at 4 oC. The amounts of chlorophyll a
and chlorophyll b, were determined spectrophotometrically using published equations
(53). Total chlorophyll was calculated as chlorophyll a + chlorophyll b. Results were
expressed as µg chlorophyll per mg of tissue and the results agreed with chlorophyll
determinations made with material extracted in 80% acetone. A minimum of five
biologically replicated samples was used for each genotype and tissue.
Starch measurements. For starch quantitation, two grams of outer fruit pericarp
were ground in 10 mL ethanol. The samples were centrifuged and the pellet was re-
extracted two more times with 10 mL ethanol. After centrifugation, the pellet was dried at
50 oC and resuspended in 5 mL of 50 mM NaAc buffer (pH 5.0). 100 µL containing 10
units of amylase and 3 units of amylo-glucosidase were added and samples were
incubated at 30 oC with stirring overnight. The samples were centrifuged and adjusted to
6 mL with water. The content of reducing sugars was determined using a modification of
the Somogyi-Nelson method and measured with a spectrophotometer at 520 nm (54).
Transmission electron microscopy. Pericarp fragments were excised from fruit at
the mature green stage and from fully expanded leaves. Fragments were fixed in
Karnovsky’s fixative using vacuum-microwave combination as described by Russin and
Trivett (55) and washed in 0.1 M sodium phosphate buffer, pH 7.2, microwaved under
vacuum at 450 W for 40 seconds, post-fixed for 2 hours in 1 % (w/v) osmium tetroxide
buffered in 0.1 M sodium phosphate buffer and microwaved a second time at 450 W for
40 seconds. After incubation in 0.1% (w/v) tannic acid in water for 30 minutes on ice and
in 2 % (w/v) aqueous uranyl acetate for 1 hour, samples were dehydrated in acetone and
embedded in Epon/Araldite resin. Ultrathin sections were examined with a Philips
13
CM120 Biotwin Lens transmission electron microscope (FEI Company). Images in
Figure 4A were taken at 11,000 magnification and 0.5 µm scale bars are shown.
Measurement of soluble solids. Soluble solid contents (oBRIX) were of total fruit
juice from freshly harvested red ripe fruit were measured with a digital refractometer
(PR100, Atago Co., Ltd.).
Sugar analysis. For simple sugar analysis, 5 to 7 g of total mature green and red fruit
tissue was extracted with 20 mL 95% (v/v) ethanol. The samples were centrifuged and
the pellets re-extracted with 10 mL 95% (v/v) ethanol. The supernatants were pooled and
adjusted with 95% (v/v) ethanol to a final volume of 45 mL. From these pooled
supernatants, 200 µL samples were dried and resuspended in 1 mL water. Forty
microliters of the resuspended sample were diluted to 10 mL with water and 200 µL were
injected in the HPLC for sugar analysis. Sugar profiles were analyzed using a DX-500
HPLC system (Dionex Corp.) equipped with an analytical Carbopac PA1 column and an
ED-40 electrochemical detector for pulsed amperimetric detection (PAD). A linear
sodium carbonate gradient at a flow rate of 0.6 mL min-1 was used. Glucose and fructose
were identified and quantified by using authentic standards. Results were expressed in
grams of sugar per 100 g of fresh fruit.
Carotenoid analysis. Carotenoid compounds were extracted and measured by
HPLC from three independent biological samples of red ripe (42 dpa) fruit epidermis and
pericarp as described previously (56). For spectrophotometric measurements, 0.25 g of
pericarp and epidermis from red ripe fruit (42 dpa) were ground in liquid N2, and
extracted with 8 ml hexane:ethanol:acetone (2:1:1) with shaking at room temperature
overnight. 1 ml water was added to each sample which was mixed by vortexing and the
14
solvent layers separated. The absorbance of the organic phase at 503 nm was used to
calculate the amount of lycopene (57, 58).
Statistical analysis. Experiments were performed according to a factorial design.
Data were analyzed by ANOVA, if the number of experimental replicates was equal, or
by General Linear Model (GLM) if the number of replicates was unequal followed by
post hoc testing using Tukey’s Honestly Significant Difference (HSD) or Bonferonni
Multiple Comparison Test (MCT) with JMP 9.0 (SAS, Cary, NC). Genetic linkage
analysis was performed by using JoinMap 4.0 software (Van Ooijen, J. W., Kyazma
B.V., Wageningen, the Netherlands, 2006).
15
Fig. S1.
Figure S1. Total soluble solids as measured by oBRIX of juice from red ripe (42 days post anthesis, dpa) fruit that had dark green shoulders (‘Ailsa Craig’ U/U) or were uniformly light green (‘Craigella’ u/u) prior to ripening. n=100 fruit of each genotype. Significant statistical differences determined by means of ANOVA and Tukey’s HSD at p<0.05 are indicated by different letters.
