targeted rna and dna sequencing in disease prediction ...• down to 2 ng fresh dna qiaseq targeted...
TRANSCRIPT
![Page 1: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/1.jpg)
Sample to Insight
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
Michael Hansen, Ph.D., Technical Specialist
1Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 2: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/2.jpg)
Sample to Insight
Legal disclaimer
QIAGEN products shown here are intended for molecular biology
applications. These products are not intended for the diagnosis,
prevention or treatment of a disease.
For up-to-date licensing information and product-specific
disclaimers, see the respective QIAGEN kit handbook or user
manual. QIAGEN kit handbooks and user manuals are available at
www.qiagen.com or can be requested from QIAGEN Technical
Services or your local distributor.
2Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 3: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/3.jpg)
Sample to Insight
Sample to Insight Workflow
4
Ingenuity Variant Analysis
QIAGEN® Clinical Insight
Interpret
Ingenuity Pathway Analysis
HGMD®
Inova Genomes
Biomedical
Genomics
Workbench
&
Biomedical
Genomics Server
Solution
QIAGEN® Clinical
Insight Analyze
(Early Access)
QIAseq FX
Library Kits
QIAseq 1-step
Amplicon KIt
QIAseq Ultralow
Input Kit
QIAseq miRNA
Library kit
QIAseq stranded
RNA kit
QIAseq RNA
Panels
QIAseq DNA
Panels
QIAseq RNAscan
Panels
QIAamp DNA kits
PAXgene RNA/DNA kits
GeneRead DNA FFPE Kit
QIAamp cfDNA/RNA Kit
exoRNeasy Kits
RNeasy Kits
Thermo
Illumina
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 4: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/4.jpg)
Sample to Insight
What is NGS?
5
Region of interest
+ Whole Genome Sequencing (WGS)
+ Whole Transcriptome Analysis (WTA)
Exome sequencing
Targeted sequencing
Sample preparation
Less info
rmation
Hig
her
covera
ge
Less c
ost
/ effort
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 5: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/5.jpg)
Sample to Insight
NGS can be used to detect all biomarkers
7
Biomarkers
Gene
expression
Copy
number
variants
Indels
Mutations
miRNA
expression
Fusions
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 6: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/6.jpg)
Sample to Insight
QIAseq solutions to detect all biomarkers using NGS
8
Biomarkers
Gene
expression
Copy
number
variants
Indels
Mutations
miRNA
expression
Fusions
QIAseq targeted RNA panels
QIAseq miRNA Library
kit
QIAseq targeted
RNAscan panels
QIAseq targeted DNA panels
QIAseq targeted
DNA panels
QIAseq targeted
DNA panels
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 7: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/7.jpg)
Sample to Insight
Targeted sequencing with UMIs
9
Biomarker
Discovery
DNA
mRNA/lncRNA
Fusion
miRNA
QIAseq Targeted DNA Panels
• UMIs
• Mutation /SNP analysis
• CNV
• Insertions / deletions
• Down to 2 ng fresh DNA
QIAseq Targeted RNAscan Panels
• UMIs
• Known fusion genes (validation)
• Unknown partners (discovery)
QIAseq miRNAseq Kit
• UMIs
• Gel free library prep
• Down to 25 ng RNA
QIAseq Targeted RNA Panel
• UMIs
• Gene expression
• Down to100 pg or 10 cells
All kits utilize SPE (single primer extension)
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 8: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/8.jpg)
Sample to Insight
Challenges of current DNA targeted sequencing approaches
15
Inability to
detect low-
frequency
mutations
Inefficient
enrichment and
sequencing of
GC-rich
regions
PCR and sequencing errors
• Limits sensitivity and accuracy of calling low-frequency variants
o Doesn’t let you confidently call variants down to 1% variant allele frequency
(VAF)
Suboptimal
uniformity of
enrichment and
sequencing
Suboptimal, GC-rich region-incompatible PCR chemistry
• Limits comprehensiveness of panel coverage
o Doesn’t let you efficiently sequence clinically-relevant genes such as CEBPA or
CCND1 – or clinically-relevant regions such as TERT promoter
Conventional PCR protocols and two-primer amplicon design
• Increases variability in coverage across targeted genomic regions
o Causes you to over-sequence to accommodate the under-sequenced
o Doesn’t let you call variants in low-depth regions
Mainly due to inferior PCR amplification approaches.
