Supporting InformationLisse et al. 10.1073/pnas.1525096113SI Materials and MethodsZebrafish Husbandry. Zebrafish (AB, Nacre, and Tg(isl2b:GFP)](21) were maintained according to established NIH protocolsand handled in strict agreement with good animal practice asapproved by the appropriate committee [MDI Biological Labo-ratory Animal Core IACUC (Institutional Animal Care and UseCommittee) Numbers 13–20]. Embryos and larvae were kept ona 14:10 h light/dark cycle at 28.5 °C and maintained in Ringerssolution (fish water; pH 7.2). Nacre fish were used for gener-ation of the transgenic Tg(krt4:Gal4_tdTomato_5xUAS_HyPer-cyto), Tg(tp63:dsRed), and Tg(tp63:CAAX-GFP) lines. MS-222(1.3 mM) and 2-Penoxyethanol (0.1%, 1:1,000) were used as an-esthetics, whereas 0.2% 2-Penoxyethanol was used for euthanasia.Nacre fish (age 9–12 mo) were used for adult experiments, exceptin Fig. S8 (comparison of vehicle controls, paclitaxel, paclitaxel +CL-82198 and CL-82198 alone) for which the isl2b:GFP strain(∼20 mo) (Tu/Longfin background) was used. The DRG neuronsin this strain are nonfluorescent during adult stages due to in-activation of the transgene by ∼4 dpf. In larvae, Rohon bearneurons in the isl2b:GFP strain were analyzed for axon de-generation and touch response. isl2b:GFP, Nacre, or AB strainswere used for larval skin experiments and axon regenerationstudies.

Chemical Inhibitors. Paclitaxel was kept as 5.8 mM stock in DMSOand diluted to either 10 μM in PBS for injections or 22 μM inRingers for incubations. The MMP-13 inhibitors CL-82198 hy-drochloride (TOCRIS) and DB04760 (sc-205756, Santa CruzBiotechnology) were kept as 10 mM stock solutions in DMSO at–20 °C and diluted to 10 μM before use. Control solutions weresupplemented with equal volumes of DMSO (vehicle). DPI andApocynin were kept as 50 and 100 mM DMSO stocks, re-spectively (TOCRIS), and diluted to 1:1,000 before use.

Zebrafish Drug Treatments, Microinjections, and Mechanical StressAssay.Drug incubations.Larvae were incubated for either 3 or 96 h startingat 2 dpf to assess axon degeneration, touch response, MMP-13expression, and tubulin tracker colocalizations. At 3 dpf, larvaewere incubated in drugs at indicated concentrations to analyzeaxon regeneration and wound repair.Microinjections. We injected 3–6 nl 10 μM paclitaxel into thecardinal vein of zebrafish larvae on 3 consecutive days (2, 3, and4 dpf), using a pulled glass capillary, and 4 μL was injected intoadult fish using a 33-gauge Hamilton syringe.Tubulin tracker injections. Oregon Green 488 bis-acetate (10 μM;Life Technologies) was injected into the cardinal vein of 2 dpfTg(tp63:dsRed) larval fish, or into transiently injected or transgenicCREST3:Gal4_5xUAS-tdTomato fish, followed by immediate time-lapse imaging for 12 h, with z stacks recorded every 20 min.Adult injections. Adult zebrafish between the ages of 9 and 12 mowere injected once daily with 0.09–0.113 mg/kg paclitaxel (or∼87–97 μg/m2) on 4 consecutive days using a 33-gauge Hamiltonsyringe. This equates to 3 μL of a 10-μM solution for fish with∼200 mg body weight (small size), 4 μL for fish with ∼350 mgbody weight (medium size), and 5 μL for fish with ∼500 mg bodyweight (large size).Wounding assay. For puncture wounding and amputations, larvaewere anesthetized and placed sideward onto an agarose-coatedplate. Caudal fin amputations were performed with a 23-gaugesyringe needle. Puncture wounds were introduced using a pulledglass capillary needle that created 20–50-μm-diameter wounds.

