synthesis and purification of biologically active rat brain-derived neurotrophic factor from...
TRANSCRIPT
Vol. 186, No. 3, 1992
August 14, 1992
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
Pages 1553-1559
SYNTHESIS AND PURIFICATION OF BIOLOGICALLY ACTIVE RAT
BRAIN- DERIVED NEUROTROPHIC FACTOR FROM E S C H E R I C H I A C O L I
Alessandro Negrol t , Vincenza Corsat, Carlo Moretto*, Stephen D. Skaper #,
and Lanfranco Callegarot
t Advanced Technology Division and #Fidia Research Laboratories,
Fidia S.p.A., Abano Terme 35031, Italy
*Dept. of Organic Chemistry, University of Padua, Italy
Received June i0, 1992
SUMMARY: The cDNA for rat brain-derived neurotrophic factor was cloned as the prepro and mature sequences into two independent expression vectors under control of the T7 promoter. When these vectors were transfected into Escherichia coli the prepro and mature forms of brain-derived neurotrophic factor accounted for about 20% and 25% of total E. coli proteins, and displayed molecular sizes of 26kDa and 15kDa, respectively. Mature brain-derived neurotrophic factor was extracted from E.coli inclusion bodies, refolded in the presence of CuC12 and purified. The resulting protein had an ED50 of 3ng/ml in supporting survival of cultured embryonic dorsal root ganglion neurons. ® 1992 Academic P . . . . . I n c .
Neurotrophic factors are critically involved in the development and
maintenence of both the peripheral and central nervous systems (1). The best
characterized neurotrophic molecule is NGF, which promotes survival, growth,
and biochemical differentiation of peripheral sympathetic and sensory neurons
and basal forebrain cholinergic neurons (1-3). Recently, molecular clones have
been isolated and characterized for three other members of the same gene family,
BDNF, n e u r o t r o p h i n - 3 / h i p p o c a m p u s - d e r i v e d neuro t roph ic factor and
neurotrophin-4. (4-13). NGF, and BDNF and neurotrophin-3 mRNAs are
1 To whom correspondence should be addressed at Advanced Technology Division, Fidia S.p.A., via Ponte della Fabbrica 3/A, 35031 Abano Terme (PD), Italy.
Abbreviat ions used: BDNF, brain-derived neurotrophic factor; CNS, central nervous system; HPLC, high performance liquid chromatography; IPTG, isopropyl-B-D-thiogalactopyranoside; NGF, nerve growth factor; PCR, p o l y m e r a s e chain react ion; SDS-PAGE, SDS p o l y a c r y l a m i d e gel electrophoresis.
1553
0006-291X/92 $4.00 Copyright © 1992 by Academic Press, Inc.
All rights of reproduction in any form reserved.
Vol. 186, No. 3, 1992 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
expressed in various populations of neurons in the brain, with highest levels in
the hippocampus (5,7,9,14).
The functions of BDNF and other neurotrophins in the central CNS are not
yet known, but BDNF has been shown to increase the survival of cultured
retinal ganglion cells (15), basal forebrain cholinergic neurons (16), and ventral
mesencephalic dopaminergic neurons (17). The fact that BDNF was originally
isolated from the brain (18) further suggests that BDNF controls primarily
neurons within or directly connected with the CNS. The limited quantities of
neurotrophic proteins in tissues, however , hampers the i r study. Bacterial
systems permit product ion of large amounts of recombinant molecules,
a l though proteins containing intrachain disulfide bonds like NGF (and
presumably other neurotrophins) present problems of correct refolding (19,20).
Here we describe the first synthesis and characterization of biologically active rat
BDNF from E.coli.
MATERIALS AND METHODS
Materials:Enzymes were purchased from Bethesda Research Laboratories. cDNA was p r e p a r e d us ing a commerc i a l l y ava i l ab le kit (S t ra tagene) . Deoxyoligonucleotide primers were synthesized with a DNA synthesizer (Model 380B, Applied Biosystems). PCR was performed using the Amplitaq kit (Cetus- Perkin Elmer). The host cell line E. coli BL21 (DE3) and plasmid pT7.7 were generously provided by Dr. Stan Tabor (Harvard Medical School). DNA manipulat ion, t ransformation, and plasmid purif ication were per formed according to published procedures (21). All plasmid constructs were transformed in the HB101 E. coli strain and the sequences verified by double-s t randed sequencing (22).
