Supplementary Methods

I. General methods and materials for synthesis

II. Synthesis of nucleotide derivatives of Ds and Pa

III. Synthesis of Bio-PaTP

IV. Steady-state kinetics for the single-nucleotide insertion experiments with KF

exo–

V. Sequences of DNA fragments for the PCR, sequencing, and transcription

experiments

VI. Dye terminator sequencing of the PCR products from DNA

VII. T7 transcription for 17-mer RNA fragments

VIII. Selectivity of the Ds-Pa pair in transcription

1

I. General methods and materials for synthesis

Reagents and solvents were purchased from standard suppliers and used without further

purification. Reactions were monitored by thin-layer chromatography (TLC) using 0.25

mm silica gel 60 plates impregnated with 254 nm fluorescent indicator (Merck). 1H NMR, 13C NMR, and 31P NMR spectra were recorded on JEOL EX270 and BRUKER (300-AVM

and AVANCE-600) magnetic resonance spectrometers. Nucleoside purification was

performed on a Gilson HPLC system with a preparative C18 column (Waters Microbond

Sphere, 150 × 19 mm). The triphosphate derivatives were purified with a DEAE-Sephadex

A-25 column (300 × 15 mm) and a C18 column (Synchropak RPP, 250 × 4.6 mm, Eichrom

Technologies). High resolution mass spectra (HRMS) and electrospray ionization mass

spectra (ESI-MS) were recorded on a JEOL HX-110 or JM 700 mass spectrometer and a

Waters micromass ZMD 4000 equipped with a Waters 2690 LC system, respectively. The

compounds for the deoxynucleoside derivatives of pyrrole-2-carbaldehyde1 and

4-propynylpyrrole-2-carbaldehyde2 were synthesized according to the previously reported

literature.

References

1. Mitsui, T., Kitamura, A., Kimoto, M., To, T., Sato, A., Hirao, I. & Yokoyama, S. An unnatural hydrophobic base pair with shape complementarity between pyrrole-2-carbaldehyde and 9-methylimidazo[(4,5)-b]pyridine. J. Am. Chem. Soc. 125, 5298-5307 (2003).

2. Mitsui, T., Kimoto, M., Sato, A., Yokoyama, S. & Hirao, I. An unnatural hydrophobic base, 4-propynylpyrrole-2-carbaldehyde, as an efficient pairing partner of 9-methylimidazo[(4,5)-b]pyridine. Bioorg. Med. Chem. Lett. 13, 4515-4518 (2003).

2

II. Synthesis of nucleotide derivatives of Ds and Pa .

Synthesis scheme for the nucleoside derivatives of

7-(2-thienyl)-3H-imidazo[4,5-b]pyridine (4).

N

O2N

H2N

Cl

N

O2N

H2N

S

N

H2N

H2N

S

O

OH

HO N

N

N

S

N

S

N

NH

O

O

O N

N

N

S

Tol

Tol

O

OH

DMTrO N

N

N

S

O

O

DMTrO N

N

N

S

P

N

ONC

O

OAc

HO N

N

N

S

O

OH

O N

N

N

S

PPP

P OOO

O-PPR

O

O- O-

O

PPP

R= O- or NH2

N

S

N

NH

O

OH

HO N

N

N

S

OH

O

OH

DMTrO N

N

N

S

OH

O

OAc

HO N

N

N

S

OAc

O

OH

O N

N

N

S

PPP

OH

(a) (b) (c) (d) (e)

(i) (h) (g)

(f)

(j), (e) (f) (h) (i)

1 2 3 4 5 6

7 8910

4 11 12 13 14

Reagents and abbreviations: (a) dichlorobis(triphenylphosphine)palladium, 2-(tributylstannyl)thiophene, DMF; (b) palladium on carbon, sodium borohydride, ethanol, ethylacetate; (c) formic acid; (d) NaH, 2-deoxy 3,5-di-O-p-toluoyl-α-D-erythro-pentofuranosyl chloride, CH3CN; (e) NH3, methanol; (f) 4,4′-dimethoxytrityl chloride, pyridine; (g) 2-cyanoethyl tetraisopropylphosphordiamidite, tetrazole, CH3CN; (h) acetic anhydride, pyridine, then dichloroacetic acid, dichloromethane; (i) 2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one, dioxane, pyridine, tri-n-butylamine, bis(tributylammonium)pyrophosphate, DMF, then I2/pyridine, water, NH4OH (for triphosphate), I2/pyridine, NH4OH (for γ-amidotriphosphate); (j) tetra-O-acetyl-β-D-ribofuranose, chloroacetic acid. Tol: toluoyl, DMT: 4,4′-dimethoxytrityl, Ac: acetyl.

3

Synthesis scheme for the nucleoside derivatives of pyrrole-2-carbaldehyde (15),

4-propynylpyrrole-2-carbaldehyde (16), and

6-amino-9-(2-deoxy-β-D-ribofuranosyl)purine 5′-γ-amidotriphosphate (22).

O

OH

HO NO

O

O NTol

Tol

O

OAc

HO N

N

N

N

HN

b)

(h)

21

(a)

H

O

H

O

R R

O

OH

DMTrO N(c)

H

O

R

(d) O

O

DMTrO N

P

N

ONC

O

H

R

NH

H

O

R

R= H or propyne

(e) O

OH

O NP OOO

O-PPHO

O

O- O-

O H

O

R

O

OH

HO N

OH

R= H (17)R= propyne (18)

H

O

R

(f), (g)NH

H

O

R

R= H (15)R= propyne (16)

(e) O

OH

O NP OOO

O-PPHO

O

O- O-

O H

O

R

R= H (19)R= propyne (20)

O

O

OH

O N

N

N

NN

22

P OOO

O-PPH2N

O

O- O-

O

OH

HH

Reagents and abbreviations: (a) NaH, 2-deoxy 3,5-di-O-p-toluoyl-α-D-erythro-pentofuranosyl chloride, CH3CN; (b) NH3, methanol; (c) 4,4′-dimethoxytrityl chloride, pyridine; (d) 2-cyanoethyl-N,N-diisopropylamino chloro phosphoramidite diisopropylethylamine, THF; (e) proton sponge, POCl3, trimethyl phosphate, then tributylamine, bis(tributylammonium)pyrophosphate, DMF; (f) NaH, CH3CN, then 2,3,5-tri-O-benzyl-D-ribofuranosyl chloride; (g) BBr3, dichloromethane; (h) 2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one, dioxane, pyridine, tri-n-butylamine, bis(tributylammonium)pyrophosphate, DMF, then I2/pyridine, NH4OH (for γ-amidotriphosphate). Tol: toluoyl, DMT: 4,4′-dimethoxytrityl, Ac: acetyl.

4

The synthesis of the nucleoside derivatives of 7-(2-thienyl)-3H-imidazo[4,5-b]pyridine (4)

was accomplished by the reactions described in the above scheme. The

7-(2-thienyl)-3H-imidazo[4,5-b]pyridine (4) was synthesized from

2-amino-3-nitro-4-chloro-pyridine (1)3 in 3 steps (72%). Deoxyribonucleoside 6 was

obtained by the coupling reaction of

1-chloro-2-deoxy-3,5-di-O-toluoyl-α-D-erythro-pentofranose4 with the sodium salt of 4,

followed by deprotection of the toluoyl groups of 5 with methanolic ammonia as a single

product in a 61% yield from 4. The ribonucleoside 11 was synthesized by a fusion coupling

reaction of tetra-O-acetyl-β-D-ribofuranose and 4 at 200°C with a catalytic amount of

chloroacetic acid, and was obtained as a single product in a 29% yield after deprotection by

methanolic ammonia and purification by RP-HPLC.

The structures of nucleosides 6 and 11 were confirmed by NMR and high resolution

mass spectroscopy. The aromatic proton peaks of compounds 6 and 11 showed the same

chemical shifts. The HMBC and HSQC spectra of compounds 6 and 11 revealed the

presence of an N-glycoside bond between the sugar C1′ and N-3 positions of the

imidazo[4,5-b]pyridine base moiety. Furthermore, we found that the thienyl moiety of

compounds 6 and 11 was attached at position 7 in the imidazo[4,5-b]pyridine ring,

according to the 2D NOESY and 2D HMBC spectra. The anomeric configurations of

compounds 6 and 11 were confirmed by the 2D NOESY and 1D NOE spectra

(Supplementary Data). The key results of the 1D NOE experiments were that the

irradiation of the H1′ proton gives 2% and 3% enhancement of the H4′ signal and 8% and

9% enhancement of the H2 signal of compounds 6 and 11, respectively. When the H2

proton was irradiated, enhancements of 9% and 10% of the H1′ signal and 3-5% of the H2′

and H3′ signals were obtained in the differential NOE experiments. Thus, the anomeric

configurations of compounds 6 and 11 were assigned as β, on the basis of NOE

experiments. Compound 6 was converted to the amidite by the conventional method, and

the trimer of d(Tp6pT) [d(TpDspT)] was confirmed by electrospray ionization mass

spectrometry (ESI-MS: see Supplementary Data). Nucleoside 5′-triphosphates 10 and 14,

5

as substrates for the enzymatic reaction, were synthesized by the previously reported

procedure5.