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 9: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/9.jpg)
Sample to Insight
Challenges of conventional targeted DNA sequencing
PCR duplicates limit accurate quantification
Five reads OR library fragments that look exactly the same.
Cannot tell whether they represent:
1. Five unique DNA molecules, or
2. Quintuplets of the same DNA molecule (PCR duplicates)
Conventional targeted
DNA sequencing
EGFR exon 21
Quantification based on non-unique reads does not reflect
quantities of original DNA molecules
17Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 10: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/10.jpg)
Sample to Insight
Challenges of conventional targeted DNA sequencing
PCR and sequencing errors (artifacts) limit variant calling accuracy
A mutation is seen in 1 out of 5 reads that map to EGFR exon 21.
Cannot accurately tell whether the mutation is:
1. A PCR or sequencing error (artifact)/false positives, or
2. A true low-frequency mutations
Conventional targeted
DNA sequencing
EGFR exon 21
Variant calling based on non-unique reads does not reflect
the mutational status of original DNA molecules
*
18Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 11: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/11.jpg)
Sample to Insight
What is a UMI (molecular barcode)?
A tag (barcode) to identify unique DNA molecules
TATCGTACAGAT(12 nucleotides long)
Incorporate this random barcode (signature)
into the original DNA or RNA molecules before amplification
to preserve their uniqueness
19Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 12: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/12.jpg)
Sample to Insight
5′ AATGTACAGTATTGCGTTTTC NNNNNNNNNNNN CGGCAGGAGACGAAGAG 3′
UMI
What is a UMI (molecular barcode)?
QIAGEN uses UIMIs with 12 random bases.
This corresponds to 16.7 million indices per sample.
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 13: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/13.jpg)
Sample to Insight
How are UMIs incorporated?
Ligate molecularly-barcoded adapters to unique DNA molecules before amplification
DNA
dsDNA
PCR amplification and sequencing
Correct for PCR duplicates and errors
TATCGTACAGAT
Molecularly-barcoded adapter
Incorporate this random barcode (signature)
into the original DNA molecule (before
amplification) to preserve its uniqueness
MB
MB
22Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 14: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/14.jpg)
Sample to Insight
Accurate quantification with UMIs
23
Five reads that look exactly the same
Cannot tell whether they represent:
1. Five unique DNA/RNA molecules, or
2. Quintuplets of the same DNA/RNA molecule (PCR duplicates)
Five unique DNA/RNA molecules
detected from 5 molecular bar codes
Quintuplets of the same DNA/RNA molecule (PCR duplicates)
Detected from 1 molecular bar code
UMI
Conventional
targeted DNA/RNA
sequencing
Digital sequencing
with UMIs
UMIs before any
amplification
EGFR exon 21
UMI
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 15: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/15.jpg)
Sample to Insight
Accurate variant calling with UMIs
24
A mutation is seen in 1 out of 5 reads that map to EGFR exon 21
Cannot accurately tell whether the mutation is:
• A PCR or sequencing error (e.g., artifact or false positive)
• A true low-frequency mutation
False variant is present in some fragments
carrying the same molecular barcode
True variant is present in all fragments
carrying the same molecular barcode
UMI
UMIs before any
amplification
EGFR exon 21
*
* *****
Conventional
targeted DNA/RNA
sequencing
Digital sequencing
with UMIs UMI
