of June 30, 2018.This information is current as Signaling

Encephalomyelitis Is Regulated by AKT3 Induced Experimental Autoimmune−

during Myelin Oligodendrocyte Glycoprotein Suppression of Inflammatory Responses

Bridget Shafit-ZagardoAyana Jordan, Jason G. Weinger, Fernando Macian and Vladislav Tsiperson, Ross C. Gruber, Michael F. Goldberg,

http://www.jimmunol.org/content/190/4/1528doi: 10.4049/jimmunol.1201387January 2013;

2013; 190:1528-1539; Prepublished online 18J Immunol 

MaterialSupplementary

7.DC1http://www.jimmunol.org/content/suppl/2013/01/18/jimmunol.120138

Referenceshttp://www.jimmunol.org/content/190/4/1528.full#ref-list-1

, 20 of which you can access for free at: cites 34 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2013 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on June 30, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

The Journal of Immunology

Suppression of Inflammatory Responses during MyelinOligodendrocyte Glycoprotein–Induced ExperimentalAutoimmune Encephalomyelitis Is Regulated by AKT3Signaling

Vladislav Tsiperson,*,1 Ross C. Gruber,*,1 Michael F. Goldberg,†,1 Ayana Jordan,*

Jason G. Weinger,‡ Fernando Macian,* and Bridget Shafit-Zagardo*

AKT3, a member of the serine/threonine kinase AKT family, is involved in a variety of biologic processes. AKT3 is expressed in

immune cells and is the major AKT isoform in the CNS representing 30% of the total AKTexpressed in spinal cord, and 50% in the

brain. Myelin-oligodendrocyte glycoprotein–induced experimental autoimmune encephalomyelitis (EAE) is a mouse model in

which lymphocytes and monocytes enter the CNS, resulting in inflammation, demyelination, and axonal injury. We hypothesized

that during EAE, deletion of AKT3 would negatively affect the CNS of AKT32/2 mice, making them more susceptible to CNS

damage. During acute EAE, AKT32/2mice were more severely affected than wild type (WT) mice. Evaluation of spinal cords

showed that during acute and chronic disease, AKT32/2 spinal cords had more demyelination compared with WT spinal cords.

Quantitative RT-PCR determined higher levels of IL-2, IL-17, and IFN-g mRNA in spinal cords from AKT32/2 mice than WT.

Experiments using bone marrow chimeras demonstrated that AKT32/2 mice receiving AKT3-deficient bone marrow cells had

elevated clinical scores relative to control WT mice reconstituted with WT cells, indicating that altered function of both CNS cells

and bone marrow–derived immune cells contributed to the phenotype. Immunohistochemical analysis revealed decreased num-

bers of Foxp3+ regulatory T cells in the spinal cord of AKT32/2 mice compared with WT mice, whereas in vitro suppression

assays showed that AKT3-deficient Th cells were less susceptible to regulatory T cell–mediated suppression than their WT

counterparts. These results indicate that AKT3 signaling contributes to the protection of mice against EAE. The Journal of

Immunology, 2013, 190: 1528–1539.

AKT or protein kinase B family of serine/threonine pro-tein kinases consists of three isoforms. AKT1-3 (PKBa,b, g) are crucial signaling molecules in the PI3K path-

way regulating cell growth, proliferation, survival, and metabo-lism (1, 2). Single and double knockout mice indicate that thefunctions of AKT isoforms are not entirely redundant. AKT12/2

mice are smaller in size with a proportional decrease in size in all

organs (3–5). Constitutively active AKT1 expressed in oligoden-drocytes and oligodendrocyte progenitor cells results in enhancedmyelination (6). AKT22/2 animals are insulin intolerant and ex-hibit a diabetes-like syndrome (3, 4, 7, 8); the brain size of AKT2null mice and WT are the same (9). Unlike AKT2 null mice,AKT12/2 mice and AKT32/2 mice maintain normal levels ofcirculating free-fatty acids indicative of normal lipid metabolism;they have normal clearance of circulating sugar and normal bloodglucose levels (8). AKT3 is the most prevalent isoform expressedin brain and plays a role in brain development and neurode-generation. AKT32/2 mice have a 25% decrease in brain size, re-sulting in fewer and smaller cells but no difference in the generalanatomic organization of the brain. The ventricular system isproportionally reduced, ruling out a disturbance in the production,circulation and absorption of cerebrospinal fluid as a cause for theobserved reduction in AKT32/2 brain size (8, 9).In the immune system, numerous studies have addressed the

role of AKT1 in T cell function. Activation of AKT1 occurs in res-ponse to engagement of CD28 and other costimulatory and cytokinereceptors to regulate T cell proliferation, glucose uptake, cytokineexpression, and cell survival (10–14). A transgenic mouse con-stitutively expressing an activated AKT1 showed that signalingthrough this kinase results in enhanced regulatory T cell (Treg)–induced differentiation and impaired Th17 responses reducing theseverity of myelin oligodendrocyte glycoprotein (MOG)–inducedexperimental autoimmune encephalomyelitis (EAE) (15). Duringthymocyte development, AKT3 can regulate the double-negative–to–double-positive transition; however, little information is avail-able on the possible role of AKT3 in the regulation of effector Tcell responses (16). We induced EAE in wild type (WT) and

*Department of Pathology, Albert Einstein College of Medicine, Yeshiva University,Bronx, NY 10461; †Department of Microbiology and Immunology, Albert EinsteinCollege of Medicine, Yeshiva University, Bronx, NY 10461; and ‡Department ofMolecular Biology and Biochemistry, University of California–Irvine, Irvine, CA92617

1V.T., R.C.G., and M.F.G. contributed equally to this work.

Received for publication May 16, 2012. Accepted for publication December 11,2012.

This work was supported by grants from the National Multiple Sclerosis Society(RG 4046-A6) and the National Institutes of Health (AI059738 and GM007288)and a National Institute of Neurological Disorders and Stroke Neuropathology TrainingGrant (T32NS007098) and National Institute of General Medical Sciences TrainingProgram in Cellular and Molecular Biology and Genetics (Grant T32 GM007491).

Address correspondence and reprint requests to Dr. Bridget Shafit-Zagardo, Depart-ment of Pathology, Albert Einstein College of Medicine, Yeshiva University, Jack andPearl Resnick Campus, Forchheimer Building, Room 524, 1300 Morris Park Avenue,Bronx, NY 10461. E-mail address: bridget.shafit-zagardo@einstein.yu.edu

The online version of this article contains supplemental material.

Abbreviations used in this article: BM, bone marrow; CI, clinical index; DAB,diaminobenzidine; EAE, experimental autoimmune encephalomyelitis; MBP, my-elin basic protein; MOG, myelin oligodendrocyte glycoprotein; RDI, relativedensity index; Tconv cell, conventional T cell; Treg, regulatory T cell; WT, wildtype.

Copyright� 2013 by TheAmericanAssociation of Immunologists, Inc. 0022-1767/13/$16.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1201387

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

AKT32/2 mice to determine the role of AKT3 in regulatingsusceptibility to EAE through its role in the CNS and immunesystem. MOG-induced EAE in C57BL/6 mice is extensively usedto address the effects of autoimmunity and inflammation on spinalcord pathology. Our goal was to test the hypothesis that AKT32/2

mice would a have a more severe disease course than WT miceduring EAE, because AKT3 is necessary for proper CNS cellintegrity and may regulate T cell function (16).

Materials and MethodsMice

AKT32/2 mice (9) were obtained from Dr. Morris Birnbaum (Universityof Pennsylvania School of Medicine, Philadelphia, PA). All mice wereextensively backcrossed on WT C57Bl6/J mice by the Birbaum and Shafit-Zagardo laboratories, and WT littermates were used as controls. Allexperiments were performed with male mice (8 wk old). All animal pro-cedures were approved by the Institute of Animal Care Committee at theAlbert Einstein College of Medicine in complete compliance with theNational Institutes of Health Guide for Care and Use of Laboratory Ani-mals. Foxp3-red fluorescent protein (RFP+) mice in C57Bl6/J were ob-tained from The Jackson Laboratory (Bar Harbor, ME) and crossed withAKT32/2 mice generating Foxp3-RFP+AKT32/2 mice.