The syntheses of the nucleoside derivatives of pyrrole-2-carbaldehyde (15) and

4-propynylpyrrole-2-carbaldehyde (16) were accomplished by the reactions described in

the above scheme. The syntheses of the deoxynucleoside derivatives of 15 and 16 were

reported1,2. The ribonucleosides of 15 and 16 were synthesized by the coupling reaction of

2,3,5-tri-O-benzyl-D-ribofuranosyl chloride6 and the sodium salt of respective 15 and 16,

followed by a treatment with BBr3 to deprotect the benzyl groups to give the

ribonucleosides of 17 (15%) and 18 (7%) in 2 steps, respectively. The structures of 17 and

18 were confirmed by NMR and high resolution mass spectroscopy. The HMBC and

HSQC spectra of compounds 17 and 18 showed that the N-glycoside bond had formed

between the sugar and the pyrrole base moiety at the C1′ carbon (see Supplementary

Data). The anomeric configurations of 17 and 18 were confirmed by the NOE experiments

(differential NOE and NOESY spectra, Supplementary Data). The key results of the

differential NOE experiments are as follows. The irradiation of the H1′ proton gives a 3-4%

enhancement of the H4′ signal. When the H2′ (and/or H3′) proton was irradiated, 9-10%

enhancement of the H5 signal was obtained. The NOESY spectra of compounds 17 and 18

showed cross peaks between H1′ and H4′, between H1′ and the CHO proton, and between

H5 and H2′ (and/or H3′). Thus, the anomeric configurations of 17 and 18 were assigned as

β, on the basis of the NOE NMR studies. The ribonucleosides of 17 and 18 were converted

to the ribonucleside 5′-triphosphates by the conventional method7.

The nucleoside 5′-triphosphates were synthesized according to the literature5,7. The

synthesis of 5′-γ-amidotriphosphate was accomplished by a slight modification of the

conventional method5. Protected nucleosides 9 and 218 were phosphitylated by

2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one. The protected nucleoside phosphites were

converted to the P2,P3-dioxo-P1-5′-nucleosidylcyclotriphosphites by a treatment with

pyrophosphate. After oxidation with iodine/water, the resulting 5′-trimetaphosphate was

treated with concentrated ammonia to give the nucleoside of 5′-γ-amidotriphosphate. The

6

purification of the 5′-γ-amidotriphosphates was carried out by anion exchange DEAE

Sephadex column chromatography and RP-HPLC. The DEAE column elution pattern and

the electrospray ionization mass spectrum of deoxyadenosine 5′-γ-amidotriphosphate (22)

are shown in Supplementary Data. In the synthesis of the 5′-γ-amidotriphosphate, the

normal 5′-triphosphate of deoxyadenosine was also formed, and the ratio of

5′-γ-amidotriphosphate:5′-triphosphate was 4.8:1, from the calculation of the fraction

absorbances. Compound 22 eluted quickly, as compared to the 5′-triphosphate of

deoxyadenosine (dATP), and was separated by the DEAE column purifacation. We

confirmed the moleculer weight of the 5′-γ-amidotriphosphate by the ESI-MS spectrum (the

difference between 22 and dATP was only 1 m/z, see Supplementary Data). After the

final purification by HPLC, the nucleoside 5′-γ-amidotriphosphates were obtained as

triethylammonium salts and characterized by NMR spectroscopy (1H and 31P NMR). The

γ-phosphate signals of the 5′-γ-amidotriphosphates of deoxyadenosine and 6 were shifted

downfield (at –0.50 and –0.52 p.p.m.), as compared to those of the 5′-triphosphates of 6, 11,

17, and 18 (Supplementary Data). This phenomenon was also observed with the

5′-γ-amidotriphosphate of guanosine9,10.

2-Amino-3-nitro-4-(2-thienyl)pyridine (2). To a solution of

2-amino-3-nitro-4-chloropyridine (1) (1.74 g, 10 mmol)3 and

dichlorobis(triphenylphosphine)palladium (II) (350 mg, 0.50 mmol) in DMF (50 ml) was

added 2-(tributylstannyl)thiophene (3.82 ml, 12 mmol) under an argon atmosphere. The

resulting mixture was stirred for 4 h at 100°C. The mixture was poured into water (250 ml)

and extracted with ethyl acetate (250 ml × 3). After drying over Na2SO4, the solvent was

evaporated in vacuo. The residue was subjected to flash silica gel chromatography using

methylene chloride : ethyl acetate (100:0 to 49:1, v/v) as an eluent, to afford 2.07 g of 2 (Rf

0.30 on methylene chloride : ethyl acetate = 19:1, v/v) in 93% yield. 1H NMR (270 MHz,

CDCl3) δ 8.17 (d, 1H, J = 5.1 Hz), 7.45 (dd, 1H, J = 5.0 and 1.1 Hz), 7.12 (dd, 1H, J = 3.6

and 1.1 Hz), 7.07 (dd, 1H, J = 5.0 and 3.6 Hz), 6.77 (d, 1H, J = 5.1 Hz), 5.66 (bs, 2H).

HRMS (FAB, 3-NBA matrix) for C9H8N3O2S (M+1): calcd, 222.0337; found, 222.0337.

7

2,3-Diamino-4-(2-thienyl)pyridine (3). To a mixture of 2 (2.06 g, 9.3 mmol) and 466 mg

palladium 10% wt. on carbon, in 130 ml of ethanol and 65 ml of ethyl acetate, 28 ml of 1 M

aqueous sodium borohydride was added at 0°C. The resulting mixture was stirred for 1 h at

0°C. To the mixture was added 43 ml of 5% aqueous ammonium chloride. The mixture was

filtered with celite. To the filtrate was added 500 ml water. After the ethanol and ethyl

acetate were evaporated, the mixture was extracted with ethyl acetate (250 ml × 3). After

drying over Na2SO4, the solvent was evaporated. The residue was subjected to flash silica

gel chromatography using methylene chloride : ethanol (19:1 to 93:7, v/v) as an eluent, to

afford 1.46 g of 3 (Rf 0.24 on methylene chloride : ethanol = 9:1, v/v) in 82% yield. 1H

NMR (270 MHz, CDCl3) δ 7.64 (d, 1H, J = 5.1 Hz), 7.40 (dd, 1H, J = 5.1 and 1.1 Hz), 7.23

(dd, 1H, J = 3.5 and 1.1 Hz), 7.14 (dd, 1H, J = 5.1 and 3.5 Hz), 6.74 (d, 1H, J = 5.1 Hz),

4.26 (bs, 2H), 3.72 (bs, 2H). HRMS (FAB, 3-NBA matrix) for C9H10N3S (M+1): calcd,

192.0595; found, 192.0588.

7-(2-Thienyl)-3H-imidazo[4,5-b]pyridine (4). A solution of 3 (956 mg, 5.0 mmol) in

formic acid (15 ml) was refluxed for 12 h. To the reaction mixture was added 24 ml of 28%

NH4OH on an ice cold bath. The resulting precipitate was filtered, washed with H2O and

ethyl eter, and dried at 60°C for 12 h to give 7-(2-thienyl)-3H-imidazo[4,5-b]pyridine (970

mg, 96%). 1H NMR (300 MHz, DMSO-d6) δ 13.20 (s, 1H), 8.48 (s, 1H), 8.30 (m, 2H),

7.78 (dd, 1H, J = 1.0 and 5.1 Hz), 7.54 (d, 1H, J = 5.1 Hz), 7.25 (dd, 1H, J = 3.8 and 4.9

Hz). 13C NMR (75 MHz, DMSO-d6) δ 148.66, 144.09, 143.44, 137.60, 131.16, 130.00,

129.24, 128.71, 128.00, 113.12. HRMS (FAB, 3-NBA matrix) for C10H8N3S (M+1): calcd,

202.0439; found, 202.0444.

7-(2-Thienyl)-3-[2-deoxy-3,5-di-O-(toluoyl)-β-D-ribofuranosyl]imidazo[4,5-b]pyridine

(5). To a mixture of 4 (403 mg, 2.0 mmol) and 32 ml of CH3CN was added NaH (96 mg,

2.4 mmol, 60% dispersion in mineral oil). The resulting mixture was stirred for 1 h at room

temperature. To the mixture was added

2-deoxy-3,5-di-O-p-toluoyl-α-D-erythro-pentofuranosyl chloride (933 mg, 2.4 mmol)4.

After stirring for 2.5 h at room temperature, the reaction mixture was separated by ethyl

8

acetate and water. The organic phase was washed three times with saturated NaCl, dried

with Na2SO4, and evaporated in vacuo. The product was purified by silica gel column

chromatography (0.5% methanol in CH2Cl2) to give 5 (714 mg, 65%). 1H NMR (270 MHz,

CDCl3) δ 8.32 (d, 1H, J = 5.3 Hz), 8.26 (s, 1H), 8.16 (dd, 1H, J = 3.8 and 1.2 Hz), 7.93 (m,

4H), 7.50 (dd, 1H, J = 5.1 and 1.2 Hz), 7.47 (d, 1H, J = 5.3 Hz), 7.22 (m, 5H), 6.68 (dd, 1H,

J = 8.6 and 5.8 Hz), 5.82 (m, 1H), 4.69 (m, 3H), 3.18 (ddd, 1H, J = 14.2, 8.6 and 6.4 Hz),

2.86 (ddd, 1H, J = 14.2, 5.8 and 2.0 Hz), 2.43 (s, 3H), 2.37 (s, 3H). HRMS (FAB, 3-NBA

matrix) for C31H28N3O5S (M+1): calcd, 554.1750; found, 554.1748.