16
Fig. S2 A
17
B
18
C
19
D BLOSUM50 BLOSUM62 PAM250
Name Length Name Length Identity Similarity Identity Similarity Identity Similarity
AtGPRI1/GLK1 420.0 AtGLK2 386.0 46.5 60.0 46.1 58.6 44.5 66.4
CaGLK1 447.0 AtGLK2 386.0 47.3 59.3 46.4 57.9 44.9 64.9
CaGLK1 447.0 AtGPRI1/GLK1 420.0 49.8 65.1 49.1 63.1 47.5 71.6
CaGLK1 447.0 CaGLK2 313.0 47.1 55.7 45.7 55.0 44.5 57.9
CaGLK1 447.0 SpGLK2 317.0 46.2 58.2 46.0 56.8 46.3 60.4
CaGLK1 447.0 SpGLK1 415.0 80.5 85.7 80.5 85.2 80.3 87.5
CaGLK1 447.0 SlGLK1 464.0 84.3 89.2 84.3 88.4 84.1 90.9
CaGLK1 447.0 SlGLK2 310.0 45.1 55.7 44.6 54.1 44.1 58.4
CaGLK2 313.0 AtGLK2 386.0 43.1 57.3 41.9 54.4 40.4 60.9
CaGLK2 313.0 AtGPRI1/GLK1 420.0 41.3 56.4 41.1 53.3 38.6 59.0
CaGLK2 313.0 SpGLK2 317.0 75.1 86.1 75.1 84.9 74.5 89.9
CaGLK2 313.0 SpGLK1 415.0 48.2 57.6 48.2 57.1 45.8 60.2
CaGLK2 313.0 SlGLK1 464.0 46.4 55.8 45.1 54.3 43.6 56.9
SpGLK2 317.0 AtGLK2 386.0 43.1 57.8 42.3 54.7 40.3 61.9
SpGLK2 317.0 AtGPRI1/GLK1 420.0 41.9 55.7 41.2 53.3 38.1 57.6
SpGLK2 317.0 SpGLK1 415.0 45.3 58.3 44.7 56.6 44.0 60.5
SpGLK1 415.0 AtGLK2 386.0 46.1 60.5 45.7 58.6 43.9 66.0
SpGLK1 415.0 AtGPRI1/GLK1 420.0 51.1 68.1 50.9 65.5 47.1 70.7
SlGLK1 464.0 AtGLK2 386.0 45.8 57.5 44.5 54.1 42.9 62.3
SlGLK1 464.0 AtGPRI1/GLK1 420.0 49.7 64.7 48.3 60.1 46.6 69.2
SlGLK1 464.0 SpGLK2 317.0 44.1 55.8 44.1 53.9 43.4 57.8
SlGLK1 464.0 SpGLK1 415.0 85.6 87.5 85.6 87.3 85.6 87.9
SlGLK2 310.0 AtGLK2 386.0 42.2 56.5 40.9 52.8 40.7 60.1
SlGLK2 310.0 AtGPRI1/GLK1 420.0 40.1 53.6 39.4 51.4 38.9 56.7
SlGLK2 310.0 CaGLK2 313.0 74.7 85.0 74.7 83.7 74.7 90.1
SlGLK2 310.0 SpGLK2 317.0 87.1 92.1 87.1 91.8 87.1 95.6
SlGLK2 310.0 SpGLK1 415.0 44.7 54.9 44.3 54.0 42.9 58.3
SlGLK2 310.0 SlGLK1 464.0 43.4 53.2 43.4 51.3 41.9 55.2 Figure S2. Amino acid alignments showing the sequences of the predicted GLK1 and GLK2 proteins from Arabidopsis (AtGLK1, AtGLK2), domesticated tomato (S. lycopersicum, (A) cv. Ailsa Craig (B) cv.’Craigella’) (SlGLK1, SlGLK2), diploid potato (S. phureja) (SpGLK1, SpGLK2) and pepper (Capsicum annuum) (CaGLK1, CaGLK2) cDNA sequences. To identify potato GLK genes, homology searches of the potato transcriptome assembly and genomes using Arabidopsis GLK1 and GLK2 were used to identify two GLK-like genes in potato (SpGLK1 and SpGLK2). The exon structures are based on comparisons with Arabidopsis, tomato and potato genomic sequences. Sequence alignment was generated by using Geneious Pro v 5.3. (C) A phylogenetic tree
20
of GLKs generated using a Bayesian inference of phylogeny. In addition to the Arabidopsis, tomato, potato and pepper GLKs, BLAST searches against protein and EST databases at NCBI and EMBL were used to identify multiple GLK sequences from Monocot, Rosid Dicot and Asterid Dicot groups. Predicted amino acid sequences were aligned with T-Coffee using the PSI-Coffee method followed by an additional alignment evaluation using Core (http://tcoffee.crg.cat/). Sequences were trimmed to remove regions that showed inconsistent alignment (0-5 reliability score out of 10). Trimmed sequences were used to construct the tree using MrBayes 3.2.1 (http://mrbayes.sourceforge.net/index.php) with mixed amino acid and co-varion models run for 300,000 iterations at 2 runs by 1 chain per run. The branch lengths indicate the evolutionary distances, and numbers indicate percent probabilities for each node. Abbreviations and accession numbers used are found in Table S8. (D) Pairwise sequence identity and similarity between tomato, potato, pepper and Arabidopsis GLKs was calculated using MatGAT 2.02 (http://bitincka.com/ledion/matgat/) run with BLOSUM50, BLOSUM62 and PAM250 alignment matrices.