NF-κB studies. At 3 dpf, NF-κB reporter larvae were preincubatedin either vehicle, diphenyleneiodonium, or Apocynin for 2 hbefore imaging and maintained in the drug during time-lapserecordings. Mechanical stress assays were performed immedi-ately before mounting larvae for imaging.ROS detection. ROS was detected in 3-dpf larvae using 4 μmpentafluorobenzenesulfonyl-fluorescein. Following incubation for1 h, animals were stressed (sometimes leading to injury), washedthree times, and immediately imaged on an Olympus FV1000confocal microscope.MMP-13 stress assays. Stress assays were performed at 2 dpf eitheron larvae injected at the one-cell stage with ∼160 pg mmp13amRNA or on wild-type larvae treated for 2 h with 22 μM pac-litaxel and 10 μM of each MMP-13 inhibitor. Larvae were pre-examined for absence of skin phenotypes and pipetted up anddown three times using a glass Pasteur pipette. Skin phenotypes,including rupturing of the tail fin and yolk, were assessed under astereomicroscope.Membrane staining.Fixed caudal fins of injected adult animals wereincubated in 1 μM BodipyFL C5-Ceramide (Molecular Probes)overnight at 4 °C in the dark. Fins were subsequently washedthree times in PBS before imaging.

Behavioral Assays.Larval touch response assay.Zebrafish larvae were stimulated with acapped microloader pipette tip at the distal caudal fin or theanterolateral yolk region either 4 h before microinjection, duringincubations, or during recovery, as indicated in Fig. 2A. Thenumber of stimuli was counted until the larvae responded to orescaped from the stimulus.Adult touch response assay. The touch response in adult fish wasassessed before injection and during recovery, as indicated in Fig.1A. Two measurement methods were used: (i) Fish were mildlyanesthetized in 1:2,000 2-Phenoxyethanol for 5 min until calmand then placed into the slit of a moist sponge. The distal caudalfin was touched with forceps until a twitching response of the fishwas observed. (ii) Unanesthetized fish were placed on a moistmicroscope glass plate and loosely covered in moist plastic foil.Animals remained under the foil until calm, and the analysis wasperformed only if the fish remained without movement for 15 s.An insect pin was subsequently dragged along the outer edges ofthe distal caudal fin from dorsal to ventral or ventral to dorsaluntil a twitching response of the fish was observed. The numberof stimuli until a response was triggered was counted. Eachmeasurement was repeated at least once to account for randommovement, and the average was taken for statistical analysis.Typically the duplicate numbers were similar, suggesting a spe-cific response to the stimulus. The second procedure was usedfor validating the method in which fish were slightly anes-thetized, as slight anesthesia was variable among fish. The dataof both procedures were combined, as we did not notice signif-icant differences.Locomotor behavior. The automated tracking system ZebraLab(ViewPoint, France) was used according to the manufacturer’sguidelines to track the swimming distances of fish over thecourse of 1 h. Larval fish were placed individually into each wellof a 24-well plate. Alternatively, up to 10 adult fish per sessionwere traced individually in glass jars. Adult fish were trackedbefore injections.

RNA Isolation and qRT-PCR. Ten to twenty larvae per group in threebiological replicates at age 2 dpf were pooled and homogenized in

Lisse et al. www.pnas.org/cgi/content/short/1525096113 1 of 11

TRIzol (Life Technologies) following 3 h of incubation in 22 μMpaclitaxel or 0.5% DMSO vehicle. Total RNA extractions wereperformed according to standard phenol-chloroform extractionprotocols. RNA was reverse-transcribed using SuperScript III re-verse transcriptase (Invitrogen) and mixed oligo dT and randomhexamer primers. qPCR was used to quantify endogenousmmp13aexpression. Gene expression was normalized with zebrafish S18rRNA and analyzed using the comparative CT Livak method usingBrilliant II SYBR Green qPCR Master Mix (Agilent).