MOG-induced EAE: active induction of EAE

C57Bl6/J WT control mice and AKT32/2 mice were immunized with MOGpeptide at 8 wk of age. MOG35-55 (3 mg/ml; Peptides International, Cleve-land, OH) was emulsified in an equal volume of CFA. CFAwas composed ofMycobacterium tuberculosis (10 mg/ml; Difco Laboratories, Detroit, MI) inIFA (Difco Laboratories). Mice were anesthetized with isoflurane and 100 mlemulsion was injected s.c. on each flank (200 ml total/mouse) on day 0. Inaddition, 200 ml pertussis toxin (2.5 mg/ml; List Biological Laboratories,Campbell, CA) was injected into the tail vein on days 0 and 2. Mice weremonitored and graded daily for clinical symptoms of disease as follows: 0,no disease; 1, limp tail; 2, limp tail and hind limb weakness; 3, hind limbparalysis; 4, hind limb and front limb paralysis; 5, moribund.

Spinal cord dissection and tissue preparation

Mice were anesthetized with ethyl ether (Fisher Scientific, Pittsburgh, PA)and sacrificed by total body perfusion with 4% paraformaldehyde (FisherScientific), or 13 PBS (pH 7.3). Spinal cords were removed and dissectedinto cervical, thoracic, and lumbar regions. Sections were placed in fixativefor immunohistochemistry or sonicated on ice with a Tissue Master 125sonicator (Omni International, Marietta, GA) in protein buffer (140 mMsodium chloride, 1 mM Tris/HCl, pH 7.4) containing 0.5% Triton X-100and protease inhibitors (2 mg/ml leupeptin; 2 mM ethylene glycol-bis[b-aminoethyl ether]-N,N,N’,N’-tetraacetic acid; 4 mg/ml pepstatin; 5 mMsodium pyrophosphate; 30 mM b-glycerophosphate; 30 mM sodiumfluoride; 100 mM sodium orthovanadate; 100 mM 4-[2-aminoethyl] ben-zene sulfonyl fluoride hydrochloride) to yield total protein homogenates.The homogenates were cleared by centrifugation at 4˚C at 70003 g for 10min. Aliquots were frozen at 280˚C.

Abs, immunohistochemistry, and stains

Myelin basic protein (MBP) mAb SMI99 (1:1000) and neurofilament mAbSMI32 (1:20,000) was purchased from Covance (Emeryville, CA). Iba1polyclonal Ab (1:600) was purchased from Wako Chemicals USA(Richmond, VA). CD3 was purchased from Dako USA (Carpinteria, CA).CD45 was purchased from Becton-Dickinson Biosciences. Foxp3 cloneFJK16s was purchased from eBioscience.

Paraformaldehyde-fixed sections were stored overnight at 4˚C, trans-ferred to 25% sucrose, and paraffin-embedded. Frozen sections wereprepared from the paraformaldehyde-fixed sections. Paraffin-embeddedsections (7 mM) were incubated with xylenes and descending alcohols,brought to 13 Tris buffered saline, pH 7.4 (13 TBS). Ag retrieval wasachieved by boiling the slides for 30 min in 13 TBS in a steamer. Next, allsections were incubated for 30 min with 13 TBS containing 0.25% TritonX-100, followed by a 1-h incubation in 5% goat serum and 5% nonfat drymilk in 13 TBS, and incubated with Abs diluted in 5% nonfat dry milk in13 TBS, overnight at 4˚C. Sections were washed three times in 13 TBSand incubated with secondary Ab followed by incubation with the ap-propriate Vecta staining kit (Vector Laboratories; Burlingame, CA) andvisualized by diaminobenzidine (DAB; Sigma). Sections were visualizedon a Zeiss Axioskop2 Plus microscope with an AxioCam MRC camera, ora Leica Leitz DRMB microscope with an Olympus DP12 camera.

Black Gold II Myelin stain (Millipore) was performed exactly as detailedby the manufacturer. To directly compare sections from each mouse thefixed, frozen sections (20 mm) were incubated with the myelin black-goldstain for exactly 12 min at 60˚C.

Western blot analysis

Total T cell protein homogenates from WT and AKT32/2 mice (40 mg and80 mg) were loaded in 13 final concentration loading buffer containing 2%SDS, 0.017% bromophenol blue dye, and 0.28 M b-mercaptoethanol (loaddye), and separated in a 10% SDS-PAGE (17). Following electrophoresis,proteins were transferred to nitrocellulose (18). Blots were incubated with5% nonfat dry milk and 5% goat serum in 13 TBS for 1 h at room tem-perature. After blocking, membranes were incubated with respective pri-mary Abs followed by HRP-conjugated secondary Abs. AKT3 mAb andsecondary Ab were obtained from Cell Signaling. b-Actin Ab was ob-tained from Sigma. Visualization was by ECL (GE Healthcare; Piscat-away, NJ).

Immunoblot analysis was performed on homogenates of lumbar spinalcord following saline perfusion. The lumbar region of the spinal cord ofnaive and chronic EAEmice, at day 40 after sensitization, was homogenizedin buffer (13 TBS, 0.25% TritonX100, containing a mixture of proteaseand phosphatase inhibitors) and aliquots were frozen at 280˚C. Image Jwas used to determine the relative density index (RDI) for MAP-2 (1:1000;Sigma)/ b-actin (1:5000; Sigma) for naive and sensitized mice.

Flow cytometry

For Treg analysis, single-cell suspensions frommouse spleen were preparedin PBS, stained with the Blue LIVE/DEAD viability dye (BluVID; Mo-lecular Probes, Eugene OR), and washed with FACS buffer (PBS + 2%FCS + 0.05% sodium azide). The cells were then blocked with mouse anti-FcgRII/III (clone 2.4G2) and surface stained with anti-CD3e (FITC clone145-2C11), anti-CD4 (APC-Cy7 clone RM4-5), and anti-CD25 (biotinclone PC-61; Becton-Dickinson Biosciences), followed by labeling withStreptavidin-Alexa Fluor 405 (Molecular Probes). Cells were fixed andpermeabilized using the eBioscience Foxp3 staining kit according to themanufacturer’s instructions and stained with anti-Foxp3 (Alexa Fluor 647clone FJK-16s; eBioscience). Samples were acquired on an LSR II flowcytometer (Becton-Dickinson Biosciences), and analysis was performedusing FlowJo software (TreeStar, Ashland, OR). For the identificationof Treg, aggregates were excluded from analysis by gating on cells withequivalent FSC-H/FSC-A profiles, and dead cells were excluded by gatingon BluVID negative cells. Tregs were identified by gating on CD4+ T cellsthat were also positive for CD25 and Foxp3.

Quantitative real-time PCR

Total RNA was prepared from lumbar spinal cord using Qiazol Reagentwith a RNeasy kit (Qiagen). RNAwas used to synthesize cDNAwith oligo-dT primers and the Superscript polymerase (Invitrogen). cDNA was synthe-sized from total RNA samples, and gene expression was analyzed usingSYBR Green in a StepOne Plus thermocycler (Applied Biosystems).Quantitative real-time PCR was performed using a SYBR Green qPCRMaster (Abgene) and specific primers to amplify a fragment from thefollowing genes: TNF-a, IL-6, IL-2, IL-17, IFN-g, b-actin. A thresholdwas set in the linear part of the amplification curve and the number ofcycles needed to reach it was determined (Ct). Fold induction was cal-culated as 22DDCt, using b-actin as an internal control for normalization.Melting curves were determined from every sample to establish thespecificity of the amplified band. Mouse-specific primers for IL-17, IL-2,and IFN-g were as follows: IL-17: forward, 59-CAGCAGCGATCATC-CCTCAAAG; reverse, 59-CAGGACCAGGATCTCTTGCTG. IL-2: for-ward, 59-CCCAAGCAGGCCACAGAATTGAAA; reverse, 59-TGAGTC-AAATCCAGAACATGCCGC. IFNg: forward, TCAAGTGGCATAGAT-GTGGAAGAA; reverse: TGGCTCTGCAGGATTTTCATG. Primers forTNFa: forward, CCCTCACACTCAGATCATCTTCT; reverse, GCTAC-GACGTGGGCTACAG. IL-6: forward, ATGGATGCTACCAAACTGGAT;reverse, TGAAGGACTCTGGCTTTGTCT; b-actin: forward, TGCACC-ACCAACTGCTTAG; reverse, GGATGCAGGGATGATGTTC; were syn-thesized through Invitrogen.com (19). Additional control primers includedGAPDH and HPRT. GAPDH: forward, CGTCCCGTAGACAAAATGGT;reverse, TTGATGGCAACAATCTCCAC. HPRT: forward, GATTAGCG-ATGATGAAC; reverse, GAGCAAGTCTTTCAGTCCTGTCCA.

