synthesis and purification of biologically active rat brain-derived neurotrophic factor from...

Vol. 186, No. 3, 1992

August 14, 1992

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Pages 1553-1559

SYNTHESIS AND PURIFICATION OF BIOLOGICALLY ACTIVE RAT

BRAIN- DERIVED NEUROTROPHIC FACTOR FROM E S C H E R I C H I A C O L I

Alessandro Negrol t , Vincenza Corsat, Carlo Moretto*, Stephen D. Skaper #,

and Lanfranco Callegarot

t Advanced Technology Division and #Fidia Research Laboratories,

Fidia S.p.A., Abano Terme 35031, Italy

*Dept. of Organic Chemistry, University of Padua, Italy

Received June i0, 1992

SUMMARY: The cDNA for rat brain-derived neurotrophic factor was cloned as the prepro and mature sequences into two independent expression vectors under control of the T7 promoter. When these vectors were transfected into Escherichia coli the prepro and mature forms of brain-derived neurotrophic factor accounted for about 20% and 25% of total E. coli proteins, and displayed molecular sizes of 26kDa and 15kDa, respectively. Mature brain-derived neurotrophic factor was extracted from E.coli inclusion bodies, refolded in the presence of CuC12 and purified. The resulting protein had an ED50 of 3ng/ml in supporting survival of cultured embryonic dorsal root ganglion neurons. ® 1992 Academic P . . . . . I n c .

Neurotrophic factors are critically involved in the development and

maintenence of both the peripheral and central nervous systems (1). The best

characterized neurotrophic molecule is NGF, which promotes survival, growth,

and biochemical differentiation of peripheral sympathetic and sensory neurons

and basal forebrain cholinergic neurons (1-3). Recently, molecular clones have

been isolated and characterized for three other members of the same gene family,

BDNF, n e u r o t r o p h i n - 3 / h i p p o c a m p u s - d e r i v e d neuro t roph ic factor and

neurotrophin-4. (4-13). NGF, and BDNF and neurotrophin-3 mRNAs are

1 To whom correspondence should be addressed at Advanced Technology Division, Fidia S.p.A., via Ponte della Fabbrica 3/A, 35031 Abano Terme (PD), Italy.

Abbreviat ions used: BDNF, brain-derived neurotrophic factor; CNS, central nervous system; HPLC, high performance liquid chromatography; IPTG, isopropyl-B-D-thiogalactopyranoside; NGF, nerve growth factor; PCR, p o l y m e r a s e chain react ion; SDS-PAGE, SDS p o l y a c r y l a m i d e gel electrophoresis.

1553

0006-291X/92 $4.00 Copyright © 1992 by Academic Press, Inc.

All rights of reproduction in any form reserved.

Vol. 186, No. 3, 1992 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

expressed in various populations of neurons in the brain, with highest levels in

the hippocampus (5,7,9,14).

The functions of BDNF and other neurotrophins in the central CNS are not

yet known, but BDNF has been shown to increase the survival of cultured

retinal ganglion cells (15), basal forebrain cholinergic neurons (16), and ventral

mesencephalic dopaminergic neurons (17). The fact that BDNF was originally

isolated from the brain (18) further suggests that BDNF controls primarily

neurons within or directly connected with the CNS. The limited quantities of

neurotrophic proteins in tissues, however , hampers the i r study. Bacterial

systems permit product ion of large amounts of recombinant molecules,

a l though proteins containing intrachain disulfide bonds like NGF (and

presumably other neurotrophins) present problems of correct refolding (19,20).

Here we describe the first synthesis and characterization of biologically active rat

BDNF from E.coli.

MATERIALS AND METHODS

Materials:Enzymes were purchased from Bethesda Research Laboratories. cDNA was p r e p a r e d us ing a commerc i a l l y ava i l ab le kit (S t ra tagene) . Deoxyoligonucleotide primers were synthesized with a DNA synthesizer (Model 380B, Applied Biosystems). PCR was performed using the Amplitaq kit (Cetus- Perkin Elmer). The host cell line E. coli BL21 (DE3) and plasmid pT7.7 were generously provided by Dr. Stan Tabor (Harvard Medical School). DNA manipulat ion, t ransformation, and plasmid purif ication were per formed according to published procedures (21). All plasmid constructs were transformed in the HB101 E. coli strain and the sequences verified by double-s t randed sequencing (22).