7-(2-Thienyl)-3-(2-deoxy-β-D-ribofuranosyl)imidazo[4,5-b]pyridine (6). To 1.33 g (2.40

mmol) of 5 was added 120 ml methanolic ammonia that was saturated at 0°C. The solution

was stirred for 2 days at room temperature. The solvent was evaporated. The residue was

subjected to flash silica gel chromatography, using methylene chloride : ethanol (97:3 to

93:7, v/v) as an eluent, to afford 717 mg of 6 in 94% yield. 1H NMR (300 MHz, DMSO-d6)

δ 8.75 (s, 1H), 8.35 (d, 1H, J = 5.1 Hz), 8.30 (d, 1H, J = 3.7 Hz), 7.83 (d, 1H, J = 5.1 Hz),

7.65 (d, 1H, J = 5.1 Hz), 7.28 (t, 1H, J = 4.2 Hz), 6.54 (t, 1H, J = 6.9 Hz), 5.34 (d, 1H, J =

4.1 Hz), 5.11 (t, 1H, J = 5.7 Hz), 4.46 (m, 1H), 3.91 (m, 1H), 3.60 (m, 2H), 2.80 (m, 1H),

2.37 (m, 1H). 13C NMR (75 MHz, DMSO-d6) δ 147.10, 144.04, 143.62, 137.06, 132.00,

131.00, 129.78, 129.06, 128.07, 113.93, 87.88, 83.72, 70.80, 61.74, 39.40. HRMS (FAB,

3-NBA matrix) for C15H16N3O3S (M+1): calcd, 318.0912; found, 318.0905. UV λmax; 311

nm; ε = 2.04 × 104 in 25 mM sodium phosphate buffer (pH 6.8).

7-(2-Thienyl)-3-[2-deoxy-5-O-(4,4′-dimethoxytrityl)-β-D-ribofuranosyl]imidazo[4,5-b]

pyridine (7). A 317 mg (1.0 mmol) portion of 6 was co-evaporated with dry pyridine three

times. To the residue in 5.0 ml of dry pyridine was added 356 mg (1.1 mmol) of

4,4′-dimethoxytrityl chloride. The resulting mixture was stirred overnight at room

temperature. The mixture was poured into water (50 ml) and extracted with methylene

chloride (50 ml × 3). After drying over Na2SO4, the solvent was evaporated in vacuo. The

residue was subjected to flash silica gel chromatography, using methylene chloride : ethyl

acetate (9:1 to 13:7, v/v) as an eluent, to afford 550 mg of 7 in 89% yield. 1H NMR (270

9

MHz, CDCl3) δ 8.29 (d, 1H, J = 5.1 Hz), 8.22 (s, 1H), 8.17 (dd, 1H, J = 3.8 and 1.1 Hz),

7.49 (dd, 1H, J = 5.1 and 1.1 Hz), 7.44 (d, 1H, J = 5.1 Hz), 7.37 (m, 2H), 7.27 (m, 5H), 7.20

(m, 3H), 6.78 (m, 4H), 6.57 (dd, 1H, J = 6.5 and 6.2 Hz), 4.66 (m, 1H), 4.12 (m, 1H), 3.75

(s, 6H), 3.42 (dd, 1H, J = 10.1 and 4.6 Hz), 3.38 (dd, 1H, J = 10.1 and 5.4 Hz), 2.86 (m,

1H), 2.56 (ddd, 1H, J = 13.8, 6.5 and 4.6 Hz), 2.06 (d, 1H, J = 3.5 Hz). HRMS (FAB,

3-NBA matrix) for C36H34N3O5S (M+1): calcd, 620.2219; found, 620.2230.

7-(2-Thienyl)-3-[2-deoxy-5-O-(4,4′-dimethoxytrityl)-β-D-ribofuranosyl]imidazo[4,5-b]

pyridine 2-cyanoethyl-N,N-diisopropylphosphoramidite (8). A 425 mg (0.69 mmol)

portion of 7 was co-evaporated with dry pyridine three times and then with dry acetonitrile

three times. To the residue in 4.6 ml of dry acetonitrile was added 262 µl (0.82 mmol) of

2-cyanoethyl tetraisopropylphosphorodiamidite and 1.68 ml of 0.45 M tetrazole in

acetonitrile. The resulting mixture was stirred for 1 h at room temperature. To the mixture

was added 90 µl of dry methanol. The mixture was poured into water (50 ml) and extracted

with methylene chloride containing 1% triethylamine (50 ml × 3). After drying over

Na2SO4, the solvent was evaporated in vacuo. The residue was subjected to flash silica gel

chromatography using hexane : ethyl acetate (4:1 to 3:2, v/v) containing 2% triethylamine

as an eluent, to afford 490 mg of 8 in 87% yield. 1H NMR (270 MHz, DMSO-d6) δ 8.65 (m,

1H), 8.27 (m, 1H), 8.23 (m, 1H), 7.81 (m, 1H), 7.62 (m, 1H), 7.26 (m, 3H), 7.18 (m, 7H),

6.75 (m 4H), 6.54 (m, 1H), 4.81 (m, 1H), 4.13 (m, 1H), 3.84-3.45 (m, 10H), 3.21 (m, 3H),

2.82-2.48 (m, 3H) 1.13 (m, 12H). 31P NMR (109 MHz, DMSO-d6) δ 148.76 ppm and

148.14 ppm. HRMS (FAB, 3-NBA matrix) for C45H51N5O6SP (M+1): calcd, 820.3298;

found, 820.3325.

7-(2-Thienyl)-3-(2-deoxy-3-O-acetyl-β-D-ribofuranosyl)imidazo[4,5-b]pyridine (9). A

124 mg (0.20 mmol) portion of 7 was co-evaporated with dry pyridine three times. To the

residue in 2.0 ml of dry pyridine was added 38 µl (0.40 mmol) of acetic anhydride. The

resulting mixture was stirred for 2 days at room temperature. The mixture was poured into

water (50 ml) and extracted with methylene chloride (50 ml × 3). After drying over Na2SO4,

the solvent was evaporated in vacuo. To the residue in 20 ml of dry methylene chloride was

10

added 200 µl of dichloroacetic acid at 0°C. The resulting mixture was stirred for 15 min at

0°C. The mixture was poured into 8 ml of sat. aqueous sodium hydrogen carbonate and 42

ml of water and extracted with methylene chloride (50 ml × 3). After drying over Na2SO4,

the solvent was evaporated in vacuo. The residue was subjected to flash silica gel

chromatography using methylene chloride : ethyl acetate (9:1 to 3:2, v/v) as an eluent to

afford 65 mg of 9 in 88% yield. 1H NMR (270 MHz, CDCl3) δ 8.29 (d, 1H, J = 5.4 Hz),

8.18 (dd, 1H, J = 3.8 and 1.1 Hz), 8.13 (s, 1H), 7.53 (dd, 1H, J = 5.0 and 1.1 Hz), 7.50 (d,

1H, J = 5.4 Hz), 7.20 (dd, 1H, J = 5.0 and 3.8 Hz), 6.69 (m, 1H), 6.37 (dd, 1H, J = 10.1 and

5.4 Hz), 5.58 (m, 1H), 4.28 (m, 1H), 3.96 (m, 2H), 3.32 (ddd, 1H, J = 15.9, 10.1, and 5.9

Hz), 2.41 (m, 1H), 2.12 (s, 3H). HRMS (FAB, 3-NBA matrix) for C17H18N3O4S (M+1):

calcd, 360.1018; found, 360.0993.

7-(2-Thienyl)-3-(β-D-ribofuranosyl)imidazo[4,5-b]pyridine (11). A mixture of 4 (80 mg,

0.4 mmol), tetra-O-acetyl-β-D-ribofuranose (130 mg, 0.4 mmol), and chloroacetic acid (2

mg) was fused at 200°C for 5 min. The resulting dark syrup was treated with methanolic

ammonia (40 ml). The reaction mixture was stirred at room temperature for 18 h. The

volatile fraction was evaporated in vacuo. To the residue was added 10 ml of 30% CH3CN

in H2O, and the product was purified by reversed phase HPLC to give 11 (39 mg, 29%, 2

steps). 1H NMR (300 MHz, DMSO-d6) δ 8.78 (s, 1H), 8.36 (d, 1H, J = 5.2 Hz), 8.31 (dd,

1H, J = 1.0 and 3.7 Hz), 7.84 (dd, 1H, J = 0.9 and 5.1 Hz), 7.66 (d, 1H, J = 5.2 Hz), 7.28

(dd, 1H, J = 3.7 and 5.0 Hz), 6.08 (d, 1H, J = 5.8 Hz), 5.49 (d, 1H, J = 6.0 Hz), 5.26 (t, 1H,

J = 6.5 Hz), 5.20 (d, 1H, J = 4.9 Hz), 4.67 (q, 1H, J = 5.8 Hz), 4.20 (q, 1H, J = 4.9 Hz), 4.00

(m, 1H), 3.71 (m, 1H), 3.59 (m, 1H). 13C NMR (75 MHz, DMSO-d6) δ 147.29, 144.07,

143.91, 137.00, 132.13, 131.08, 129.86, 129.14, 128.10, 114.02, 87.76, 85.57, 73.48, 70.43,

61.43. HRMS (FAB, 3-NBA matrix) for C15H16N3O4S (M+1): calcd, 334.0862; found,

334.0871.