Generation of Transgenes and Transgenic Zebrafish Lines. The krt4:HyPer expression vector was assembled using a two-way (Janus)expression system. For cloning, pHyPer-cyto (Evrogen) was di-gested with AflII and EcoRV and cloned into the multiplecloning site of a de novo assembled expression construct con-taining the krt4 promoter (courtesy of Gromoslav Smolen,Harvard University, Cambridge, MA), a Gal4VP16 cassette, 3′-tdTomato-5′, 5xUAS, and a 5′–multiple cloning site–3′ site. Thisconstruct is flanked by Tol2 (transposon) sites. We coinjected15–30 pg plasmid with 300 pg Tol2 transposase mRNA into one-cell stage embryos to generate transgenic animals. F2 transgenicTg(krt4:Gal4VP16_tdTom-5xUAS-HyPer)SR12015 were used foranalysis. The tp63:CAAX-GFP cassette was assembled by di-gesting pT2KXIG_tp63:GFP (courtesy of Gromek Smolen, Har-vard University, Cambridge, MA) with NotI and BamHI andinserting PCR-amplified CAAX-GFP [courtesy of Chi-Bin Chien,formerly University of Utah, Salt Lake City (deceased)] usingprimers with matched restriction sites. We coinjected 15 pg ofplasmid with 300 pg Tol2 transposase mRNA into one-cell stageembryos to generate transgenic animals. F3 transgenic Tg(tp63:CAAX-GFP)SR22015 were used for the wound healing analysis andadult immunohistochemistry. CREST3 was previously generatedas CREST3:Gal4VP16-14xUAS cassette (29) using the gatewaysystem. To assemble Tg(CREST3:Gal4_14xUAS_tdTomato) us-ing this system, a pDONR vector P2R-P3 harboring tdTomato wasgenerated and individual pDONR vectors containing CREST3,Gal4VP16-14xUAS, and tdTomato were recombined with apDEST (Tol2) vector (courtesy of Chi-Bin Chien). For cloning ofmmp13a cDNA, total RNA from 3-dpf zebrafish of the AB strainwas isolated using TRIzol (Thermofisher) extraction. cDNA wasprepared using an oligo-dT and random hexamer primer mix. Theprimers for mmp13a amplification were designed to include the 5′and 3′ untranslated regions. Primers were used as follows: for-ward, 5′ ATCAGTTTCTTGAAGGAGAAGGAA 3′; reverse, 5′TCAAATTGCTCAAACCTTTATTCAAAATTGCAT 3′. Fol-lowing amplification with Advantage 2 Taq DNA Polymerase(Clontech), the amplicon was ligated into pCR2.1 TOPO (LifeTechnologies), and a size check was performed with EcoRI,followed by DNA quality check via sequencing. The mmp13a(mmp13aΔ373) deletion variant was generated by digestingpCR2.1TOPO:mmp13a (AB strain) with ClaI/StuI, followed byKlenow treatment and religation. Religation led to incorporationof a stop codon at position 348 bp that leads to a frame shift at theN terminus of the zinc-binding active site and subsequent deletionof the C-terminal 373 amino acids.

Messenger RNA Synthesis. The mmp13a wild-type and deletionplasmids were linearized with Acc65I, and the T7 MessageMachine kit (Ambion) was used to synthesize capped mRNA.Messenger RNA synthesis was followed by DNase treatment andpurification using the RNAeasy Miniprep kit (QIAGEN). Bandswere checked on an agarose gel with sizes expected to be 1.65 kbfor the full-length and 0.9 kb for the deletion construct.

Immunofluorescence Staining. Acetylated tubulin (1:1,500; Sigma-Aldrich) and Neurofilament (1:100; Sigma-Aldrich) staining wasperformed in Nacre and isl2b:GFP (nonfluorescent adult) fish.Fins were fixed either 1 (day 5) or 10 d (day 14) after the last

injection using 2% (wt/vol) paraformaldehyde (PFA)/PBS forlarvae and 4% (wt/vol) PFA/PBS for adult fish. Fish were in-cubated at 4 °C overnight or at room temperature for 4 h. Thiswas followed by three washes in PBS/0.05% Tween/1% DMSO/1% Triton X-100 for 15min. Some of the fins were cleared intissue clearing reagent (ScaleView, Olympus) by incubation for 2wk at 4 °C, rocking, before immunohistochemistry, but the im-aging was not significantly different from uncleared Nacre fins.Fins were dehydrated using a methanol series [25%, 50%, 75%,and 2× 100% (vol/vol)] and kept at –20 °C overnight in 20 mLglass vials. Methanol was replaced with ice-cold acetone, and finswere incubated for 7 min at –20 °C, followed by two washes inddH2O for 1 min. The fins were then washed 3× in TBS/0.05%Tween/1% DMSO/1% Triton X-100 (TBSTDT) for 10 min.Rehydrated fins were blocked in 10% (vol/vol) goat serum/TBSTDT for 1 h at room temperature, followed by overnightantibody incubation in 2-mL tubes at 4 °C on a rotator. Nextmorning, fins were transferred to six-well plates and washed 8–10times for 30–40 min each in TBSTDT, followed by overnightincubation in goat anti-mouse FITC or Alexa633 secondary an-tibody (1:1,500) in 2-mL tubes. The fins were transferred back tosix-well plates in the morning and washed 3–5 times in TBS/0.05%Tween, followed by mounting in 1.2% (wt/vol) low-meltagarose and imaging on a FV1000 Olympus confocal micro-scope. For MMP-13 detection, a 1:200 dilution of polyclonalanti–MMP-13 Hinge antibody (AnaSpec, USA) was used inNacre fish. A 1:500 dilution of a mouse anti-RFP antibody(ThermoFisher) was used to detect dsRed-expressing keratino-cytes in larval fish. A 1:1,500 dilution of goat anti-rabbit Cy-2 (Ab-Cam) and 1:1,000 goat anti-mouse AlexaFluor 633 was used forsecondary detection, respectively. During secondary antibody incu-bations, specimens were cotreated with 0.5 μg/mL DAPI or Hoechst33342 for nuclear staining. For longer storage, specimens were fixedin 4% PFA for 20 min at room temperature to preserve the fluo-rescence, followed by three washes in PBS/Tween-20 and storage at4 °C. For detection of tp63-positive basal cells in adult fish, we useda membrane-tagged transgenic line that was generated in our lab-oratory, Tg(tp63:CAAX-GFP)SR22015, in which GFP anchors to theplasma membrane via the CAAX motif.