ELISA

Cytokines (IL-2, IL-17, and IFN-g) were measured in supernatants re-covered from T cells activated under different conditions by sandwich

The Journal of Immunology 1529

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

ELISA. Capture and biotinylated anti-cytokine Abs were purchased fromBecton-Dickinson Biosciences.

Bone marrow chimeras and induction of EAE

Bone marrow chimera experiments were performed as detailed (20). Fourgroups of 7-wk-old irradiated male WT and AKT32/2 mice (920 rad)received 107 bone marrow (BM) cells from 6-wk-old male mice 24 h afterirradiation. Mice were housed in quarantine for 6 wk, at which time themice were sensitized with human MOG35-55 peptide as above. Mice weremonitored for clinical signs of disease. Individual scores were analyzed forgroup significance using the Bonferroni multiple comparison test. Animalsin all groups showed similar numbers of CD4+ and CD8+ T cells and CD4+

CD25+Foxp3+ Tregs in spleen and lymph nodes after reconstitution.

Isolation of T cells and suppression assays

CD4+ T cells were isolated from lymph nodes and spleens of naive orMOG-sensitized mice using anti-CD4 coupled magnetic beads (Invi-trogen). To generate Th1 cells, T cells were stimulated with 0.5 mg/mlplate bound anti-CD3ε and 0.5 mg/ml anti-CD28 (Becton-DickinsonBiosciences) and differentiated for 7 d with IL-12 (10 ng/ml; CellSciences), anti–IL-4 (10 mg/ml) and recombinant human IL-2 (10 U/ml;National Cancer Institute Biological Resources Branch Preclinical Re-pository). To generate Th17 cells, CD4+ T cells were activated with 0.5mg/ml of plate bound anti-CD3ε and 0.5 mg/ml of anti-CD28 Abs anddifferentiated for 5 d with IL-6 (20 ng/ml), TGF-b (2.5 ng/ml), IL-23 (10ng/ml) anti–IFN-g (5 mg/ml; Becton-Dickinson Biosciences), anti–IL-4(10 mg/ml; National Cancer Institute Biological Resources Branch Pre-clinical Repository), anti–IL-10 (1 mg/ml), and anti–IL-2 (2 mg/ml;Becton-Dickinson Biosciences). Cells were cultured in DMEM supple-mented with 10% FCS, 2 mM L-glutamine, nonessential amino acids,essential vitamins (Cambrex), and 50 mM b-mercaptoethanol. T cells (5 3103) were stimulated with 0.1 mg/ml plate-bound anti-CD3ε and anti-CD28 in 96-well plates for 48 h. Supernatants were collected, and IL-2levels were measured in a sandwich ELISA following the manufacture’srecommendations (Becton-Dickinson Biosciences or eBioscience). CD4+

CD25+ T cells were isolated by using a Cellection Biotin Binder Kit(Invitrogen), according to the manufacturer’s protocol. RFP+ Tregs werepurified from spleen and lymph nodes of Foxp3-RFP+ mice by cell sorting.

In vitro suppression assays were performed with 2.5 3 105 preactivatedTregs (0.5 mg/ml plate-bound anti-CD3ε and 0.5 mg/ml anti-CD28, 100 U/ml IL-2 for 24 h) and equal numbers of naive or Th1 CD4+ T cells. T cellswere then activated with 0.1 mg/ml plate-bound anti-CD3ε and 0.1 mg/mlantiCD28. Supernatants were collected. IL-2 production was assayed usingELISA.

Statistical analysis

To analyze significance during EAE a Mann–Whitney U test was per-formed on the clinical indices at each time point. For bone marrow chimerastudies, two-way ANOVA analysis was performed. Unless otherwise statedStudent t test was performed for two group comparisons.

ResultsFollowing sensitization with MOG peptide, AKT32/2 mice aremore severely affected than WT mice

As AKT3 constitutes 50% of the total AKT in brain and 30% ofspinal cord, and is increased during cellular stress, we questionedwhether AKT32/2 mice would be more severely compromised thanWT mice after sensitization with MOG35-55 peptide. Fig. 1A showsthat AKT32/2 mice succumbed to EAE earlier, and remained sickerduring the acute phase spanning the first 21 d after MOG injection.From day 9 through day 14, there was a higher incidence of EAEin AKT32/2 mice, and clinical scores were increased at nearly allpoints of the acute phase of disease until day 21. The diseaseincidence was 100% in both groups of mice. Although diseaseseverity in the AKT32/2 mice (n = 4) peaked at ∼13 d, the WTmice (n = 5) had a less severe disease course and recovered toa degree leaving the AKT32/2 mice chronic and sicker than the WTmice. Male AKT32/2 mice with significantly higher clinical scoresduring acute disease was observed in four independent experiments(p , 0.05, Mann–Whitney U test). In one experiment with female

FIGURE 1. AKT32/2 mice have significantly higher clinical scores than

WT mice and increased CD45+ and Iba1+ inflammation in lumbar spinal

cord during acute EAE. (A) Following MOG sensitization, WT and AKT32/2

mice were monitored and graded daily for evidence of EAE as follows: 0, no

disease; +1, limp tail or hind limb weakness; +2, limp tail and hind limb

weakness; +3, hind limb paralysis; +4, hind and front limb paralysis; +5,

moribund. (B and C) Increased CD45 and Iba1 immunostaining in AKT32/2

spinal cord during EAE. Lumbar spinal cord sections from mice with clinical

scores for 10 d were incubated with anti-CD45 (B) and anti-Iba1 (C). The

clinical score of the WT mouse was 1.5 and the AKT32/2 mouse was 2.0.

Data are mean 6 SEM. Visualization was by DAB. Asterisks in (Ba), (Bb),

and (Ca), (Cb) indicate the designated area in panels (Bc), (Bd) and (Cc),

(Cd) at higher magnification. Original magnification: (Ba), (Bb) and (Ca),

(Cb) 350; (Bc), (Bd) and (Cc), (Cd) 3400. (C) Evaluation of Iba1+ in-

flammation in spinal cord sections. Three to four sections of spinal cord were

examined. Each section was scored for the extent of inflammation on a scale

of one to four, and the average per mouse was noted and compared with the

WT for statistical significance using a Mann–Whitney U test.

1530 AKT3 DEFICIENCY WORSENS EAE

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

mice, AKT32/2 mice (n = 7) had significantly higher clinical scoresthan WT mice (n = 8) after three consecutive days with clinicalscores (p , 0.05, Mann–Whitney U test).

MOG-sensitized AKT32/2 mice with clinical scores for10 d have significantly more CD45+ and Iba1+ cells in theventral funiculus of spinal cord relative to WT mice

In pathologic states, microglia and macrophages are activated andexhibit dramatic morphologic changes that can be detected whenstained with CD45 and the calcium-binding protein Iba1. We ex-amined whether activated resident microglia along with macro-phages contribute to the more severe disease course observed inAKT32/2 mice. CD45 immunostaining from three to four sectionsfrom the lumbar region of the spinal cord from five WT and fourAKT32/2 mice was examined and scored on a scale of one to four,with four being maximal CD45+ immunoreactivity. The mean valuefor the WT mice was 1.86 0.37 (values = 1, 1, 2, 2, 3), whereas themean value for the AKT32/2 mice was 3.36 0.48 (values = 3, 4, 4,2; p # 0.05). In the AKT32/2 spinal cords, there was more wide-spread areas of inflammation. Fig. 1B illustrates the CD45+ stainingin frozen sections from lumbar spinal cords of mice that had clinicalscores for 10 consecutive days. Although we observed a significantincrease in the number of CD45+ cells in lumbar spinal cord, we didnot observe a significant increase in total CD45+ high, CD11b+ lowmacrophages in total brain and spinal cord of individual mice (n =4) by flow cytometry. The mean CD45 high, CD11b low for WTmice was 256,424 6 24,005, and the value for the AKT32/2 was186,294 6 20,056 (p . 0.05).CD11b+ high, CD45+ low/intermediate cells were significantly

less in the AKT32/2 mice (228,1226 24,640; n = 4) relative to theWT (412,682 6 42,910; n = 4; p , 0.01), likely reflecting the 25%decrease in brain and spinal cord weight observed in the AKT32/2

mice. Because CD11b does not distinguish between activated andtotal microglia and macrophages, we examined whether there wasa difference in activated microglia by staining cross-sections oflumbar and lumbar-sacral spinal cords of WT and AKT32/2 micewith Abs against Iba1. Fig. 1C shows the spinal cord of a repre-sentative WT mouse and an AKT32/2 mouse with similar scores(WT clinical index (CI) = 1.5; AKT32/2 CI = 2.0). All mice hadclinical scores for 10 d. Examination of multiple sections of thespinal cord show that, although the mice had similar scores, thespinal cords of AKT32/2 mice had more extensive Iba1+ immu-nostaining than WT spinal cords; this was more evident in micewith higher clinical scores. To determine whether there was a sig-nificant difference in Iba1 staining, three to four sections of spinalcord per mouse were examined and scored on a scale of one to four.The extent of Iba1+ inflammation was scored as follows: 1 = mildinflammation at lesions; 2 = moderate inflammation at lesions; 3 =severe inflammation at lesions; 4 = very severe inflammation in-volving.50% of the spinal cord. We examined eight WT mice andseven AKT32/2mice, and obtained statistical analysis using Mann–Whitney U test. The overall score for the AKT32/2 spinal cords(n = 7 mice) was 3.7 6 0.18 (SEM). The overall score of the WTspinal cords (n = 8 mice) was 2.6 6 0.42 (SEM; p , 0.05).