7-(2-Thienyl)-3-[5-O-(4,4′-dimethoxytrityl)-β-D-ribofuranosyl]imidazo[4,5-b]pyridine

(12). Compound 11 (99 mg, 0.29 mmol) was co-evaporated with dry pyridine three times

and was dissolved in pyridine (3.0 ml). To the solution was added 4,4'-dimethoxytrityl

11

chloride (106 mg, 0.31 mmol), and the mixture was stirred at room temperature for 2 h. The

reaction mixture was poured into 5% NaHCO3 in H2O and extracted with ethyl acetate. The

organic phase was washed with saturated NaCl three times, dried with Na2SO4, and

evaporated in vacuo. The product was purified by silica gel column chromatography (1%

methanol in CH2Cl2) to give 12 (131 mg, 71%). 1H NMR (600 MHz, CDCl3) δ 8.39 (s, 1H),

8.28 (d, 1H, J = 5.2 Hz), 8.25 (d, 1H, J = 3.4 Hz), 7.52 (t, 2H, J = 5.7 Hz), 7.22 (m, 2H),

7.14 (m, 7H), 6.69 (m, 5H), 6.04 (d, 1H, J = 6.2 Hz), 4.77 (m, 1H), 4.48 (m, 1H), 4.34 (d,

1H, J = 4.6 Hz), 3.70 (s, 6H), 3.46 (dd, 1H, J = 3.4 and 10.5 Hz), 3.23 (dd, 1H, J = 2.9 and

10.5 Hz). HRMS (FAB, 3-NBA matrix) for C36H34N3O6S (M+1): calcd, 636.2168; found,

636.2173.

7-(2-Thienyl)-3-(2,3-di-O-acetyl-β-D-ribofuranosyl)imidazo[4,5-b]pyridine (13). A 120

mg (0.19 mmol) portion of 12 was co-evaporated three times with dry pyridine. To the

residue in 1.9 ml of dry pyridine was added 72 µl (0.76 mmol) of acetic anhydride. The

resulting mixture was stirred for 7 h at room temperature. The mixture was poured into 5%

NaHCO3 (50 ml) and ethyl acetate (50 ml). The organic phase was washed once with

saturated NaCl. After the organic phase was dried over Na2SO4, the solvent was evaporated

in vacuo. The residue was co-evaporated twice with toluene. To the residue, in 19 ml of

CH2Cl2, was added 190 µl of dichloroacetic acid at 0°C. The resulting reaction mixture was

stirred for 15 min at 0°C. The mixture was poured into 5% NaHCO3 and extracted with

CH2Cl2. The organic phase was washed with saturated NaCl, and after the organic phase

was dried over Na2SO4, the solvent was evaporated in vacuo. The product was purified by

silica gel column chromatography, using 2% methanol in CH2Cl2 as an eluent, to afford 77

mg of 13 in 93% yield. 1H NMR (300 MHz, DMSO-d6) δ 8.79 (s, 1H), 8.37 (d, 1H, J = 5.2

Hz), 8.29 (dd, 1H, J = 1.2 and 3.7 Hz), 7.84 (dd, 1H, J = 1.1 and 5.1 Hz), 7.68 (d, 1H, J =

5.2 Hz), 7.27 (dd, 1H, J = 3.7 and 5.1 Hz), 6.38 (d, 1H, J = 6.8 Hz), 6.02 (dd, 1H, J = 5.6

and 6.6 Hz), 5.54 (m, 2H), 4.26 (m, 1H), 3.71 (m, 2H), 2.14 (s, 3H), 1.98 (s, 3H). 13C NMR

(75 MHz, DMSO-d6) δ 169.55, 169.22, 146.98, 144.39, 143.85, 136.74, 132.50, 131.02,

12

130.11, 129.32, 128.14, 114.36, 85.20, 83.63, 72.34, 71.23, 61.05, 20.44, 20.13. HRMS

(FAB, 3-NBA matrix) for C19H20N3O6S (M+1): calcd, 418.1073; found, 418.1049.

1-(β-D-Ribofuranosyl)pyrrole-2-carbaldehyde (17). To a solution of

pyrrole-2-carboxaldehyde (330 mg, 3.5 mmol) in CH3CN (18 mL) was added NaH (60%

oil dispersion, 152 mg, 3.8 mmol). The reaction mixture was stirred at room temperature

for 45 min. A solution of 2,3,5-tri-O-benzyl-D-ribofuranosyl chloride6 (3.1 mmol) in

CH3CN (13 ml), prepared from 2,3,5-tri-O-benzyl-1-O-p-nitrobenzoyl-D-ribofuranose (1.8

g 3.1 mmol), was then added. The reaction mixture was stirred at room temperature for 4 h.

The product was separated by ethyl acetate and water, and the organic phase was washed

with saturated NaCl three times, dried with Na2SO4, and evaporated in vacuo. The residue

was purified by silica gel column chromatography (eluted by 20% ethyl acetate in hexane)

to give crude 1-(2,3,5-tri-O-benzyl-D-ribofuranosyl)pyrrole-2-carbaldehyde (506 mg).

After the crude 1-(2,3,5-tri-O-benzyl-D-ribofuranosyl)pyrrole-2-carbaldehyde was

co-evaporated with toluene three times, CH2Cl2 (17 ml) was added to the residue. To the

solution was added BBr3 (1 M solution, 3.0 ml) at –78°C. The reaction mixture was stirred

for 2.5 h, and then 50% methanol in CH2Cl2 (25 ml) was added. After the solution was

stirred for 10 min at –78°C, 28% NH4OH (0.5 ml) was added and the reaction mixture was

stirred until it reached room temperature. The product was separated by CH2Cl2 and H2O,

and the water phase was washed with CH2Cl2 three times, and evaporated in vacuo. The

product was purified by reversed phase C18 HPLC to give

1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde (108 mg, 15%, 2 steps). 1H NMR (270 MHz,

DMSO-d6) δ 9.54 (s, 1H), 7.74 (s, 1H), 7.06 (dd, 1H, J = 1.6 and 4.0 Hz), 6.39 (d, 1H, J =

4.3 Hz), 6.30 (dd, 1H, J = 3.0 and 4.0 Hz), 5.27 (d, 1H, J = 5.6 Hz), 5.05 (d, 1H, J = 4.9 Hz),

5.00 (t, 1H, J = 5.3 Hz), 4.02 (m, 2H), 3.85 (m, 1H), 3.52 (m, 2H). 13C NMR (75 MHz,

DMSO-d6) δ 179.41, 131.68, 128.24, 124.94, 110.23, 89.34, 84.33, 75.64, 69.50, 60.82.

HRMS (FAB, 3-NBA matrix) for C10H14NO5 (M+1): calcd, 228.0872; found, 228.0863.

4-Propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde (18).

4-Propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde was synthesized by using

13

4-propynylpyrrole-2-carbaldehyde (16)2 (266 mg, 2.0 mmol) according to the synthesis of

17, and yielded 18 (39 mg, 7%, 2 steps) after purification by RP-HPLC. 1H NMR (300

MHz, DMSO-d6) δ 9.50 (s, 1H), 7.91 (s, 1H), 7.09 (d, 1H, J = 1.8 Hz), 6.32 (d, 1H, J = 3.6

Hz), 5.32 (d, 1H, J = 5.5 Hz), 5.07 (t, 1H, J = 5.2 Hz), 5.05 (d, 1H, J = 4.2 Hz), 4.01 (m,

1H), 3.86 (m, 1H), 3.66 (ddd, 1H, J = 3.4, 5.3, and 11.9 Hz), 3.55 (ddd, 1H, J = 3.6, 4.9,

and 12.1 Hz), 1.97 (s, 3H). 13C NMR (75 MHz, DMSO-d6) δ 179.60, 131.15, 130.43,

126.13, 106.22, 89.62, 85.26, 84.49, 75.86, 73.17, 69.30, 60.53, 3.79. HRMS (FAB, 3-NBA

matrix) for C13H16NO5 (M+1): calcd, 266.1028; found, 266.1023.

Synthesis of nucleoside 5′-triphosphates 10 and 14. The protected nucleoside (0.1 mmol,

9 or 13) was dissolved in pyridine and evaporated to dryness in vacuo. The residue was

dissolved in pyridine (100 µl) and dioxane (300 µl). A 1 M solution of

2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one in dioxane (110 µl, 0.11 mmol) was added.

After 10 min, tri-n-butylamine (100 µl) and 0.5 M bis(tributylammonium)pyrophosphate in

DMF (300 µl, 0.15 mmol) were quickly added to the reaction mixture. The reaction mixture

was stirred at room temperature for 10 min. A solution of 1% iodine in pyridine/water (98/2,

v/v) (2.0 ml) was then added. After 15 min, 150 µl of a 5% aqueous solution of NaHSO3,

followed by 5.0 ml of water, was added to the reaction mixture. The solution was stirred at

room temperature for 30 min, and then 20 ml of concentrated ammonia was added.