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 16: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/16.jpg)
Sample to Insight
Reduction of false positives
27
Enabled by the unique combination of UMIs and UMI-aware bioinformatics
Variant calling performance on 1% NA12878 variants in panel N0030. X-axis is the number of false positives per megabase and y-axis
is sensitivity. Solid lines, dashed lines, and dotted lines represent smCounter, MuTect, and VarDict respectively. Each point on the
ROC curve represents a threshold value. (a) ROC curves of smCounter, MuTect, and VarDict base on 223 SNVs. (b) ROC curves of
smCounter and VarDict on 49 indels. Note that MuTect does not call indels
smCounter =
UMI-aware variant caller
UMI-based analysis:
90% sensitivity at 10
false positives per Mb
Non-UMI-based analysis:
90% sensitivity at 85
false positives per Mb
Xu et al. BMC Genomics (2017) 18:5
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 17: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/17.jpg)
Sample to Insight
Actionable DNA variants for precision medicine
Only a handful of mutations are actionable
Actionable DNA variant BRAF V600EEGFR E746-750
+ Kinase domain mutationHER2
Disease Melanoma Lung adenocarcinomas IDC-breast cancer
Therapy Vemurafenib (PLX4032) Erlotinib/Gefitinib Trastuzumab
Reference genome
AGCTCGTTGCTCAGCTC
Insertion
AGCTCGTTGCTCAGCGTTC
Deletion
AGCTC---GCTCAGCTC
Mutations Indels Copy number variations
T
G
CA
TG
A
C
C
G
CA
TG G
C
G
Point mutation
28Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 18: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/18.jpg)
Sample to Insight
29
QIAseq Targeted DNA Panel Workflow
DNA variant analysis workflow (Illumina®)
UMI
1.5 Days
Enzyme-based random DNA fragmentation
End repair and A tailing
Library quantification
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 19: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/19.jpg)
Sample to Insight
Comprehensive coverage of GC-rich regions
CCND1
GC content
Coverage
GC content
Coverage
CEBPA
The proprietary PCR chemistry used in the QIAseq Targeted DNA Panels enables
efficient coverage of regions high in GC content.
30Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 20: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/20.jpg)
Sample to Insight
Unmatched uniformity
• A 830 kb region was enriched from 20 ng of NA12878 DNA with the
Comprehensive Cancer Panel
• A library was constructed for sequencing on a MiSeq, with 2600x read depth
• The panel achieved a uniformity of 99.5% at 0.2x of mean coverage, and 98% at
0.3x of mean coverage
31Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 21: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/21.jpg)
Sample to Insight
Specifications of QIAseq Targeted DNA Panels
32
DNA input 1–40 ng DNA
Primer multiplexing level 11,500 / 9.600 primers (catalog/custom DNA)
Number of primer pools 1
Enrichment technology SPE-based with molecularly-barcoded adapters
Amplicon size Average 150 bp
Sample multiplexing level 384 (Illumina), 96 (Ion Torrent)
Total workflow time 8–9 hours
Number of libraries per sample 1
Sequencer compatibility Illumina and Ion Torrent platforms
Types of variants detected SNP, indel, CNV
Variant allele frequency called 1% with 40 ng DNA
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 22: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/22.jpg)
Sample to Insight
QIAseq Targeted DNA panel with different DNA input amounts
• QIAseq Targeted DNA Panel
◦ Actionable Solid Tumor Panel
◦ Comprehensive Cancer panel
33
QIAseq Targeted DNA Panels delivered consistently high sequencing specificity and
coverage uniformity with different DNA inputs.