Following active MOG sensitization, overt demyelination isobserved in AKT32/2 spinal cord during acute disease

To determine whether the AKT32/2 mice had more demyelinationthat WT mice, we sacrificed mice 3, 4, 5, and 10 d after the initialclinical sign of disease (CI $ 1.0) and by MBP immunostainingexamined paraffin-embedded spinal cord sections to evaluatewhether AKT32/2mice had sustained demyelination relative to WTmice. Three-four nonserial sections were examined from multiplemice and time points. As demonstrated in Fig. 2A, AKT32/2 mice

had earlier signs of demyelination in the ventral spinal cord relativeto WT mice. Signs of demyelination were more obvious in theAKT32/2 lumbar spinal cord 3–4 d after clinical signs of disease(Figure 2Aa–h). The asterisk in each of the low magnification panelsindicates the designated area in the panels at higher magnification.In mice with clinical scores for 5 d and 10 d, there were visible signsof demyelination in the WT mice (Figs. 2Ai, 2Aj, and 2Bc, 2Bd).AKT32/2 mice had higher clinical scores and more extensive de-myelination in the ventral funiculus (Figs. 2Ak, 2Al and 2Bg–h).Iba1 staining in WT and AKT32/2 spinal cord are illustrated in Fig.2Bb and 2Bf. The representative mice had the mean clinical scorefor the WT and AKT32/2 mice at the time of sacrifice. To quantifythe extent of demyelination in mice with clinical scores for 10 d,frozen spinal cord sections from WT mice (n = 5) and AKT32/2

mice (n = 4) were incubated with Myelin Black-Gold II stain andanalyzed with ImageJ (Fig. 2C). The extent of demyelination wascalculated as a percentage of the dark demyelinated area relativeto the percentage of the total white matter area within the dorsal,ventral and lateral regions. The mean percentage of demyelinationfor the WT mice was 3.5 6 1.4 (SD), and the mean percentage ofdemyelination for the AKT32/2 mice was 9.8 6 0.74 (p = 0.0026).

During chronic disease, MOG-induced EAE pathology inAKT32/2 mice includes extensive demyelination, and SMI32+

axonal spheroids in white matter

Longitudinal spinal cord sections frommice with clinical scores for29–30 d were evaluated for demyelination and axonal damagefollowing immunostaining with MBP and SMI32. Fig. 3A–D showrepresentative longitudinal sections with SMI32+ axonal swellingsextending the length of the white matter tracts of both WT (Fig.3A and 3C) and AKT32/2 lumbar spinal cord (Fig. 3B and 3D).The arrow in Fig. 3A, 3B denotes the level of the cord magnified inFig. 3C, 3D. Although the AKT32/2 spinal cord appeared to havemore SMI32+ axonal swelling at this time point, evaluation ofmultiple cross-sections of WT and AKT32/2 spinal cords frommice with clinical scores for 3–5 d (day 14 after sensitization), or10 d did not have statistically significant differences (p . 0.05).Demyelination was more severe in AKT32/2 mice than WT mice

during the chronic phase, consistent with demyelination during acutedisease. Examination of MBP immunostaining determined that de-myelination in the AKT32/2 mice extended farther up the spinalcord. A clear region of myelin pallor is visible in Fig. 3F (arrow) andextends toward a region of more extensive myelin staining. At highmagnification (Fig. 3H), an oligodendrocyte extending MBP+ pro-cesses adjacent to axons are observed, arrowhead.We examined brain stem at the level of pons from the afore-

mentioned WT and AKT32/2 mice with MBP and MAP-2 andobserved no overt lesions in the sections examined.

Relative to WT, MAP-2 in AKT32/2 lumbar spinal cord issignificantly reduced during chronic EAE

Western blot analysis and immunohistochemistry confirm a sig-nificant decrease inMAP-2 in lumbar spinal cord in AKT32/2mice(n = 4) relative to WT (n = 3) at day 40 after sensitization (Fig. 4).The CIs of the WT mice ranged from 0–1.5, whereas the CIsof the AKT32/2 mice ranged from 1–4. Naive WT (n = 1) andAKT32/2 (n = 3) lumbar spinal cord were analyzed and comparedwith the sensitized spinal cords. As shown in Fig. 4A, MAP-2 inthe lumbar region of spinal cord of sensitized AKT32/2 mice wassignificantly reduced relative to lumbar spinal cords from sensi-tized WT mice (p = 0.039). There was no significant loss in MAP-2 in the sensitized WT mice relative to the naive mice. MAP-2 inthe sensitized AKT32/2 spinal cord was significantly reducedrelative to the naive AKT32/2 spinal cord (p = 0.017).

The Journal of Immunology 1531

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

In addition to performing immunoblot analysis, we examinedMAP-2 immunoreactivity using longitudinal sections of spinal cordwith areas of demyelination and inflammation. Fig. 4B shows MBP,Iba1, and MAP-2 immunostaining for the sensitized WT andAKT32/2 mice. The mice had clinical scores for 30 d. The boxedareas, denoting part of the lesion with reduced MBP immunoreac-tivity and Iba1 staining, are further illustrated at a higher magnifi-cation for MAP-2. In the AKT32/2 sections, there is MAP-2 pallorthat is consistent with the immunoblot analysis. Fig. 4C showssections of spinal cord from naive WT and AKT32/2 mice stainedfor MBP and MAP-2. In the multiple naive AKT32/2 mice exam-ined, there was no overt loss of MBP or MAP-2 immunoreactivityconsistent with the immunoblot analyses. Furthermore, there wasno overt alteration in the length of the spinal cord in the AKT32/2

spinal cord relative to the WT spinal cord (Supplemental Fig. 1).

Relative to WT mice, AKT32/2 mice express increasedinflammatory cytokine mRNAs during acute EAE

To address the contribution of resident and infiltrating inflam-matory cells, mRNAwas isolated from the lumbar spinal cords

of mice having three consecutive days of clinical scores (∼day14 postsensitization). Quantitative real-time PCR was per-formed using primers specific for IL-17, IL-2, INF-g, IL-6, andTNF-a to quantify the expression of these cytokines. Similaranalyses were performed with RNA isolated from the same re-gion of spinal cord from naive mice. Values were normalizedto levels of b-actin mRNA and calculated as the fold inductionmRNA relative to naive mice for AKT32/2 and WT mice forIL-2, IL-17, and IFN-g. Additional analyses used HPRT andGAPDH as controls with similar results. No detectable levels ofIL-6 or TNF-a were obtained in naive mice; therefore, levelsrepresent values expressed at day 14 post EAE. As demonstratedin Fig. 5, there was a significant increase in INF-g, IL-2, and IL-17 mRNA expression in AKT32/2 lumbar spinal cords (n = 9)relative to WT lumbar spinal cords (n = 6) during acute EAE(p , 0.05). Relative to naive mice, IL-6 and TNF-a mRNAweredramatically increased in the WT and AKT32/2 spinal cordduring EAE. Although the levels of IL-6 mRNA in AKT32/2

mice was markedly increased relative to the WT mice, signifi-cance was not obtained. Furthermore, there was no difference in

FIGURE 2. AKT32/2 mice have

more demyelination in the ventral

funiculus than WT mice during acute

EAE. Paraffin-embedded cross-sec-

tions of lumbar spinal cord, with

clinical scores for 3–5 d (A) or 10 d

(B), were incubated with MBP mAb

SMI99 and visualized by DAB. (B)

Representative sections were stained

with H&E (Ba, Be) or incubated with

Ab to Iba1 (Bb and Bf), and MBP (Bc,

Bd, Bg, Bh) and visualized by DAB.