Ammonolysis was carried out at room temperature for 2 h. After the reaction solution was

concentrated in vacuo, the product was purified by DEAE Sephadex (A-25) column

chromatography (eluted by a linear gradient of 50 mM to 1 M TEAB), and then by

C18-HPLC (eluted by a gradient of 0% to 30% CH3CN in 100 mM triethylammonium

acetate) to give the nucleoside 5′-triphosphate.

7-(2-Thienyl)-3-(2-deoxy-β-D-ribofuranosyl)imidazo[4,5-b]pyridine 5′-triphosphate

(10). 1H NMR (270 MHz, D2O) δ 8.51 (s, 1H), 8.09 (d, 1H, J = 5.3 Hz), 7.78 (d, 1H, J = 3.6

Hz), 7.56 (d, 1H, J = 4.9 Hz), 7.36 (d, 1H, J = 5.3 Hz), 7.12 (t, 1H, J = 4.9 Hz), 6.41 (t, 1H,

J = 7.3 Hz), 4.16 (m, 1H), 4.04 (m, 2H), 3.01 (q, 18H, J = 7.3 Hz), 2.72 (m, 1H), 2.46 (m,

1H), 1.09 (t, 27H, J = 7.3 Hz). 31P NMR (109 MHz, D2O) δ –9.94 (d, 1P, J = 20.1 Hz),

14

–10.72 (d, 1P, J = 20.1 Hz), –22.58 (t, 1P, J = 20.1 Hz). Electrospray ionization-mass

spectroscopy (ESI-MS) for C15H18N3O12P3S; calcd, 555.97 (M-H)–; found, 555.69 (M-H)–.

7-(2-Thienyl)-3-(β-D-ribofuranosyl)imidazo[4,5-b]pyridine 5′-triphosphate (14). 1H

NMR (300 MHz, D2O) δ 8.74 (s, 1H), 8.32 (d, 1H, J = 5.4 Hz), 8.01 (d, 1H, J = 3.5 Hz),

7.68 (dd, 1H, J = 1.1 and 5.1 Hz), 7.64 (d, 1H, J = 5.1 Hz), 7.25 (dd, 1H, J = 3.5 and 5.1

Hz), 6.25 (d, 1H, J = 6.0 Hz), 4.82 (m, 1H), 4.57 (m, 1H), 4.36 (m,1H), 4.20 (m, 2H), 3.11

(q, 18H, J = 7.3 Hz), 1.19 (t, 27H, J = 7.3 Hz). 31P NMR (109 MHz, D2O) δ –9.80 (d, 1P, J

= 20.1 Hz), –11.03 (d, 1P, J = 18.9 Hz), –22.78 (t, 1P, J = 20.1 and 18.9 Hz). ESI-MS for

C15H18N3O13P3S; calcd, 571.97 (M-H)–; found, 571.74 (M-H)–.

Synthesis of nucleoside 5′-γ-amidotriphosphates 10 and 22.5,9,10 The protected

nucleoside (0.1 mmol, 9 or 218) was dissolved in pyridine and evaporated to dryness in

vacuo. The residue was dissolved in pyridine (100 µl) and dioxane (300 µl). A 1 M solution

of 2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one in dioxane (110 µl, 0.11 mmol) was

added. After 10 min, tri-n-butylamine (100 µl) and 0.5 M

bis(tributylammonium)pyrophosphate in DMF (300 µl, 0.15 mmol) were quickly added to

the reaction mixture. The reaction mixture was stirred at room temperature for 10 min. A

solution of 1% iodine in pyridine/water (98/2, v/v) (2.0 ml) was then added. After 15 min,

150 µl of a 5% aqueous solution of NaHSO3 was added. After the solvent was evaporated,

20 ml of 28% aqueous ammonia was added to the residue. Ammonolysis was carried out at

60°C for 5 h (for the γ-amidotriphosphate of deoxyadenosine) or at room temperature 2 h

(for the γ-amidotriphosphate of 6). After the reaction solution was concentrated in vacuo,

the product was purified by DEAE Sephadex (A-25) column chromatography (eluted by a

linear gradient of 50 mM to 1 M TEAB), and then by C18-HPLC (eluted by a gradient of

0% to 30% CH3CN in 100 mM triethylammonium acetate) to give the nucleoside

5′-γ-amidotriphosphate.

6-Amino-9-(2-deoxy-β-D-ribofuranosyl)purine 5′-γ-amidotriphosphate (22). 1H NMR

(270 MHz, D2O) δ 8.35 (s, 1H), 8.11 (s, 1H), 6.37 (t, 1H, J = 6.9 Hz), 4.16 (m, 1H), 4.03

15

(m, 2H), 3.05 (q, 18H, J = 7.3 Hz), 2.70 (m, 1H), 2.48 (m, 1H), 1.13 (t, 27H, J = 7.3 Hz). 31P NMR (109 MHz, D2O) δ –0.50 (d, 1P, J = 19.5 Hz), –10.77 (d, 1P, J = 19.5 Hz), –22.14

(t, 1P, 20.1 Hz). ESI-MS for C10H17N6O11P3; calcd, 489.01 (M-H)–; found, 488.98 (M-H)–.

7-(2-Thienyl)-3-(2-deoxy-β-D-ribofuranosyl)imidazo[4,5-b]pyridine

5′-γ-amidotriphosphate (5′-γ-amidotriphosphate of 10). 1H NMR (270 MHz, D2O) δ

8.57 (s, 1H), 8.16 (d, 1H, J = 5.3 Hz), 7.85 (d, 1H, J = 3.6 Hz), 7.58 (d, 1H, J = 4.9 Hz),

7.45 (d, 1H, J = 5.3 Hz), 7.15 (t, 1H, J = 4.6 Hz), 6.48 (t, 1H, J = 6.9 Hz), 4.18 (m, 1H),

4.05 (m, 2H), 3.03 (q, 18H, J = 7.3 Hz), 2.75 (m, 1H), 2.50 (m, 1H), 1.11 (t, 27H, J = 7.3

Hz). 31P NMR (109 MHz, D2O) δ –0.52 (d, 1P, J = 20.1 Hz), -10.75 (d, 1P, J = 19.5 Hz),

-22.14 (t, 1P, J=20.8 Hz). ESI-MS for C15H19N4O11P3S; calcd, 554.99 (M-H)–; found,

555.01 (M-H)–.

Synthesis of nucleoside 5′-triphosphates 19 and 20.7 To a solution of

1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde (17) or

4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde (18) (0.1 mmol) and a proton

sponge (33 mg, 0.15 mmol) in trimethyl phosphate (500 µl) was added POCl3 (12 µl, 0.13

mmol) at 0°C. The reaction mixture was stirred at 0°C for 2 h. Tri-n-butylamine (120 µl,

0.5 mmol) was added to the reaction mixture, followed by 0.5 M

bis(tributylammonium)pyrophosphate in a DMF solution (1.0 ml, 0.5 mmol). After 5 min,

the reaction was quenched by the addition of 0.5 M triethylammonium bicarbonate (TEAB,

500 µl). The resulting crude product was purified by DEAE Sephadex A-25 column

chromatography (eluted by a linear gradient of 50 mM to 1 M TEAB), and then by

C18-HPLC (Synchropak RPP, Eichrom Technologies, eluted by a gradient of 0% to 30%

CH3CN in 100 mM triethylammonium acetate).

1-(β-D-Ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (19). 1H NMR (270 MHz,

D2O) δ 9.28 (s, 1H), 7.64 (s, 1H), 7.08 (d, 1H, J = 3.9 Hz), 6.45 (d, 1H, J = 4.1 Hz), 6.32 (m,

1H), 4.32 (m, 2H), 4.10 (m, 3H), 3.03 (q, 18H, J = 7.3 Hz), 1.11 (t, 27H, J = 7.3 Hz). 31P

16

NMR (109 MHz, D2O) δ –10.51 (d, 1P, J = 19.5 Hz), –11.3 (d, 1P, J = 20.1 Hz), –22.91 (t,

1H, J = 20.1 Hz). ESI-MS for C10H16NO14P3: calcd, 465.97 (M-H)–; found, 465.85 (M-H)–.

4-Propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (20). 1H

NMR (270 MHz, D2O) δ 9.28 (s, 1H), 7.70 (s, 1H), 7.08 (s, 1H), 6.40 (d, 1H, J = 4.0 Hz),

4.30 (m, 2H), 4.13 (m, 3H), 3.06 (q, 18H, J = 7.3 Hz), 1.86 (s, 3H), 1.14 (t, 27H, J = 7.3

Hz). 31P NMR (109 MHz, D2O) δ –10.10 (d, 1P, J = 19.5 Hz), –11.02 (d, 1P, J = 19.5 Hz),

–22.82 (t, 1P, J = 20.1 Hz). ESI-MS for C13H18NO14P3: calcd, 503.99 (M-H)–; found,

503.94 (M-H)–.