Construction of eucaryotic expression plasmid: Two oligonucleotides derived from the 5' and 3' regions of the mouse BDNF gene (23) were used as primers for amplification of the coding region by PCR (24) using rat brain cDNA as template. Restriction sites XbaI and SalI were incorporated into the primers. The sequences of the deoxyoligonucleotide primers were: forward: 5' TTTCTAGATGACCATCCTTTTCCTTAC 3' reverse: 3' AAGTCGACTATCTTCCCTTTTAATGG 5'. The amplified sequence was cut at XbaI and SalI and cloned into pGEM3 (Promega) and pSVT7 (21) under control of the SV40 promoter for transient expression in COS-7 cells as describeed previously (4).

Construction of procaryotic expression plasmids: In order to clone BDNF in the procaryot ic expression plasmid pT7.7 two other primers containing the restriction site NdeI were synthesized. The first primer served to obtain the preprosequence of BDNF, and the second primer the mature sequence of BDNF. prepro primer: forward: 5'TTCATATGCACTCTGACCCCGCCCG 3' mature primer: forward: 5'TTCATATGACCATCCTTTTCCTTAC 3' The primer for mature BDNF contains a Met codon at the amino terminus for transduction. Other nucleotides were changed to decrease the structural stability of mRNA (25) without altering the amino acid sequence. For PCR, BDNF cloned into pGEM3 was used as template with an annealing temperature of 42°C for the

1554


first two cycles; subsequently the annealing temperature was raised to 54°C. The plasmids generated are shown in Fig. 1.

Induction of the expression of BDNF in E.coli: Two liters of E.coli BL21 (DE3) carrying the plasmids pT7.7 BDNF amd pT7.7pBDNF were grown in Luria broth with 200~tg/ml of ampicillin (37°C) until reaching an O.D. of 0.6 (590nm). Production of the recombinant proteins was induced by addition of 1ram IPTG for 3hr. Localization of BDNF to periplasmic or cytoplasmic regions of E.Coli was done according to (21).

Refolding conditions: The inclusion bodies were solubilized in 6M guanidinium, 2M dithiothreitol, 50mM acetate, pH 4.5 for 1hr. The supernatant obtained after centrifugation at 10,000g for 20min was adjusted to a protein concentration of 20~tg/ml. Renaturation was performed by air oxidation at room temperature for 72hr in the presence of 3M guanidinuim and 6uM CuC12 in 50mM Tris/HC1 pH8.5. The protein solution was then applied to a CM cellulose column and BDNF eluted with 0.5M NaC1, pH 9.0. The BDNF fraction was further purified using reverse phase HPLC ; BDNF eluted at approximately 40% (v/v) acetonitrile in trifluoroacetic acid.

Analytical SDS-PAGE: Bacterial culture samples were analyzed on 15% SDS- PAGE (26), and the gels stained with Coomassie brillant blue.

Biological assay: Biological activity of BDNF was assayed using cultured neurons from chicken embryonic day 10 dorsal root ganglia, as described by Skaper and Varon (27) for NGF.

RESULTS

Expression of recombinant BDNF in Escherichia coli Suitable plasmids were constructed which allowed for the expression of

preproBDNF and mature BDNF in E. coli BL21(DE3) (Fig. 1). A 26-KDa band

appeared on a stained SDS-polyacrylamide gel when E. coli transformed with

pT7.7pBDNF were induced with IPTG (Fig. 2, lane c), in accord with the

molecular weight deduced from the preproBDNF nucleotide sequence. The

amount of preproBDNF as judged by densitometric scans of the stained gel was

about 20% of the total bacterial proteins. No induced band at 15-KDa was visible,

which would correspond to mature BDNF.

Recombinant E.coli carrying plasmid pT7.7BDNF yielded a 15-KDa band

on the stained SDS-polyacrylamide gel upon induction with IPTG ( Fig. 2, lane

b).This protein species accounted for some 25% of the total protein. Both BDNF

species were present exclusively in inclusion bodies, with no evidence for either

a cytoplasmic or extracellular location.

Refolding and purification of recombinant BDNF

Because the BDNF produced in this system is not biologically active, a

refolding method was devised to permit recovery of an active protein.

