Originally published 3 December 2009; Revised 12 January 2010

www.sciencemag.org/cgi/content/full/science.1180278/DC1

Supporting Online Material for

Targeted 3′ Processing of Antisense Transcripts Triggers Arabidopsis FLC Chromatin Silencing

Fuquan Liu, Sebastian Marquardt, Clare Lister, Szymon Swiezewski, Caroline Dean*

*To whom correspondence should be addressed. E-mail: caroline.dean@bbsrc.ac.uk

Published 3 December 2009 on Science Express

DOI: 10.1126/science.1180278

This PDF file includes

Materials and Methods SOM Text Figs. S1 to S11 Table S1 References

Revision 12 January 2010: The corrected SOM contains figure numbers on the respective figures. No other changes have been made.

Material and Methods:

Genetic materials: The parental C2 line was generated by crossing Ler containing the 35S::FCAγ transgene, (over-expressing FCA) (1), to Ler containing transgenic FRI and FLC::LUC (2). We ensured that the three transgenes in C2 were homozygous before using the line for mutagenesis. A line (gvF) was generated in the Col background containing the same three transgenes, at the same genomic location, by crossing and then backcrossing the C2 parental line nine times to the Col wild type. The three transgenes were confirmed as homozygous before being used for the genetic mapping of sof2 and sof19. cstf64-2 (Sail_794_G11) was ordered from the Nottingham Arabidopsis Stock Centre, NASC. cstf77-2 (GK_136D03) was ordered from GABI-Kat. The other flowering time mutants used in this study have been previously described .

Procedures and methods:

Mutagenesis and screen of sof mutants: Chemical mutagenesis of the parental line C2 was carried out as described in (3). sof mutants were identified in the resulting M2 population by screening for seedlings with increased FLC::LUC bioluminescence activity compared to the parental C2 control line, using the light sensitive Photek and Nightowl CCD camera systems .

Genetic mapping of sof2 and sof19: As a first step sof2 and sof19 were backcrossed twice to the parental line to reduce the presence of interfering secondary mutations. Backcrossed sof2 and sof19 were then crossed to gvF and the F2 rescreened for FLC::LUC bioluminescence. Plants with high FLC::LUC bioluminescence activity in the resulting F2 populations were selected as presumed homozygotes of sof2 or sof19, and genotyping using molecular markers polymorphic between the Ler and Col wild types determined the position of markers closely linked to the mutant phenotype. Candidate genes lying within the final mapping interval were amplified and sequenced in the parental line as well as in the sof2 or sof19 mutants to identify specific base changes.

Flowering time analysis: plants were grown in controlled environment rooms with a photoperiod of 16 hours light and 8 hours dark. Temperature ranged between 23-25 °C during the day and 20-22 °C at night. The total leaf number (TLN) or rosette leaf number (RLN) produced by the main apical meristem before switching the developmental program to the initiation flowering was counted to measure variation in flowering time.

FLC::LUC detection: seedlings around 10-15 days after germination on plates of GM medium were sprayed with 1mM of luciferin (Promega) substrate solution and incubated in the dark at room temperature for 20 min. LUC bioluminescence activity of the seedlings was assayed using either the Photek or Nightowl light sensitive CCD camera detection systems.

Genotyping:

cstf64-1 was genotyped by CAPS marker with oligos cstf64-1.F (ATTCAGATTAGTTACGGATAGAGA) and cstf64-1.R (ACGGGTTTTGTCAGTGC) and digested with Bsr I.

cstf64-2 homozygote was genotyped by PCR with primers cstf64-G11.F2 (ACCGAATGGACAAAGAAAGTAAGAATC) and cstf64-G11.R2 (CTCGGTCGCGTCGTAAGGAAT).

cstf64-2 T-DNA insertion was genotyped by PCR with primers Sail_Lba1 (AACGTCCGCAATGTGTTATTAAGTTGTC) and cstf64-G11.R1 (TCTCTAAGTTGTTCCTCGGTCGCGTCGTAAG).

cstf77-1 was genotyped using a CAPS marker. Amplification with sof2_CAPS_F (TAGGACTTGCGAAGATTGGCATAA) and with CstF77_E13R (ACACCCTCAGCCCTCCGGA), amplification product was digested with RsaI, the cstf77-1 mutation prevents the digest.

cstf77-2 was genotyped using so8409 (T-DNA specific) (ctttatcccacttctgtaagtttccc) and 77_5uF (tgtcggaagattgtgacacttattga) to detect presence of the insertion; and with 77_5uF and 77_rev1 (ATCTGTTTGGTAGCATCATCATTGT) to test whether the T-DNA insertion is homozygously present (no amplification).