References

3. De Roos, K. B. & Salemink, C. A. Deazapurine derivatives. V, A new synthesis of 1- and 3-deaza-adenine and related compound. Recueil. 88, 1263-1274 (1963).

4. Rolland, V., Kotera, M. & Lhomme, J. Convenient preparation of 2-deoxy 3,5-di-O-p-toluoyl-α-D-erythro-pentofuranosyl chloride. Synthetic commun. 27, 3505-3511 (1997).

5. Ludwig, J. & Eckstein, F. Rapid and efficient synthesis of 5′-O-(1-thiotriphosphates), 5′-O-triphosphates and 2′,3′-cyclophosphorothioates using 2-chloro-4H-1,3,2-benzosioxaphosphorin-4-one. J. Org. Chem. 54, 631-635 (1989).

6. Stevens, J. D., Ness, R. K. & Fletcher. Jr, H. G. Syntheses with partially benzylated sugars. XI. Studies on the synthesis of the anomeric 5,6-dimethyl-1-D-ribofuranosylbenzimidazole (Ribazoles). Comparison of the condensation of 2,3,5-tri-O-benzoyl-D-ribofuranosyl bromide and 2,3,5-tri-O-benzoyl-D-ribofuranosyl chloride with 5,6-dimethylbenzimidazole. J. Org. Chem. 33, 1806-1810 (1968).

7. Kovacs, T. & Otvos, L. Simple synthesis of 5-vinyl- and 5-ethynyl-2′-deoxyuridine-5′-triphosphates. Tetrahedron Lett. 29, 4525-4528 (1988).

8. Ti, G. S., Gaffney, B. L. & and Jones, R. A. Transient protection: Efficient One-Flask Syntheses of Protected Deoxynucleosides. J. Am. Chem. Soc. 104, 1316-1319 (1982).

9. Stumber, M., Herrmann, C., Wohlgemuth, S., Kalbitzer, H. R., Jahn, W. & Geyer, M. Synthesis, characterization and application of two nucleoside triphosphate analogues, GTPγNH2 and GTPγF. Eur. J. Biochem. 269, 3270-3278 (2002).

10. Knorre, D. G., Kurbatov, V. A. & Samukov, V. V. General method for the synthesis of ATP gamma-derivatives. FEBS Lett. 70, 105-108 (1976).

17

III. Synthesis of Bio-PaTP

Synthesis scheme for 1-(β-D-ribofuranosyl)-4-[(3-biotinamido-1-propynyl)]

pyrrole-2-carbaldehyde 5′-triphosphate (28).

(a), (b), (c)

NH

H

O

I

23

O

OH

HO N

OH

24

H

O

NH

Cl2HCO

(d) O

OH

DMTrO N

OH

25

H

O

NH

Cl2HCO

(e) O

OAc

HO N

OAc

26

H

O

NH

Cl2HCO

O

OH

O N

OH

27

H

O

H2N

(f)

P OOO

O-PPHO

O

O- O-

O(g)

O

OH

O N

OH

28

H

O

N

P OOO

O-PPHO

O

O- O-

O

H

OS

NN

O

H

H

Reagents and abbreviations: (a) NaH, CH3CN, then 2,3,5-tri-O-benzyl-D-ribofuranosyl chloride; (b) BBr3, dichloromethane; (c) 3-(dichloroacetamido)-1-propyne, tetrakis(triphenylphosphine)palladium, CuI, triethylamine, DMF; (d) 4,4′-dimethoxytrityl chloride, pyridine; (e) acetic anhydride, pyridine, then dichloroacetic acid, dichloromethane; (f) 2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one, dioxane, pyridine, tri-n-butylamine, bis(tributylammonium)pyrophosphate, DMF, then I2/pyridine, water, NH4OH; (g) biotin-N-hydroxysuccinimide, DMF, NaHCO3 and Na2CO3 buffer (pH 8.6) then NH4OH. DMTr: 4,4′-dimethoxytrityl, Ac: acetyl.

18

1-(β-D-Ribofuranosyl)-4-[(3-dichloroacetamido)-1-propynyl]pyrrole-2-carbaldehyde (24)

was synthesized by coupling 4-iodopyrrole-2-carbaldehyde (23) with

2,3,5-tri-O-benzyl-D-ribofuranosyl chloride, which was prepared by chlorination11 of

2,3,5-tri-O-benzyl-D-ribofuranose, using CCl4 and tris(dimethylamino)phosphane, followed

by a treatment with BBr3. The ribonucleoside of 4-iodopyrrole-2-carbaldehyde was

converted to the ribonucleoside of

4-[(dichloroacetamide)-1-propynyl]pyrrole-2-carbaldehyde (24) by palladium-mediated

cross-coupling according to the literature12. The structure of 24 was confirmed by NMR

and high resolution mass spectroscopy. The HMQC and HMBC spectra of 24 revealed that

the N-glycoside bond is formed between the sugar and the pyrrole base moiety at the C1′

carbon. From the NOE experiment (NOESY spectrum in Supplementary Data), the

anomeric configuration of 24 was assigned as β; the cross peaks of the NOESY spectrum of

24 were similar to those of 18, and showed a cross peak between the H1′ and H4′ protons.

Compound 24 was converted to the 2′,3′-O-acetylated ribonucleoside 26 in two steps (87%

from 24), and then the nucleoside 5′-triphosphate (27) was prepared by a conventional

method5. Finally, compound 27 was converted to Bio-PaTP (28) in a 14% yield from 26.

The structure of 28 was confirmed by 1H NMR, 31P NMR and mass spectrometry. The

proton signals of the biotin moiety in 28 were identical to those of the previously

synthesized biotinylated-yTP12, and the 31P NMR spectrum in D2O showed a typical

phosphorus signal corresponding to nucleoside 5′-triphosphates.

1-(β-D-Ribofuranosyl)-4-[(3-dichloroacetamido)-1-propynyl]pyrrole-2-carbaldehyde

(24). To a THF solution (4.6 ml) containing 2,3,5-tri-O-benzyl-D-ribofuranose (1.0 g, 2.3

mmol) and CCl4 (344 µl, 3.6 mmol), hexamethylphosphorous triamide (562 µl, 3.0 mmol)

was added at –78°C. The solution was stirred for 2 h at –78°C and for 30 min at room

temperature (solution A). To a solution of 4-iodopyrrole-2-carboxaldehyde (830 mg, 3.7

mmol) in CH3CN (25 mL) was added NaH (60% oil dispersion, 150 mg, 3.7 mmol). The

reaction mixture was stirred at room temperature for 30 min. A solution of

2,3,5-tri-O-benzyl-D-ribofuranosyl chloride in THF (solution A) was then added. The

19

reaction mixture was stirred at room temperature for 12 h. The product was separated by

ethyl acetate and water. The organic layer was washed with saturated NH4Cl three times,

dried with Na2SO4, and evaporated in vacuo. The product was purified by silica gel column

chromatography (eluted by 1% methanol in dichloromethane) to give

1-(2,3,5-tri-O-benzyl-D-ribofuranosyl)-4-iodopyrrole-2-carbaldehyde. To a solution of

1-(2,3,5-tri-O-benzyl-D-ribofuranosyl)-4-iodopyrrole-2-carbaldehyde in dichloromethane

(15 ml) was added BBr3 (1 M solution, 8.5 ml) at –78°C. The reaction mixture was stirred

for 2 h, and then 50% methanol in CH2Cl2 (30 ml) was added. After stirring the solution at

–78°C for 10 min, 28% NH4OH (4 ml) was added, and the reaction mixture was stirred

until it reached room temperature. The solution was added to CH2Cl2 and H2O. The water

layer was isolated and washed with CH2Cl2 three times, and the residue was evaporated in

vacuo. The product was purified by reversed phase C18 HPLC to give

1-(β-D-ribofuranosyl)-4-iodopyrrole-2-carbaldehyde (330 mg).

1-(β-D-Ribofuranosyl)-4-iodopyrrole-2-carbaldehyde (176 mg, 0.5 mmol, containing the α

anomer) was co-evaporated with pyridine and toluene. To a solution of

1-(β-D-ribofuranosyl)-4-iodopyrrole-2-carbaldehyde (176 mg),

tetrakis(triphenylphosphine)palladium (29 mg, 0.025 mmol), CuI (15 mg, 0.08 mmol), and

triethylamine (105 µl, 0.75 mmol) in DMF (1.8 ml), a 1 M solution (750 µl) of

3-(dichloroacetamido)-1-propyne (0.75 mmol) in DMF was added. The reaction was stirred

at room temperature for 12 h. The product was separated with EtOAc/H2O, and the organic

layer was dried with Na2SO4, and evaporated in vacuo. The product was purified by silica

gel column chromatography (10% methanol in dichloromethane) and RP-HPLC to give

compound 24 (123 mg, 26%, 3 steps total yield) as the β isomer. Compound 24: 1H NMR

(300 MHz, DMSO-d6) δ 9.54 (d, 1H, J = 0.8 Hz), 9.10 (t, 1H, J = 5.2 Hz), 8.01 (s, 1H),

7.18 (d, 1H, J = 1.8 Hz), 6.49 (s, 1H), 6.34 (d, 1H, J = 3.5 Hz), 5.35 (d, 1H, J = 5.6 Hz),

5.10 (m, 2H), 4.17 (d, 2H, J = 5.4 Hz), 4.02 (m, 2H), 3.88 (m, 1H), 3.68 (ddd, 1H, J = 3.4,

5.3, and 12.1 Hz), 3.57 (ddd, 1H, J = 3.5, 5.0, and 12.1 Hz). 13C NMR (75 MHz,

DMSO-d6) δ 180.28, 163.78, 131.88, 131.49, 126.85, 105.23, 90.23, 85.26, 85.04, 76.83,

20

76.41, 69.75, 67.01, 60.96, 30.20. HRMS (FAB, 3-NBA matrix) for C15H17N2O6Cl2 (M+1):

calcd, 391.0464; found, 391.0462.