94,0 94,790,5
97,7 97,8 97,499,5 99,6 99,9 99,2 99,4 99,8
0
20
40
60
80
100
120
101Z-1 ng 101Z-10 ng 101Z-20 ng 3501Z-1 ng 3501Z-10 ng 3501Z-20 ng
Percentage
on target% with primer 0.2x mean% baseMT
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 23: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/23.jpg)
Sample to Insight
QIAseq DNA panels on various types of DNA samples
• QIAseq Targeted DNA Panel
◦ Myeloid Neoplasms panel
◦ BRCA1 and BRCA2 Panel
• Blood, bone marrow or FFPE DNA
sample
• QIAseq Targeted DNA Panels delivered
consistently high sequencing
performance across different DNA
sample types
34
50
60
70
80
90
100
110
blood BM BM blood FFPE FFPE FFPE BM
Percentage
on target with primers% 0.2x mean baseMT%
50
60
70
80
90
100
110
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
Percentage
FFPE DNA samples
on target% with primer 0.2x mean baseMT%
Myeloid Neoplasms Panel
BRCA1 and BRCA2 Panel
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 24: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/24.jpg)
Sample to Insight
RS
QIAseq DNA Panel on buccal swap DNA samples
• QIAseq Targeted DNA Inherited Diseases Panel
◦ 298 genes, 11,579 primers in a single tube, ~838 kb region
• Buccal swab DNA sample (20 ng)
◦ Usually contaminated with bacterial DNA that could pose a challenge for target enrichment
97,93 98,2099,10 99,21
50
60
70
80
90
100
110
1 2
Percentage
Buccal swab DNA
on target% with primer
0.2x mean baseMT%
35
QIAseq Targeted DNA Panels achieved high specificity and coverage uniformity on
buccal swab DNA samples indicating high specificity of primers.
.
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 25: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/25.jpg)
Sample to Insight
QIAseq Targeted DNA Panels
List of panels
Panel
Variant
(Cat) number Number of genes Number of primers Type of coverage
Breast Cancer Panel DHS-001Z 93 4831 1
Colorectal Cancer Panel DHS-002Z 71 2929 1
Myeloid Neoplasms Panel DHS-003Z 141 5887 1
Lung Cancer Panel DHS-005Z 72 4149 1
Actionable Solid Tumor Panel DHS-101Z 23 651 2
BRCA1 And BRCA2 Panel DHS-102Z 2 223 1
BRCA1 And BRCA2 Plus Panel DHS-103Z 6 348 1
Pharmacogenomics Panel DHS-104Z 39 146 3
Mitochondria Panel DHS-105Z Chromosome M 222 4
Inherited Diseases Panel DHS-3011Z 298 11,579 1
Comprehensive Cancer Panel DHS-3501Z 275 11,311 1
1. Exonic regions of genes plus 10 bases to cover intron/exon junctions
2. Type 1 coverage for tumor suppressor genes and hotspots for oncogenes
3. SNPs
4. Full chromosome
Types of coverage:
38Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 26: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/26.jpg)
Sample to Insight
QIAseq Targeted DNA panels
List of panels
Panel
Variant
(Cat) number
Panel size
(bases)
Specificity
(reads with primers, %)
Uniformity
(0.2x mean baseMT, %)
Breast Cancer Panel DHS-001Z 370,942 96.47 99.84
Colorectal Cancer Panel DHS-002Z 215,328 90.39 99.79
Myeloid Neoplasms Panel DHS-003Z 436,672 95.31 99.71
Lung Cancer Panel DHS-005Z 318,059 97.3 99.91
Actionable Solid Tumor Panel DHS-101Z 15,160 90.48 99.85
BRCA1 And BRCA2 Panel DHS-102Z 16,405 99.59 100
BRCA1 And BRCA2 Plus Panel DHS-103Z 25,590 99.46 99.92
Pharmacogenomics Panel DHS-104Z 3313 93.43 99.34
Mitochondria Panel DHS-105Z 16,570 99.72 99.08
Inherited Diseases Panel DHS-3011Z 838,627 97.29 99.21
Comprehensive Cancer Panel DHS-3501Z 836,670 97.42 99.76
Uniformity and specificity are defined based on NA12878 tests
39Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 27: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/27.jpg)
Sample to Insight
Customized panels
40
Extended and custom
What is the list of your targets?
Extended
panels
Custom panels
• Extend the contents of an existing cataloged panel
• Turnaround time = 14 days
• Bioinformatically target any gene(s) or genomic region(s) within the
human genome
• Turnaround time = 14 days
Targeted DNA sequencing in disease prediction – detecting sequence variants with digital sequencing
![Page 28: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/28.jpg)
Sample to Insight
QIAseq Targeted DNA Custom Panel performance
41
QIAseq Targeted DNA Custom Panels achieved consistent superior performance
without any optimization.
