t rohwer et al. nature 000 , 1-4 (2011) doi:10.1038/nature09829

T Rohwer et al. Nature 000, 1-4 (2011) doi:10.1038/nature09829 CDW phase transition of 1T-TiSe 2 .

Upload: maddock-walters

Post on 02-Jan-2016

20 views

Category:

Documents

2 download

Report

Download

Embed Size (px):

DESCRIPTION

CDW phase transition of 1T-TiSe 2. T Rohwer et al. Nature 000 , 1-4 (2011) doi:10.1038/nature09829. - PowerPoint PPT Presentation

TRANSCRIPT

T Rohwer et al. Nature 000, 1-4 (2011) doi:10.1038/nature09829

CDW phase transition of 1T-TiSe2.

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

GI Motility online (May 2006) | doi:10.1038/gimo48

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

GI Motility online (May 2006) | doi:10.1038/gimo6

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

doi:10.1038/nature05150 LETTERS

17 September 2009 doi:10.1038/nature08355 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo31

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

GI Motility online (May 2006) | doi:10.1038/gimo12

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

GI Motility online (May 2006) | doi:10.1038/gimo46

1 November 2007 doi:10.1038/nature06221 LETTERS

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

doi:10.1038/nature05202 LETTERS

DOI: 10.1038/NPHYS3211 Supplementary Information for

Nature Biotechnology: doi:10.1038/nbt