21
Fig. S3
Figure S3. Maturing fruit from Tcontrol (A) and transgenic plants expressing p35S::AtGLK1 (B,) or p35S::AtGLK2 (C). From left to right fruit are green (4, 6, 12, 18, 25, 32 dpa) turning (35 dpa) and fully red ripe (42 dpa).
22
Fig. S4 A
B
Figure S4. Chlorophyll contents of green fruit as a function of exposure to light during maturation. A. Phenotypes of ‘Ailsa Craig’ U/U and ‘Craigella’ u/u mature green (32 dpa) fruit after maturation in the absence (Dark) and presence (Light) of light. B. Chlorophyll contents of pericarp from the pedicel (shoulders) or style (stylar) region of mature green fruit. Significant statistical differences determined by means of GLM and Tukey’s HSD at p<0.05 are indicated by different letters.
23
Fig. S5
Figure S5. Expression and phenotypes of fruit expressing p35S::SlGLK2. A. SlGLK2 expression as determined by hybridization of SlGLK2 specific probes to gel blots of RNA from ‘Ailsa Craig’ U/U or ‘M82’ u/u transformed with p35S::SlGLK2. B. Fruit phenotypes from representative plants of lines overexpressing (OE) or with co-suppressed expression (CS) of SlGLK2. Five transformed U/U lines and more than 5 transformed u/u lines showed the overexpression fruit phenotype. Four other transformed U/U lines showed the co-suppression phenotype.
24
Fig. S6
Figure S6. Summary of transcript abundance analysis by hybridization to EUTOM3 microarrays. A. Comparison of 3216 genes differentially expressed in AtGLK expressing lines relative to Tcontrol lines. B. Cellular components Gene Ontology (GO) terms of significantly (p<0.05, fold change >2) down-regulated genes in IM green fruit identified in EUTOM3 microarray hybridizations. The total number of genes with known GO terms is shown below bars. C. Hierarchical average linkage clustering of 3216 genes differentially expressed in AtGLK expressing lines relative to Tcontrol. Red and blue correspond to up- and down-regulation, respectively. D. 672 genes differentially expressed in both AtGLK1 and AtGLK2 expressing lines. E. Genes differentially expressed only in the AtGLK1 expressing lines. F. Genes differentially expressed only in the AtGLK2 expressing lines.
25
Fig. S7
Figure S7. Exposure of fruit to light determines soluble solids in ripe fruit. A. Ripe fruit (42 dpa) fruit phenotype of u/u ‘T63’ fruit that developed in normal light (Light) and in light blocking bags (Dark). B. Total soluble solids of juice from red ripe (42 dpa) fruit. Significant statistical differences determined by means of GLM and Tukey’s HSD at p<0.05 are indicated by different letters.
26
Fig. S8
A
B Phytoene Phytofluene Lutein γ-Carotene β-Carotene cis-Lycopene trans-Lycopene Total Carotenoids
Average ± SE Average ± SE Average ± SE Average ± SE Average ± SE Average ± SE Average ± SE Average ± SE
Tcontrol 4.23 ± 0.10 a 2.83 ± 0.44 a 0.95 ± 0.20 a 2.44 ± 0.09 a 4.35 ± 0.33 a 2.25± 0.21 a 121.58 ± 0.39 a 138.18 ± 0.81 a
p35S::AtGLK1 6.45 ± 0.87 a 4.41 ± 0.40 b 1.56 ± 0.14 a 3.42 ± 0.10 a 6.47 ± 0.51 a 3.58 ± 0.42 a 252.29 ± 17.28 b 278.51 ± 17.68 b
p35S::AtGLK2 4.61 ± 0.35 a 2.68 ± 0.20 a 1.80 ± 0.19 a 3.18 ± 0.14 a 6.72 ± 0.35 a 4.04 ± 0.73 a 166.28 ± 14.51 a 189.43 ± 16.18 a Figure S8. Carotenoid compounds in ripe fruit. A. Lycopene content of red fruit pericarp and epidermis measured as the absorbance at 503 nm of ethanol/hexane/acetone extracts of pulverized pericarp tissue. B. Carotenoid compound contents of red fruit measured by HPLC. Statistical significance determined by means of GLM and Bonferonni MCT at p<0.05 are indicated by different letters.