50
60
70
80
90
100
110
1 2 3 4 5 6 7 8 9 10
Percentage
Custom Panel
on target with primer% 0.2x mean baseMT%
Targeted DNA sequencing in disease prediction – detecting sequence variants with digital sequencing
![Page 29: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/29.jpg)
Sample to Insight
Overcoming current challenges
42
For optimal variant detection
With the QIAseq Targeted DNA Panels, variant detection is done by analyzing
unique DNA molecules instead of total reads.
Current approach Challenges
How QIAseq Targeted DNA Panels
overcome challenges of current
approaches
• Conventional targeted DNA
sequencing for variant detection
• PCR and sequencing errors • UMIs that enable digital sequencing to
correct for PCR and sequencing errors
• Inefficient sequencing of GC-rich
regions
• Proprietary chemistry to efficiently
sequence GC-rich regions
• Suboptimal uniformity of enrichment
and sequencing
• SPE-based primer design to increase
uniformity
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 30: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/30.jpg)
Sample to Insight
QIAGEN’s solutions to overcome challenges of targeted NGS
43
QIAseq Targeted DNA Panels
• Proprietary PCR chemistry to enrich even
GC-rich regions
• Primers based on single primer extension
(SPE) approach for enhanced uniformity
• Detects SNP, indel and CNV
Panel box (kit)
• Molecularly-barcoded library adapters to
incorporate unique molecular indices
(UMIs).
Index box (kit)
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 31: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/31.jpg)
Sample to Insight
QIAGEN’s DNA sequencing solutions
44
Targeted DNA panels for actionable variant identification
Whole genome library preparation using FX technology
Whole genome sequencing from ultra-low input samples
Whole genome sequencing from cell-free DNA
Amplicon sequencing with fast library preparation
Single-cell sequencing
Whole methylome analysisNEW !
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 32: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/32.jpg)
Sample to Insight
RNA targeted panels for disease prediction
45
Why use targeted RNA panels for gene expression analysis ?
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 33: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/33.jpg)
Sample to Insight
Central dogma revisited
46Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 34: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/34.jpg)
Sample to Insight
Central dogma revisited
47Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 35: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/35.jpg)
Sample to Insight
Unparalleled efficiency and flexibility vs RT-qPCR
48
An example: 96 samples, 421 genes
Benefits QIAseq targeted RNA panels RT-qPCR
Material required One pool of primers 105 x 384-well plates
Run time 14 hours for NextSeq500 run 310 hours
(2 hours per plate)
Hands-on time 3 hours (for 96 samples) 105 hours
(one hour per plate)
Cost per sample $65 $239
Sample 10 ng each sample 4 ug each sample
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 36: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/36.jpg)
Sample to Insight
QIAseq Targeted RNAseq - performance
49
Extremely sensitive profiling, avg. 2-5 copy per cell
Highly flexible, from 12 to 1000 or more targets, 1 to 96 samples
High specificity, ~ 97-99% accuracy maintained through all panels
UMIs for absolute quantification
Requires no rRNA depletion or blocking or dT selection
Only 10 ng total RNA
Makes best use of limited NGS budget
System optimized for best possible performance with FFPE samples
Curated knowledge base for gene expression specific panels
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 37: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/37.jpg)
Sample to Insight
Title, Location, Date 50
Value of QIAseq molecular barcode for RNA targeted panels
50
In a well designed, well optimized, and well executed experiment, data from barcodes and reads ~ same. But with
sample variation, FFPE, oversampling, etc. barcodes give a distinct advantage in precision and reproducibility .