Western Blot Analysis of MMP-13. Pools of 10 larvae at 2 dpf in twobiological replicates incubated in either 0.27% DMSO/Ringersvehicle solution or 22 μM paclitaxel for 3 h were collected forprotein extraction in RIPA buffer, containing 1× protease in-hibitor mixture (Promega). The anti-MMP13 Hinge antibody(AnaSpec) was used at a 1:1,000 dilution for primary and goatanti-rabbit-HRP (AnaSpec) at 1:5,000 for secondary detection.

TUNEL Staining. TUNEL staining was performed using the In SituCell Death Detection Kit with Fluorescein (Roche), according tothe manufacturer’s manual. Micrococcal nuclease (New EnglandBiolabs) was used as a positive control. Negative controls did notcontain labeling mix. Briefly, animals were treated for either 3 or96 h with either vehicle (0.05%DMSO/Ringers) or paclitaxel (22 μM)and fixed overnight in 2% PFA/PBS at 4 °C. Larvae were washedthree times in PBS/0.1%Tween. A reaction mixture of 25 μLTUNEL enzyme solution [terminal deoxynucleotidyl transferasefrom calf thymus (EC 2.7.7.31), recombinant in Escherichia coli, instorage buffer, 10× concentration) and 225 μL label solution(nucleotide mixture in reaction buffer, 1× concentration) wasprepared. Larvae were incubated in the reaction solution in thedark at 37 °C for 1 h. Larvae were washed three times in PBS/0.1%Tween and imaged on an Olympus FV1000 confocal microscope.

Scanning Electron Microscopy. Zebrafish larvae (3 dpf) pretreatedfor 3 h either with 0.27% DMSO/Ringers vehicle solution(matched DMSO volume), 22 μM paclitaxel, or 22 μM paclitaxeland either CL82198 or DB04760 (10 μM each) were fixed in 2%

Lisse et al. www.pnas.org/cgi/content/short/1525096113 2 of 11

PFA/2% (wt/vol) glutaraldehyde, 70 mM NaH2PO4, 3% (wt/vol)sucrose for 16 h at 4 °C, rocking. The specimens were washedthree times in 0.1 M cacodylate buffer, pH 7.4, for 10 min eachand postfixed for 3 h with 2% (wt/vol) OsO4, followed by 4–5rinses in deionized water. The specimens were then treated with1% thiocarbodydiazide for 30 min, washed 4–5 times in de-ionized water, and refixed in 1% OsO4, followed by 4–5 washesin deionized water. This was followed by dehydration in 25%,40%, 60%, 80%, 95%, and 100% (vol/vol) ethanol, performingthree washes for 10 min between each step. After drying withhexamethyldisilazane two times for 5 min, the specimens weremounted on an aluminum stub with carbon tape and coated withgold/palladium. Images were collected at 20 kV on a Hitachi S-3000N scanning electron microscope.

Skin Barrier Assay. Transgenic Tg(krt4:Gal4_tdTomato_5xUAS_HyPer-cyto) larvae at 3 dpf were pretreated with vehicle(0.27% DMSO), paclitaxel (22 μM), paclitaxel (22 μM), andCL82198 or CL82198 alone for 3 h. HyPer fluorescence wasimaged in 3-dpf larvae using 405/488 and 505/555 nm filter set-tings and a 20×/0.5 N.A. objective, using the following settings:1.2× zoom, 970-ms scan speed, pinhole setting to 800 airy unitsand 320 × 320 pixels. We recorded 4-μm sections every 3 min for30 min in up to four animals per session. Exogenous H2O2(0.01%) was added after 30 min, and imaging was continued for60 min. For HyPer quantifications, images were background-subtracted in Imaris 7.7.1 (Bitplane), and fluorescent cells weredetected using the Spots function. Subsequently, the “IntensityProfile” of the Imaris MatLab feature was used to calculate theintensities in each channel. The 488/405 ratios were calculated inExcel. Images shown in Fig. 6 were generated in ImageJ usingthe Image Calculator “Division” function to divide 488/405channels. The tiff images were subsequently processed in theZeiss ZEN software for pseudocoloring using the spectrum scale.