Asterisks indicate the designated area

in the panels at higher magnification.

(Aa), (Ac), Ae), (Ag), (Ai), and (Ak):

original magnification 350; (Ab),

(Ad), (Af), (Ah), (Aj), and (Al): orig-

inal magnification 3100. (Ba), (Bb),

(Bc), (Be), (Bf), and (Bg): original

magnification 350; (Bd) and (Bh):

original magnification 3100). (C) Black

Gold II Myelin staining of frozen spinal

cord sections from WT (n = 5) and

AKT32/2 mice (n = 4) with clinical

scores for 10 d (Ca)–Ch), original

magnification 350.

1532 AKT3 DEFICIENCY WORSENS EAE

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

TNF-a mRNA between the two treated groups of mice (p .0.05).

Bone marrow chimera studies support the hypothesis thatimmune cells contribute to the more severe disease courseobserved in AKT32/2 mice

To explore whether immune cells could also contribute to the moresevere disease course observed in AKT32/2 mice, four groups of7-wk-old irradiated male mice (WT and AKT32/2) received 107

BM cells from 6-wk-old male mice 24 h after irradiation. Micewere housed in quarantine for 6 wk, at which time the mice were

sensitized with MOG35-55 peptide. Mice were monitored forclinical signs of disease as detailed above, and data from the ex-periment are presented in Fig. 6 and Tables I and II. Irradiated WTor AKT32/2 mice receiving BM cells from AKT32/2 mice had amore severe disease course than AKT32/2 mice receiving BMcells from WT mice or WT mice reconstituted with WT bonemarrow cells. Tables I and II show the mean clinical scores andthe statistical analyses for the four groups of mice from days 17–20. The data show that AKT32/2 mice receiving AKT32/2 BMcells are significantly sicker than the groups of mice receiving WTBM cells. The data indicate that both defects in radioresistant cells

FIGURE 3. AKT32/2 mice have more demyelination than WT mice during chronic EAE. Longitudinal sections of lumbar spinal cord from AKT32/2

and WT mice, with clinical scores for 29–30 d, were incubated with SMI32 (A–D) and MBP (E–H); visualization was by DAB. Arrows in (A), (B), (E), and

(F) denote areas of magnification in (C), (D), (G), and (H), respectively. The arrow in (F) (lower right) also denotes a region of myelin pallor. The arrowhead

in (H) shows an oligodendrocyte extending MBP+ processes adjacent to axons. (A and B) Original magnification 325; (C–F) original magnification 350;

(G and H) original magnification 3400.

The Journal of Immunology 1533

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

and radiosensitive BM-derived cells contribute to the increasedseverity of MOG-induced EAE observed in AKT32/2 mice.

CNS tissues from AKT32/2 mice have fewer Tregs in lumbarspinal cord than WT mice

Based on the results obtained with the BM chimeras, and giventhe key role of T cells in the pathogenesis of EAE, we evaluatedwhether differences in the number of infiltrating T cells could beobserved between WT and AKT32/2 mice. We sacrificed mice atday 14, when all mice had clinical scores for 3–5 d. Brain andspinal cords were isolated from WT and AKT32/2 mice and thenumber of CD4+Foxp3+ cells was determined using FACS anal-ysis. As demonstrated in Fig. 7A, the mean number of CD4+

Foxp3+ cells in WT CNS was 8199 6 1129 (n = 4), and the meannumber in the AKT32/2 CNS was 4058 6 683 (n = 4; p , 0.02).FACS analysis of CD3+ cells in total brain and spinal cord fromWT (223,082 6 15,177; n = 4) and AKT32/2 mice (155,649 621,144; n = 4) showed fewer CD3+ cells in AKT32/2 mice rela-tive to the WT (p # 0.05). We next determined the ratio of CD3+/Foxp3+ in the CNS and determined that there was a significantdifference in the ratio of these cell populations in the WT (28.6 63.4; n = 4) and the AKT32/2 mice (39.2 6 2.4; n = 4; p # 0.05).In addition, we performed immunohistochemistry and focused

our attention on the lumbar spinal cord. At this time point, the meanclinical scores of the AKT32/2 mice were 2.7 6 0.25 (n = 6) andthe WT mice were 1.8 6 0.14 (n = 4; p = 0.02). Four sections ofspinal cord and three nonserial slides were analyzed for CD3 andFoxp3 expression by immunohistochemistry. A representativeH&E stained section of WT and AKT32/2 spinal cord is shown inFig. 7Ba, 7Be); the arrows denote the lesion documented at highmagnification after staining with CD3 and Foxp3. CD3 immuno-staining in Fig. 7Bb and 7Bf illustrates the lesions and extent ofCD3+ T cells at low magnification. The number of CD3+ cells ineach section was too abundant to count, and overlapping cellswere difficult to assess at higher magnification (Fig. 7Bc, 7Bg);therefore, full spinal cord sections were scanned in ImageJ soft-ware, and the mean RDI was determined. There was no significantdifference in the number of CD3+ cells in the lumbar and lumbarsacral region of the spinal cords of the two groups of mice (p .0.05). To assess the total number of Foxp3+ cells within thelumbar spinal cord section for each mouse, multiple nonserialsections were counted; Foxp3+ cells in the meninges were ex-cluded from the count. We observed a significant reduction inFoxp3+ Tregs in the spinal cord of the AKT32/2 mice (p = 0.02;Fig. 7Bd and 7Bh). The mean number of Foxp3+ Tregs in theAKT32/2 spinal cord cross-section was 10.1 6 1.3 versus 27.5 64.8 in the WT spinal cord. The representative cross-sections ofWT and AKT32/2 mice had clinical scores equivalent to the meanvalue. Thus, lumbar spinal cords of AKT32/2 mice had fewerFoxp3+ Tregs, higher cytokine mRNA levels in the lumbar spinalcord, and a more severe clinical course of disease than the WTmice. In an additional experiment, we examined Foxp3+ cells infrozen sections of lumbar spinal cord from mice with clinicalscores for 10 d. At this time, there was no significant difference inthe number of Foxp3+ cells in the two groups of mice by immu-nohistochemistry, suggesting that the Tregs might have alreadytrafficked out of the CNS.We then analyzed whether the differences observed in Treg

infiltration in spinal cord might reflect differences in the generaldistribution of Treg cells in lymphoid organs. Supplemental Table 1

FIGURE 4. Significant loss of MAP-2 during chronic EAE is observed

by immunoblot and immunohistochemical analysis. (A) Western blot

analysis shows a significant loss of MAP-2 in lumbar spinal cord 40 d after

sensitization. Lumbar spinal cord protein homogenate was loaded as 20 mg

per lane. The upper portion of the blot was incubated with an mAb to

MAP-2 (Sigma, 1:1000), and the lower portion was incubated with an

mAb to b-actin (Sigma). Visualization was by ECL. Densitometry and

RDI was performed on signals in the linear range (ImageJ). (B) Longitu-

dinal sections of lumbar spinal cord from sensitized mice with clinical

scores for 30 d were incubated with Abs to MBP, Iba1, and MAP-2. The

boxed region denotes region magnified in MAP-2–stained sections (MBP,

Iba1: original magnification 350; MAP2: original magnification 3200).

(C) Longitudinal sections of lumbar spinal cord from naive, 10-wk-old WT

and AKT32/2 mice incubated with Abs to MAP-2 and MBP (MAP2,

MBP: original magnification 3100).

1534 AKT3 DEFICIENCY WORSENS EAE

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

shows the distribution of CD4+CD25+ and CD4+CD252 T cellsisolated from the spleen and lymph nodes of naive WT andAKT32/2 mice. Of the overall CD4+ T cells 10–12% were CD4+

CD25+ in both WT and AKT32/2 mice. Labeling with a Foxp3 Abrevealed that the percentage of Foxp3+ T cells in the CD4+CD25+

population was ∼84%, corroborating that equivalent numbers ofFoxp3+ Tregs were present in the peripheral repertoire of WT andAKT32/2 mice (Fig. 8A). To further substantiate that the numberof peripheral CD4+CD25+Foxp3+ cells were equivalent in naiveWT and AKT32/2 mice, AKT32/2 mice were crossed withFoxp32RFP+ mice, and the resulting Foxp32RFP+/AKT3+/+ and

Foxp32RFP+/AKT32/2 mice were analyzed using flow cytom-etry. As shown in Fig. 8B, equivalent cells were observed in bothspleen and lymph node populations of WT and AKT32/2 Foxp32

RFP+ mice, p . 0.05.