Problem:
sequence-dependent amplification bias and noise
Solution:
Molecular barcode, count unique barcodes instead of number of raw reads
![Page 38: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/38.jpg)
Sample to Insight
‘Simple’ procedure, integrated library preparation
51
6 h
ou
rs
GSP1, GSP2
clean up per
primer, thereby
minimizing primer
dimers
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 39: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/39.jpg)
Sample to Insight
QIAseq sample multiplexing guidelines on NGS platforms
52
Where can you run this?
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 40: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/40.jpg)
Sample to Insight
QIAseq Targeted Panels
54
Comprehensive Panels (available for 12 or 96 samples)
Cancer Transcriptome (395)
Inflammation & Immunity Transcriptome (475)
Signal Transduction PathwayFinder (406)
Stem Cell & Differentiation Markers (293)
Molecular Toxicology Transcriptome (370)
Angiogenesis & Endothelial Cell Biology (340)
Apoptosis & Cell Death (264)
ECM & Adhesion Molecules (421)
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 41: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/41.jpg)
Sample to Insight
QIAseq Targeted Panels – content, controls and customization
55
Flexible design, extend your panel
Add 25 of your favorite targets (mRNAs or lncRNAs)
to QIAGEN’s comprehensive panel
lnc13
ADAMT
S9
CAHM
DLEU2
GAS5
GAS6-
AS1
GNAS
LINC00
261
MEG3
MIR31
HG
MIR7-
3HG
NAMAPTCSC1
PTCSC3
TERC
ZFAS1
LINC0
0312DLX6
NEAT
GACA
T1
What is the role of tumor suppressor lncRNAs?
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 42: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/42.jpg)
Sample to Insight
Custom panels
56
Online custom builder
• Choose your own gene content from 54,881
human mRNA and lncRNA
• Easy to use online Custom Panel Builder to
tailor panel to your research needs
o Input list of genes
o Select proper controls (genomic DNA
contamination control, HKGs, or your
own)
o Output: list of genomic coordinates for
primers designed specifically for your
genes of interest
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 43: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/43.jpg)
Sample to Insight
Custom builder
57
Download zip file containing:
• Summary file
• Bed file
All your custom designs
are saved for easy retrieval
Have questions?
Easily contact us
Configure and order
Custom panel
number
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 44: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/44.jpg)
Sample to Insight
Custom builder
58
Gene ID
and
symbol
Strand of the
genome the
gene is onAmplicon
coordinates
Designated
controls
are shown
here
• Single exon (1) means both primers are within one exon
• # Gencode basic RNAs: total number of RNA transcripts found for the gene in Gencode
• # Gencode basic RNAs matched: # of RNA transcripts targeted by the designed amplicon
• # off target genes: rough prediction of # of off target genes that will also get enriched by the
primer pair for the target gene
• Amplicon not genome unique: reads that will not be able to be uniquely mapped to the
genome, so some MT counts might come from another loci
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 45: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/45.jpg)
Sample to Insight
Custom builder
59
Bed fileLocation of designed amplicon
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 46: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/46.jpg)
Sample to Insight
Specifications : Differential Gene Expression :
Species coverage
Biological replicates
Human
Mouse + Rat – Custom
Please consider, n=3 important for statistics
Short reads for FFPE, and
exosomal RNA
Average amplicon size 97 nt, range [95-130 nt]
Coverage across the transcript
We count single common exon per gene. Same design
philosophy as RT2 PCR Arrays
Depth of sequencing Capture enough unique tags of each transcript such that
statistical inferences can be made (>10 tags per gene)
Stranded library prep Not required, assays target unique regions
Type of reads (paired or
unpaired?)
Not necessary, 150 base single reads more than enough for
accurate data
mRNA and lncRNAs
QiaSeq was designed against database containing lncRNA and
mRNA. Assays are specific for lncRNA or mRNA. Currently
54,881 genes from Ensembl version 81
63
Experimental Setup & things to consider
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 47: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/47.jpg)
Sample to Insight
QIAseq workflow: from sample to insight
64
Included in
Panel Kit Included in cloud+ Index Kit+ Library Quant
Kit
Extra : CLC Biomedical workbench with MT plugin
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 48: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/48.jpg)
Sample to Insight
66
Small Molecules – Signal Transduction
• HEK293T Cells were treated with 90 different chemical inhibitors.