Northern blot analysis: A FLC cDNA fragment, including the last exon and 3’ UTR, was amplified with primers FLCexon7.5’ (GGAGAATAATCATCATGTGGGAGCA) and FLC3UTR.3’ (CTCACACGAATAAGGTACAAAGTTC). The purified PCR product was labelled (with α-P32 dCTP) by a primer extension reaction, using primer FLC3UTR.3’, to generate a single-stranded antisense probe to detect FLC or FLC::LUC on total RNA blots. Similarly, FLC antisense transcripts were detected on total RNA blots using a single stranded sense probe generated by the FLCexon7.5’primer. Hybridizations were performed using Ultrahyb buffer (Ambion), following the manufacturers instructions. The blots were stripped and re-probed with loading controls such as β-TUBULIN (4) or APT (5). Co-immuno precipitation analysis: CstF77 cDNA was amplified using the oligonucleotides: CstF77_cDNA_F (CACCGTGAAATTCATGGCTGATAAGTACATC) and 77GwR+ (TTAGCCAGTGCTACCAGAAAGCT), CstF77-PR was amplified using: 77PrichGwF (CACCAACGACCTTGATCATTTAGCCAGACAAGA) and 77GwR+ (TTAGCCAGTGCTACCAGAAAGCT). Cstf64 cDNA was amplified using the oligonucleotides: CstF64_cDNA_F (CACCATGGCTTCATCATCATCCCAACGA) and CstF64_cDNA_w/stopR (CTATGAAGGCTGCATCATGTGGTCT). The PCR fragments were cloned into pENTR/D-TOPO according to manufacturers’ instructions (Invitrogen, Cat. No. K2400-20). FLAG-tagged constructs were generated by LR-reaction using the destination vector pGWB11 (6) and HA-tagged CstF64 by a LR-reaction using pGWB14 (6). The expression clones were transformed into the Agrobacterium tumefacies strain C58C1 and mixtures pressure-infiltrated into Nicotiana

benthamiana leaves as described (7). The p19 suppressor of gene silencing (8) was co-infiltrated to achieve higher levels of protein. Immuno precipitation was performed using the buffers described in (9), the FLAG-tagged proteins were precipitated using anti-FLAG agarose (Sigma:A2220). The samples were analysed by western blotting using anti-FLAG antibody (sigma, F3165) and anti-HA antibody sigma, H663) according to manufacturers’ instructions. Western analysis was performed as described (10). Chromatin immuno precipitation (ChIP) was done as described (11) using H3K4me3 antibody from Upstate (05-745) and Pol II antibody from Abcam (ab817).

Quantitative RT-PCR: total RNA samples were treated with Turbo DNA-free (Ambion) to remove any contaminating genomic DNA. The first strand of cDNA was prepared by Superscript III first strand synthesis system (Invitrogen) using Oligo d(T) or gene specific primers. Quantitative PCR was performed on a Lightcycler 480 (Roche) with SYBR green Jumpstart reaction regent (Sigma) and analyzed for absolute quantification against a standard curve for each primer pair. The templates used to generate the standard curve were serial dilutions of cDNA. Every PCR was repeated at least twice while PCR for standard curve was repeated three times.