27
Table S1. Table S1. Eight predicted genes in the 60,507 bp region of S. lycopersicum chromosome 10 (ITAG2.4 Release: genomic annotations, http://solgenomics.net) between SL2.40ch10:2275056 and SL2.40ch10:2335463. SlGLK2 (yellow highlight) is within this region, specifically between Sl2.40chr10:2291209 and Sl240chr10:2295578. Start Stop Gene ID Identifier 2276303 2278610 Solyc10g008140 Unidentified, length=2308
2281545 2281874 Solyc10g008150 Glutaredoxin (AHRD V1 ***- B9MYC1_POPTR); B contains Interpro domain(s) IPR011905 Glutaredoxin-like%2C plant II
2293088 2295945 Solyc10g008160 Transcription factor (Fragment) Slglk2/u (AHRD V1 *--- D6MK15_9ASPA)
2300710 2304760 Solyc10g008170 26S proteasome regulatory subunit (AHRD V1 ***- C6HL17_AJECH)
2305283 2311789 Solyc10g008180
26S proteasome regulatory subunit (AHRD V1 ***- A8J3A4_CHLRE); B contains Interpro domain(s) IPR016643 26S proteasome regulatory complex%2C non-ATPase subcomplex%2C Rpn1 subunit
2311949 2314392 Solyc10g008190
OB-fold nucleic acid binding domain containing protein (AHRD V1 ***- B6SHT0_MAIZE); B contains Interpro domain(s) IPR012340 Nucleic acid-binding%2C OB-fold
2315211 2319689 Solyc10g008200
Tyrosine aminotransferase (AHRD V1 **** D3K4J1_PAPSO); B contains Interpro domain(s) IPR005958 Tyrosine%2Fnicotianamine aminotransferase
2325581 2332352 Solyc10g008210 Os07g0507200 protein (Fragment) homolog (AHRD V1 *-*- C7J530_ORYSJ); B contains Interpro domain(s) IPR009675 Targeting for Xklp2
28
Table S2. Table S2. Relative expression of SlGLK1 and SlGLK2 as determined by qRT-PCR of cDNA prepared from young fully expanded leaves and from the pedicellar shoulder (Pedicel) and stylar (Style) portions of ‘Ailsa Craig’ U/U or ‘Craigella’ u/u green fruit (25 dpa) that developed in normal light conditions. qRT-PCR reactions were done on 4 - 5 biological replicated samples. Values were normalized to the expression of actin and expression of SlGLK1 and SlGLK2 is relative to the expression of SlGLK1 in the pedicellar portion of u/u. Standard errors are indicated.
Relative Expression SlGLK1 SlGLK2 Leaves Pedicel Style Leaves Pedicel Style U/U 353.4 ± 22.7 1.0 ± 0.8 -1.8 ± 1.5 394.1 ± 72.6 329.7 ± 112.5 41.1 ± 8.1 u/u 222.0 ± 37.1 -1.4 ± 0.4 -1.9 ± 0.2 10.6 ± 22.5 86.3 ± 44.9 16.3 ± 4.0
29
Table S3 Table S3. Relative expression of SlGLK1 and SlGLK2 as determined by qRT-PCR of cDNA prepared from the pedicellar shoulder (Pedicel) or the blossom stylar (style) portions of green ‘Ailsa Craig’ U/U or ‘Craigella’ u/u fruit (25 dpa) that developed in normal light conditions (Light) or in light blocking bags (Dark). qRT-PCR reactions were done on 4-5 biologically replicated samples. Values were normalized to the expression of actin and expression of SlGLK1 and SlGLK2 is relative to the expression of SlGLK1 in the pedicellar portion of u/u fruit that developed in the light. Standard errors are indicated.
Relative Expression SlGLK1 SlGLK2 Pedicel Style Pedicel Style U/U (Light) 1.0 ± 0.8 -1.8 ± 1.5 329.7 ± 112.5 41.1 ± 8.1 U/U (Dark) 1.0 ± 0.7 -1.9 ± 1.3 127.1 ± 54.3 10.4 ± 21.0 u/u (Light) -1.4 ± 0.4 -1.85 ± 0.2 86.3 ± 44.9 16.3 ± 4.0 u/u (Dark) -6.8 ± 1.1 -4.0 ± 1.1 6.3 ± 21.7 13.5 ± 0.6
30
Table S4 – attached separately Table S4 (ST.4). Genes (3215 genes) identified as differentially expressed in p35S::AtGLK expressing lines versus wild-type (WT, TControl). Functional annotations are based on ITAG2.3 and ANOVA 3 way-LSD statistics. The sample types are WT (Tcontrol), GLK1 (expressing p35S::AtGLK1) and GLK2 (expressing p35S::AtGLK2). The annotations in this file are: Gene identity (ID) corresponding to the mRNA ID (Tomato whole genome sequence (WGS) cDNA ITAG 2.3) and Cluster based on Venn diagrams. Gene Functional Annotations:GO terms, Tomato WGS cDNA ITAG 2.3 hit name (exons); ITAG description; nearest 3-prime marker; nearest 5-prime marker; pseudo-molecule and position; tomato cDNA TAIR10 best hit; Arabidopsis gene symbol; Arabidopsis gene description; Arabidopsis component GO term and general cellular component. Matches with previous work with GLKs, photomorphogenesis regulators: Genes reported in Waters et al. (32), Savitch et al. (33), Rohrmann et al. (34) and Enfissi et al. (35), Kolotilin et al. (2007). Statistics: probe id, p-value(type), p-value(replicate), p-value(sample type(type)), p-value(WT * WT vs. transgenic * GLK1), Fold-Change(WT * WT vs. transgenic * GLK1), Fold-Change (WT * WT vs. transgenic * GLK1) (Description), p-value (WT * WT vs. transgenic * GLK2), Fold-Change (WT * WT vs. transgenic * GLK2), Fold-Change (WT * WT vs. transgenic * GLK2) (Description), F (type), SS (type), F (sample type(type)), SS (sample type(type)), F (replicate), SS (replicate), SS (Error), F (Error). Red cells indicate p<0.05.