1-(2,3-Di-O-acetyl-β-D-ribofuranosyl)-4-[(3-dichloroacetamido)-1-propynyl]pyrrole-2-

carbaldehyde (26). Compound 24 (118 mg, 0.3 mmol) was co-evaporated with pyridine

three times. To the residue in pyridine (3.0 ml) was added 4,4′-dimethoxytrityl chloride

(113 mg, 0.33 mmol). The mixture was stirred for 1 h at room temperature, and was added

to EtOAc and 5% NaHCO3. The organic layer was washed with saturated NaCl, dried over

Na2SO4, and evaporated in vacuo. The product was purified by silica gel chromatography

(1% methanol in CH2Cl2) to give 197 mg of 25 in a 95% yield. Compound 25 (188 mg,

0.27 mmol) was co-evaporated with pyridine three times. To the residue in pyridine (2.7

ml) was added acetic anhydride (103 µl, 1.1 mmol). The mixture was stirred for 12 h at

room temperature, and added to EtOAc and 5% NaHCO3. The organic layer was washed

with saturated NaCl, dried over Na2SO4, and evaporated in vacuo. To the residue in

dichloromethane (27 ml) was added dichloroacetic acid (270 µl) at 0°C. The mixture was

stirred for 15 min at 0°C, poured into 5% aqueous sodium hydrogen carbonate, and

extracted with dichloromethane. After it was dried over Na2SO4, the solution was

evaporated in vacuo. The product was purified by silica gel chromatography (1% methanol

in CH2Cl2) to give 118 mg of 26 in a 92% yield. Compound 25: 1H NMR (500 MHz,

DMSO-d6) δ 9.56 (s, 1H), 9.05 (t, 1H, J = 5.0 Hz), 7.72 (s, 1H), 7.38-7.20 (m, 10H), 6.87

(d, 4H, J = 7.1 Hz), 6.47 (s, 1H), 6.34 (d, 1H, J = 3.3 Hz), 5.47 (d, 1H, J = 5.3 Hz), 5.13 (d,

1H, J = 5.7 Hz), 4.12-4.00 (m, 5H), 3.73 (s, 6H), 3.22 (m, 2H). HRMS (FAB, 3-NBA

matrix) for C36H35N2O8Cl2 (M+1): calcd, 693.1770; found, 693.1721. Compound 26: 1H

NMR (500 MHz, DMSO-d6) δ 9.50 (s, 1H), 9.10 (bs, 1H), 8.06 (s, 1H), 7.24 (d, 1H, J = 1.3

Hz), 6.64 (d, 1H, J = 5.0 Hz), 6.48 (s, 1H), 5.43 (t, 1H, J = 5.0 Hz), 5.35 (t, 1H, J = 5.2 Hz),

5.32 (t, 1H, J = 4.8 Hz), 4.17 (m, 3H), 3.73 (m, 1H), 3.62 (m, 1H), 2.07 (s, 3H), 2.01 (s,

3H). HRMS (FAB, 3-NBA matrix) for C19H21N2O8Cl2 (M+1): calcd, 475.0675; found,

475.0687.

21

1-(β-D-Ribofuranosyl)-4-[(3-biotinamido-1-propynyl)]pyrrole-2-carbaldehyde

5′-triphosphate (28). The protected nucleoside 26 (47 mg, 0.1 mmol) was dissolved in

pyridine and evaporated in vacuo. The residue was dissolved in pyridine (100 µl) and

dioxane (300 µl). A 1 M solution of 2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one in

dioxane (110 µl, 0.11 mmol) was added. After 10 min, aliquots of tri-n-butylamine (100 µl)

and 0.5 M bis(tributylammonium)pyrophosphate in DMF (300 µl, 0.15mmol) were quickly

added to the reaction mixture. The mixture was stirred at room temperature for 10 min. A

solution of 1% iodine in pyridine/water (98/2, v/v) (2.0 ml) was then added. After 15 min, a

5% aqueous solution (150 µl) of NaHSO3 was added. The volatile components were

removed by evaporation, and then water (5.0 ml) was added to the residue. The solution

was stirred at room temperature for 30 min, and then was treated with concentrated

ammonia (20 ml) at room temperature for 12 h. The solution was evaporated in vacuo, and

the product was purified by DEAE Sephadex (A-25) column chromatography (eluted by a

linear gradient of 50 mM to 1 M TEAB), and then by C18-HPLC (eluted by a gradient of

0% to 30% CH3CN in 100 mM triethylammonium acetate) to give the nucleoside

5′-triphosphate 27. After lyophilization, compound 27, in 0.1 M NaHCO3–Na2CO3 buffer

(5 ml, pH 8.6), was reacted with biotin-N-hydroxysuccinimide (900 µl, 0.14 M in a DMF

solution) at room temperature for 3 h. The mixture was treated with 28% NH4OH (2 ml) for

1 h. The product was purified by DEAE Sephadex (A-25) column chromatography (eluted

by a linear gradient of 50 mM to 1 M TEAB), and then by C18-HPLC (eluted by a gradient

of 0% to 30% CH3CN in 100 mM triethylammonium acetate) to give the nucleoside

5′-triphosphate 28 in a 14% yield from 26. Compound 27: ESI-MS for C13H19O14N2P3:

calcd, 519.00 (M-H)-; found, 518.98 (M-H)-. Compound 28: 1H NMR (300 MHz, D2O)

δ 9.36 (d, 1H, J = 0.9 Hz), 7.86 (s, 1H), 7.20 (d, 1H, J = 1.7 Hz), 6.44 (d, 1H, J = 4.1 Hz),

4.39-4.33 (m, 3H), 4.23-4.15 (m, 4H), 4.06 (d, 2H, J = 3.7 Hz), 3.18 (m, 1H), 3.12 (q, 24H,

J = 7.3 Hz), 2.82 (dd, 1H, J = 4.9 and 13.1 Hz), 2.60 (d, 1H, J = 13.0 Hz), 2.23 (t, 2H, J =

7.0 Hz), 1.60 (m, 4H), 1.32 (m, 2H), 1.20 (t, 36H, J = 7.3 Hz). 31P NMR (107 MHz,

D2O) δ –8.96 (d, 1P, J = 16.5 Hz), –10.67 (d, 1H, J = 20.1 Hz), –22.36 (t, 1P, J = 20.1 Hz).

ESI-MS for C23H33O16N4P3S: calcd, 745.07 (M-H)-; found, 745.07 (M-H)-. UV-vis

22

spectrum (in 10 mM sodium phosphate buffer, pH 7.0), λmax = 258 nm (ε = 1.1 × 104),

308 nm (ε = 9.5 × 103).

Referemces

11. Rosemeyer, H., & Seela, F. 171. Stereoselective synthesis of pyrrolo[2,3-d]pyrimidine α- and β-D-ribonucleosides from anomerically pure D-ribofuranosyl chlorides: solid-liquid phase-transfer glycosylation and 15N-NMR spectra. Helv. Chim. Acta 71, 1573-1585 (1988).

12. Moriyama, K., Kimoto, M., Mitsui, T., Yokoyama, S. & Hirao, I. Site-specific biotinylation of RNA molecules by transcription using unnatural base pairs. Nucleic Acids Res. 33, e129 (2005).

23

IV. Steady-state kinetics for the single-nucleotide insertion experiments with KF exo–.

A primer (20-mer) labeled with 6-carboxyfluorescein at the 5'-end was annealed with a

template (35-mer), in 100 mM Tris-HCl (pH 7.5) buffer containing 20 mM MgCl2, 2 mM

DTT, and 0.1 mg/ml bovine serum albumin. The primer-template duplex solution (10 µM,

5 µl) was mixed with 2 µl of an enzyme solution containing the exonuclease-deficient

Klenow fragment, KF exo– (Amersham USB). The mixture was incubated for more than 2

min, and then the reactions were initiated by adding each dNTP solution (3 µl) to the

duplex-enzyme mixture at 37°C. The amount of enzyme used (5–50 nM), the reaction time

(1–35 min), and the gradient concentration of dNTP (0.3–1500 µM) were adjusted to give

reaction extents of 25% or less. The reactions were quenched with 10 µl of a stop solution

(95% formamide and 20 mM EDTA), and the mixtures were immediately heated at 75°C

for 3 min. The diluted products were analyzed on an automated ABI 377 DNA sequencer

equipped with the GeneScan software (version 3.0). Relative velocities (v0) were calculated

as the extents of the reaction divided by the reaction time, and were normalized to the

enzyme concentration (20 nM) for the various enzyme concentrations used. The kinetic

parameters (KM and Vmax) were obtained from Hanes-Woolf plots of [dNTP]/v0 against

[dNTP]. The entire list of kinetic parameters can be found as Supplementary Table 1a and

1b.