Primer sequences for Quantitative RT-PCR: * For FLC antisense polyadenylaton at the proximal site: LP_FLCin6polyA (tttttttttttttttactgcttcca) and set1_RP (cacaccaccaaataacaacca). * For FLC antisense polyadenylaton at the distal site: LP_FLCprom_polyA (tttttttttttttttgcggtacac) and set4_RP (ggggtaaacgagagtgatgc). * For total FLC antisense RNA: set6_LP (accttattcgtgtgagaattgc) and set6_RP (ttgacagaagtgaagaacacataca) * FLC unspliced fragment a (in figure 2): FLC_RT_F (ttctccaaacgtcgcaacggtctc) and FLC_Cr (tcactcaacaacatcgagcac). * FLC unspliced fragment b (figure 2): FLCunspliced_F (cgcaattttcatagcccttg) and FLCunspliced_R (ctttgtaatcaaaggtggagagc). * FLC mRNA, AtMul1 and UBC assays were done as in (12) (Primers in bold were used in gene-specific RT reactions).

References: 1. R. Macknight et al., Plant Cell 14, 877 (2002). 2. J. S. Mylne et al., Proc. Natl. Acad. Sci. USA, 103, 5012 (2006). 3. F. Liu et al., Mol Cell 28, 398 (2007). 4. D. P. Snustad, N. A. Haas, S. D. Kopczak, C. D. Silflow, Plant Cell 4, 549

(1992). 5. S. Marquardt, P. K. Boss, J. Hadfield, C. Dean, J Exp Bot 57, 3379 (2006). 6. T. Nakagawa et al., J Biosci Bioeng 104, 34 (2007). 7. T. S. Mucyn et al., Plant Cell 18, 2792 (2006). 8. O. Voinnet, S. Rivas, P. Mestre, D. Baulcombe, Plant J 33, 949 (2003). 9. D. Manzano et al., Proceedings of the National Academy of Sciences 106,

8772 (2009).

10. V. Quesada, R. Macknight, C. Dean, G. G. Simpson, Embo Journal 22, 3142 (2003).

11. F. De Lucia, P. Crevillen, A. M. Jones, T. Greb, C. Dean, Proc Natl Acad Sci U S A 105, 16831 (2008).

12. I. Baurle, L. Smith, D. C. Baulcombe, C. Dean, Science 318, 109 (2007).

Supplementary text for female gametophytic defect in cstf77-2: We obtained seed of five independent descendents of an individual containing the cstf77-2 insertion from the Arabidopsis stock centre. The parental plant may have been heterozygous (CSTF77/cstf77-2) or homozygous (cstf77-2/cstf77-2) for the insertion. We assayed resistance to the herbicide Sulfadiazine (Sul) conferred by the GABI-KAT T-DNA insertion in the five independent progenies. The progenies contained high proportion of sensitive plants, indicating that the resistance conferred by the T-DNA insertion was segregating and none of the five obtained lines was homozygous for the insertion. We thus analyzed the progeny of a heterozygote, which was expected to yield one quarter of lines homozygous for the insertion. None were observed however, perhaps indicating viability defects of the homozygote. We tested whether Sul-resistance co-segregated with the cstf77-2 insertion into CstfF77 in five Sul-resistant plants of each line as several T-DNAs may be present in the background. All 25 individuals genotyped (markers see methods) contained the cstf77-2 insertion, suggesting the absence of additional unlinked T-DNA insertions conferring Sul-resistance. We addressed the possibility that cstf77-2 homozygotes may be lethal by analysing several siliques of each of the 25 lines and tested for defective seed set. Indeed, a high proportion of defective seed were observed in siliques of all of the 25 individuals (FigS4.A). Several explanations for this observation exist: the phenotype could be caused by male or female gametophytic defects or defective embryo or seed development. We sought to discriminate between these possibilities by reciprocal test crosses. The ctsf77-2 heterozygote was crossed with wild-type (Col) as either male or female and also itself. We quantified the phenotype of the resulting F1 seed and distinguished healthy looking from either empty ovules or aborted seed set (combined to “aborted” in the table FigS4.B). A ratio of about 25% aborted seed would indicate defects of the cstf77-2/cstf77-2 homozygote (defective embryo or seed development). However, the observed rate of about 50% in the progeny of self pollinated cstf77-2/CstF77 is consistent with gametophytic defects, as each CstF77 allele (mutant and wild type in the case of the heterozygote) contributes to gametogenesis independently. About 50% of the seed is aborted when cstf77-2 is transmitted from the female side, indicating defective female gametogenesis. We analysed F1 progeny of a cross using cstf77-2/CstF77 as male partner and found that mutant and wild type allele are transmitted with equal frequency, indicating that mutant pollen is fully viable and male gametogenesis not largely affected by ctsf77-2. Taken together, our analysis of cstf77-2 reveals an essential role for CSTF77 in the development of the female gametophyte.