31
Table S5- attached separately
Table S5 (ST.5). Results of GO term enrichment analysis of AtGLK expressing lines vs WT (Tcontrol). For enrichment all Venn diagram sectors are considered.
32
Table S6- attached separately
Table S6 (ST-6). GO term description for functional categories with p-value <0.1
33
Table S7
Table S7. Primers used for PCR and qRT-PCR.
34
Sequences Forward Primer Reverse Primer
SULII CGGACAGTTTCTCCGATGGA GGATAGAACGCAGCGTCTGG
NPTII GGCCGCTTGGGTGGAGAG GGTAGCCGGATCAAGCGTATG
At5g44190 (AtGLK2) AGCGGAAGAGATGAGGAACA CTAAGGCAGGAGCTGTCCAC
At5g44190 (AtGLK2) ATGTTAACTGTTTCTCCGGCTCCAG TCAAGGAAGAGGAGGAACATTAGAAACTCC
At2g20570 (AtGLK1) AGGTGGATTGGACACCAGAG CTGGCGGTGCTCTAAATCTC
AtGLK1 – qRT-PCR Efficiency 97.29%
ATTTAGAGCACCGCCAGTTG ACGCTCTCTTTTGACGGATG
AtGLK2 – qRT-PCR Efficiency 93.73%
AGCAACCACTCTATCCACAG TAACGTCCCCAATAGCTG
LexA activator GCCTTCAGATGTTCTTCAGC
35s promoter GAACTCGCCGTAAAGACTGG
LTP promoter ATGCAAAGAAGGACGTAGGC TGTGGTGTGAATGCGATAGA
PDS promoter TAACTGCCAAACCACCACAA
Rbc3b promoter TCCAATGGTTATGGTTGCTCT
SlGLK1 (Solyc07g053630) ATGGAAAGTTTCGCGATAGGAGGA CTATGCACAAGTTGGTGGTATTTTA
SlGLK2 (Solyc10g008160) ATTTTCTCTCTTTTGATGTCACC CYTTGATAATGTGGATGCCAAAA
SlGLK1 – qRT-PCR (3), Efficiency 95.53%
CCGTAAGCAGTGGTGATGAGTCTG AACCCGAACCTACATCCGAAGC
SlGLK2 – qRT-PCR Efficiency 94.18%
CCTTACATGTTTGGGGGCATCCAC GGGGTGCAAATCAGAGGC
SlGLK2(GLK2E1F/GLK2E2R) ATGCTTGCTCTATCTTCATCATTGA TTGAAGATGACTAGCAATGTTATGTCT
SlActin – qRT-PCR CCTCAGCACATTCCAGCAG CCACCAAACTTCTCCATCCC
35
Table S8 Table S8. GenBank accession numbers.