Construction of eucaryotic expression plasmid: Two oligonucleotides derived from the 5' and 3' regions of the mouse BDNF gene (23) were used as primers for amplification of the coding region by PCR (24) using rat brain cDNA as template. Restriction sites XbaI and SalI were incorporated into the primers. The sequences of the deoxyoligonucleotide primers were: forward: 5' TTTCTAGATGACCATCCTTTTCCTTAC 3' reverse: 3' AAGTCGACTATCTTCCCTTTTAATGG 5'. The amplified sequence was cut at XbaI and SalI and cloned into pGEM3 (Promega) and pSVT7 (21) under control of the SV40 promoter for transient expression in COS-7 cells as describeed previously (4).
Construction of procaryotic expression plasmids: In order to clone BDNF in the procaryot ic expression plasmid pT7.7 two other primers containing the restriction site NdeI were synthesized. The first primer served to obtain the preprosequence of BDNF, and the second primer the mature sequence of BDNF. prepro primer: forward: 5'TTCATATGCACTCTGACCCCGCCCG 3' mature primer: forward: 5'TTCATATGACCATCCTTTTCCTTAC 3' The primer for mature BDNF contains a Met codon at the amino terminus for transduction. Other nucleotides were changed to decrease the structural stability of mRNA (25) without altering the amino acid sequence. For PCR, BDNF cloned into pGEM3 was used as template with an annealing temperature of 42°C for the
1554
Vol. 186, No. 3, 1992 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
first two cycles; subsequently the annealing temperature was raised to 54°C. The plasmids generated are shown in Fig. 1.
Induction of the expression of BDNF in E.coli: Two liters of E.coli BL21 (DE3) carrying the plasmids pT7.7 BDNF amd pT7.7pBDNF were grown in Luria broth with 200~tg/ml of ampicillin (37°C) until reaching an O.D. of 0.6 (590nm). Production of the recombinant proteins was induced by addition of 1ram IPTG for 3hr. Localization of BDNF to periplasmic or cytoplasmic regions of E.Coli was done according to (21).
Refolding conditions: The inclusion bodies were solubilized in 6M guanidinium, 2M dithiothreitol, 50mM acetate, pH 4.5 for 1hr. The supernatant obtained after centrifugation at 10,000g for 20min was adjusted to a protein concentration of 20~tg/ml. Renaturation was performed by air oxidation at room temperature for 72hr in the presence of 3M guanidinuim and 6uM CuC12 in 50mM Tris/HC1 pH8.5. The protein solution was then applied to a CM cellulose column and BDNF eluted with 0.5M NaC1, pH 9.0. The BDNF fraction was further purified using reverse phase HPLC ; BDNF eluted at approximately 40% (v/v) acetonitrile in trifluoroacetic acid.
Analytical SDS-PAGE: Bacterial culture samples were analyzed on 15% SDS- PAGE (26), and the gels stained with Coomassie brillant blue.
Biological assay: Biological activity of BDNF was assayed using cultured neurons from chicken embryonic day 10 dorsal root ganglia, as described by Skaper and Varon (27) for NGF.
RESULTS
Expression of recombinant BDNF in Escherichia coli Suitable plasmids were constructed which allowed for the expression of
preproBDNF and mature BDNF in E. coli BL21(DE3) (Fig. 1). A 26-KDa band
appeared on a stained SDS-polyacrylamide gel when E. coli transformed with
pT7.7pBDNF were induced with IPTG (Fig. 2, lane c), in accord with the
molecular weight deduced from the preproBDNF nucleotide sequence. The
amount of preproBDNF as judged by densitometric scans of the stained gel was
about 20% of the total bacterial proteins. No induced band at 15-KDa was visible,
which would correspond to mature BDNF.
Recombinant E.coli carrying plasmid pT7.7BDNF yielded a 15-KDa band
on the stained SDS-polyacrylamide gel upon induction with IPTG ( Fig. 2, lane
b).This protein species accounted for some 25% of the total protein. Both BDNF
species were present exclusively in inclusion bodies, with no evidence for either
a cytoplasmic or extracellular location.
Refolding and purification of recombinant BDNF
Because the BDNF produced in this system is not biologically active, a
refolding method was devised to permit recovery of an active protein.