Accumulation of BDNF in the bacterial inclusion bodies accounted for over 80%

1555


N

• T 7 p r o m o t e r

A M P r

p T T . T p B D N F ( 3 2 0 0 K b )

Figure 1. Structure of the expression plasmids for preproBDNF (pT7.7pBDNF) and mature BDNF (pT7.7BDNF). Arrows indicate the direction of transcription.

of the protein in the insoluble fraction (optical density tracing). A buffer

cointaining 6M guanidinium and 0.1M Tris (pH 4.5) was used to solubilize these

proteins. After refolding (renaturation) by allowing oxidation in the presence of

CuC12, cation exchange chromatography and reverse phase HPLC (Fig. 3) were

used to purify the recombinant protein. Neuronal survival bioassays indicated a

single peak of activity, and the protein sample was run as a single 15-KDa band

on a SDS-polyacrylamide gel (Fig. 3, inset); purity was greater than 95%. With

this procedure it is possible to obtain approximately 100~tg of purified BDNF per

liter of bacterial culture, after refolding. Sequencing revealed the presence of an

a b c

Figure 2. Expression of recombinant rat BDNF in E.coli. Samples of E. coli lysate were applied to a 15% SDS-PAGE gel, followed by Coomassie blue staining. E. coli BL21 (DE3) transformed with: (b) pT7.7 BDNF, (c) pT7.7 pBDNF. (a) molecular weight standards.

1556


0.I0,

0.08, ,-/

m 0 . 0 6 . ~J Z

, ¢

© 0 . 0 4 .

, C

0 . 0 2 ,

O , m

a b r - . . . . . . . . .

/ I I I

/ I

/ i

I i i

, i I I I

l b 2to 3 0

ELUTION tMnvJ

i lO0

80

- 6 0 - ~ N

b -

© - 4 0 }-'-

o~ - 2 0 q" r

i

, .5

.o

Figure 3. Reverse phase HPLC of rat BDNF. After refolding and cation exchange chromatography, proteins were applied to a Vydac C18 reverse phase HPLC column (0.46x30cm) equilibrated in water containing 0.1% trifluoroacetic acid. The gradient was developed with acetonitrile in 0.1% trifluoroacetic acid. Inset: 15% SDS PAGE of biologically active fraction (*) from HPLC and silver stained.

addi t ional Met res idue at the N- te rminus of ma tu r e BDNF, which did not appea r

to affect neu ro t roph ic activity. Pur i f ied r ecombinan t rat BDNF s u p p o r t e d the

surv iva l and neur i te ou tg rowth of dorsal root gangl ion neurons , wi th an EC50 of

2 - 3 n g / m l (Fig. 4) be ing close to the dissocia t ion cons tant of the h igh-af f in i ty

BDNF receptor (28).

2 0

1 6 ~d

©

Z 8

© O

J

o:3 ; h ,'o 3'0 16o 3~o n ~ / r n l

.Figure 4.Biological activity of BDNF before (A) and after (a)reverse phase HPLC. Neuronal survival assays were performed according to (27).

1557

Vol . 186, No. 3, 1992 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

DISCUSSION

Some proteins, such as human growth hormone, are actively secreted by

E.coli because the leader peptide is recognized by bacterials cells (29). While

BDNF possesses a leader peptide and is secreted by eukaryotic cells (4,30; our

unpubl i shed data), E.coli are unable to recognize this leader pept ide and

therefore do not process BDNF to its mature form. This is the first report of

successful expression of biologically active mature BDNF in bacteria.

Recombinant BDNF has been produced in transiently transfected COS

cells (4) and stably transfected CHO cells (30), and purified in the latter case.

Conditioned medium from transfected cells can be used to some extent in in

vitro studies, although it is not possible to quantify the amount of BDNF present,

nor easily apply this material to in vivo experiments. The specific activity of the

human BDNF obtained by Rosenthal et al. (30) was comparable to that of the

present E. coli-derived rat BDNF. The system described here has several

advantages, namely it is less expensive and time-consuming than that using

mammalian cells, and a less complicated purification scheme is needed to purify

the protein from bacterial inclusion bodies rather than culture conditioned

medium. More importantly, the refolding procedure can be applied to other

neurotrophins, all of which likely have disulfide bridges and present similar

problems of biological activity in E.coli (20).

Brain injury leads to increased levels of BDNF mRNA (31,32).

Furthermore, BDNF mRNA levels are reduced in the h ippocampus of

Alzheimer's disease brain (33). Thus, BDNF may play an important role in CNS

functions. The availability of pure recombinant BDNF will facilitate studies on

the neurotrophic actions of this molecule.

REFERENCES

1. Barde, A., (1989) Neuron 2, 1525-1534. 2. Levi-Montalcini, R. (1987) Science 237, 1154-1162. 3.Thoenen, H., Bantlow, C., and Heumann, R. (1987) Rev. Physiol. Biochem.