Protein Name Full name GenBank Accession number
AaGLK Artemisia annua UniGene Aan.2135
AtGLK2 Arabidopsis thaliana GOLDEN2-like 2 protein NP_199232.1
AtGLK1 Arabidopsis thaliana GPRI1/GLK1 NP_565476.1
BdGLKA Brachypodium distachyon probable transcription factor GLK1-like XP_003563963.1
BdGLKB Brachypodium distachyon probable transcription factor GLK2-like XP_003565554.1
BnGLKB Brassica napus cDNA 5', mRNA sequence GR447064.1 & EE428427.1 *
BrGLKB Brassica rapa subsp. pekinensis FY423077.1 & EX098749.1 *
CaGLK1 Capsicum annuum golden 2-like 1 transcription factor GLK1 JF807944
CaGLK2 Capsicum annuum golden 2-like 2 transcription factor GLK2 JF807945
GmGLKA Glycine max PREDICTED: transcription activator GLK1-like XP_003543323.1
GmGLKB Glycine max PREDICTED: transcription activator GLK1-like XP_003540379.1
GmGLKC Glycine max uncharacterized protein LOC100799248 NP_001241943.1
GmGLKD Glycine max PREDICTED: transcription activator GLK1-like XP_003539944.1
HaGLK Helianthus annuus cDNA clone UniGene Han.12384
HvGLKA Hordeum vulgare subsp. vulgare predicted protein BAJ98698.1
HvGLKB Hordeum vulgare subsp. vulgare predicted protein BAJ84790.1
MtGLK Medicago truncatula Two-component response regulator-like APRR2 XP_003607509.1
OsGLK1 OsG2-like, Oryza sativa Japonica Group golden2-like BAD62070.1
OsGLK2 Oryza sativa Japonica Group OsGLK2 BAD81484.1
PtGLK Populus trichocarpa predicted protein XP_002310413.1
RcGLK Ricinus communis DNA binding protein, putative XP_002517855.1
SbGLKA Sorghum bicolor hypothetical protein SORBIDRAFT_10g008400 XP_002436765.1
SbGLKB Sorghum bicolor hypothetical protein SORBIDRAFT_03g000400 XP_002454868.1
SlGLK1 Solanum lycopersicum GLK1 JF807943/JQ316460
SlGLK2 Solanum lycopersicum GLK2 (U) JX163897/JQ316459
Slglk2 Solanum lycopersicum glk2 (u) JF807947
SpGLK1 Solanum phureja GLK1 JF807946
SpGLK2 Solanum phureja GLK2 JF807948
TaGLKA Triticum aestivum golden 2-like protein ABL10089.1
TaGLKB Triticum aestivum MYB-related protein AEV91189.1
ThGLKA Thellungiella halophila mRNA, complete cds AK352526.1 *
ThGLKB Thellungiella halophila unnamed protein product BAJ33719.1
36
VvGLK Vitis vinifera PREDICTED: transcription activator GLK1-like XP_002275230.1
ZmGLK1 Zea mays G2-like1 NP_001105018.1
ZmG2 Zea mays putative transcription factor Golden2 AAK50391.1 * EMBL accessions
References and Notes 1. L. Butler, The linkage map of the tomato. J. Hered. 43, 25 (1952).
2. A. F. Yeager, The uniform fruit color gene in the tomato. Proc. Am. Soc. Hort. Sci. 33, 512 (1935).
3. S. M. Kinzer, S. J. Schwager, M. A. Mutschler, Mapping of ripening-related or -specific cDNA clones of tomato (Lycopersicon esculentum). Theor. Appl. Genet. 79, 489 (1990). doi:10.1007/BF00226158
4. C. M. Rick, High soluble-solids content in large-fruited tomato lines derived from a wild green-fruit species. Hilgardia 42, 493 (1974).
5. S. D. Tanksley, J. Hewitt, Use of molecular markers in breeding for soluble solids content in tomato—A re-examination. Theor. Appl. Genet. 75, 811 (1988). doi:10.1007/BF00265610
6. G. A. Kemp, I. L. Nonnecke, Differences in intensity of unripe fruit colour in the tomato. Can. J. Plant Sci. 40, 306 (1960). doi:10.4141/cjps60-041
7. C. M. Rick, L. Butler, Cytogenetics of the tomato. Adv. Genet. Incorp. Mol. Gen. Med. 8, 267 (1956).
8. M. T. Waters, J. A. Langdale, The making of a chloroplast. EMBO J. 28, 2861 (2009). doi:10.1038/emboj.2009.264 Medline
9. S. Hetherington, R. Smillie, W. Davies, Photosynthetic activities of vegetative and fruiting tissues of tomato. J. Exp. Bot. 49, 1173 (1998).