Accumulation of BDNF in the bacterial inclusion bodies accounted for over 80%
1555
Vol. 186, No. 3, 1992 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
N
• T 7 p r o m o t e r
A M P r
p T T . T p B D N F ( 3 2 0 0 K b )
Figure 1. Structure of the expression plasmids for preproBDNF (pT7.7pBDNF) and mature BDNF (pT7.7BDNF). Arrows indicate the direction of transcription.
of the protein in the insoluble fraction (optical density tracing). A buffer
cointaining 6M guanidinium and 0.1M Tris (pH 4.5) was used to solubilize these
proteins. After refolding (renaturation) by allowing oxidation in the presence of
CuC12, cation exchange chromatography and reverse phase HPLC (Fig. 3) were
used to purify the recombinant protein. Neuronal survival bioassays indicated a
single peak of activity, and the protein sample was run as a single 15-KDa band
on a SDS-polyacrylamide gel (Fig. 3, inset); purity was greater than 95%. With
this procedure it is possible to obtain approximately 100~tg of purified BDNF per
liter of bacterial culture, after refolding. Sequencing revealed the presence of an
a b c
Figure 2. Expression of recombinant rat BDNF in E.coli. Samples of E. coli lysate were applied to a 15% SDS-PAGE gel, followed by Coomassie blue staining. E. coli BL21 (DE3) transformed with: (b) pT7.7 BDNF, (c) pT7.7 pBDNF. (a) molecular weight standards.
1556
Vol. 186, No. 3, 1992 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
0.I0,
0.08, ,-/
m 0 . 0 6 . ~J Z
, ¢
© 0 . 0 4 .
, C
0 . 0 2 ,
O , m
a b r - . . . . . . . . .
/ I I I
/ I
/ i
I i i
, i I I I
l b 2to 3 0
ELUTION tMnvJ
i lO0
80
- 6 0 - ~ N
b -
© - 4 0 }-'-
o~ - 2 0 q" r
i
, .5
.o
Figure 3. Reverse phase HPLC of rat BDNF. After refolding and cation exchange chromatography, proteins were applied to a Vydac C18 reverse phase HPLC column (0.46x30cm) equilibrated in water containing 0.1% trifluoroacetic acid. The gradient was developed with acetonitrile in 0.1% trifluoroacetic acid. Inset: 15% SDS PAGE of biologically active fraction (*) from HPLC and silver stained.
addi t ional Met res idue at the N- te rminus of ma tu r e BDNF, which did not appea r
to affect neu ro t roph ic activity. Pur i f ied r ecombinan t rat BDNF s u p p o r t e d the
surv iva l and neur i te ou tg rowth of dorsal root gangl ion neurons , wi th an EC50 of
2 - 3 n g / m l (Fig. 4) be ing close to the dissocia t ion cons tant of the h igh-af f in i ty
BDNF receptor (28).
2 0
1 6 ~d
©
Z 8
© O
J
o:3 ; h ,'o 3'0 16o 3~o n ~ / r n l
.Figure 4.Biological activity of BDNF before (A) and after (a)reverse phase HPLC. Neuronal survival assays were performed according to (27).
1557
Vol . 186, No. 3, 1992 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
DISCUSSION
Some proteins, such as human growth hormone, are actively secreted by
E.coli because the leader peptide is recognized by bacterials cells (29). While
BDNF possesses a leader peptide and is secreted by eukaryotic cells (4,30; our
unpubl i shed data), E.coli are unable to recognize this leader pept ide and
therefore do not process BDNF to its mature form. This is the first report of
successful expression of biologically active mature BDNF in bacteria.
Recombinant BDNF has been produced in transiently transfected COS
cells (4) and stably transfected CHO cells (30), and purified in the latter case.
Conditioned medium from transfected cells can be used to some extent in in
vitro studies, although it is not possible to quantify the amount of BDNF present,
nor easily apply this material to in vivo experiments. The specific activity of the
human BDNF obtained by Rosenthal et al. (30) was comparable to that of the
present E. coli-derived rat BDNF. The system described here has several
advantages, namely it is less expensive and time-consuming than that using
mammalian cells, and a less complicated purification scheme is needed to purify
the protein from bacterial inclusion bodies rather than culture conditioned
medium. More importantly, the refolding procedure can be applied to other
neurotrophins, all of which likely have disulfide bridges and present similar
problems of biological activity in E.coli (20).
Brain injury leads to increased levels of BDNF mRNA (31,32).
Furthermore, BDNF mRNA levels are reduced in the h ippocampus of
Alzheimer's disease brain (33). Thus, BDNF may play an important role in CNS
functions. The availability of pure recombinant BDNF will facilitate studies on
the neurotrophic actions of this molecule.
REFERENCES
1. Barde, A., (1989) Neuron 2, 1525-1534. 2. Levi-Montalcini, R. (1987) Science 237, 1154-1162. 3.Thoenen, H., Bantlow, C., and Heumann, R. (1987) Rev. Physiol. Biochem.
