synthetic biology
DESCRIPTION
Synthetic BiologyTRANSCRIPT
![Page 1: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/1.jpg)
Synthetic Biology(The Cell as a Nanosystem)
ARC BioinformaticsUC Davis Summer 2006
![Page 2: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/2.jpg)
![Page 3: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/3.jpg)
Synthetic Biology
• Nanotechnology is emulating biology– Molecular assemblers, molecular sensors– ‘Bots’ that deliver medicine to specific cells
• Biotechnology is helping out– Genetic ‘reengineering’ of e-coli, phages
• Nano-Bio or Bio-Nano?– Two very interesting approaches… – The answer might be ‘synthetic biology’
![Page 4: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/4.jpg)
![Page 5: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/5.jpg)
DNA 2.0
• DNA 2.0 Inc. is a leading provider for synthetic biology. With our gene synthesis process you can get synthetic DNA that conforms exactly to your needs, quickly and cost effectively. Applications of custom gene synthesis include codon optimization for increased protein expression, synthetic biology, gene variants, RNAi trans-complementation and much more.
![Page 6: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/6.jpg)
Nano-Bio-Info-Tech (NBIT)
• ‘Fusion’ or ‘convergence’ of– Nanotechnology– Biotechnology– Information technology
• Focus of regional development– Nanobiotechnology (DNA microarrays)– Bioinformatics and Informatics
• Add stem cell and genetic engineering
![Page 7: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/7.jpg)
Some Definitions…
• Bionanotechnology– Biology as seen through the eyes of nano– How do molecules work in biology?– How can we make biology work for us?
• Applications– Self assembled protein metal complexes– DNA scaffolding for arrayed assembly– Phage injection of targeted viral DNA
![Page 8: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/8.jpg)
Bio-Nano Convergence
![Page 9: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/9.jpg)
Bio-Nano Machinery
• Using protein / viral complexes and DNA to self-assemble devices, and novel function, into biomechanical systems
Earth’s early nanostructures ~ 2 billion years ago
![Page 10: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/10.jpg)
NanoBioConvergence
• Nanotechnology used in biotech– DNA microarrays (GeneChip™)– SNP genotyping applications
• Silicon microtechnology for the lab– Lab-On-A-Chip (LOC)– System-On-A-Chip
• Biocompatible engineered surfaces– Better performance / durability in humans
![Page 11: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/11.jpg)
![Page 12: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/12.jpg)
Affymetrix GeneChip™
![Page 13: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/13.jpg)
Nature’s Toolkit
• Self Assembly– Viral caspids– Proteins– Genetic Algorithms
• Information networks– DNA => miRNA => mRNA => Protein– Protein => miRNA = DNA (intron) / DNA (exon)
• Energy networks (proteome / metabolome)
![Page 14: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/14.jpg)
Molecular Self Assembly
Figure1: 3D diagram of a lipid bilayer membrane - water molecules not represented for clarity
http://www.shu.ac.uk/schools/research/mri/model/micelles/micelles.htm
Figure 2: Different lipid model -top : multi-particles lipid molecule
-bottom: single-particle lipid molecule
![Page 15: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/15.jpg)
Viral Self-Assembly
http://www.virology.net/Big_Virology/BVunassignplant.html
![Page 16: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/16.jpg)
Self-Assembled Algorithms
--------------------------- 1010110001011010ATGCCAGTACTGGTACGGTCATGACC0101001110100101---------------------------
![Page 17: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/17.jpg)
Bio-Nano-Info
• Looking at bio through the eyes of nano– Physical properties of small / life systems
• Looking at nano through the eyes of bio– Self-assembly of molecular nano structures
• Interaction of information and molecules– Molecular assemblies as information and
operating systems - nano execution of IT
![Page 18: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/18.jpg)
Nano-Bio-Info-Tech
Nano
Bio Info
Sel
f ass
embl
y
Mic
roar
rays
, Bio
ME
MS
Quantum
computing
nanoelectronic devices
Digital cellsDNA computinginsilico biology
Concept by Robert Cormia
![Page 19: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/19.jpg)
Bio-Informatics
• Looking at life as an information system– DNA as a database– RNA as a decision network– Proteins and genes as runtime DLLs
• Modeling gene regulatory networks– Simulating life as a computer program– Using silicon to validate biological models
![Page 20: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/20.jpg)