Fig S1. Rationale behind interpreting genetic data by suppressor mutagenesis coupled to epistatic analysis. From left to right, Arabidopsis with high FCA activity (thick line) strongly reduces FLC levels (low). The arrow demarcates the induction of mutations that can ensure suppression by two alternative ways. 1.) A component (X) of the FCA-pathway is mutated (crossed out with red cross) and thus FCA-mediated repression of FLC is reduced (leading to increased FLC). 2.) Alternatively a component (Y) in a pathway repressing FLC in parallel to FCA (suppressive symbol in parallel to FCA) might be disrupted (crossed out with red cross), which leads to increased FLC despite fully functional FCA-mediated repression. Discrimination between these possibilities requires additional genetic experiments (second arrow). Strong mutant alleles (at least one of them null) are combined. The phenotype (FLC increase/delay in flowering time) of the resulting double mutant is compared to that of the individual single mutants. The phenotype of the double mutant (FLC increase/delay in flowering time) may not be enhanced compared to the stronger single mutant (not additive), in which case the component identified by suppressor mutagenesis (X) and FCA act in the same pathway. A null allele strongly disrupts the pathway and so adding a mutation further disrupting the same pathway has no effect. However, the double mutant may show a stronger phenotype (FLC increase/delay in flowering time) than the strongest single mutant (additive), in which case the new component identified by suppressor mutagenesis (Y) acts in a parallel pathway. Combining mutant alleles strongly disrupting two parallel pathways converging to regulate the same target (here: FLC repression) leads to a stronger phenotype as independent activities are disrupted. Fig S2. Known and new mutations suppressed function of over-expressed FCA to repress FLC::LUC. (A). FLC::LUC bioluminescence activity detected by the Photek CCD camera system of plant seedlings grown on a single plate. 21 seedlings of each genotype (listed on both sides of the image) are separated by white lines. On the right are four new mutants identified in the genetic screen. (B). FLC::LUC bioluminescence activity detected by the Nightowl CCD camera system, of C2 parental line and sof2 seedlings grown on the same plate. (C). Western blot analysis. The antibodies used are labelled on the left while the genotypes are labelled on the top. Top penal shows only the FCA protein from 35S::FCAγ. The same blot was re-probed with FY antibody to detect the endogenous FY as a loading control. FCA protein from 35S::FCAγ in sof19 is at the same level as in C2 parental line. (D). FCA protein from 35S::FCAγ in sof2 compared to the C2 control. Coomassie blue staining of the membrane is shown as loading control. Fig S3. Complementation test in the F1 generation demonstrating that mutations in CstF64 and CstF77 cause the phenotypes of sof19 and sof2. (A). Schematic structure of CstF77 (encoded by gene At1g17760) and CstF64 (encoded by gene At1g71800), position of mutations are marked. (B) cstf64 mutations suppress high FCA activity, elevate FLC::LUC bioluminescence and confer late flowering. FLC::LUC bioluminescence detected by Photek CCD camera system, flowering time of the indicated genotypes in the F1 is shown on the left side of each panel, wild type copy in red and mutated copy in black. Origin of the wild type gene copy is shown in the braces. The F1