AKT3-deficient T cells are resistant to Treg-mediatedsuppression

Given the increased cytokine production observed in AKT32/2

spinal cords during EAE, we examined whether efficient Treg-mediated suppression of T cells could rely on AKT3. First, todetermine whether AKT3 was expressed in mature T cells, proteinhomogenates of CD4+ T cells isolated from the spleens of WTand AKT32/2 mice were examined for AKT3 expression by im-munoblot analysis. As shown in Fig. 9A, AKT3 was detected inWT T cell homogenates but not in T cells from AKT32/2 mice.We then examined whether loss of AKT3 may cause resistance toTreg-mediated suppression that could account for the increasedcytokine expression detected in spinal cords of AKT32/2miceduring EAE. Fig. 9B, 9C shows that in vitro differentiated Th1cells (Supplemental Fig. 2A) from both WT mice and AKT32/2

mice expressed similar levels of IL-2 when stimulated using plate-bound anti-CD3 and anti-CD28, indicating that activation-inducedcytokine expression is not altered in AKT32/2 CD4+ T cells.Furthermore, Tregs from the WT mice and the AKT32/2 micewere able to suppress WT T cell activation. In contrast, CD4+

CD252 Th1 cells from AKT32/2 mice could not be efficientlysuppressed by either AKT32/2 or WT Tregs; the data were con-sistent across genders, indicating that AKT32/2 T cells are moreresistant to Treg-mediated suppression. Similar results were ob-tained when Th17 cells (Supplemental Fig. 2B) were analyzed.Although the overall level of Treg-mediated suppression of cy-tokine production was lower than detected in Th1 cells, there was

FIGURE 5. Quantitative real-time PCR demonstrates that relative to WT mice, AKT32/2 mice have increased inflammatory cytokine expression in

spinal cord during acute EAE. Total RNAwas isolated from spinal cords of naive mice and MOG-sensitized WT and AKT32/2 mice after three consecutive

days of clinical scores. Values were normalized to levels of b-actin mRNA and calculated as the fold induction mRNA relative to naive mice for AKT32/2

and WT mice for IL-2, IL-17, and IFN-g. Similar statistically significant results were obtained when the data were normalized to GAPDH or HPRT. No

detectable levels of IL-6 or TNF-a were obtained for naive mice; therefore, levels represent values expressed during EAE. *p . 0.05.

FIGURE 6. Mice receiving BM cells from AKT32/2 mice have higher

mean clinical scores following MOG-induced EAE. Upon sacrificing the

mice, we analyzed the repopulation of T cells in spleen. Our analysis

demonstrated that the repopulation of BM cells in groups 1 through 4 were

successful. Data were normalized to the day of onset of disease for each

group of mice. Inverted triangle and grey dashed line, AKT32/2 BM to

irradiated (Irrad.) AKT32/2 mice (n = 8). Square and solid black line,

AKT32/2 BM to Irrad. WT mice (n = 20). Triangle and dashed black line,

WT BM to Irrad. WT mice (n = 10). Circle and solid grey line, WT BM

to Irrad. AKT32/2 mice (n = 12). Data are presented as mean 6 SEM.

Individual scores were analyzed for group significance using the Bonfer-

roni multiple comparison test.

Table I. Mice receiving BM cells from AKT32/2 mice have highermean clinical scores following MOG-induced EAE: mean clinical scoresof mice (days 17–20)

Groups Mean 6 SEM

WT BM to Irrad. AKT32/2 mice 2.5 6 0.063AKT32/2 BM to Irrad. WT mice 3.0 6 0.025WT BM to Irrad. WT mice 2.8 6 0.063AKT32/2 BM to Irrad. AKT32/2 mice 3.4 6 0.095

The Journal of Immunology 1535

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

still a significant decrease in the susceptibility to Treg-mediatedsuppression in AKT3-deficient Th17 cells compared with WT cells(Fig. 9E).To further substantiate the contribution of T cells to severity of

disease in the AKT32/2 mice, we examined the T cell populationsin the periphery of WT and AKT32/2 EAE mice. In three inde-pendent experiments, we examined the susceptibility of T cellsfrom AKT32/2 mice to Treg-mediated suppression. In the ex-periment shown in Fig. 9D, AKT32/2 mice (n = 8) and WT mice(n = 7) were examined during the acute phase of disease. Micewere sacrificed, and spleen and lymph nodes were harvested.CD4+CD252 conventional T (Tconv) cells and CD4+CD25+ Tregswere isolated, and suppression of activation-induced IL-2 pro-duction was evaluated. Spleens and lymph nodes were pooledfrom two to three mice with comparable clinical scores; all miceshowed signs of disease. The ability of WT CD4+CD25+ Tregs to

suppress AKT32/2 CD4+CD252 Tconv cells was significantlyless than in WT Tconv cells (p = 0.026). As observed in naivemice, in the absence of Tregs the level of IL-2 production did notdiffer between AKT32/2 mice and WT mice. These data dem-onstrate that a disruption in the AKT3 signaling pathway in sen-sitized AKT32/2 mice results in increased resistance to Treg-mediated suppression with enhanced cytokine production.In summary, our combined studies show that following MOG-

induced EAE AKT32/2 mice have a more severe course of dis-ease resulting in inefficient suppression of T cells, fewer Tregs inthe CNS, increased cytokine mRNA expression, extensive Iba1+

microglia and reduced MBP expression in the ventral funiculusduring acute disease, and prolonged demyelination during chronicdisease. BM chimera studies indicate that both hematopoietic cellsand cells of the CNS contribute to the more severe pathology inAKT32/2 mice. The extensive demyelination observed in the

Table II. Mice receiving BM cells from AKT32/2 mice have higher mean clinical scores following MOG-induced EAE: comparison test (days 17–20)

Bonferroni multiple comparison test p , 0.05 Summary

WT BM to AKT32/2 versus AKT32/2 BM to WT mice Yes p , 0.01WT BM to AKT32/2 mice versus WT BM to WT mice Yes p , 0.05WT BM to AKT32/2 mice versus AKT32/2 BM to AKT32/2 mice Yes p , 0.0001AKT32/2 BM to WT mice versus WT BM to WT mice No nsAKT32/2 BM to WT mice versus AKT32/2 BM to AKT32/2 mice Yes p , 0.01WT BM to WT mice versus AKT32/2 BM to AKT32/2 mice Yes p , 0.001

ns, Not significant.

FIGURE 7. During acute EAE, fewer Tregs are present in the spinal cord of AKT32/2 mice than WT mice. (A) FACS analysis of brain and spinal cord of

mice having clinical scores for 3–4 d show fewer Foxp3+ Tregs in the CNS of AKT32/2 mice during acute EAE. The ratio of CD3+/Foxp3+ cells is

significantly increased in AKT32/2 brain and spinal cord; *p # 0.05, **p , 0.02. The ratio of CD3+/Foxp3+ cells is significantly increased in AKT32/2

brain and spinal cord (p , 0.05). (B) Mice with clinical scores for 4 d were sacrificed on day 14. Multiple 7-mm, 4% paraformaldehyde-treated sections of

spinal cord were stained with H&E and incubated with Abs to CD3 and Foxp3. The arrows in (Ba) and (Be) denote the area in (Bc), (Bd), (Bg), and (Bh) at

higher magnifications. Original magnification: (Ba, Bb, Be, Bf) 350; (Bc, Bd, Bg, Bh) 3400.

1536 AKT3 DEFICIENCY WORSENS EAE

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

ventral funiculus of AKT32/2 mice support the hypothesis thatAKT3 is an important signaling pathway in the CNS.

DiscussionAs a result of an incomplete understanding of the abundance andspecific activities of each of the AKT isoforms in normal tissue andin disease states, we initiated a study to define the role of AKT3 inthe CNS using the experimental model EAE. Although expressedin most cell types (8, 9), AKT3 is the predominant form expressedin the CNS of naive mice and the major AKT isoform in neurons(21). In the immune system, AKT3 contributes to the pre–TCR-induced signaling required for the double-negative–to–double-positive transition in thymocytes; however, functions of thisAKT isoform in mature T cells have not been yet characterized(16). AKT32/2 mice are viable, show no growth retardation withthe exception of a smaller brain size and weight, and have noanatomic malformations in brain structure, except for a thinnerwhite matter fiber tract within the corpus callosum (8).To test our hypothesis that deletion of AKT3 would negatively

affect the CNS making AKT32/2 mice more susceptible to de-generation, we sensitized mice with MOG35-55 peptide. Our datashow that AKT32/2 mice had higher clinical scores after MOG-induced EAE, had more Iba1+ and CD45+ cells in lumbar spinalcord during acute disease, exhibited more demyelination duringacute and chronic disease, expressed more IL-2, INF-g, and IL-17, and IL-6 mRNA, and had fewer Foxp3+ Tregs in the CNSthan WT mice. Because AKT3 is expressed by many cell typesand can play a role in the periphery, we examined MOG-inducedEAE in BM chimeras using WT and AKT32/2 mice. Our resultsshow that only when irradiated AKT32/2 mice received AKT32/2

bone marrow cells were the mice significantly more impairedduring MOG-induced EAE than irradiated WT mice receivingBM cells from WT mice. These results support a role for AKT3in the CNS and in the regulation of the activity of BM-generatedcells.