Human Keratinocyte (HEK001) Differentiation and Scratch WoundAssay. HPV-16–transformed human epidermal keratinocytes(HEK001; ATTC, CRL-2404) were maintained in keratinocyte-serum free (KSF) medium (Gibco-Brl, 17005–042) supple-mented with 5 ng/mL human recombinant EGF, low CaCl2 (0.06mM), and 2 mM L-glutamine (without bovine pituitary extract).Cells were incubated with 8% CO2 and 92% humidified atmo-sphere at 34 °C and seeded (4 × 104 cells/cm2) in tissue cultureplates precoated with type I collagen (Gibco-Brl, R-011-K). Forscratch analyses, cells were cultured in glass-bottom 12-wellplates (MatTek Corporation, P12G-1.5–14-F). Cells were grownto confluence, replaced with EGF-minus media for 12 h, andrefreshed with complete media, and 10-μL pipette tips were usedto make vertical scratches along the surface of the wells. Wellswere immediately washed with PBS to avoid replating of dis-associated cells. Scratch wound repair was documented at indicatedtimes using confocal imaging. For drug treatments, HEK001s werepretreated for 2 h with 1 μM of the H2O2-selective sensor penta-fluorobenzenesulfonyl-fluorescein (Cayman Chemical, 10005983)or with 0.1–10 μM paclitaxel, CL-82198, and DB04760.

Zebrafish Imaging. Zebrafish larvae were mounted as described inref. 62. For time-lapse imaging, 10–20 larvae per session wereimaged either on a FV1000 (Olympus) or Zeiss LSM510 con-focal microscope with a motorized stage for up to 12 h persession (20× objective, 0.75 N.A.). Stacks were projected intosingle images and processed in Imaris (Bitplane) or ImageJ.Movies were assembled in QuickTime Pro-7. Images of Tg(isl2b:GFP) larva (Fig. 2B), and larvae used for TUNEL staining (Fig.S3) were assembled from multiple single projected image stacksfollowing confocal imaging.

Quantifications.Axon branch density. The axon branch density in the caudal fin wasquantified in Imaris (Bitplane) using the Manual FilamentStructure Creation option and Autopath in the Draw menu of theFilament Tracer module. Branch starting points were determinedand automatically traced within defined grids, as indicated ingraphs, and then the average branch number was determined bycounting axon branches either in proximal or distal segments(distal–dorsal and distal–ventral). For distal segments, 12 gridsper image were counted that were located 300 μm away from theedge of the fin, as this region was defined to be most represen-tative of differences between paclitaxel and vehicle controls. Thedata were presented as axon branch density per 50 μm3 in larvaland 100 μm3 in adult quantifications, except for neurofilament(NF160) staining in which the branch density was determined ina 50-μm3 region. The average nerve diameter [thickness of axonbundles (depicted as nerve diameter in graph) projecting alongthe bony rays] was determined in the distal caudal fin of fishstained for NF160 using the pairwise “Measurement” tool inImaris. The analysis was performed on three axon bundles ineach of two images per fish in a total of five fish per group. Tofurther determine the surface area occupied by axons in thedistal caudal fin of NF160-stained fish, images were processed inFiji using background subtraction, conversion into binary images,and edge detection.Clearance of axon debris. Clearance was determined for each severedbranch by measuring the time between fragmentation onset and dis-appearance of the last fragment. Only axons in which fragmentationonset could be visualized following immediate imaging after amputationwere quantified. The clearance rate was assessed in 30-min intervals.Growth and retraction measurement. Growth and retraction weredetermined in larvae treated for 3 h either with vehicle or pac-litaxel (22 μM). Images were aligned with the StackReg plugin inFiji, followed by tracking of branch tips using the ManualTracking tool and “Directionality” feature.Fluorescence intensity measurements. The z stacks were loaded intoImaris, background-subtracted, and fluorescent cells were detectedusing the Spots function. Fluorescence intensities were determinedusing the Intensity Profile in the Imaris Matlab feature.Wound size quantifications. Puncture wounds were quantified intransgenic Tg(tp63:CAAX-GFP) zebrafish larvae to outline thewound. The average wound diameter using the longest extensionwas determined using the Imaris Measurement tool.Fin diameter. Fin diameters were measured at the region of thedistal notochord from the dorsal to ventral extent.Length–width ratio (LWR). Two perpendicular measurements of cellsin which the plasma membrane had been stained with BODIPYFL C5-ceramide (ThermoFisher Scientific) were taken in Imarisusing the Measurement tool. The average LWRs for each treatmentgroup were calculated.3D rendering. Image stacks were loaded into Imaris and back-ground-subtracted, and surfaces in each channel were detectedwith the Surface function. Channels were merged, and rotatingimages were recorded using the Animation tool.