Goal of Digital Cells
• Simulate a Gene Regulatory Network– Goal of e-cell, CellML, and SBML projects
• Test microarray data for biological model– Run expression data through GRN functions
• Create biological cells with new functions– Splice in promoters to control expression– Create oscillating networks using operons
![Page 21: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/21.jpg)
Digital Cell Components
• Bio-logic gates– Inverters, oscillators
• Creating genomic circuitry– Promoters, operons and genes
• Multigenic oscillating solutions
• Ron Weiss is the pioneer in the field– http://www.princeton.edu/~rweiss/
![Page 22: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/22.jpg)
Digital Cell Basics
http://www.ee.princeton.edu/people/Weiss.php
![Page 23: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/23.jpg)
Digital Cell Circuit (1)
INVERSE LOGIC. A digital inverter that consists of a gene encoding the instructions for protein B and containing a region (P) to which protein A binds. When A is absent (left)—a situation representing the input bit 0—the gene is active. and B is formed—corresponding to an output bit 1. When A is produced (right)—making the input bit 1—it binds to P and blocks the action of the gene—preventing B from being formed and making the output bit 0. Weiss http://www.ee.princeton.edu/people/Weiss.php
![Page 24: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/24.jpg)
Digital Cell Circuit (2)
In this biological AND gate, the input proteins X and Y bind to and deactivate different copies of the gene that encodes protein R. This protein, in turn, deactivates the gene for protein Z, the output protein. If X and Y are both present, making both input bits 1, then R is not built but Z is, making the output bit 1. In the absence of X or Y or both, at least one of the genes on the left actively builds R, which goes on to block the construction of Z, making the output bit 0. Weiss
http://www.ee.princeton.edu/people/Weiss.php
![Page 25: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/25.jpg)
Digital Cells – Bio Informatics
http://www.ee.princeton.edu/people/Weiss.php
Modeling life as an information system
![Page 26: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/26.jpg)
Gene Regulatory Network
![Page 27: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/27.jpg)
Basic GRN Circuit Flow
Gross anatomy of a minimal gene regulatory network (GRN) embedded in a regulatory network. A regulatory network can be viewed as a cellular input-output device. http://doegenomestolife.org/
![Page 28: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/28.jpg)
http://doegenomestolife.org/
Gene regulatory networks ‘interface’ with cellular processes
![Page 29: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/29.jpg)
Information vs. Processing
Just as in a computer, data bits and processing bits are made from the same material, 0 or 1, or A, T, C, G, or U in biology
![Page 30: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/30.jpg)
Nature as a Computer
• Biological systems like DNA and RNA especially appear to be more than networks of information.
• RNA itself can be seen as a molecular decision network
![Page 31: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/31.jpg)
E-Cell
• E-Cell System is an object-oriented software suite for modeling, simulation, and analysis of large scale complex systems such as biological cells. Version 3 allows many components driven by multiple algorithms with different timescales to coexist
![Page 32: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/32.jpg)
Computer Modeling Metabolic Pathways
• BioCyc – collection of organism specific metabolic pathway databases
• cellML is an XML based format for exchanging biological data from genes to proteins to metabolism
![Page 33: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/33.jpg)
Digital Cells MeetSynthetic Biology
• Model the circuit
• Validate the circuit
• Tinker with the circuit
• Then…
• Alter the gene to build a new protein– SNPs will give you a ‘first approach’
• See if the new protein is ‘well tolerated’
![Page 34: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/34.jpg)
Gene Therapy
• Gene therapy using an Adenovirus vector. A new gene is inserted into an adenovirus vector, which is used to introduce the modified DNA into a human cell. If the treatment is successful, the new gene will make a functional protein.
http://en.wikipedia.org/wiki/Gene_therapy
![Page 35: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/35.jpg)
DNA Vaccines
• The ultimate method to train the immune system against a multitude of threats
• Inject a known sequence of DNA
• Trick the cell into expressing it, then seeing it as an antigen to ward against.