10. M. M. Blanke, F. Lenz, Fruit photosynthesis. Plant Cell Environ. 12, 31 (1989). doi:10.1111/j.1365-3040.1989.tb01914.x
11. S. Carrara, A. Pardossi, G. F. Soldatini, F. Tognoni, L. Guidi, Photosynthetic activity of ripening tomato fruit. Photosynthetica 39, 75 (2001). doi:10.1023/A:1012495903093
12. A. J. Matas et al., Tissue- and cell-type specific transcriptome profiling of expanding tomato fruit provides insights into metabolic and regulatory specialization and cuticle formation. Plant Cell 23, 3893 (2011). doi:10.1105/tpc.111.091173 Medline
13. T. Manzara, P. Carrasco, W. Gruissem, Developmental and organ-specific changes in DNA-protein interactions in the tomato rbcS1, rbcS2 and rbcS3A promoter regions. Plant Mol. Biol. 21, 69 (1993). doi:10.1007/BF00039619 Medline
14. M. Sugita, W. Gruissem, Developmental, organ-specific, and light-dependent expression of the tomato ribulose-1,5-bisphosphate carboxylase small subunit gene family. Proc. Natl. Acad. Sci. U.S.A. 84, 7104 (1987). doi:10.1073/pnas.84.20.7104 Medline
15. L. A. Wanner, W. Gruissem, Expression dynamics of the tomato rbcS gene family during development. Plant Cell 3, 1289 (1991). Medline
16. B. Piechulla, W. Gruissem, Diurnal mRNA fluctuations of nuclear and plastid genes in developing tomato fruits. EMBO J. 6, 3593 (1987). Medline
17. B. Piechulla, R. E. Glick, H. Bahl, A. Melis, W. Gruissem, Changes in photosynthetic capacity and photosynthetic protein pattern during tomato fruit ripening. Plant Physiol. 84, 911 (1987). doi:10.1104/pp.84.3.911 Medline
18. D. W. Fitter, D. J. Martin, M. J. Copley, R. W. Scotland, J. A. Langdale, GLK gene pairs regulate chloroplast development in diverse plant species. Plant J. 31, 713 (2002). doi:10.1046/j.1365-313X.2002.01390.x Medline
19. J. A. Langdale, C4 cycles: Past, present, and future research on C4 photosynthesis. Plant Cell 23, 3879 (2011). doi:10.1105/tpc.111.092098 Medline
20. M. T. Waters et al., GLK transcription factors coordinate expression of the photosynthetic apparatus in Arabidopsis. Plant Cell 21, 1109 (2009). doi:10.1105/tpc.108.065250 Medline
21. M. T. Waters, E. C. Moylan, J. A. Langdale, GLK transcription factors regulate chloroplast development in a cell-autonomous manner. Plant J. 56, 432 (2008). doi:10.1111/j.1365-313X.2008.03616.x Medline
22. H. Nakamura et al., Ectopic overexpression of the transcription factor OsGLK1 induces chloroplast development in non-green rice cells. Plant Cell Physiol. 50, 1933 (2009). doi:10.1093/pcp/pcp138 Medline
23. A. Bravo-Garcia, Y. Yasumura, J. A. Langdale, Specialization of the Golden2-like regulatory pathway during land plant evolution. New Phytol. 183, 133 (2009). doi:10.1111/j.1469-8137.2009.02829.x Medline
24. Y. Yasumura, E. C. Moylan, J. A. Langdale, A conserved transcription factor mediates nuclear control of organelle biogenesis in anciently diverged land plants. Plant Cell 17, 1894 (2005). doi:10.1105/tpc.105.033191 Medline
25. A. H. Paterson et al., Resolution of quantitative traits into Mendelian factors by using a complete linkage map of restriction fragment length polymorphisms. Nature 335, 721 (1988). doi:10.1038/335721a0 Medline
26. S. D. Tanksley, M. A. Mutschler, C. M. Rick, in Genetic Maps, S. J. O’Brien, Ed. (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1987), pp. 655–669.
27. Y. Eshed, D. Zamir, An introgression line population of Lycopersicon pennellii in the cultivated tomato enables the identification and fine mapping of yield-associated QTL. Genetics 141, 1147 (1995). Medline
28. Materials and methods are available as supplementary materials at Science Online.
29. J. Rohrmann et al., Combined transcription factor profiling, microarray analysis and metabolite profiling reveals the transcriptional control of metabolic shifts occurring during tomato fruit development. Plant J. 68, 999 (2011). doi:10.1111/j.1365-313X.2011.04750.x Medline
30. E. M. A. Enfissi et al., Integrative transcript and metabolite analysis of nutritionally enhanced DE-ETIOLATED1 downregulated tomato fruit. Plant Cell 22, 1190 (2010). doi:10.1105/tpc.110.073866 Medline
31. Y. Liu et al., Manipulation of light signal transduction as a means of modifying fruit nutritional quality in tomato. Proc. Natl. Acad. Sci. U.S.A. 101, 9897 (2004). doi:10.1073/pnas.0400935101 Medline
32. M. T. Waters et al., GLK transcription factors coordinate expression of the photosynthetic apparatus in Arabidopsis. Plant Cell 21, 1109 (2009). doi:10.1105/tpc.108.065250 Medline
33. L. V. Savitch, R. Subramaniam, G. C. Allard, J. Singh, The GLK1 ‘regulon’ encodes disease defense related proteins and confers resistance to Fusarium graminearum in Arabidopsis. Biochem. Biophys. Res. Commun. 359, 234 (2007). doi:10.1016/j.bbrc.2007.05.084 Medline
34. J. Rohrmann et al., Combined transcription factor profiling, microarray analysis and metabolite profiling reveals the transcriptional control of metabolic shifts occurring during tomato fruit development. Plant J. 68, 999 (2011). doi:10.1111/j.1365-313X.2011.04750.x Medline
35. E. M. A. Enfissi et al., Integrative transcript and metabolite analysis of nutritionally enhanced DE-ETIOLATED1 downregulated tomato fruit. Plant Cell 22, 1190 (2010). doi:10.1105/tpc.110.073866 Medline
36. L. Darby, D. B. Ritchie, I. B. Taylor, in The Glasshouse Crops Research Institute Annual Report (Glasshouse Crops Research Institute, Littlehampton, UK, 1977), pp. 168–184.