genotypes are generated by crossing a cstf64-1 heterozygote in the C2 parental background with cstf64-2 heterozygote in Col background. The presence of the indicated CstF64 alleles was assayed by genotyping. Averages and standard errors of flowering time (total leaf number) are shown on the right. n indicated the number of plants analyzed with the indicated genotype. (C). cstf77 mutations suppress high FCA activity, elevate FLC::LUC bioluminescence and confer late flowering. Labelling as in B), except FLC::LUC bioluminescence was detected by the Nightowl CCD camera system and flowering time is represented as rosette leaf number. CstF77 (Ler)/CstF77 (Col) and CstF77 (Ler)/cstf77-2 are generated by crossing the mutagenesis parent C2 with a heterozygote of cstf77-2 in Col background. cstf77- 1/CstF77 (Col) and cstf77-1/cstf77-2 are generated by crossing sof2 with a cstf77-2 heterozygote. The allelic composition at CstF77 was identified by genotyping. Fig S4. Additional phenotypes of cstf77-2 and cstf64-2 mutants. (A). Seed development of wild type CstF77/CstF77 (Col) or cstf77-2/CstF77 heterozygotes. Siliques were opened and analyzed under a stereo microscope. Aborted seed are marked by arrows, the arrow denoted by * shows empty ovules, the unmarked arrow early defective seed set. (B). Table showing the analysis of test-crosses. Aborted seed determined as in (A) was quantified alongside healthy seed in the resulting F1 of crosses between cstf77-2/CstF77and CstF77/CstF77 or self pollinated cstf77-2/CstF77, the number of indicated events is indicated by n. (C). cstf64-2 has curved young leaves compared to wild type (Col) in young seedling stage. (D). cstf64-2 has pale leaves and a smaller rosette than wild type (Col) at adult rosette stage. (E). Comparison of cstf64-2 mutants to wild type (Col) silique development. Note that cstf64-2 does not have developed siliques due to sterility. (F). In vivo association of CstF64 and CstF77. HA-CstF64 was transiently co-expressed with FLAG-tagged proteins (indicated on top) in N.benthamiana leaves. FLAG-tagged proteins were immunoprecipitated and success of the procedure monitored by anti-FLAG western blotting (top exposures) of the soluble protein input, the non-immunoprecipitated protein fraction of the input (unbound) and the immunoprecipitated protein fraction of the input (IP). The same samples were analysed for co-immunoprecipitation of CstF64 by anti-HA western blotting (bottom exposures). Fig S5. cstf64-1 is late flowering without over-expressed FCA. The columns represent averages of a flowering time analysis by counting the total leaf number of cstf64-1 or its Ler wild type control. 20 individuals of each indicated genotype have been analyzed and error bars represent the standard deviation. Fig S6. cstf64-2 is not additive with fca, fy or fld in FLC repression. FLC mRNA measured by qRT-PCR was normalized to UBC as reference. The data of mutants are then normalized to Col wild type control. The data is given as averages; error bars represent standard errors of three biological replicates with two technical repeats. Welch Two Sample t-test showed that FLC mRNA in fve-3 cstf64-2 double mutants is significantly higher than in fve-3 but that

there is no significant difference between fca-9 and fca-9cstf64-2, fy-2 and fy-2cstf64-2 or fld-4 and fld-4cstf64-2 (p< 0.05). Fig S7. cstf64 mutations result increased FLC nascent transcript levels. FLC nascent RNA (fragment b in figure 2) measured by qRT-PCR was normalized to UBC as reference. The data of cstf64-1 and cstf64-2 are then normalized to their Ler and Col wild type controls, respectively. The data is given as averages; error bars represent standard deviation of three biological replicates with two technical repeats. Fig S8. FLC RNA processing assay. (A). total FLC antisense transcript level is increased in cstf, fca and fy. qRT-PCR measuring both processed and unprocessed FLC antisense transcripts are normalized to the UBC qRT-PCR control . Data of cstf64-1, fca-1 and fy-1are then normalized to their Ler wild type control. Data of cstf64-2, fca-9 and fy-2 are normalized to their Col wild type control. The result is shown as averages and error bars represent standard errors of three biological replicates with two technical repeats. (B). FLC mRNA polyadenylation is not reduced in cstf64, fca or fy. qRT-PCR analysis of FLC mRNA level is normalized FLC nascent RNA level (measured by qRT-PCR of fragment b in figure 2). Data of cstf64-1, fca-1 and fy-1 are then normalized to their Ler wild type control. Data of cstf64-2, fca-9 and fy-2 are normalized to their Col wild type control. The data is given as averages and error bars denote standard errors of three biological replicates with two technical repeats. (C). FLC antisense transcript analysis by northern blotting. The abundance of FLC antisense transcripts polyadenylated at the proximal site comparing the Ler wild type to the fca-1 mutant is shown. Plants were cold-treated (two weeks) to enhance the total FLC antisense levels. The blot was stripped and re-probed with to detect APT as a loading control (below). Fig S9. fpa suppress high FCA activity mediated FLC repression. (A). Genotypes are labelled on the top. sof34 de-represses FLC::LUC bioluminescence activity detected by the Photek CCD system (below) and flowers later than the C2 parental control line (bottom). Flowering time analysis given as averages of a leaf counting experiment with standard errors (n=20). (B). sof34 de-represses FLC::LUC and endogenous FLC transcripts compared to parental C2 line assayed by FLC northern blot analysis. Genotypes are shown on the top. Position of FLC and FLC::LUC transcripts indicated on the left, rRNA is shown as loading control. (C). Complementation test in the F1 generation demonstrating that a mutation in FPA causes the phenotype of sof34. Schematic domain structure of FPA with the annotated mutations of fpa-2 and sof34 identified is shown on top. Three rectangles represent the FPA RRM domains. The sof34 mutation changes the GCA alanine codon 735 bp from the start ATG of the FPA cDNA into GTA coding for valine instead. FLC::LUC bioluminescence activity of the indicated genotypes is shown below. Fig S10. Four-step working model for targeted 3’ processing of FLC antisense transcripts triggering chromatin silencing. (A). Schematic showing transcription start sites of sense and antisense FLC transcripts, the latter