• Used to fight cancer.
![Page 36: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/36.jpg)
Animal Model Systems
• Mice make perfect models – as they are:
• Cheap (reasonably)• Fast / easy growing• Very ‘inbred’• Mouse DNA arrays
and the mouse genome are fairly well known, characterized
![Page 37: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/37.jpg)
Stem Cell Technology
Once you have an ‘altered genome’ ready to test beyond a simple one cell environment, you leverage the ability of stem cells to ‘mass produce’ your synthetic biology solution
![Page 38: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/38.jpg)
Cell as a Nanosystem
• Bilayer outer lipid membrane
• Energy apparatus• Diffuse metabolome• Proteome with
signaling network• DNA / RNA operating
system, nucleosome miRNA control units
![Page 39: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/39.jpg)
Green Algae at Work Making H2
Algal cell suspension / cells
Thylakoid membrane
These little critters are very happy just to be working!
![Page 40: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/40.jpg)
Proposed Engineered H2 Bacterium
http://gcep.stanford.edu/pdfs/tr_hydrogen_prod_utilization.pdf
![Page 41: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/41.jpg)
In Vitro Photo-Production of H2
Yellow arrow marks insertion of hydrogenase promoter.Right side data cell optimized for continuous H2 production.
![Page 42: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/42.jpg)
Synthetic Biology Roadmap
• Understanding of gene elements and transcriptional control at miRNA level
• Ability to model protein structure, and surface potential / folding / function
• Ability to create functional operons and regulated / feedback transcriptional control
• Stem cell and gene therapy synergism
![Page 43: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/43.jpg)
Role of Bioinformatics
• Where are genes?– What are the regulatory inputs?
• What are the proteins?– Where are post translational modifications?
• What are the pathways?– What are the protein – RNA interactions?
• Can we ‘modulate’ the operon networks to include precision feedback control?
![Page 44: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/44.jpg)
Global Gene Expression
Gene expression tells you how the machine is workingBioinformatics shows you where the control points are
![Page 45: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/45.jpg)
Reprogramming the Cell
• The cell is a molecular system where all parts also participate in an information system.
• We model that system, and then attempt to alter the ‘internal influences’ to create different functional outputs.
![Page 46: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/46.jpg)
Synthetic Proteins
All proteins are ‘synthetic’ – peptides => polymers
![Page 47: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/47.jpg)
Synthetic Proteins
• Synthesis– New polymers
• Biochemistry• Structural studies
– Structure / function
• Functional studies– New properties
• New applications– Cell structure adapts
well to environments
![Page 48: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/48.jpg)
Nature as a NanoToolbox
http://www.cse.ucsc.edu/~hongwang/ATP_synthase.html
![Page 49: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/49.jpg)
Summary
• Nano-Bio-Info Technology– Builds on nanotech and biotech– Adds information tech to model systems
• Synthetic biology– Building informatics into modified genomes– Integrating biology and nanotechnology,
working with life as an information system
• Stem cell work will be the next frontier– Bringing innovation to life in higher organisms
![Page 50: Synthetic Biology](https://reader033.vdocument.in/reader033/viewer/2022061300/54c6fd4c4a79590f458b4582/html5/thumbnails/50.jpg)
References
• http://www.ee.princeton.edu/people/Weiss.php• http://www.dbi.udel.edu/ • http://biospice.lbl.gov/ • http://www.systems-biology.org/ • http://www.e-cell.org/• http://sbml.org/ • http://biocyc.org/• http://www.sbi.uni-rostock.de/teaching/research/ • http://www.ipt.arc.nasa.gov/