37. M. B. Trevino, M. A. O’Connell, Three drought-responsive members of the nonspecific lipid-transfer protein gene family in Lycopersicon pennellii show different developmental patterns of expression. Plant Physiol. 116, 1461 (1998). doi:10.1104/pp.116.4.1461 Medline
38. G. Giuliano, G. E. Bartley, P. A. Scolnik, Regulation of carotenoid biosynthesis during tomato development. Plant Cell 5, 379 (1993). Medline
39. L. A. Wanner, W. Gruissem, Expression dynamics of the tomato rbcS gene family during development. Plant Cell 3, 1289 (1991). Medline
40. G. Sandmann, S. Römer, P. D. Fraser, Understanding carotenoid metabolism as a necessity for genetic engineering of crop plants. Metab. Eng. 8, 291 (2006). doi:10.1016/j.ymben.2006.01.005 Medline
41. R. Brent, M. Ptashne, A eukaryotic transcriptional activator bearing the DNA specificity of a prokaryotic repressor. Cell 43, 729 (1985). doi:10.1016/0092-8674(85)90246-6 Medline
42. N.-C. Lin, R. B. Abramovitch, Y. J. Kim, G. B. Martin, Diverse AvrPtoB homologs from several Pseudomonas syringae pathovars elicit Pto-dependent resistance and have similar virulence activities. Appl. Environ. Microbiol. 72, 702 (2006). doi:10.1128/AEM.72.1.702-712.2006 Medline
43. J. J. Fillatti, J. Kiser, R. Rose, L. Comai, Efficient transfer of a glyphosate tolerance gene into tomato using a binary Agrobacterium tumefaciens vector. Nat. Biotechnol. 5, 726 (1987). doi:10.1038/nbt0787-726
44. A. Drummond et al., in www.geneious.com (2010).
45. Y. Eshed, D. Zamir, An introgression line population of Lycopersicon pennellii in the cultivated tomato enables the identification and fine mapping of yield-associated QTL. Genetics 141, 1147 (1995). Medline
46. D. Cantu et al., Ripening-regulated susceptibility of tomato fruit to Botrytis cinerea requires NOR but not RIN or ethylene. Plant Physiol. 150, 1434 (2009). doi:10.1104/pp.109.138701 Medline
47. S. Chang, J. Puryear, J. Cairney, A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 11, 113 (1993). doi:10.1007/BF02670468
48. J. Vrebalov et al., Fleshy fruit expansion and ripening are regulated by the Tomato SHATTERPROOF gene TAGL1. Plant Cell 21, 3041 (2009). doi:10.1105/tpc.109.066936 Medline
49. K. J. Livak, T. D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Δ Δ C(T)) Method. Methods 25, 402 (2001). doi:10.1006/meth.2001.1262 Medline
50. R. A. Irizarry et al., Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. 31, e15 (2003). doi:10.1093/nar/gng015 Medline
51. C. Eisenhart, The assumptions underlying the analysis of variance. Biometrics 3, 1 (1947). doi:10.2307/3001534 Medline
52. K. J. Cheung, V. Badarinarayana, D. W. Selinger, D. Janse, G. M. Church, A microarray-based antibiotic screen identifies a regulatory role for supercoiling in the osmotic stress response of Escherichia coli. Genome Res. 13, 206 (2003). doi:10.1101/gr.401003 Medline
53. R. Porra, W. Thompson, P. Kriedmann, Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochim. Biophys. Acta 975, 384 (1989). doi:10.1016/S0005-2728(89)80347-0
54. D. A. T. Southgate, Determination of Food Carbohydrates (Applied Science Publishers, Barking, Essex, ed. 178, 1976).
55. W. A. Russin, C. L. Trivett, in Microwave: Techniques and Protocols, R. T. Giberson, R. S. Demaree, Eds. (Humana Press, Totowa, NJ, 2001), pp. 25–35.
56. J. M. Lee et al., Combined transcriptome, genetic diversity and metabolite profiling in tomato fruit reveals that the ethylene response factor SlERF6 plays an important role in ripening and carotenoid accumulation. Plant J. 70, 191 (2012). doi:10.1111/j.1365-313X.2011.04863.x Medline
57. J. Javanmardi, C. Kubota, Variation of lycopene, antioxidant activity, total soluble solids and weight loss of tomato during postharvest storage. Postharvest Biol. Technol. 41, 151 (2006). doi:10.1016/j.postharvbio.2006.03.008
58. I. Martínez-Valverde, M. J. Periago, G. Provan, A. Chesson, Phenolic compounds, lycopene and antioxidant activity in commercial varieties of tomato (Lycopersicum esculentum). J. Sci. Food Agric. 82, 323 (2002). doi:10.1002/jsfa.1035