• The 421 Signal Transduction Gene Qiaseq Panel was investigated.
• In one day we went from total RNA to sequence ready libraries for
96 samples. The final libraries were quantified, normalized, and
pooled.
• Prior to loading onto a NextSeq,the denatured libraries were diluted
to the appropriate input concentration to generate suitable clusters
on the NextSeq.
• The parameters of the NextSeq run were; single 151 bp read, with
a Custom Sequencing Primer (included in kit).
QIAseq Targeted RNA Panel : Application data from customer
cells
treated cells
RNA
Indexed libraries
Normalized, pooled libraries
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 49: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/49.jpg)
Sample to Insight
HDAC Mechanistic Network in HEK293T Cells Treated with Trichostatin A
86
HDAC is predicted to be inhibited by Trichostatin A and drives a
mechanistic network with 18 other regulators.
Ingenuity Pathway Analysis
Cell cycle
NHR, proliferation Transcriptional
activator
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 50: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/50.jpg)
Sample to Insight
Our RNA-seq vision to our customers
The importance of miRNA regulation is shown here by targeting genes involved in invasion of cells necessary
for tumor progression and metastasis
87
We tie everything
together with our
different RNA-seq
options & data
analysis
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 51: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/51.jpg)
Sample to Insight
Our RNA-seq vision to our customers
miRNA
88
… with miRNA
sequencing
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 52: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/52.jpg)
Sample to Insight
Our RNA-seq vision to our customers
89
miRNA
mRNA
… with mRNA
sequencing
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 53: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/53.jpg)
Sample to Insight
Our RNA-seq vision to our customers
miRNA
90
mRNA
Molecular
mechanism
… and data
analysis &
biological
interpretation
with IPA
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 54: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/54.jpg)
Sample to Insight
QIAGEN’s RNA-Seq solutions
92
3’ RNA-Seq transcriptome with sample ultra-plexing incl. (LNA®)
miRNA/piRNA sequencing, gel-free and locked nucleic acids (LNA®) enhancement
Stranded mRNA sequencing, unique workflow and CleanStart PCR
Single-cell RNA-seq, gene expression or RNA isoform analysis
Targeted RNA panels for gene expression
T-cell receptor CDR3 quantification and identification
Fusion gene analysis
NEW !
NEW !
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 55: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/55.jpg)
Sample to Insight
93
Questions ?
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 56: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/56.jpg)
Sample to Insight
Extra...
QIAGEN 082017 94
![Page 57: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/57.jpg)
Sample to Insight
QIAseq miRNA Library Kit
The “next-generation” in miRNA sequencing products
95Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 58: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/58.jpg)
Sample to Insight
96
QIAseq miRNA overview
What is the kit? miRNA-focused next-generation sequencing library prep kit and integrated
bioinformatics/data analysis solution
What is the product used for? Preparation of mature miRNome libraries from any species
What sequencers are the libraries compatible with? Illumina sequencers
What can be done with the sequencing data?
• Differential expression calculations of miRNA from highly multiplexed samples
• Novel miRNA discovery
• Identification of IsomiRs
What are distinguishing features of the prep kit?