Pharmacol. 109, 145-160. 4. Leibrock, J., Lottspeich, F., Hohn, A., Hofer, M., Hengerer, B., Masiakowski, P.,

Thoenen, H., and Barde, Y.-A. (1989) Nature 341, 149-152. 5. Hohn, A., Leibrock, J., Bailey, K., and Barde, Y.-A. (1990) Nature 344, 339-341. 6. Maisonpierre, P.C., Belluscio, L., Squinto, S., Ip, N.Y., Furth,M.E., Lindsay,

R.M., and Yancopoulos, G.D. (1990) Science 247, 1446-1451. 7. Ernfors, P., Ibafiez, C.F., Ebendal, T., Olson, L., and Persson, H. (1990) Proc. Natl.

Acad. Sci. USA 87, 5454-5458. 8. Kaisho, Y., Yoshimura, K., and Nakahama, K. (1990) FEBS Lett. 266,187-191. 9. Ernfors, P., Wetmore, C., Olson, L., and Persson, H. (1990) Neuron 5, 511-526. 10.Rosenthal, A., Goeddel D.V., Nguyen, T., Lewis, M., Shih, A.,Laramee, G.R.,

Nikolics, K., and Winslow, J.W. (1990) Neuron 4, 767-773. 11.Jones, K.R., and Reichardt, L.P. (1990) Proc. Natl. Acad. Sci. USA 87, 8060-8064. 12.Hallb66k, F., Ibgtfiez, C.F., and Persson, H. (1991) Neuron 6, 845-858.

1558


13.Ip, N.Y., Ibafiez, C.F., Nye, S.H., McClain, J., Jones, P.F., Gies, D.R., Belluscio, L., LeBeau, M.M., Espinosa III, R., Squinto, S.P., Persson, H., and Yancopoulos, G.D. (1992) Proc. Nail. Acad. Sci. USA 89, 3060-3064.

14.Maisonpierre, P.C., Bellluscio, L., Friedman, B., Alderson, R.F.,Wiegand, S.J., Furth, M.E., Lindsay, R.M., and Yancopoulos, G.D.(1990) Neuron 5, 501-509.

15.Johnson, J.E., Barde, Y.-A., Schwab, M., and Thoenen, H. (1986) J. Neurosci. 6, 3031-3038.

16.Alderson,R.F., Alterman, A., Barde, Y.-A., and Lind~ay, R.M.(1990) Neuron 5, 297-306.

17.Hyman, C., Hofer, M., Barde, Y.-A, Juhasz, M. Yancopoulos, G.D., Squinto, S.P., and Lindsay, R.M. (1991) Nature 350, 230-232.

18.Barde, Y.-A., Edgar, D., and Thoenen, H. (1982) EMBO J. 1,559-553. 19.Dicou, E. (1992) Neurochem. Internatl. 20, 129-134. 20.Negro A., Martini I., Bigon, E., Cazzola, F., Minozzi, C.-M., Skaper S.D., and

Callegaro, L. (1992) Gene 110, 251-256. 21.Sambrook, S.D., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: A

laboratory Manual, Cold spring Harbor Laboratory, Cold Spring Harbor, NY. 22.Sanger, F., Nicklen, S., and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74,

5463-5468. 23.Hofer, M., Pagliusi, S.P., Hohn, A., Leibrock, J., and Barde, Y.-A. (1990) EMBO J.

9, 2459-2464. 24.Saiki, R.K., Sharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A., and

Arnheim, N. (1985) Science 230, 1350-1354. 25.Zucker, M., and Striegler, P., (1981) Nucleic Acids Res. 9, 133-148. 26.Laemmli, U.K. (1970) Nature 227, 680-685. 27.Skaper, S.D., and Varon, S. (1986) Dev. Brain Res. 24, 39-46. 28.Rodriguez-Tebar, A., Dechant, G.G., and Barde, Y.-A. (1990) Neuron 4, 487-492. 29.Chang, C.M., Rey, M., Bochner, B., Heyneker, H., and Gray, G. (1987) Gene 55,

187-196. 30.Rosenthal, A., Goeddel, D.V., Nguyen, T., Martin, E., Burton L.E., Shih, A.,

Laramee, G.R., Wurm, F., Mason, A., Nikolics, K., and Winslow, J.W. (1991) Endocrinology 129, 1289-1294.

31.Ballarin M., Ernfors, P., Lindefors N., and Persson, H. (1991) Exp. Neurol. 114, 35-43.

32. Lindvall, O., Ernfors, P., Benozon, J., Kokaia, Z., Smith, M.-J., Siesjo, B.K., and Persson, H., (1992) Proc. Natl. Acad. Sci. USA 89, 648-652.

33.Phillips, H.S., Hains, J.M., Armanini, M., Laramee, G., Johnson, S.A., and Winslow, J.W.(1991) Neuron 7, 695-702.

1559

synthesis and purification of biologically active rat brain-derived neurotrophic factor from...

Documents