Statistical Analyses. Statistical comparisons were made using Prism5 software (GraphPad). The unpaired Student’s t test with a 95%confidence interval was used to compare the means of two un-matched groups, assuming that the values followed a Gaussian dis-tribution. For multiple comparison tests of three or more groups,one or two-way ANOVA at an alpha = 0.05 (95% confidence in-terval) and Tukey’s multiple comparison posttesting was used tocompare the means of each column. Significance is denoted withasterisks: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. As-terisks above columns depict comparisons to the control column,and brackets indicate alternative comparisons. The number of bi-ological replicates is expressed as n in each figure legend, followedby the number of fish per replicate and group.

Lisse et al. www.pnas.org/cgi/content/short/1525096113 3 of 11

Fig. S1. Neurofilament (NF160) staining in adult zebrafish shows decreased axon branch density after paclitaxel injection. (A) Neurofilament (NF160) im-munofluorescence staining on day 5 in adult caudal fins following four vehicle or 10-μM paclitaxel injections shows decreased staining of the fine cutaneousaxon branches and thick axon bundles along the bony rays. (Scale bar, 100 μm.) (B) Binary images to demonstrate loss of axons in thick axon bundles along thebony rays (arrows). (C and D) Quantification of axon branch density (C), diameter of axon bundles projecting along the bony rays (D), and axonal surface area(E) (five fish per group).

Fig. S2. Paclitaxel incubation decreases caudal fin size. Caudal fin diameter (measured at the level of the notochord from dorsal to ventral) as a function ofage demonstrates a slightly reduced size when larvae are incubated in paclitaxel as opposed to DMSO vehicle. *P < 0.05, **P < 0.01.

Fig. S3. Paclitaxel treatment does not increase apoptosis in larval fish. (A and B) Image assemblies of TUNEL staining in vehicle (A) and paclitaxel (B)-treatedlarvae following 3 h (Top panels) and 96 h (Bottom panels) of incubation in either DMSO/Ringers solution or paclitaxel. DMSO-treated controls have slightlyincreased apoptosis compared with paclitaxel-treated larvae. (C) Positive control pretreated with micrococcal nuclease shows ubiquitous staining. (D) Negativecontrol without labeling reagent. (E) Quantification of average apoptotic cell number in 50 μm3 within caudal fins shows a slight (but not significant) increasein apoptosis in DMSO/vehicle controls (six fish per group). (Scale bar, 200 μm.)

Lisse et al. www.pnas.org/cgi/content/short/1525096113 4 of 11

Fig. S4. Altered caudal fin morphology following paclitaxel injection into larval fish at 2 dpf. (A) Morphological changes (arrows) in the fin fold 1 h afterinjection with 10 μM paclitaxel (see also Inset showing a higher magnification). (B) Fin damage (arrows) 3 h after paclitaxel injection. (C) Vehicle controls withundamaged fins 4 h postinjection. (Scale bar, 200 μm.) hpinj, hours postinjection.

Fig. S5. Altered caudal fin morphology following paclitaxel injections into adult fish. (A) The skin of the distal caudal fin in adult fish injected with 10 μMpaclitaxel appears disorganized on day 5 compared with vehicle controls when assessed with Bodipy Ceramide staining to outline cellular morphologies. Insetsshow higher magnifications of cells. Lines depict the length and width of cells as quantified in B. (B) The LWR is decreased after paclitaxel injection, suggestingthat cells are more rounded (five fish per group). (Scale bar, 50 μm.) ****P < 0.0001. Pctx, paclitaxel.