24

V. Sequences of DNA fragments for the PCR, sequencing, and transcription experiments.

(The sequences of F1-F14 are presented on the next page.)

25

Sequences of chemically synthesized DNA fragments F1(91-mer) 5'-GAAATTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATACCATGGGCTCCAAGAAGCCGGTCCCCATCATN1N2N3N4N5GCAACCGC-3' F2 (81-mer) 5'-TTTCACACAGGAAACAGCTATGACCCGGGTTATTACATGCGCTGGCACTTGCCCGTACGGCGGTTGCN6N7N8N9N10ATGATGGGG-3' F3 (66-mer) 5'-GAAATTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATACCATGGGCTCCAAGAAGCC-3' F4 (47-mer) 5'-pGGTCCCCATCATN1N2N3N4N5GCAACCGCCGTACGGGCAAGACGCAGCGCG-3' F5 (61-mer) 5'-pGGGGTTCTCATCATCATCATCATCATTAATAACCCGGGTCATAGCTGTTTCCTGTGTGAAA-3' F6 (53-mer) 5'-pCCATGGTATATCTCCTTCTTAAAGTTAACCCTATAGTGAGTCGTATTAATTTC-3' F7 (50-mer) 5'-pCTTGCCCGTACGGCGGTTGCN6N7N8N9N10ATGATGGGGACCGGCTTCTTGGAGC-3' F8 (71-mer) 5'-TTTCACACAGGAAACAGCTATGACCCGGGTTATTAATGATGATGATGATGATGAGAACCCCCGCGCTGCGT-3' F9 (66-mer) 5'-GAAATTAATACGACTCACTATAGGGCCAACCAGAAGAAGGAGACAGACCAAGGGCACCAAGAAGCC-3' F10 (47-mer) 5'-pGGACCCCAACAAN1N2N3N4N5GCAACCGCCGAACGGGCAAGACGCAGCGCG-3' F11 (61-mer) 5'-pGGGGAACACAACAGCACCAACAGCACCAACAACCCGGGACAAAGCAGCAACCAGGGAGAAA-3' F12 (53-mer) 5'-pCCTTGGTCTGTCTCCTTCTTCTGGTTGGCCCTATAGTGAGTCGTATTAATTTC-3' F13 (50-mer) 5'-pCTTGCCCGTTCGGCGGTTGCN6N7N8N9N10TTGTTGGGGTCCGGCTTCTTGGTGC-3'

26

F14 (71-mer) 5'-TTTCTCCCTGGTTGCTGCTTTGTCCCGGGTTGTTGGTGCTGTTGGTGCTGTTGTGTTCCCCCGCGCTGCGT-3' Primers for sequencing and PCR Primer1 (25-mer, 5'-primer) 5'-GAAATTAATACGACTCACTATAGGG-3' Primer2 (24-mer, 3'-primer) 5'-TTTCACACAGGAAACAGCTATGAC-3'

27

VI. Dye terminator sequencing of the PCR products from DNA.

The cycle sequencing reactions (20 µl) were performed on a PTC-100 Programmable

Thermal Controller (MJ Research) with Cycle Sequencing Mix (8 µl) of BigDye

Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) containing 0.3 pmol template

and 4 pmol Primer1 or Primer2, in the presence or absence of 1 nmol dPa'TP. After 25

cycles of PCR (96°C, 10 sec; 50°C, 5 sec; 60°C, 4 min), the residual dye terminators were

removed from the reaction with CENTRI-SEP columns (Princeton Seperations), and the

solutions were dried. The residues were resuspended in a formamide solution (4 µl) and

fractionated on the ABI 377 DNA sequencer, using a 6% polyacrylamide-6 M urea gel. The

sequence data were analyzed with the Applied Biosystems PRISM sequencing analysis

v3.2 software.

PCR was performed in 20 mM Tris-HCl buffer (pH 8.8), with 10 mM KCl, 10

mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, 0.3 mM each dNTP (N = Pa, G, C, and

T) and dNTPN (N = Ds and A), 1 µM each Primer1 and Primer2, 2.3-2.4 nM

double-stranded DNA fragment (DNA1-9), and 0.04 unit/µl Vent DNA polymerase (NEB)

on the PTC-100 Controller. The PCR cycle was as follows: 94°C, 0.5 min; 45°C, 0.5 min;

65°C, 4 min. For sequencing analysis, the PCR products were purified by gel

electrophoresis (7% polyacrylamide-7 M urea gel) or filtration using Microcon YM-30

(Millipore) and Micropure-EZ (Millipore). After sequencing reactions with or without

dPa'TP, the sequences were analyzed on the ABI 377 DNA sequencer, using a 6%

polyacrylamide-6 M urea gel (see Supplementary Figs. 1 and 2).

Some DNA templates (DNA2, 4, 5, 7-9) with different sequence contexts around

the unnatural bases did not yield a clear gap on the sequencing pattern obtained in the

presence of dPa'TP. For example, in the sequencing of DNA templates (DNA2) containing

a 5'-TDsG-3'/3'-APaC-5' sequence, the resulting fragment yielded by the incorporation of

the dye-terminator A, at a position following the Pa' incorporation, showed unusual

mobility on the sequencing gel, and the peak corresponding to the A was shifted forward

(Supplementary Fig. 2a). Thus, the positions of the unnatural bases in DNA fragments

28

should be confirmed by comparing both of the peak patterns obtained from sequencing in

the presence and absence of dPa'TP.

In addition, sequencing of the original DNA fragments, DNA8 and DNA9,

containing a 5'-GDsT-3'/3'-CPaA-5' sequence, revealed unusual patterns. In the sequencing

in the presence of dPa'TP, strong peaks of the dye-terminators of dideoxy-A and -C

appeared around the unnatural base position. Similarly, in the sequencing in the absence of

dPa'TP, the peaks following the unnatural base position did not disappear, although this

phenomenon was improved by heating the sample in the PCR buffer (pH 8.8)

(Supplementary Fig. 2g) or a concentrated NH4OH solution. In spite of this abnormality,

the amplification specificity and efficiency of DNA8 and DNA9 were as high as those of

the other DNA fragments (Supplementary Fig. 2g).

29

VII. T7 transcription for 17-mer RNA fragments.

Transcription (20 µl) was performed in 40 mM Tris-HCl buffer (pH 8.0) containing 24 mM

MgCl2, 2 mM spermidine, 5 mM DTT, 0.01% Triton X-100, 1 mM each natural NTP, 0–3

mM PaTP, 0–3 mM Pa'TP, 0–3 mM DsTP, 10 mM GMP, 2 µM template, and 2.5 units/µl

T7 RNAP (Takara). For the efficiency analysis, the reactions were carried out in the

presence of 2 µCi [γ-32P]GTP (Perkin Elmer, instead of GMP). After an incubation at 37°C

for 3 h, the reactions were quenched by the addition of the dye solution. The mixtures were

heated at 75°C for 3 min, and were loaded onto a 15–20% polyacrylamide–7 M urea gel.

The products on the gels were analyzed with a bio-imaging analyzer (BAS2500, Fuji Film).

For the nucleotide-composition analysis, transcripts were internally labeled with

0.1 µCi/µl [α-32P]UTP or [α-32P]ATP (Amersham). The transcripts were digested by 0.75

unit of RNase T2 at 37°C for 2 h, in 10 µl of 15 mM sodium acetate buffer (pH 4.5) with

0.05 A260 unit of E. coli tRNA (Sigma). The digestion products were analyzed by 2D-TLC

(HPTLC plate, 100 x 100 mm, Merck) with the following developing solvents: isobutyric

acid-ammonia-water (66:1:33 v/v/v) for the first dimension, and isopropyl

alcohol-HCl-water (70:15:15 v/v/v or 75:15:10 v/v/v for Pa'-transcripts) for the second

dimension. The spots on the TLC plates were analyzed with a bio-imaging analyzer,

BAS2500 (Fuji Film) (see Supplementary Fig. 3 and Table 2).

30

VIII. Selectivity of the Ds–Pa pair in transcription.

In the nucleotide-composition analysis of the 17-mer transcripts, 1% of the total

misincorporation rate in the transcripts can be detected, and thus, the misincorporation of

Pa or Ds opposite the natural bases corresponded to less than 0.25% per position on average,

as determined by the formula: (the Pa or Ds composition) / [(total numbers of nucleotides at

5' neighbor of A or U) = 4].

By using transcripts with a long chain length, small amounts of misincorporation

can be detected. Thus, the analysis of the biotinylated 152-mer transcripts is more useful for

detecting the subtle misincorporation of the unnatural substrate, Bio-PaTP, opposite the

natural bases. The average misincorporation rates per position were determined by using

the formula: y = [1-(1-0.01x)152]×100, where y is the yield (%) of the complex of the

biotinylated transcripts with streptavidin (nearly equal to the percent of the total Bio-Pa

misincorporation) and x is the misincorporation rate (%) per position. For example, when

the misincorporation (x) is 0.25%, the mobility-shifted band yield (y) corresponds to 31%.

31