FIGURE 8. Equivalent numbers of Tregs are found in spleen and lymph

nodes of naive WT and AKT32/2 mice. (A) The percentage of CD25+

Foxp3+ T cells in the CD4+ T cell population was assessed by FACS in

cells isolated from spleen of WT and AKT32/2 mice. (B) Quantification of

the percentages of Foxp3+ cells in the CD4+ T cell population in spleen

and lymph nodes of WT and AKT32/2 mice.

FIGURE 9. CD4+ T cells isolated from naive AKT32/2 mice and from

mice following MOG-induced EAE are more resistant to Treg-mediated

suppression than T cells from WT mice. (A) Total T cell protein homo-

genates were prepared from WT and AKT32/2 mice and incubated with

an AKT3 mAb followed by b-actin, visualization was by ECL. Lanes 1

and 2, WT; lanes 3 and 4, AKT32/2; 40 mg (lanes 1 and 3) and 80 mg

(lanes 2 and 4) of protein were loaded for each sample. (B, C) In vitro

differentiated primary Th1 cells from WT or AKT32/2 naive mice were

activated with plate-bound anti-CD3 and anti-CD28 in the presence or

absence of WT or AKT32/2 Tregs for 24 h, and IL-2 production was

measured with ELISA. Results are mean 6 SEM from three independent

experiments (**p, 0.01). (C) Suppression was evaluated as a percentage of

inhibition of IL-2 expression induced by WT Tregs on WT or AKT32/2

Th1 cells (*p = 0.013). (D) Spleens and lymph nodes from WTor AKT32/2

mice were pooled according to the clinical scores (two to three mice per

group). Each assay was performed in triplicate. CD4+ Tconv cells were

activated in the presence and absence of Tregs (50,000 cells each) and

cocultured for 48 h. Supernatants were then harvest for ELISA to detect IL-

2 production (*p = 0.026). (E) In vitro differentiated Th17 cells from wild

type or AKT3-deficient mice were activated with plate-bound anti-CD3 in

the presence or absence of WT Tregs. IL-17 production was measured by

ELISA. Results are presented as a percentage of suppression of IL-17

production in the presence of Tregs compared with control-activated Th17

cells. Graph represents mean 6 SEM from three independent experiments.

*p , 0.05.

The Journal of Immunology 1537

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

Our initial evaluation of naive WT and AKT32/2 mice deter-mined that they had comparable CD4+CD252 conventional cellsand Foxp3+RFP+ Tregs in the periphery. However, after sensiti-zation with MOG, there were fewer Foxp3+ Tregs that entered thespinal cord of AKT32/2 mice during acute EAE. Flow cytometryshowed that the number of neutrophils and NK cells were com-parable (data not shown). The observed decrease in CD4+CD25+

Foxp3+ cells combined with the activated state of the Iba1+ glialikely contributed to the increase in cytokine mRNA and the moresevere disease course observed in the AKT32/2 mice. Tregs havebeen shown to modulate EAE, and adoptive transfer of thesesuppressor cells ameliorates EAE progression (22). Interestingly,Tconv cells of naive AKT32/2 mice failed to be efficiently sup-pressed by Treg. This resistance to Treg-mediated suppression wasalso observed when T cells from AKT32/2 EAE mice were an-alyzed. The exact defect in the suppressive mechanism in T cellslacking AKT3 is currently unknown. Although AKT1 hyper-activation has been shown to confer resistance to suppression(23), we did not observe any compensatory increase in the acti-vation of other AKT kinases in AKT32/2 mice (data not shown),which suggests that signaling pathways regulated specifically byAKT3 modulate the susceptibility of conventional CD4+ T cells tosuppression by Tregs. However, AKT3 deficiency did not appearto affect Treg function, because Tregs from AKT32/2 mice wereable to efficiently suppress effector T cells from WT mice, indi-cating that the defect caused by the lack of AKT3 activity does notaffect the Treg’s ability to suppress, but causes an inability of theconventional CD4+ T cells to be efficiently suppressed.Th1 and Th17 cells promote inflammation by cytokine pro-

duction. Th1 cells produce IFN-g, and Th17 cells produce IL-17.IFN-g can downregulate EAE by signaling macrophages, micro-glia, and astrocytes to produce inducible NO synthase and sub-sequently NO generation (24–28). However, IFN-g treatmentin vitro inhibits cell cycle exit in differentiating oligodendrocyteprogenitor cells (29) and in marmosets does not abate the EAEdisease course (30). This finding indicates that an inflammatory–to–anti-inflammatory balance is essential to modulate EAE pro-gression. Inefficient T cell suppression could result in increasedproduction of proinflammatory molecules that would exacerbatedisease progression as is observed in AKT32/2 mice during EAE.Production of proinflammatory molecules can be upregulated inthe CNS as a result of the migration of inflammatory cells into theCNS, as well as secretion of proinflammatory factors by residentglia. IL-17 is a potent inflammatory cytokine that helps to recruitmonocytes and neutrophils to the site of inflammation, similar toIFN-g (31). IL-17 activates immune cells to produce a host ofchemokines, cytokines, and adhesion molecules and as a resultcontributes to a more severe EAE disease course (32). In addition,IL-17 has been shown to contribute to the pathology of multiplesclerosis. We found that IL-17, INF-g, and IL-2 production areincreased during acute EAE in both WT and AKT32/2 mice, withsignificantly higher mRNA expression in spinal cords fromAKT32/2 mice. This finding suggests that influx of inflammatorycells into the CNS or activation of resident inflammatory cellssignificantly increased cytokine mRNA production in AKT32/2

spinal cord relative to WT mice. IL-6 produced by T cells, mac-rophages, and microglia can be both proinflammatory and anti-inflammatory. IL-6 can suppress TNF-a, which itself can promoteinflammation or promote remyelination depending upon whichreceptor (TNFR1 or TNFR2) is activated (33). During EAE, TNF-a mRNA was significantly increased in the sensitized WT andAKT32/2 spinal cords relative to the naive spinal cords; however,there was no significant difference in mRNA between the twogroups of mice.

Our data support our hypothesis that the loss of AKT3 affectsthe severity of EAE. Currently, there are no known downstreamsubstrates for AKT3, and additional studies are warranted to ex-plore this line of study. It is also possible that, rather than novelsubstrates for each AKT isoform, there is preferential localizationof each isoform to a subcellular region of the cell, without whichnormal cell signaling cannot occur. Because AKT3 was determinedto be activated following heat shock and oxidative stress (34), itlikely contributes to maintaining normal homeostasis in the CNS,and in its absence the resulting damage can increase influx ofinfiltrating inflammatory cells. This effect may be compoundedby the fact that AKT3-deficient effector CD4+ T cells are less sus-ceptible to Treg-mediated suppression.

AcknowledgmentsWe thank Rebecca Bauer, who participated in the high school summer re-

search program, for help with the Myelin Black-Gold II stain, and Dr.

Hyeon-Sook Suh and Sunhee Lee for access to some of their mouse cytokine

and control primer pairs.

DisclosuresThe authors have no financial conflicts of interest.

References1. Manning, B. D., and L. C. Cantley. 2007. AKT/PKB signaling: navigating

downstream. Cell 129: 1261–1274.2. Engelman, J. A., J. Luo, and L. C. Cantley. 2006. The evolution of phosphati-

dylinositol 3-kinases as regulators of growth and metabolism. Nat. Rev. Genet. 7:606–619.

3. Cho, H., J. L. Thorvaldsen, Q. Chu, F. Feng, and M. J. Birnbaum. 2001. Akt1/PKBalpha is required for normal growth but dispensable for maintenance ofglucose homeostasis in mice. J. Biol. Chem. 276: 38349–38352.

4. Yang, Z. Z., O. Tschopp, M. Hemmings-Mieszczak, J. Feng, D. Brodbeck,E. Perentes, and B. A. Hemmings. 2003. Protein kinase B alpha/Akt1 regulatesplacental development and fetal growth. J. Biol. Chem. 278: 32124–32131.