Lisse et al. www.pnas.org/cgi/content/short/1525096113 5 of 11

Fig. S6. NF-κB activation in keratinocytes. (A) NF-κB activity (green) detected in keratinocytes of a transgenic Tg(NF-κB:EGFP) reporter line that mosaicallyexpresses krt4:dsRed in keratinocytes. (Scale bar, 20 μm.) (B) Cell types present within the caudal fin of a 3-dpf zebrafish larva using transmission electronmicroscopy. The caudal fin consists of three skin layers: the outer periderm (P, also known as enveloping layer, yellow), the inner basal cell layer (B, marked ingreen), and the mesenchymal cell layer (M) with actinotrichia (A). RB sensory axons are located between basal cells and periderm (not visible in this image).

Fig. S7. Touch response in larval zebrafish treated with CL82198 and DB04760. Larvae incubated for 96 h in vehicle, CL82198, or DB04760 alone show nosignificant difference in the touch response after stimulation at either the distal caudal fin or the anterior yolk/head region with a pipette tip (12 fishper group).

Lisse et al. www.pnas.org/cgi/content/short/1525096113 6 of 11

Fig. S8. Axon branch density and touch response in adult Tg(isl2b:GFP) fish. (A) Axon branch density in the distal caudal fin of adult Tg(isl2b:GFP) fish assessed1 d after the last injection with anti-acetylated tubulin staining. Axon branch density of paclitaxel + CL82198 or CL82198 alone is similar to vehicle controls,whereas paclitaxel injections significantly reduce the number of axons. Note that the GFP transgene is not expressed in adult transgenic fish, and the overallaxon branch density is lower compared with the Nacre background (6–7 fish per group). (B) The touch response in Tg(isl2b:GFP) fish is rescued upon co-administration of CL82198 (6–7 fish per group). ****P < 0.0001.

Fig. S9. MMP-13 overexpression and rescue of skin phenotypes by MMP-13 inhibition. (A) In the left gel image, RT-PCR for detection of wild-type andnonfunctional mmp13aΔ373 mRNA in which 709 bp are deleted. Both samples contain endogenous mmp13a mRNA. The cDNA was prepared from pools of 15larvae at 6 h postfertilization (hpf). In the right gel image, mmp13a was amplified from 2-dpf larvae and from an mmp13a-containing plasmid, serving aspositive control. (B) Scheme of MMP-13 structural domains and deletion inmmp13aΔ373. (C) Altered fin morphology induced by paclitaxel incubation is rescuedupon coadministration of DB04760 for either 3 or 96 h, as assessed by scanning electron microscopy. (Scale bar, 25 μm.)

Lisse et al. www.pnas.org/cgi/content/short/1525096113 7 of 11

Fig. S10. Paclitaxel impairs skin wound repair. (A and B) Rapid repair of a puncture wound (dashed circles) in a vehicle-treated transgenic Tg(tp63:CAAX-GFP)zebrafish larva (A). The puncture wound is retained in a larva incubated in 22 μM paclitaxel (B). Animals were preincubated in 22 μM vehicle or paclitaxel for3 h, injured, and retained in the treatment solution for 12 h. (Scale bar, 20 μm.) (C) Quantification of wound diameter over 12 h shows rescue of wound repairwith MMP-13 inhibitors (n = 2, 4–5 larvae per group). (D, D’, and D’’) Scratch wounding of HEK001 human keratinocytes shows ROS/H2O2 formation at thescratch wound margin of vehicle (yellow arrows, D) but not paclitaxel-treated cells (D’ and D’’). (Scale bar, 50 μm.) (E and E’) ROS/H2O2 formation is present invehicle (E) and paclitaxel-treated HEK001 cells (E’) after 12 h. (Scale bar, 50 μm.) (F and F’) Healed scratch in vehicle (F) but not paclitaxel-treated wells (F’) after24 h. (G) ROS/H2O2 fluorescence intensity measured from the scratch margin 1 h postscratch (hps). (Scale bar, 100 μm.) (H) HEK001 scratch wound gap size overtime (n = 5; ***P < 0.001). (I) HEK001 gap closure distance at 12 hps following Pctx + CL-82198 or CL-82198 alone administration. (J) HEK001 gap closuredistance at 18 hps following Pctx + DB04760 or DB04760 alone administration. (K) Still images (Eosin) of HEK001 cells from J. Insets on the right of each imageshow higher magnifications of highlighted boxes. Control cells at the scratch margin show decreased cell–cell adhesion and formation of lamellipodia at theleading (migratory) edge, which is absent in paclitaxel-treated cells and rescued with DB04760. DB04760 alone increases the number of cells with lamellipodiaformation. (Scale bar, 20 μm.) *P < 0.05, **P < 0.01, ***P < 0.001. a.u., arbitrary units; CL, CL-82198; DB, DB04760; hpp, hours postpuncture; hps, hourspostscratch; mpp, minutes postpuncture; Pactx, paclitaxel; SC, scratch.