occurs over a region of 100 nucleotides (grey gradient bar). FLC antisense introns are indicated as dashed lines. The distal poly A site of the FLC antisense transcript is shown. Transcription of FLC is associated with a peak of H3K4-dimethylation in the central region FLC. (B). FCA/CPSF/CstF- or FPA- promote usage of the proximal polyadenylation site in the FLC antisense transcript. (C). The dashed arrow represents the region of proposed termination and co-transcriptional RNA decay after proximal polyadenylation, it overlaps with the region where FLD demethylates H3K4me2 (marked by a horizontal brace). The question mark indicates the unknown part of the mechanism coupling termination and FLD action. (D). Removal of H3K4me2 mediates transcriptional down-regulation of both strands. Fig S11.The nrpd1a mutation does not suppress function of over-expressed FCA. FLC northern blot analysis comparing genotypes labelled on top. The same blots were reprobed with β-Tubulin (β-TUB) as loading control. Notice that nrpd1a-2 does not strongly increase FLC and thus suppress 35S::FCAγ compared to dcl3-1.

figS1

figS2

figS3

figS4

figS5

figS6

figS7

figS8

figS9

figS10

figS11

genotype biological replicates

UBC mRNA, reference gene

FLC antisense RNA polyadenylated at the proximal site

FLC antisense RNA polyadenylated at the distal site

total FLC antisense

Col 1 0.941  0.500  0.156  0.146 

2 1.075  0.756  0.147  0.319 

3 1.225  1.175  0.371  0.531 

fca-9 1 1.001  1.860  2.910  2.030 

2 1.004  1.305  2.070  1.345 

3 0.912  2.190  3.470  1.980 

fy-2 1 1.003  0.794  0.964  1.145 

2 1.011  1.320  0.763  1.535 

3 1.310  1.615  1.255  1.069 

cstf64-2 1 0.884  0.521  0.007  0.677 

2 0.832  0.484  0.003  0.585 

3 0.873  0.295  0.009  0.590 

fpa-7 1 0.957  0.190  1.400  1.470 

2 1.030  0.223  1.410  1.380 

3 0.971  0.396  2.075  1.645 

fve-3 1 0.980  2.260  0.864  0.774 

2 1.110  3.100  2.070  1.505 

3 1.060  3.100  1.965  1.560  Supporting table 1. Raw qRT-PCR data. The numbers give the concentration of indicated transcripts (top) in relative units of a standard curve. After cDNA synthesis, 1 ul of cDNA from each sample was combined with a mixed cDNA sample defined as relative unit 1. Serial dilutions of cDNA was made from this cDNA mix to generate diluted relative units of cDNA and were used as standard templates to do qPCR together with all the individual cDNA samples derived from different genotypes (indicated on the left). The PCR efficiencies in standard curve generation and cDNA sample analysis were similar. PCR reactions for standard curve generation were performed as triplicates, while PCR for cDNA samples were performed as technical duplicates of three biological repeats.