5. Chen, W. S., P. Z. Xu, K. Gottlob, M. L. Chen, K. Sokol, T. Shiyanova,I. Roninson, W. Weng, R. Suzuki, K. Tobe, et al. 2001. Growth retardation andincreased apoptosis in mice with homozygous disruption of the Akt1 gene.Genes Dev. 15: 2203–2208.

6. Flores, A. I., S. P. Narayanan, E. N. Morse, H. E. Shick, X. Yin, G. Kidd,R. L. Avila, D. A. Kirschner, and W. B. Macklin. 2008. Constitutively active Aktinduces enhanced myelination in the CNS. J. Neurosci. 28: 7174–7183.

7. Cho, H., J. Mu, J. K. Kim, J. L. Thorvaldsen, Q. Chu, E. B. Crenshaw, III,K. H. Kaestner, M. S. Bartolomei, G. I. Shulman, and M. J. Birnbaum. 2001.Insulin resistance and a diabetes mellitus-like syndrome in mice lacking theprotein kinase Akt2 (PKB beta). Science 292: 1728–1731.

8. Tschopp, O., Z. Z. Yang, D. Brodbeck, B. A. Dummler, M. Hemmings-Mieszczak, T. Watanabe, T. Michaelis, J. Frahm, and B. A. Hemmings. 2005.Essential role of protein kinase B gamma (PKB gamma/Akt3) in postnatal braindevelopment but not in glucose homeostasis. Development 132: 2943–2954.

9. Easton, R. M., H. Cho, K. Roovers, D. W. Shineman, M. Mizrahi, M. S. Forman,V. M. Lee, M. Szabolcs, R. de Jong, T. Oltersdorf, et al. 2005. Role for Akt3/protein kinase Bgamma in attainment of normal brain size. Mol. Cell. Biol. 25:1869–1878.

10. Ahmed, N. N., H. L. Grimes, A. Bellacosa, T. O. Chan, and P. N. Tsichlis. 1997.Transduction of interleukin-2 antiapoptotic and proliferative signals via Aktprotein kinase. Proc. Natl. Acad. Sci. USA 94: 3627–3632.

11. Cantrell, D. 2002. Protein kinase B (Akt) regulation and function in T lymphocytes.Semin. Immunol. 14: 19–26.

12. Kane, L. P., P. G. Andres, K. C. Howland, A. K. Abbas, and A. Weiss. 2001. Aktprovides the CD28 costimulatory signal for up-regulation of IL-2 and IFN-gamma but not TH2 cytokines. Nat. Immunol. 2: 37–44.

13. Plas, D. R., S. Talapatra, A. L. Edinger, J. C. Rathmell, and C. B. Thompson.2001. Akt and Bcl-xL promote growth factor-independent survival throughdistinct effects on mitochondrial physiology. J. Biol. Chem. 276: 12041–12048.

14. Wieman, H. L., J. A. Wofford, and J. C. Rathmell. 2007. Cytokine stimulationpromotes glucose uptake via phosphatidylinositol-3 kinase/Akt regulation ofGlut1 activity and trafficking. Mol. Biol. Cell 18: 1437–1446.

15. Pierau, M., S. Engelmann, D. Reinhold, T. Lapp, B. Schraven, and U. H. Bommhardt.2009. Protein kinase B/Akt signals impair Th17 differentiation and support naturalregulatory T cell function and induced regulatory T cell formation. J. Immunol. 183:6124–6134.

16. Mao, C., E. G. Tili, M. Dose, M. C. Haks, S. E. Bear, I. Maroulakou, K. Horie,G. A. Gaitanaris, V. Fidanza, T. Ludwig, et al. 2007. Unequal contribution of Aktisoforms in the double-negative to double-positive thymocyte transition. J.Immunol. 178: 5443–5453.

17. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of thehead of bacteriophage T4. Nature 227: 680–685.

1538 AKT3 DEFICIENCY WORSENS EAE

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

18. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of pro-teins from polyacrylamide gels to nitrocellulose sheets: procedure and someapplications. Proc. Natl. Acad. Sci. USA 76: 4350–4354.

19. Suh, H. S., M. Cosenza-Nashat, N. Choi, M. L. Zhao, J. F. Li, J. W. Pollard,R. L. Jirtle, H. Goldstein, and S. C. Lee. 2010. Insulin-like growth factor 2 re-ceptor is an IFNgamma-inducible microglial protein that facilitates intracellularHIV replication: implications for HIV-induced neurocognitive disorders. Am. J.Pathol. 177: 2446–2458.

20. Stromnes, I. M., and J. M. Goverman. 2006. Active induction of experimentalallergic encephalomyelitis. Nat. Protoc. 1: 1810–1819.

21. Endersby, R., X. Zhu, N. Hay, D. W. Ellison, and S. J. Baker. 2011. Nonre-dundant functions for Akt isoforms in astrocyte growth and gliomagenesis in anorthotopic transplantation model. Cancer Res. 71: 4106–4116.

22. Davidson, T. S., and E. M. Shevach. 2011. Polyclonal Treg cells modulate Teffector cell trafficking. Eur. J. Immunol. 41: 2862–2870.

23. Wehrens, E. J., G. Mijnheer, C. L. Duurland, M. Klein, J. Meerding, J. vanLoosdregt, W. de Jager, B. Sawitzki, P. J. Coffer, B. Vastert, et al. 2011. Func-tional human regulatory T cells fail to control autoimmune inflammation due toPKB/c-akt hyperactivation in effector cells. Blood 118: 3538–3548.

24. Xie, Q. W., R. Whisnant, and C. Nathan. 1993. Promoter of the mouse geneencoding calcium-independent nitric oxide synthase confers inducibility by in-terferon gamma and bacterial lipopolysaccharide. J. Exp. Med. 177: 1779–1784.

25. Misko, T. P., J. L. Trotter, and A. H. Cross. 1995. Mediation of inflammation byencephalitogenic cells: interferon gamma induction of nitric oxide synthase andcyclooxygenase 2. J. Neuroimmunol. 61: 195–204.

26. Tada, Y., A. Ho, T. Matsuyama, and T. W. Mak. 1997. Reduced incidence andseverity of antigen-induced autoimmune diseases in mice lacking interferonregulatory factor-1. J. Exp. Med. 185: 231–238.

27. Lin, R. F., T. S. Lin, R. G. Tilton, and A. H. Cross. 1993. Nitric oxide localized tospinal cords of mice with experimental allergic encephalomyelitis: an electronparamagnetic resonance study. J. Exp. Med. 178: 643–648.

28. Galea, E., D. J. Reis, and D. L. Feinstein. 1994. Cloning and expression ofinducible nitric oxide synthase from rat astrocytes. J. Neurosci. Res. 37: 406–414.

29. Chew, L. J., W. C. King, A. Kennedy, and V. Gallo. 2005. Interferon-gammainhibits cell cycle exit in differentiating oligodendrocyte progenitor cells. Glia52: 127–143.

30. Thakur, A. B., and N. F. Landolfi. 1999. A potent neutralizing monoclonal an-tibody can discriminate amongst IFNgamma from various primates with greaterspecificity than can the human IFNgamma receptor complex. Mol. Immunol. 36:1107–1115.

31. Kang, Z., C. Z. Altuntas, M. F. Gulen, C. Liu, N. Giltiay, H. Qin, L. Liu,W. Qian, R. M. Ransohoff, C. Bergmann, et al. 2010. Astrocyte-restricted ab-lation of interleukin-17-induced Act1-mediated signaling ameliorates autoim-mune encephalomyelitis. Immunity 32: 414–425.

32. Komiyama, Y., S. Nakae, T. Matsuki, A. Nambu, H. Ishigame, S. Kakuta,K. Sudo, and Y. Iwakura. 2006. IL-17 plays an important role in the devel-opment of experimental autoimmune encephalomyelitis. J. Immunol. 177:566–573.

33. Arnett, H. A., J. Mason, M. Marino, K. Suzuki, G. K. Matsushima, and J. P. Ting.2001. TNF alpha promotes proliferation of oligodendrocyte progenitors andremyelination. Nat. Neurosci. 4: 1116–1122.

34. Shaw, M., P. Cohen, and D. R. Alessi. 1998. The activation of protein kinase Bby H2O2 or heat shock is mediated by phosphoinositide 3-kinase and not bymitogen-activated protein kinase-activated protein kinase-2. Biochem. J. 336:241–246.

The Journal of Immunology 1539

by guest on June 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from