• “Gel-free” prep kit for miRNA sequencing
• Broad RNA input: 500 ng to 1 ng
• Library prep from cells and tissues of any species
• Library prep from serum, plasma and other biofluids
• Integrated Unique Molecular Index (UMI) technology
• Rapid workflow
• Highly optimized chemistry
QIAseq miRNA Library Kit: Unparalleled miRNA-focused
sequencing for accurate digital quantification
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 59: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/59.jpg)
Sample to Insight
QIAGEN 082017 97
QIAseq miRNA mapping rates and specs
miRNA mapping rates routinely observed
• Cell lines: 50-60% or greater
• Tissues: 75% or greater
• Serum/plasma: 15-30% or greater
Specs
• Sample type: Cells, fresh/frozen tissue, FFPE tissue, serum/plasma, biofluids
• Animal and plant samples
• Any species
• Total RNA input range (cells/tissues): 500 ng to 1 ng
• Total RNA input recommendation (serum/plasma): 5 µl when RNA has been isolated from
200 µl of sample
• What RNAs are included in library prep? Highly optimized for miRNA
• piRNAs will also be efficiently sequenced
• Multiplex capability: 48 samples
• Sequencer compatibility: Illumina
• Total library construction time: 8 hours
![Page 60: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/60.jpg)
Sample to Insight
Amplify
& Sequence
98
Unique Molecular Index (UMI) principle
Original Sample
miRNA 1
miRNA 2
RT
with UMI
Raw Reads
• Original sample (3:2 ratio of “miRNA 1” to “miRNA 2”)
• miRNA 1: 3 molecules
• miRNA 2: 2 molecules
• Interpretation of “raw reads” (2:1 of “miRNA 1” to “miRNA 2”)
• miRNA 1: 12 reads
• miRNA 2: 6 reads
• Interpretation of “UMIs” (3:2 ratio of “miRNA 1” to “miRNA 2”)
• Reads are collapsed based on “molecule counts”
• miRNA 1: 12 reads BUT 3 molecules are identified due to UMIs
• miRNA 2: 6 reads BUT 2 molecules are identified due to UMIs
Instead of number of reads, the number of unique UMIs are counted, which
accurately reflects the original status of the transcript
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 61: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/61.jpg)
Sample to Insight
99
5’ PO4 3’ miRNA
Step 1: 3’ ligation3’Pre-adenylated
adapter
Step 3: Reverse-transcription
with Unique Molecular Index
(UMI) assignment
5’3’
Step 4: QMN Bead prep
Step 5: cDNA cleanup
RT primer with UMI
5’ Step 2: 5’ ligation3’
5’ 3’
5’5’ 3’3’
Step 6: Library amplification
and Sample Index assignment5’ 3’3’ 5’
Universal For
Rev with Index
5’ PO4
QIAseq miRNA: Save a Day of Workflow-8 Hours
Step 7: Library cleanup
Steps 8-11: Library Pre-Seq QC, Determining Library Conc, Prep for Seq, Data Analysis
Elimination of adapter dimer
from sequencing library
Targeted RNA and DNA sequencing in disease prediction using QIAseq tools
![Page 62: Targeted RNA and DNA sequencing in disease prediction ...• Down to 2 ng fresh DNA QIAseq Targeted RNAscan Panels • UMIs • Known fusion genes (validation) • Unknown partners](https://reader033.vdocument.in/reader033/viewer/2022042314/5f0252af7e708231d403b39c/html5/thumbnails/62.jpg)
Sample to Insight
QIAGEN 082017 100
Data Analysis
• Primary Analysis: http://ngsdataanalysis.sabiosciences.com/QIAseqmiRNA/
• Well-characterized species:
• UMI (Molecular Tag: MT) counting and mapping (species-specific miRBase, genome)
• Poorly-characterized species:
• UMI (MT) counting and mapping (“all of miRBase”)
• Secondary Analysis: http://qiagen.com/GeneGlobe
• Differential expression analysis
• Multiple normalization methods offered that are routinely used for miRNA analysis
• geNorm
• Total Molecular Tag Count
• DESeq2
• Trimmed Mean of M (edgeR)
read set Sample 1
total_reads 36,373,962
no_adapter_reads 528,950
too_short_reads 3,217,741
MT_defective_reads 355,202
miRNA_Reads 29,847,956
hairpin_Reads 6,598
piRNA_Reads 320,882
rRNA_Reads 432,801
tRNA_Reads 328,813
mRNA_Reads 181,949
otherRNA_Reads 506,069
notCharacterized_Mappable 386,804
notCharacterized_notMappable 260,197