Pharmacol. 109, 145-160. 4. Leibrock, J., Lottspeich, F., Hohn, A., Hofer, M., Hengerer, B., Masiakowski, P.,
Thoenen, H., and Barde, Y.-A. (1989) Nature 341, 149-152. 5. Hohn, A., Leibrock, J., Bailey, K., and Barde, Y.-A. (1990) Nature 344, 339-341. 6. Maisonpierre, P.C., Belluscio, L., Squinto, S., Ip, N.Y., Furth,M.E., Lindsay,
R.M., and Yancopoulos, G.D. (1990) Science 247, 1446-1451. 7. Ernfors, P., Ibafiez, C.F., Ebendal, T., Olson, L., and Persson, H. (1990) Proc. Natl.
Acad. Sci. USA 87, 5454-5458. 8. Kaisho, Y., Yoshimura, K., and Nakahama, K. (1990) FEBS Lett. 266,187-191. 9. Ernfors, P., Wetmore, C., Olson, L., and Persson, H. (1990) Neuron 5, 511-526. 10.Rosenthal, A., Goeddel D.V., Nguyen, T., Lewis, M., Shih, A.,Laramee, G.R.,
Nikolics, K., and Winslow, J.W. (1990) Neuron 4, 767-773. 11.Jones, K.R., and Reichardt, L.P. (1990) Proc. Natl. Acad. Sci. USA 87, 8060-8064. 12.Hallb66k, F., Ibgtfiez, C.F., and Persson, H. (1991) Neuron 6, 845-858.
1558
Vol. 186, No. 3, 1992 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
13.Ip, N.Y., Ibafiez, C.F., Nye, S.H., McClain, J., Jones, P.F., Gies, D.R., Belluscio, L., LeBeau, M.M., Espinosa III, R., Squinto, S.P., Persson, H., and Yancopoulos, G.D. (1992) Proc. Nail. Acad. Sci. USA 89, 3060-3064.
14.Maisonpierre, P.C., Bellluscio, L., Friedman, B., Alderson, R.F.,Wiegand, S.J., Furth, M.E., Lindsay, R.M., and Yancopoulos, G.D.(1990) Neuron 5, 501-509.
15.Johnson, J.E., Barde, Y.-A., Schwab, M., and Thoenen, H. (1986) J. Neurosci. 6, 3031-3038.
16.Alderson,R.F., Alterman, A., Barde, Y.-A., and Lind~ay, R.M.(1990) Neuron 5, 297-306.
17.Hyman, C., Hofer, M., Barde, Y.-A, Juhasz, M. Yancopoulos, G.D., Squinto, S.P., and Lindsay, R.M. (1991) Nature 350, 230-232.
18.Barde, Y.-A., Edgar, D., and Thoenen, H. (1982) EMBO J. 1,559-553. 19.Dicou, E. (1992) Neurochem. Internatl. 20, 129-134. 20.Negro A., Martini I., Bigon, E., Cazzola, F., Minozzi, C.-M., Skaper S.D., and
Callegaro, L. (1992) Gene 110, 251-256. 21.Sambrook, S.D., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: A
laboratory Manual, Cold spring Harbor Laboratory, Cold Spring Harbor, NY. 22.Sanger, F., Nicklen, S., and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74,
5463-5468. 23.Hofer, M., Pagliusi, S.P., Hohn, A., Leibrock, J., and Barde, Y.-A. (1990) EMBO J.
9, 2459-2464. 24.Saiki, R.K., Sharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A., and
Arnheim, N. (1985) Science 230, 1350-1354. 25.Zucker, M., and Striegler, P., (1981) Nucleic Acids Res. 9, 133-148. 26.Laemmli, U.K. (1970) Nature 227, 680-685. 27.Skaper, S.D., and Varon, S. (1986) Dev. Brain Res. 24, 39-46. 28.Rodriguez-Tebar, A., Dechant, G.G., and Barde, Y.-A. (1990) Neuron 4, 487-492. 29.Chang, C.M., Rey, M., Bochner, B., Heyneker, H., and Gray, G. (1987) Gene 55,
187-196. 30.Rosenthal, A., Goeddel, D.V., Nguyen, T., Martin, E., Burton L.E., Shih, A.,
Laramee, G.R., Wurm, F., Mason, A., Nikolics, K., and Winslow, J.W. (1991) Endocrinology 129, 1289-1294.
31.Ballarin M., Ernfors, P., Lindefors N., and Persson, H. (1991) Exp. Neurol. 114, 35-43.
32. Lindvall, O., Ernfors, P., Benozon, J., Kokaia, Z., Smith, M.-J., Siesjo, B.K., and Persson, H., (1992) Proc. Natl. Acad. Sci. USA 89, 648-652.
33.Phillips, H.S., Hains, J.M., Armanini, M., Laramee, G., Johnson, S.A., and Winslow, J.W.(1991) Neuron 7, 695-702.
1559