Lisse et al. www.pnas.org/cgi/content/short/1525096113 8 of 11

Movie S1. Caudal fin of vehicle control is innervated by DRG axons. Shown are axons in the distal caudal fin of an adult zebrafish on day 5 (1 d after the lastinjection), which were partially traced. Axons were stained for acetylated tubulin.

Movie S1

Movie S2. Caudal fin of paclitaxel-injected fish is largely denervated. Shown are axons in the distal caudal fin of an adult zebrafish on day 5 (1 d after the lastinjection), after four paclitaxel injections. Traces reveal widespread denervation. Axons were stained for acetylated tubulin.

Movie S2

Movie S3. Tubulin tracker does not colocalize with cutaneous axons in 2-dpf larva. Shown are three timelapse sequences of 12 h each, starting 20 min aftertubulin tracker injection into a larva transiently expressing CREST3:Gal4UAS_tdTomato, with z stacks recorded every 20 min. (Sequence 1) Bright field image,axons (red) and tubulin tracker (green). (Sequence 2) Tubulin tracker alone. (Sequence 3) Axons (red) and tubulin tracker (green). (Sequence 4) CREST3:tdTomato. Axons do not colocalize with tubulin tracker.

Movie S3

Lisse et al. www.pnas.org/cgi/content/short/1525096113 9 of 11

Movie S4. Tubulin tracker colocalizes with basal keratinocytes in 2-dpf larva. Shown are three timelapse sequences of 12 h each starting 20 min after tubulintracker injection into a transgenic Tg(tp63:dsRed) larva in which basal keratinocytes are fluorescently labeled. The z stacks were recorded every 20 min.(Sequence 1) Bright field, basal keratinocytes (red) and tubulin tracker (green). (Sequence 2) Tubulin tracker. (Sequence 3) Basal keratinocytes (red) and tubulintracker (green). (Sequence 4) p63:dsRed. Note the red fluorescent cells at the distal edges colocalize with tubulin tracker.

Movie S4

Movie S5. Cutaneous axon regeneration in 3-dpf vehicle control larva. Caudal fin amputation in a larva treated for 3 h with 0.5% DMSO/Ringers induces axonregeneration. Shown is a 12-h time-lapse sequence with individually recorded z stacks, which were projected into a single plane, every 30 min. One cutaneousaxon of a Rohon-beard neuron with multiple branches is fluorescently labeled following transient injection of CREST3:Gal4_UAS:GFP into one-cell stageembryos. The second sequence shows regenerating axons that were manually traced in Fiji.

Movie S5

Movie S6. Cutaneous axon regeneration is impaired in 3-dpf larva treated with paclitaxel. Treatment for 3 h with 22 μM paclitaxel impairs axon regeneration.Shown is a time-lapse sequence with individually recorded z stacks, which were projected into a single plane, every 30 min. One cutaneous axon of a Rohon-beard neuron with multiple branches is fluorescently labeled following transient injection of CREST3:Gal4_UAS:GFP into one-cell stage embryos. The secondsequence shows regenerating axons that were manually traced in Fiji.

Movie S6

Lisse et al. www.pnas.org/cgi/content/short/1525096113 10 of 11

Movie S7. Impaired axon regeneration is partially rescued with DB04760. Treatment for 3 h with 22 μM paclitaxel and 10 μM DB04760 partially rescuesimpaired axon regeneration. Shown is a time-lapse sequence with individually recorded z stacks, which were projected into a single plane, every 30 min. Onecutaneous axon of a Rohon-beard neuron with multiple branches is fluorescently labeled following transient injection of CREST3:Gal4_UAS:GFP into one-cellstage embryos. The second sequence shows regenerating axons that were manually traced in Fiji.

Movie S7

Movie S8. MMP-13 colocalizes with keratinocytes. 3D rendering of a mosaically labeled keratinocyte (red) and MMP-13 (green) following immunofluores-cence staining in a zebrafish larva treated for 3 h with 22 μM paclitaxel. (Scale bar, 10 μm.)

Movie S8

Movie S9. MMP-13 expression is absent from cutaneous axons. 3D rendering of cutaneous axons stained for acetylated tubulin (green) and MMP-13 (red) in azebrafish larva treated for 3 h with 22 μM paclitaxel.

Movie S9

Lisse et al. www.pnas.org/cgi/content/short/1525096113 11 of 11